
Sample records for nocardiopsis yanglingensis sp

  1. Nocardiopsis potens sp. nov., isolated from household waste. (United States)

    Yassin, A F; Spröer, C; Hupfer, H; Siering, C; Klenk, H-P


    The taxonomic position of an actinomycete, designated strain IMMIB L-21(T), was determined using a polyphasic taxonomic approach. The organism, which had phenotypic properties consistent with its classification in the genus Nocardiopsis, formed a distinct clade in the 16S rRNA gene sequence tree together with the type strain of Nocardiopsis composta, but was readily distinguished from this species using DNA-DNA relatedness and phenotypic data. The genotypic and phenotypic data show that the organism represents a novel species of the genus Nocardiopsis, for which the name Nocardiopsis potens sp. nov. is proposed. The type strain is IMMIB L-21(T) (=DSM 45234(T)=CCUG 56587(T)).

  2. Preliminary screening of Ni(II metal tolerance and dye-decolorizing by Nocardiopsis sp. SD8

    Directory of Open Access Journals (Sweden)

    Ramasamy Thangaraj


    Full Text Available Objective: To reveal the screening of metal tolerance and dye-decolorizing of Nocardiopsis sp. Methods: NiSO4 and Congo red dye were used for evaluating the metal tolerance and dyedecolorizing of the randomly selected actinobacterial isolates. Results: Nocardiopsis sp. SD8 showed a better efficiency in Ni(II tolerance, though a longer lag phase was observed for this microorganism grown for 7 days in integrated mismatch negativity. Interestingly, we also found that Nocardiopsis sp. SD8 had dye-decolorizing, hemolytic, lipase and protease activity. Conclusions: The present results revealed the bioremediation of metal resistant and diverse properties of Nocardiopsis sp. SD8 and further investigations are needed to extract and identify the potent molecule.

  3. Nocardiopsis arabia sp. nov., a halotolerant actinomycete isolated from a sand-dune soil. (United States)

    Hozzein, Wael N; Goodfellow, Michael


    The taxonomic status of an unknown actinomycete isolated from a sand-dune soil was established using a polyphasic approach. Isolate S186(T) had chemotaxonomic and morphological properties consistent with its classification in the genus Nocardiopsis, grew on agar plates at NaCl concentrations of up to 15 % (w/v) and formed a distinct phyletic line in the Nocardiopsis 16S rRNA gene sequence tree. Its closest phylogenetic neighbours were Nocardiopsis chromatogenes, Nocardiopsis composta, Nocardiopsis gilva and Nocardiopsis trehalosi, with sequence similarity to the various type strains of 96.9 %, but it was readily distinguished from the type strains of these and related species using a range of phenotypic properties. It is apparent from the genotypic and phenotypic data that strain S186(T) belongs to a novel species of the genus Nocardiopsis, for which the name Nocardiopsis arabia sp. nov. is proposed. The type strain is S186(T) (=CGMCC 4.2057(T) =DSM 45083(T)).

  4. Endophytic Nocardiopsis sp. from Zingiber officinale with both antiphytopathogenic mechanisms and antibiofilm activity against clinical isolates. (United States)

    Sabu, Rohini; Soumya, K R; Radhakrishnan, E K


    Novel and potential antimicrobial compounds are essential to tackle the frequently emerging multidrug-resistant pathogens and also to develop environment friendly agricultural practices. In the current study, endophytic actinomycetes from rhizome of Zingiber officinale were explored in terms of its diversity and bioactive properties. Fourteen different organisms were isolated, identified and screened for activity against Pythium myriotylum and human clinical pathogens. Among these, Nocardiopsis sp. ZoA1 was found to have highest inhibition with excellent antibacterial effects compared to standard antibiotics. Remarkable antibiofilm property was also shown by the extract of ZoA1. Its antifungal activity against Pythium and other common phytopathogens was also found to be promising as confirmed by scanning electron microscopic analysis. By PCR-based sequence analysis of phz E gene, the organism was confirmed for the genetic basis of phenazine biosynthesis. Further GC-MS analysis of Nocardiopsis sp. revealed the presence of various compounds including Phenol, 2,4-bis (1,1-dimethylethyl) and trans cinnamic acid which can have significant role in the observed result. The current study is the first report on endophytic Nocardiopsis sp. from ginger with promising applications. In vivo treatment of Nocardiopsis sp. on ginger rhizome has revealed its inhibition towards the colonization of P. myriotylum which makes the study to have promises to manage the severe diseases in ginger like rhizome rot.

  5. Nocardiopsis akesuensis sp. nov., an actinomycete isolated from a salt water beach. (United States)

    Gao, Guang-Bin; Luo, Xiao-Xia; Xia, Zhan-Feng; Zhang, Yao; Wan, Chuan-Xing; Zhang, Li-Li


    The taxonomic position of a novel actinomycete, strain TRM 46250T, isolated from the sediment of a salt water beach at Baicheng, Xinjiang, China, was determined by a polyphasic approach. Strain TRM 46250T grew optimally in the presence of 2 % (w/v) NaCl and an optimum temperature range for growth of 28-37 °C. The whole-cell sugars of strain TRM 46250T were ribose, xylose, mannose and galactose. The diagnostic diamino acid was meso-diaminopimelic acid. The polar lipids were phosphatidylinositol, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethyl ethanolamine and six unidentified phospholipids. The predominant menaquinones were MK-10, MK-10(H6) and MK-10(H8). The major fatty acids were 10-methyl C18 : 0, iso-C16 : 0, C16 : 0, iso-G C16 : 1 and C18 : 1ω9c. Based on morphological and chemotaxonomic characteristics the isolate was determined to belong to the genus Nocardiopsis. The phylogenetic tree based on its nearly complete 16S rRNA gene sequence (1493 nt) with those of representative strains showed that the strain consistently falls into a distinct phyletic line together with Nocardiopsis gilva YIM 90087T (97.68 % similarity) and a subclade consisting of Nocardiopsis composta KS9T (97.52 %), Nocardiopsis rosea YIM 90094T (97.44 %) and Nocardiopsis rhodophaea YIM 90096T (97.16 %). However, DNA-DNA hybridization studies between strain TRM 46250T and N. gilva YIM 90087T showed only 36.94 % relatedness. On the basis of these data, strain TRM 46250T should be designated as a representative of a novel species of the genus Nocardiopsis, for which the name Nocardiopsis akesuensis sp. nov. is proposed. The type strain is TRM 46250T (=CCTCC AA 2015027T=KCTC 39725T).

  6. Biosynthesis, antimicrobial and cytotoxic effect of silver nanoparticles using a novel Nocardiopsis sp. MBRC-1. (United States)

    Manivasagan, Panchanathan; Venkatesan, Jayachandran; Senthilkumar, Kalimuthu; Sivakumar, Kannan; Kim, Se-Kwon


    The biosynthesis of nanoparticles has been proposed as a cost effective environmental friendly alternative to chemical and physical methods. Microbial synthesis of nanoparticles is under exploration due to wide biomedical applications, research interest in nanotechnology and microbial biotechnology. In the present study, an ecofriendly process for the synthesis of nanoparticles using a novel Nocardiopsis sp. MBRC-1 has been attempted. We used culture supernatant of Nocardiopsis sp. MBRC-1 for the simple and cost effective green synthesis of silver nanoparticles. The reduction of silver ions occurred when silver nitrate solution was treated with the Nocardiopsis sp. MBRC-1 culture supernatant at room temperature. The nanoparticles were characterized by UV-visible, TEM, FE-SEM, EDX, FTIR, and XRD spectroscopy. The nanoparticles exhibited an absorption peak around 420 nm, a characteristic surface plasmon resonance band of silver nanoparticles. They were spherical in shape with an average particle size of 45 ± 0.15 nm. The EDX analysis showed the presence of elemental silver signal in the synthesized nanoparticles. The FTIR analysis revealed that the protein component in the form of enzyme nitrate reductase produced by the isolate in the culture supernatant may be responsible for reduction and as capping agents. The XRD spectrum showed the characteristic Bragg peaks of 1 2 3, 2 0 4, 0 4 3, 1 4 4, and 3 1 1 facets of the face centered cubic silver nanoparticles and confirms that these nanoparticles are crystalline in nature. The prepared silver nanoparticles exhibited strong antimicrobial activity against bacteria and fungi. Cytotoxicity of biosynthesized AgNPs against in vitro human cervical cancer cell line (HeLa) showed a dose-response activity. IC50 value was found to be 200 μg/mL of AgNPs against HeLa cancer cells. Further studies are needed to elucidate the toxicity and the mechanism involved with antimicrobial and anticancer activity of the synthesized AgNPs as

  7. Extracellular synthesis of gold bionanoparticles by Nocardiopsis sp. and evaluation of its antimicrobial, antioxidant and cytotoxic activities. (United States)

    Manivasagan, Panchanathan; Alam, Moch Syaiful; Kang, Kyong-Hwa; Kwak, Minseok; Kim, Se-Kwon


    Advancement of biological process for the synthesis of bionanoparticles is evolving into a key area of research in nanotechnology. The present study deals with the biosynthesis, characterization of gold bionanoparticles by Nocardiopsis sp. MBRC-48 and evaluation of their antimicrobial, antioxidant and cytotoxic activities. The gold bionanoparticles obtained were characterized by UV-visible spectroscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, field emission scanning electron microscopy, energy dispersive X-ray analysis and transmission electron microscopy (TEM). The synthesized gold bionanoparticles were spherical in shape with an average of 11.57 ± 1.24 nm as determined by TEM and dynamic light scattering (DLS) particle size analyzer, respectively. The biosynthesized gold nanoparticles exhibited good antimicrobial activity against pathogenic microorganisms. It showed strong antioxidant activity as well as cytotoxicity against HeLa cervical cancer cell line. The present study demonstrated the potential use of the marine actinobacterial strain of Nocardiopsis sp. MBRC-48 as an important source for gold nanoparticles with improved biomedical applications including antimicrobial, antioxidant as well as cytotoxic agent.

  8. New structures and composition of cell wall teichoic acids from Nocardiopsis synnemataformans, Nocardiopsis halotolerans, Nocardiopsis composta and Nocardiopsis metallicus: a chemotaxonomic value. (United States)

    Tul'skaya, Elena M; Shashkov, Alexander S; Streshinskaya, Galina M; Potekhina, Natalia V; Evtushenko, Ludmila I


    The structures of the cell wall teichoic acids (TA) from some species of the genus Nocardiopsis were established by chemical and NMR spectroscopic methods. The cell walls of Nocardiopsis synnemataformans VKM Ac-2518(T) and Nocardiopsis halotolerans VKM Ac-2519(T) both contain two TA with unique structures-poly(polyol phosphate-glycosylpolyol phosphate)-belonging to the type IV TA. In both organisms, the minor TA have identical structures: poly(glycerol phosphate-N-acetyl-β-galactosaminylglycerol phosphate) with the phosphodiester bond between C-3 of glycerol and C-4 of the amino sugar. This structure is found for the first time. The major TA of N. halotolerans has a hitherto unknown structure: poly(glycerol phosphate-N-acetyl-β-galactosaminylglycerol phosphate), the N-acetyl-β-galactosamine being acetalated with pyruvic acid at positions 4 and 6. The major TA of N. synnemataformans is a poly(glycerol phosphate-N-acetyl-β-galactosaminylglycerol phosphate) with the phosphodiester bond between C-3 of glycerol and C-3 of the amino sugar. The cell walls of Nocardiopsis composta VKM Ac-2520 and N. composta VKM Ac-2521(T) contain only one TA, namely 1,3-poly(glycerol phosphate) partially substituted with N-acetyl-α-glucosamine. The cell wall of Nocardiopsis metallicus VKM Ac-2522(T) contains two TA. The major TA is 1,5-poly(ribitol phosphate), each ribitol unit carrying a pyruvate ketal group at positions 2 and 4. The structure of the minor TA is the same as that of N. composta. The results presented correlate well with the phylogenetic grouping of strains and confirm the species and strain specific features of cell wall TA in members of the genus Nocardiopsis.

  9. Nocardiopsis species: Incidence, ecological roles and adaptations. (United States)

    Bennur, Tahsin; Kumar, Ameeta Ravi; Zinjarde, Smita; Javdekar, Vaishali


    Members of the genus Nocardiopsis are ecologically versatile and biotechnologically important. They produce a variety of bioactive compounds such as antimicrobial agents, anticancer substances, tumor inducers, toxins and immunomodulators. They also secrete novel extracellular enzymes such as amylases, chitinases, cellulases, β-glucanases, inulinases, xylanases and proteases. Nocardiopsis species are aerobic, Gram-positive, non-acid-fast, catalase-positive actinomycetes with nocardioform substrate mycelia and their aerial mycelia bear long chains of spores. Their DNA possesses high contents of guanine and cytosine. There is a marked variation in properties of the isolates obtained from different ecological niches and their products. An important feature of several species is their halophilic or halotolerant nature. They are associated with a variety of marine and terrestrial biological forms wherein they produce antibiotics and toxins that help their hosts in evading pathogens and predators. Two Nocardiopsis species, namely, N. dassonvillei and N. synnemataformans (among the thirty nine reported ones) are opportunistic human pathogens and cause mycetoma, suppurative infections and abscesses. Nocardiopsis species are present in some plants (as endophytes or surface microflora) and their rhizospheres. Here, they are reported to produce enzymes such as α-amylases and antifungal agents that are effective in warding-off plant pathogens. They are prevalent as free-living entities in terrestrial locales, indoor locations, marine ecosystems and hypersaline habitats on account of their salt-, alkali- and desiccation-resistant behavior. In such natural locations, Nocardiopsis species mainly help in recycling organic compounds. Survival under these diverse conditions is mediated by the production of extracellular enzymes, antibiotics, surfactants, and the accumulation of compatible solutes. The accommodative genomic features of Nocardiopsis species support their existence

  10. Antibiofilm effect of Nocardiopsis sp. GRG 1 (KT235640) compound against biofilm forming Gram negative bacteria on UTIs. (United States)

    Rajivgandhi, Govindan; Vijayan, Ramachandran; Maruthupandy, Muthuchamy; Vaseeharan, Baskaralingam; Manoharan, Natesan


    Urinary tract infections (UTIs) are diverse public health complication and caused by range of pathogens, however mostly Gram negative bacteria cause significant life threatening risks to different populations. The prevalence rate and antimicrobial resistance among the Gram negative uropathogens alarmed significantly heighten the economic burden of these infections. In this study, we investigated the antibiofilm efficiency of Pyrrolo [1,2-a] pyrazine-1,4-dione,hexahydro-3-(2-methylpropyl) extracted from endophytic actinomycetes Nocardiopsis sp. GRG 1 (KT235640) against P. mirabilis and E. coli. The extracted compound was characterized through TLC, HPLC, GC-MS, LC-MS and confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM). The compound, Pyrrolo [1,2-a] pyrazine-1, 4-dione, hexahydro-3-(2-methylpropyl) inhibits both bacterial biofilm formation as well as reduces the viability of preformed biofilms. Furthermore, CLSM image shows cell shrinkage, disorganized cell membrane and loss of viability. The SEM result also confirms the cell wall degradation in treated cells of the bacteria. Hence, the Pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl) is active against P. mirabilis and E. coli. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. A Novel Protein Elicitor BAR11 From Saccharothrix yanglingensis Hhs.015 Improves Plant Resistance to Pathogens and Interacts With Catalases as Targets


    Yanan Zhang; Yanan Zhang; Xia Yan; Xia Yan; Hongmei Guo; Hongmei Guo; Feiyang Zhao; Feiyang Zhao; Lili Huang; Lili Huang


    Previously, we reported the biocontrol effects of Saccharothrix yanglingensis strain Hhs.015 on Valsa mali. Here, we report a novel protein elicitor BAR11 from the biocontrol strain Hhs.015 and its functions in plant defense responses. Functional analysis showed that the elicitor BAR11 significantly stimulated plant systemic resistance in Arabidopsis thaliana to Pseudomonas syringae pv. tomato DC3000. In addition, systemic tissues accumulated reactive oxygen species and deposited callose in a...

  12. Borrelidins C-E: New Antibacterial Macrolides from a Saltern-Derived Halophilic Nocardiopsis sp. (United States)

    Kim, Jungwoo; Shin, Daniel; Kim, Seong-Hwan; Park, Wanki; Shin, Yoonho; Kim, Won Kyung; Lee, Sang Kook; Oh, Ki-Bong; Shin, Jongheon; Oh, Dong-Chan


    Chemical investigation of a halophilic actinomycete strain belonging to the genus Nocardiopsis inhabiting a hypersaline saltern led to the discovery of new 18-membered macrolides with nitrile functionality, borrelidins C-E ( 1 - 3 ), along with a previously reported borrelidin ( 4 ). The planar structures of borrelidins C-E, which are new members of the rare borrelidin class of antibiotics, were elucidated by NMR, mass, IR, and UV spectroscopic analyses. The configurations of borrelidines C-E were determined by the interpretation of ROESY NMR spectra, J-based configuration analysis, a modified Mosher's method, and CD spectroscopic analysis. Borrelidins C and D displayed inhibitory activity, particularly against the Gram-negative pathogen Salmonella enterica , and moderate cytotoxicity against the SNU638 and K562 carcinoma cell lines.

  13. Biosurfactant produced from Actinomycetes nocardiopsis A17: Characterization and its biological evaluation. (United States)

    Chakraborty, Samrat; Ghosh, Mandakini; Chakraborti, Srijita; Jana, Sougata; Sen, Kalyan Kumar; Kokare, Chandrakant; Zhang, Lixin


    This investigation aims to isolate an Actinomycetes strain producing a biosurfactant from the unexplored region of industrial and coal mine areas. Actinomycetes are selected for this study as their novel chemistry was not exhausted and they have tremendous potential to produce bioactive secondary metabolites. The biosurfactant was characterized and further needed to be utilized for pharmaceutical dosage form. Isolation, purification, screening, and characterization of the Actinomycetes A17 were done followed by its fermentation in optimized conditions. The cell-free supernatant was used for the extraction of the biosurfactant and precipitated by cold acetone. The dried precipitate was purified by TLC and the emulsification index, surface tension and CMC were determined. The isolated strain with preferred results was identified as Actinomycetes nocardiopsis A17 with high foam-forming properties. It gives lipase, amylase, gelatinase, and protease activity. The emulsification index was found to be 93±0.8 with surface tension 66.67 dyne/cm at the lowest concentration and cmc 0.6 μg/ml. These biosurfactants were characterized by Fourier transform infra red (FT-IR) spectroscopy and liquid chromatography-mass spectrometry (LC-MS). Therefore, it can be concluded that the biosurfactant produced by Actinomycetes nocardiopsis sp. strain A17 was found to have satisfactory results with high surface activity and emulsion-forming ability. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Osteomyelitis associated with Nocardiopsis composta in a dog. (United States)

    Salas, Elisa N; Royal, Debra; Kurz, Lance; Loy, J Dustin


    We report the first detection of Nocardiopsis composta in association with osteomyelitis in a young male miniature Australian shepherd dog. Findings included suppurative osteomyelitis containing intralesional Fite's acid fast bacilli, aerobic culture of branching Gram-positive rods, and positive identification via phenotypic analysis and 16S rDNA sequencing.

  15. Two new sesquiterpenoids produced by halophilic Nocardiopsis chromatogenes YIM 90109. (United States)

    Sun, Ming-Wei; Zhang, Xiao-Mei; Bi, Hui-Li; Li, Wen-Jun; Lu, Chun-Hua


    Two new germacradiene-type sesquiterpenoids, including 1(10)E,5E-germacradiene-9β,11-diol (or 9β-hydroxyl germacradienol) (1) and 11-hydroxy-1(10)E,5E-germacradien-2-one (2-oxygermacradienol) (2), together with a known geosmin-type sesquiterpenoid (1β,4β,4aβ,7α,8aα)-4,8a-dimethyloctahydronaphthalene-1,4a,7(2H)-triol (3), were elucidated by their NMR spectroscopic data, HR-ESI-MS and single-crystal X-ray diffraction from the halophilic strain Nocardiopsis chromatogenes YIM 90109. The antimicrobial activities were evaluated by paper diffusion method.

  16. Evaluation and enhancement of heavy metals bioremediation in aqueous solutions by Nocardiopsis sp. MORSY1948, and Nocardia sp. MORSY2014

    Directory of Open Access Journals (Sweden)

    Mervat Morsy Abbas Ahmed El-Gendy

    Full Text Available ABSTRACT An analysis of wastewater samples collected from different industrial regions of Egypt demonstrated dangerously high levels of nickel (0.27-31.50 mg L-1, chromium (1.50-7.41 mg L-1 and zinc (1.91-9.74 mg L-1 in the effluents. Alarmingly, these heavy metals are among the most toxic knownones to humans and wildlife. Sixty-nine Actinomycete isolates derived from contaminated sites were evaluated under single, binary, and ternary systems for their biosorption capacity for Ni2+, Cr6+ and Zn2+ from aqueous solutions. The results of the study identified isolates MORSY1948 and MORSY2014 as the most active biosorbents. Phenotypic and chemotypic characterization along with molecular phylogenetic evidence confirmed that the two strains are members of the Nocardiopsis and Nocardia genera, respectively. The results also proved that for both the strains, heavy metal reduction was more efficient with dead rather than live biomass. The affinity of the dead biomass of MORSY1948 strain for Ni2+, Cr6+ and Zn2+ under the optimized pH conditions of 7, 8 and 7, respectively at 40 °C temperature with 0.3% biosorbent dosage was found to be as follows: Ni2+ (87.90% > Zn2+ (84.15% > Cr6+ (63.75%. However, the dead biomass of MORSY2014 strain under conditions of pH 8 and 50 °C temperature with 0.3% biosorbent dose exhibited the highest affinity which was as follows: Cr6+ (95.22% > Ni2+ (93.53% > Zn2+ (90.37%. All heavy metals under study were found to be removed from aqueous solutions in entirety when the sorbent dosage was increased to 0.4%.

  17. Functional gene-based discovery of phenazines from the actinobacteria associated with marine sponges in the South China Sea. (United States)

    Karuppiah, Valliappan; Li, Yingxin; Sun, Wei; Feng, Guofang; Li, Zhiyong


    Phenazines represent a large group of nitrogen-containing heterocyclic compounds produced by the diverse group of bacteria including actinobacteria. In this study, a total of 197 actinobacterial strains were isolated from seven different marine sponge species in the South China Sea using five different culture media. Eighty-seven morphologically different actinobacterial strains were selected and grouped into 13 genera, including Actinoalloteichus, Kocuria, Micrococcus, Micromonospora, Mycobacterium, Nocardiopsis, Prauserella, Rhodococcus, Saccharopolyspora, Salinispora, Serinicoccus, and Streptomyces by the phylogenetic analysis of 16S rRNA gene. Based on the screening of phzE genes, ten strains, including five Streptomyces, two Nocardiopsis, one Salinispora, one Micrococcus, and one Serinicoccus were found to be potential for phenazine production. The level of phzE gene expression was highly expressed in Nocardiopsis sp. 13-33-15, 13-12-13, and Serinicoccus sp. 13-12-4 on the fifth day of fermentation. Finally, 1,6-dihydroxy phenazine (1) from Nocardiopsis sp. 13-33-15 and 13-12-13, and 1,6-dimethoxy phenazine (2) from Nocardiopsis sp. 13-33-15 were isolated and identified successfully based on ESI-MS and NMR analysis. The compounds 1 and 2 showed antibacterial activity against Bacillus mycoides SJ14, Staphylococcus aureus SJ51, Escherichia coli SJ42, and Micrococcus luteus SJ47. This study suggests that the integrated approach of gene screening and chemical analysis is an effective strategy to find the target compounds and lays the basis for the production of phenazine from the sponge-associated actinobacteria.


    Directory of Open Access Journals (Sweden)

    Tânia L. Montenegro STAMFORD


    Full Text Available O isolamento e a identificação de microrganismos produtores de enzimas de interesse comercial, utilizando tubérculos de jacatupé (Pachyrhizus erosus L. Urban, foi o objetivo principal deste trabalho. Isolaram-se microrganismos endofíticos e epifíticos identificados por observação micromorfológica. A avaliação da atividade enzimática das linhagens foi determinada pelo método de difusão em ágar. As sessenta e oito linhagens isoladas dos tubérculos de jacatupé foram cultivadas em meio sólido específico para amilase, lipase, protease e celulase por 96h a 280 C. Os microrganismos epifíticos encontrados foram Pithomyces (7,3%, Aspergillus (19,2%, Fusarium (5,9% e Trichoderma (5,8%, e os endofíticos foram Mucor (7,3%, Rhizopus (10,3%, Bacillus (19,0%, Staphylococcus (10,3% e Nocardiopsis (15%. As linhagens de Nocardiopsis sp. apresentaram atividade lipolítica superior à do padrão, porém a atividade amilolítica não apresentou diferença significativa comparada com o padrão. As linhagens de Mucor sp., Pithomyces sp. e Staphylococcus sp. produziram atividade proteolítica abaixo do padrão. Nenhum isolado apresentou atividade celulolítica.The isolation and identification of microorganisms that produce enzyme of commercial interest utilizing tubers of yam bean legume (Pachyrrizus erosus L. Urban was the main objective of this work. Endophytic and epiphytic microorganisms were isolated by micromorphologyc observation. The agar diffusion method was used to determine the enzymatic activity. Sixty-eight isolates from yam bean tubers were cultured at 280 C in solid medium specific to amylase, lipase, protease and cellulase for 96h. The epiphytic microorganisms Pithomyces (7,3%, Aspergillus (19,2%, Fusarium (5,9% and Trichoderma (5,8% and the endophytic microorganisms Mucor (7,3%, Rhizopus (10,3% Bacillus (19%, Staphylococcus (10,3% and Nocardiopsis (15% were isolated. Compared to the specific standard culture Nocardiopsis sp. showed

  19. Effect of amino acids on the repression of alkaline protease synthesis in haloalkaliphilic Nocardiopsis dassonvillei

    Directory of Open Access Journals (Sweden)

    Amit K. Sharma


    Full Text Available A newly isolated salt-tolerant alkaliphilic actinomycete, Nocardiopsis dassonvillei strain OK-18 grows on mineral salts medium with glucose as carbon source. It also grows and produces protease with amino acids as sole carbon source. The synthesis of extracellular alkaline protease parallel to growth was repressible by substrate concentrations. The absolute production of the protease was delinked with growth under nutritional stress, as protease production was high, despite poor growth. When amino acids served as the sole source of carbon and nitrogen, the enzyme production was significantly controlled by the number of amino acids. Maximal protease production was achieved with proline, asparagine, tyrosine, alanine, methionine and valine as sole source of carbon and nitrogen in minimal medium. With the increasing number of different amino acids in the presence and absence of glucose, the protease production was synergistically lower as compared to complex medium.

  20. Bioprospecting of Novel and Bioactive Compounds from Marine Actinomycetes Isolated from South China Sea Sediments. (United States)

    Yang, Na; Song, Fuhang


    Marine actinomycetes are less investigated compared to terrestrial strains as potential sources of natural products. To date, few investigations have been performed on culturable actinomycetes associated with South China Sea sediments. In the present study, twenty-eight actinomycetes were recovered from South China Sea sediments after dereplication by traditional culture-dependent method. The 16S rRNA gene sequences analyses revealed that these strains related to five families and seven genera. Twelve representative strains possessed at least one of the biosynthetic genes coding for polyketide synthase I, II, and nonribosomal peptide synthetase. Four strains had anti-Mycobacterium phlei activities and five strains had activities against methicillin-resistant Staphylococcus aureus. 10 L-scale fermentation of strains Salinispora sp. NHF45, Nocardiopsis sp. NHF48, and Streptomyces sp. NHF86 were carried out for novel and bioactive compounds discovery. Finally, we obtained a novel α-pyrone compound from marine Nocardiopsis sp. NHF48, an analogue of paulomenol from marine Streptomyces sp. NHF86 and a new source of rifamycin B, produced by Salinispora sp. NHF45. The present study concluded that marine actinomycetes, which we isolated from South China Sea sediments, will be a suitable source for the development of novel and bioactive compounds.

  1. Quantitative Proteomics Reveals Membrane Protein-Mediated Hypersaline Sensitivity and Adaptation in Halophilic Nocardiopsis xinjiangensis. (United States)

    Zhang, Yao; Li, Yanchang; Zhang, Yongguang; Wang, Zhiqiang; Zhao, Mingzhi; Su, Na; Zhang, Tao; Chen, Lingsheng; Wei, Wei; Luo, Jing; Zhou, Yanxia; Xu, Yongru; Xu, Ping; Li, Wenjun; Tao, Yong


    The genus Nocardiopsis is one of the most dominant Actinobacteria that survives in hypersaline environments. However, the adaptation mechanisms for halophilism are still unclear. Here, we performed isobaric tags for relative and absolute quantification based quantitative proteomics to investigate the functions of the membrane proteome after salt stress. A total of 683 membrane proteins were identified and quantified, of which 126 membrane proteins displayed salt-induced changes in abundance. Intriguingly, bioinformatics analyses indicated that these differential proteins showed two expression patterns, which were further validated by phenotypic changes and functional differences. The majority of ABC transporters, secondary active transporters, cell motility proteins, and signal transduction kinases were up-regulated with increasing salt concentration, whereas cell differentiation, small molecular transporter (ions and amino acids), and secondary metabolism proteins were significantly up-regulated at optimum salinity, but down-regulated or unchanged at higher salinity. The small molecule transporters and cell differentiation-related proteins acted as sensing proteins that played a more important biological role at optimum salinity. However, the ABC transporters for compatible solutes, Na(+)-dependent transporters, and cell motility proteins acted as adaptive proteins that actively counteracted higher salinity stress. Overall, regulation of membrane proteins may provide a major protection strategy against hyperosmotic stress.

  2. Production of a new glycolipid biosurfactant from marine Nocardiopsis lucentensis MSA04 in solid-state cultivation. (United States)

    Kiran, G Seghal; Thomas, T Anto; Selvin, Joseph


    Considering the need of potential biosurfactant producers and economic production processes using industrial waste, the present study aims to develop solid-state culture (SSC) of a marine actinobacterium for biosurfactant production. A potential biosurfactant producer Nocardiopsis lucentensis MSA04 was isolated from the marine sponge Dendrilla nigra. Among the substrates screened, wheat bran increased the production significantly (E(24) 25%) followed by oil seed cake and industrial waste such as tannery pretreated sludge, treated molasses (distillery waste) and pretreated molasses. Enhanced biosurfactant production was achieved under SSC conditions using kerosene as carbon source, beef extract as nitrogen source and wheat bran as substrate. The maximum production of biosurfactant by MSA04 occurred at a C/N ratio of 0.5 envisaging that a higher amount of nitrogen source is required by the strain compared to that of the carbon source. The kerosene and beef extract interactively increase the production and a stable production was attained with the influence of both factors independently. A significant interactive influence of secondary control factors such as copper sulfate and inoculum size was validated in response surface methods-based experiments. The surface active compound produced by MSA04 was characterized as glycolipid with a hydrophobic non-polar hydrocarbon chain (nonanoic acid methyl ester) and hydrophilic sugar, 3-acetyl 2,5 dimethyl furan. In conclusion, the strain N. lucentensis MSA04 was a potential source of glycolipid biosurfactant, could be used for the development of bioremediation processes in the marine environment. Copyright 2010 Elsevier B.V. All rights reserved.

  3. Halophilic and halotolerant actinomycetes from a marine saltern of Goa, India producing anti-bacterial metabolites. (United States)

    Ballav, Shuvankar; Kerkar, Savita; Thomas, Sabu; Augustine, Nimmy


    Marine salterns are estuarine ecosystems in Goa, receiving inputs from riverine and marine waters. The Salinity fluctuates between 0 and 300 psu which makes it a conducive niche for salt tolerant and salt loving Actinomycetales. Halotolerant and halophilic Actinomycetales producing anti-bacterial metabolites were studied from crystallizer pond sediments of Ribandar saltern, Goa. Three media viz. Starch casein, R2A and Inorganic salt starch agar at four different salinities (35, 50, 75 and 100 psu) were used for isolation. R2A agar at 35 psu was the most preferred by hypersaline actinomycetes. The dominant group was halotolerant Streptomyces spp. others being rare actinomycetes viz. Nocardiopsis, Micromonospora and Kocuria spp. More than 50% of the isolates showed anti-bacterial activity against one or more of the fifteen human pathogens tested. Eight strains from 4 genera showed consistent anti-bacterial activity and studied in detail. Most halotolerant isolates grew from 0 to 75 psu, with optimum antibiotic production at 35 psu whereas halophiles grew at 20 to 100 psu with optimum antibiotic production at 35 psu. Four Streptomyces strains showed multiple inhibition against test organisms while four rare actinomycetes were specific in their inhibitory activity. This is the first report of a halophilic Kocuria sp., Nocardiopsis sp., and halotolerant Micromonospora sp. producing anti-bacterial compound(s) against Staphylococcus aureus, Staphylococcus citreus, and Vibrio cholerae, respectively. Sequential extraction with varying polarity of organic solvents showed that the extracts inhibited different test pathogens. These results suggest that halophilic and halotolerant actinomycetes from marine salterns are a potential source of anti-bacterial compounds. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Draft genome sequences of six neonatal meningitis-causing escherichia coli isolates (SP-4, SP-5, SP-13, SP-16, SP-46, and SP-65) (United States)

    Neonatal meningitis Escherichia coli isolates (SP-4, SP-5, SP-13, SP-16, SP-46, and SP-65) were recovered from infants in the Netherlands from 1989 to 1997. Here, we report the draft genome sequences for these six E. coli isolates, which are currently being used to validate food safety processing te...

  5. Bioinformatic Tools for Metagenomic Analysis of Pathogen Backgrounds and Human Microbial Communities (United States)


    CCAAAGCCGGTGGCCTAACCTTCGGGGAGGAGCCGTCTAAGGCAGGACAGATGACTGGGGTGAAGTCGTA ACAAG >gi|219857564|ref|NR_025152.1| Nocardiopsis composta strain KS9 16S...Fructobacillus ficulneus strain FS-1 16S ribosomal RNA, partial sequence 2250718 2252192 gi|219857564|ref|NR_025152.1| Nocardiopsis composta strain...Bacteria_16S 2253094 2253187 1 94 gi|219857564|ref|NR_025152.1| Nocardiopsis composta strain KS9 16S ribosomal RNA, partial sequence 2252243 2253696

  6. Control of Branchionus sp. and Amoeba sp. in cultures of Arthrospira sp. Control de Branchionus sp. y Amoeba sp. en cultivos de Arthrospira sp.

    Directory of Open Access Journals (Sweden)

    Carlos Méndez


    Full Text Available Cultivation of cyanobacterium Arthrospira sp. has been developed in many countries for the production of proteins, pigments and other compounds. Outdoor mass cultures are often affected by biological contamination, drastically reducing productivity as far as bringing death. This study evaluates the control of Branchionus sp. and Amoeba sp. with two chemical compounds: urea (U and ammonium bicarbonate (AB, in laboratory conditions and outdoor mass culture of Arthrospira sp. The lethal concentration 100 (LC100 at 24 h for Branchionus sp. and Amoeba sp. determined was of 60-80 mg L-1 (U and 100-150 mg L-1 (AB. The average effective inhibition concentration for 50% of the population (IC50 in Arthrospira sp., after 72 h, was 80 mg L-1 (U and 150 mg L-1 (AB. The application of doses of 60 mg L-1 (U or 100 mg L-1 (AB in the outdoor mass culture of this contaminated microalga, completely inhibited grazing and did not affect the growth of Arthrospira sp. but rather promoted rapid recovery of algal density at levels prior to infestation. These compounds provided an economical and effective control of predators in cultures of Arthrospira sp.El cultivo de la cianobacteria Arthrospira sp. ha sido desarrollado en muchos países para la obtención de proteínas, pigmentos y otros compuestos. Cultivo que a nivel industrial se ve afectado frecuentemente por contaminación biológica, reduciendo drásticamente la productividad hasta causar la muerte. Este estudio evalúa el control de Branchionus sp. y de Amoeba sp. con dos compuestos químicos, la urea (U y bicarbonato de amonio (AB en cultivos de Arthrospira sp. La concentración letal 100 (LC100 determinada a las 24 h para Branchionus sp. y Amoeba sp. fue de 60-80 mg L-1 (U y 100-150 mg L-1 (AB. La concentración media de inhibición efectiva, después de 72 h, para el 50% de la población (IC50 en Arthrospira fue de 80 mg L-1 (U y 150 mg L-1 (AB. La aplicación de dosis de 60 mg L-1 (U ó 100 mg L-1 (AB en

  7. Seroprevalencia de Leptospira sp., Rickettsia sp. Ehrlichia sp. en trabajadores rurales del departamento de Sucre, Colombia Seroprevalence of Leptospira sp., Rickettsia sp. and Ehrlichia sp. in rural workers of Sucre, Colombia

    Directory of Open Access Journals (Sweden)

    Rodrigo Ríos


    Full Text Available Objective. Determinar la seroprevalencia de Leptospira sp., Rickettsia sp. y Ehrlichia sp. en trabajadores de áreas rurales del departamento de Sucre. Material y métodos. Se realizó un estudio escriptivo, prospectivo, de corte transversal, que pretendió determinar la seroprevalencia e Leptospira sp., Rickettsia sp. y Ehrlichia sp. en 90 trabajadores de áreas rurales del departamento de Sucre. Se estableció la presencia de anticuerpos séricos anti-IgM específicos anti-Leptospira por la técnica de ELISA indirecta. Para la determinación de Rickettsia sp. y Ehrlichia sp. se uso la técnica de inmunofluorescencia indirecta. Resultados. La población evaluada estaba compuesta por 27 (30% ordeñadores, 21 (23% jornaleros, 18 (20% profesionales del campo y 24 (27% que realizaban otras actividades. Ventidós (24% muestras resultaron positivas en alguna de las pruebas. De éstas, 12 (13,3% fueron positivas para Leptospira sp., 7 (7,8% para Rickettsia sp. y 3 (3,3% ara Ehrlichia sp. Conclusión. Este fue el primer estudio que se llevó a cabo en el departamento de Sucre y permitió demostrar que existe una prevalencia importante de Leptospira p.,Rickettsia sp. y Ehrlichia sp.. Los factores de riesgo ocupacional fueron factores determinantes en la seropositividad.Objective. To determine the seroprevalence of Leptospira sp., Rickettsia sp. and Ehrlichia sp. in agricultural workers of Sucre. Methods. A descriptive prospective cross-sectional study was conducted in ninety rural workers of Sucre. Presence of serum antibodies anti-IgM specific anti-Leptospira by indirect ELISA was established. For the determination of Rickettsia and Ehrlichia indirect inmunoflorescence was used. Results.The population was composed by 27 (30% milkers, 21 (23% day workers, 18 farm professionals (20% and 24 (26% workers in others activities. A total of 22 (24% samples were positive to some test. Twelve (13.3% were positive to Leptospira sp., seven (7.8% to Rickettsia sp

  8. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang


    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  9. Ovos de Toxocara sp. e larvas de Ancylostoma sp. em praça pública de Lavras, MG Toxocara sp. eggs and Ancylostoma sp. larva in public parks, Brazil

    Directory of Open Access Journals (Sweden)

    Antônio Marcos Guimarães


    Full Text Available Larva migrans visceral e cutânea são zoonoses parasitárias causadas pela infecção da larva de Toxocara sp. e Ancylostoma sp., respectivamente. O objetivo do estudo foi verificar a contaminação por ovos de Toxocara sp. e ovos e larvas de Ancylostoma sp. em amostras de solos coletadas de praças públicas e de áreas de recreação infantil de Lavras, Estado de Minas Gerais, por meio da técnica de centrífugo-flutuação e do método de Baermann. A ocorrência de ovos de Toxocara sp. e, ovos e larvas de Ancylostoma sp. foi observada em 69,6% (16/23 das amostras de solo coletadas de praças públicas. A contaminação somente por ovos de Ancylostoma sp. em amostras de solo coletadas em escolas/creches foi de 22,2% (4/18. A percentagem de amostras de areia coletadas de escolas/creches contaminadas somente com larvas de Ancylostoma sp. foi de 11,1% (2/18. Praças públicas são as áreas com maior risco potencial de infecção por Toxocara sp. e Ancylostoma sp. Exame coproparasitológico realizado em 174 amostras de fezes de cães observou 58% e 23%, respectivamente, com ovos de Ancylostoma sp. e Toxocara sp.Visceral and cutaneous larva migrans are parasitic zoonoses caused by the infection of larval nematodes Toxocara sp. and Ancylostoma sp. respectively. The objective of this study was to investigate the contamination by Toxocara sp. eggs and Ancylostoma sp. eggs and larva of soil samples collected from public parks and children's playground areas in state of Minas Gerais, Brazil, using both Baermann's method and centrifugal flotation technique. Toxocara sp. and Ancylostoma sp. eggs were observed in soil samples collected from public squares in 17.4% (4/23 and 69.6 (16/23 respectively. In schools and child day care settings the contamination by Ancylostoma sp. larva in sand samples was 11.1% (2/18. Public parks are settings of more potential risk of Toxocara sp. eggs and Ancylostoma sp. infection. Stool parasitology testing of 174 stool

  10. Antibacterial Actions and Potential Phototoxic Effects of Volatile oils of Foeniculum sp. (fennel, Salvia sp. (sage, Vitis sp. (grape, Lavandula sp. (lavender

    Directory of Open Access Journals (Sweden)

    Elif Ayse Erdogan Eliuz


    Full Text Available In the present study, the volatile compounds of essential oil of Foeniculum vulgare (fennel, Salvia officinalis (sage, Vitis vinifera (grape, Lavandula angustifolia (lavender were analysed by gas chromatography-mass spectrometry (GC-MS using the Nist and Willey libraries. It was determined that the main components of Foeniculum sp. were anethole (41.11%, carvacrol (9.18%. whereas main components of Salvia sp were 1.8 cineole (34.09%, caryophyllene (10.95%, camphor (9.44%, α-pinene (8.42%. Vitis sp. contained linoleic acid (36.98%, 2,4-decadienal (30.79%. Finally, volatile component of Lavandula sp. was linalool (33.57%, linalyl acetate (30.74%. Photoxic antibacterial activity of volatile oil of those plants against Escherichia coli (ATCC 25293, Klebsiella pneumoniae (10031, Salmonella thyphimurium, Bacillus subtilis (ATCC 6633, Staphylococcus aureus (ATCC 25925, Enterococcus feacalis (ATCC 29212 were examined by using disc diffusion method. We demonstrated that volatile oil effectively can be activated by a standard LED light. In vitro, significant phototoxicity was demonstrated by volatile oil of Foeniculum sp. and Vitis sp. (P < 0.05, while minor phototoxicity was induced by Lavandula sp. Therefore, volatile oil of plant can be considered as a potential photosensitizer in the photochemical therapy.

  11. Bradysia sp. em morangueiro Bradysia sp. in strawberry

    Directory of Open Access Journals (Sweden)

    Bernadete Radin


    Full Text Available No trabalho, relatam-se os primeiros registros de Bradysia sp. (Insecta: Diptera: Sciaridae em morangueiro (Fragaria x ananassa Duch., cultivado no Município de Eldorado do Sul, RS. O cultivo foi realizado em sacolas com três metros de comprimento, preenchidas com substrato composto de casca de arroz e turfa, dispostas horizontalmente sobre bancadas de madeira, em ambiente protegido. A presença de Bradysia sp. foi observada na segunda quinzena de agosto de 2005. Neste trabalho, estão descritos os sintomas apresentados no morangueiro pela praga, prováveis conseqüências sobre o aparecimento de doenças e uma breve descrição morfológica da Bradysia sp., adulto e fase larval.This paper describes the first record of Bradysia sp. (Insecta; Diptera; Sciaridae in strawberry (Fragaria x ananassa, cultivated in the city of Eldorado do Sul, RS, Brazil. Strawberry was planted in plastic bags filled with a mixture of burnt rice hulls and peat and cultivated in a greenhouse. The presence of Bradysia sp was noticed in the second fortnight of August, 2005. The symptoms in strawberry and the probable consequences in terms of disease arising were described in the present study, as well as the morphological characterization of Bradysia sp. and its illustrations.

  12. INTERAKSI ANTARA Trichoderma Harzianum, Penicillium SP. DAN Pseudomonas SP. SERTA KAPASITAS ANTAGONISMENYA TERHADAP Phytophthora CapsicilN VITRO*[Interaction Among Trichoderma Harzianum, Penicillium SP., Pseudomonas SP. and Antagonism Capacities Against Phy


    Suharna, Nandang


    A preliminary study has been done to know antagonism capacities of three isolates of Trichoderma harzianum, two isolates of Penicillium sp.and one isolate of Pseudomonas sp.against Phytophthora capsici in vitro and interaction among those six antagonists.The highest antagonism capacity possessed by Penicillium sp. KN1, respectively followed by Penicillium sp.KN2,Pseudomonas sp. GH1 and the three T. harzianum isolates. Except for those three T. harzianum isolates, the two Penicillium sp.isolat...

  13. Differences in nutrient uptake capacity of the benthic filamentous algae Cladophora sp., Klebsormidium sp. and Pseudanabaena sp. under varying N/P conditions. (United States)

    Liu, Junzhuo; Vyverman, Wim


    The N/P ratio of wastewater can vary greatly and directly affect algal growth and nutrient removal process. Three benthic filamentous algae species Cladophora sp., Klebsormidium sp. and Pseudanabaena sp. were isolated from a periphyton bioreactor and cultured under laboratory conditions on varying N/P ratios to determine their ability to remove nitrate and phosphorus. The N/P ratio significantly influenced the algal growth and phosphorus uptake process. Appropriate N/P ratios for nitrogen and phosphorus removal were 5-15, 7-10 and 7-20 for Cladophora sp., Klebsormidium sp. and Pseudanabaena sp., respectively. Within these respective ranges, Cladophora sp. had the highest biomass production, while Pseudanabaena sp. had the highest nitrogen and phosphorus contents. This study indicated that Cladophora sp. had a high capacity of removing phosphorus from wastewaters of low N/P ratio, and Pseudanabaena sp. was highly suitable for removing nitrogen from wastewaters with high N/P ratio. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. First report of Anisakis sp. in Epinephelus sp. in East Indonesia


    Annytha Ina Rohi Detha; Diana Agustiani Wuri; Julianty Almet; Yuni Riwu; Christin Melky


    Objective: The present research was conducted to identify the prevalence of Anisakis sp. as fish-borne zoonoses in Epinephelus sp. in territorial waters of East Nusa Tenggara, Indonesia. Materials and methods: A total of 50 fish (Epinephelus sp.) were collected from Kupang Fish Market in East Nusa Tenggara. Identification of Anisakis sp. was performed based on morphological observations considering shape of ventriculus, boring tooth, and mucron using binocular microscope. Results: Prev...

  15. Penicillium araracuarense sp. nov., Penicillium elleniae sp. nov., Penicillium penarojense sp. nov., Penicillium vanderhammenii sp. nov. and Penicillium wotroi sp. nov., isolated from leaf litter. (United States)

    Houbraken, Jos; López-Quintero, Carlos A; Frisvad, Jens C; Boekhout, Teun; Theelen, Bart; Franco-Molano, Ana Esperanza; Samson, Robert A


    Several species of the genus Penicillium were isolated during a survey of the mycobiota of leaf litter and soil in Colombian Amazon forest. Five species, Penicillium penarojense sp. nov. (type strain CBS 113178(T) = IBT 23262(T)), Penicillium wotroi sp. nov. (type strain CBS 118171(T) = IBT 23253(T)), Penicillium araracuarense sp. nov. (type strain CBS 113149(T) = IBT 23247(T)), Penicillium elleniae sp. nov. (type strain CBS 118135(T) = IBT 23229(T)) and Penicillium vanderhammenii sp. nov. (type strain CBS 126216(T) = IBT 23203(T)) are described here as novel species. Their taxonomic novelty was determined using a polyphasic approach, combining phenotypic, molecular (ITS and partial β-tubulin sequences) and extrolite data. Phylogenetic analyses showed that each novel species formed a unique clade for both loci analysed and that they were most closely related to Penicillium simplicissimum, Penicillium janthinellum, Penicillium daleae and Penicillium brasilianum. An overview of the phylogeny of this taxonomically difficult group is presented, and 33 species are accepted. Each of the five novel species had a unique extrolite profile of known and uncharacterized metabolites and various compounds, such as penicillic acid, andrastin A, pulvilloric acid, paxillin, paspaline and janthitrem, were commonly produced by these phylogenetically related species. The novel species had a high growth rate on agar media, but could be distinguished from each other by several macro- and microscopical characteristics.

  16. Fatty acid composition of Spirulina sp., Chlorella sp. and Chaetoceros sp. microalgae and introduction as potential new sources to extinct omega 3 and omega 6

    Directory of Open Access Journals (Sweden)

    Homan Gorjzdadeh


    Full Text Available Background: This study was carried out to determine the oil fatty acids from two special species of microalgae; Spirulina sp.,Chlorella sp. and also Chaetoceros sp. collected from Bahmanshir River. Materials and Methods: Sampling of microalgae Chaetoceros sp. from Bahmanshir River was under taken using bottle samplers during spring season of 2013. Microalgae Spirulina sp. and Chlorella sp. were supplied from Shrimp Research Institute of Iran in Bushehr Province. Samples then were cultured under controlled laboratory conditions and mass culture for 100 liters was undertaken. Isolation of microalgae species from water of cultured media was carried out using filtration and centrifugation methods. The fatty acid compositions were determined by Gas – FID chromatography. Results: Results showed that regarding Saturated Fatty Acids (SFA obtained from purified culture of Chaetoceros sp., Spirulina sp. and Chlorella sp. the maximum amount of total fatty acids were belonged to palmitic acids (C16:0 with 15.21%, 30.1% and 25.17% of total fatty acids  respectively. Analysis of Mono Unsaturated Fatty Acids (MUFA showed that in the Oleic acid was maximum amount of 34% in Spirulina sp. In addition the amount of MUFA in Chlorella sp. was 16.37% of total fatty acids. On the other hand the amount of palmeotic acid in purified culture of Chaetoceros sp. was 30.33% from total content of fatty acids. Analysis of Poly Unsaturated Fatty Acids (PUFA, Linoleic acid (C18:2 (Omega 6, revealed maximum percentage in Spirulina sp. with 18.8%. Results of Alpha linoleic acid (C18:3 (Omega3 analysis showed maximum amount of 9.66% in Chlorella sp. compared to other microalgae with lower omega 3 contents. Spirulina sp. contained maximum amount of Linoleic acid (C18:2 with 18.8% of total fatty acids. Therefore, Spirulina sp. can be considered as a rich source of omega 6 for the purpose of fatty acid extractions. The presence of PUFA in Chlorella sp. and Spirulina sp. was

  17. Isolation and screening of proangiogenic and antiangiogenic metabolites producing rare actinobacteria from soil. (United States)

    Azarakhsh, Y; Mohammadipanah, F; Nassiri, S M; Siavashi, V; Hamedi, J


    Angiogenesis is a physiological process that has important impacts on the pathology and healing of various diseases, and its induction or inhibition by bioactive actinobacterial metabolites can help the treatment of some diseases. In this study, the effects of actinobacterial extract in the process of angiogenesis have been explored. In this research, proangiogenic and antiangiogenic metabolites producing actinobacteria were isolated from soil samples and their fermentation broth were extracted and after evaluation of their toxicity by MTT assay, antiangiogenic and proangiogenic activities were screened against human umbilical vein endothelial cells (HUVECs) by in vitro tube formation and migration assay. Isolated strains were identified through molecular techniques. The results showed that Nocardiopsis arvandica UTMC 103 and Nonomuraea sp. UTMC 2180 extracts had a high potential of anti-angiogenic activity on HUVECs. For the first time proangiogenic potency of a rare actinobacterium, Kribbella sp. UTMC 522, was reported, and N. arvandica UTMC 103 and Nonomuraea sp. UTMC 2180 extracts inhibits the proliferation, migration and angiogenesis activity of HUVECs with reasonable potency. Metabolites of the introduced rare actinobacteria are potent proangiogenic and angiogenic inhibitors. Identification of angiogenic-antiangiogenic mechanisms and purification of the extracts would be useful in therapeutic angiogenesis. © 2017 The Society for Applied Microbiology.

  18. Eficiencia de pseudomonas sp, rhodopseudomonas sp, micrococcus sp y bacillus sp empleados como cultivos individuales y en consorcio, en la degradación de petróleo diesel ii


    Otiniano García, Nélida Milly Esther


    In order to evaluate the efficiency of Pseudomonas sp, Rhodopseudomonas sp, Micrococcus sp, Bacillus sp, and the consortium formed by these four microorganisms in the diesel II petroleum degradation, it was worked in 5 bioreactors of aerated and shaken tank of 1.5 litters of capacity, with speed agitation of 120 rpm, and air flow of 0.5 vvm; in which were placed; 940 mL of Minimum Broth of Davies pH 7.0; 50 mL of diesel II petroleum as source of carbon and 10 mL of a suspension of approx...

  19. Pengendalian Hayati Penyakit Layu Fusarium Pisang (Fusarium oxysporum f.sp. cubense dengan Trichoderma sp.

    Directory of Open Access Journals (Sweden)

    Albertus Sudirman


    Full Text Available The aim of this research was to study the inhibiting ability of Trichoderma sp. to control fusarium wilt of banana in greenhouse condition. The experiments consisted of the antagonism test between Trichoderma sp. and Fusarium oxysporum f.sp. cubense (Foc in vitro using dual culture method and glass house experiment which was arranged in 3×3 Factorial Complete Randomized Design. First factor of the latter experiment was the dose of Trichoderma sp. culture (0, 25, and 50 g per polybag, second factor was time of Trichoderma culture application (2 weeks before Foc inoculation, at same time with Foc inoculation and 2 weeks after Foc inoculation. Trichoderma sp. was cultured in mixed rice brand and chaff medium. The disease intensity was observed with scoring system of wilting leaves (0–4. The results showed that Trichoderma sp. was antagonistic against Foc in vitro and inhibited 86% of Foc colony development. Mechanism of antagonism between Trichoderma sp. and Foc was hyperparasitism. Trichoderma hyphae coiled around Foc hyphae. Lysis of Foc hyphae was occurred at the attached site of Trichoderma hyphae on Foc hyphae. Added banana seedling with Trichoderma sp. Culture reduced disease intensity of Fusarium wilt. Suggested dose of Trichoderma culture application in glass house was 25 g/polybag, given at the same time with Foc inoculation. Penelitian ini bertujuan untuk mengetahui kemampuan Trichoderma sp. untuk pengendalian penyakit layu fusarium pisang di rumah kaca. Penelitian meliputi pengujian daya hambat Fusarium oxysporum f.sp. cubense (Foc in vitro dan kemampuan menekan intensitas penyakit di rumah kaca. Penelitian in vitro meliputi uji antagonisme dan mekanismenya yang dilakukan secara dual culture. Uji pengaruh Trichoderma sp. terhadap penyakit layu Fusarium dilakukan di rumah kaca dengan Rancangan Acak Lengkap Faktorial. Faktor pertama adalah dosis biakan Trichoderma sp., dengan tiga aras (0, 25, 50 g/per bibit dalam polibag. Faktor kedua

  20. SP140L, an Evolutionarily Recent Member of the SP100 Family, Is an Autoantigen in Primary Biliary Cirrhosis

    Directory of Open Access Journals (Sweden)

    Mario Saare


    Full Text Available The SP100 family members comprise a set of closely related genes on chromosome 2q37.1. The widely expressed SP100 and the leukocyte-specific proteins SP110 and SP140 have been associated with transcriptional regulation and various human diseases. Here, we have characterized the SP100 family member SP140L. The genome sequence analysis showed the formation of SP140L gene through rearrangements of the two neighboring genes, SP100 and SP140, during the evolution of higher primates. The SP140L expression is interferon-inducible with high transcript levels in B cells and other peripheral blood mononuclear cells. Subcellularly, SP140L colocalizes with SP100 and SP140 in nuclear structures that are devoid of SP110, PML, or p300 proteins. Similarly to SP100 and SP140 protein, we detected serum autoantibodies to SP140L in patients with primary biliary cirrhosis using luciferase immunoprecipitation system and immunoblotting assays. In conclusion, our results show that SP140L is phylogenetically recent member of SP100 proteins and acts as an autoantigen in primary biliary cirrhosis patients.

  1. Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp. (United States)

    Kiliç, Nur Koçberber; Dönmez, Gönül


    Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

  2. Superhard sp2–sp3 hybrid carbon allotropes with tunable electronic properties

    Directory of Open Access Journals (Sweden)

    Meng Hu


    Full Text Available Four sp2–sp3 hybrid carbon allotropes are proposed on the basis of first principles calculations. These four carbon allotropes are energetically more favorable than graphite under suitable pressure conditions. They can be assembled from graphite through intralayer wrinkling and interlayer buckling, which is similar to the formation of diamond from graphite. For one of the sp2–sp3 hybrid carbon allotropes, mC24, the electron diffraction patterns match these of i-carbon, which is synthesized from shock-compressed graphite (H. Hirai and K. Kondo, Science, 1991, 253, 772. The allotropes exhibit tunable electronic characteristics from metallic to semiconductive with band gaps comparable to those of silicon allotropes. They are all superhard materials with Vickers hardness values comparable to that of cubic BN. The sp2–sp3 hybrid carbon allotroes are promising materials for photovoltaic electronic devices, and abrasive and grinding tools.

  3. Selective C(sp2)-C(sp) bond cleavage: the nitrogenation of alkynes to amides. (United States)

    Qin, Chong; Feng, Peng; Ou, Yang; Shen, Tao; Wang, Teng; Jiao, Ning


    Breakthrough: A novel catalyzed direct highly selective C(sp2)-C(sp) bond functionalization of alkynes to amides has been developed. Nitrogenation is achieved by the highly selective C(sp2)-C(sp) bond cleavage of aryl-substituted alkynes. The oxidant-free and mild conditions and wide substrate scope make this method very practical. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. In vitro cytotoxicity evaluation of nano-carbon particles with different sp{sup 2}/sp{sup 3} ratios

    Energy Technology Data Exchange (ETDEWEB)

    Li, S.S.; Wu, B.J.; Deng, Q.Y. [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China); Guo, Y.B. [The Third People' s Hospital of Chengdu, Sichuan 610031 (China); Leng, Y.X., E-mail: [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China); Huang, N. [Key Laboratory for Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan 610031 (China)


    Graphitization occurs during the long-term service of a diamond-like carbon (DLC) modified artificial joint. Then, DLC wear debris, which are carbon particles with different sp{sup 2}/sp{sup 3} ratios and sizes ranging from the nano- to micro-meter scale produced. In this paper, to promote the application of DLC coating for artificial joint modification, the cytotoxicity of DLC debris (nano-carbon particles, NCs) with different sp{sup 2}/sp{sup 3} ratios was studied. The microstructure and physical characteristics of NCs with different sp{sup 2}/sp{sup 3} ratios were investigated by Raman spectroscopy, X-ray photoelectron spectroscopy (XPS), Transmission Electron Microscope (TEM) and Dynamic Light Scattering (DLS). Meanwhile, osteoblasts and macrophages were applied to characterize the cytotoxicity of the NCs. In vitro cytotoxicity assay results indicated that cells incubated with NCs of different sp{sup 2}/sp{sup 3} ratios had greater osteogenic capacity, and these particles caused a weaker immune response in comparison with CoCrMo particles. Taken together, the results indicated that NCs with different sp{sup 2}/sp{sup 3} ratios presented a good cytocompatibility than CoCrMo particles. But no significant differences were observed among NCs with different sp{sup 2}/sp{sup 3} ratios. The better cytocompatibility of NCs is mainly attributable to their surface charge. - Highlights: • NCs with different sp{sup 2}/sp{sup 3} ratios have been successfully prepared by annealing treatment. • NCs with different sp{sup 2}/sp{sup 3} ratios show good osteogenic capacity and lower immune response. • The good cytocompatibility of NCs is mainly dependent on its surface charge.

  5. Xylanolytic enzyme systems in Arthrobacter sp MTCC 5214 and Lactobacillus sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Khandeparker, R.; Jalal, T.

    The production of extracellular xylanolytic enzymes such as xylanase, alfa-L-arabinofuranosidase (alfa-l-AFase), and acetyl xylan esterase (Axe) by marine Arthrobacter sp and Lactobacillus sp was investigated using different carbon sources Induction...

  6. Sp6 and Sp8 Transcription Factors Control AER Formation and Dorsal-Ventral Patterning in Limb Development (United States)

    Haro, Endika; Delgado, Irene; Junco, Marisa; Yamada, Yoshihiko; Mansouri, Ahmed; Oberg, Kerby C.; Ros, Marian A.


    The formation and maintenance of the apical ectodermal ridge (AER) is critical for the outgrowth and patterning of the vertebrate limb. The induction of the AER is a complex process that relies on integrated interactions among the Fgf, Wnt, and Bmp signaling pathways that operate within the ectoderm and between the ectoderm and the mesoderm of the early limb bud. The transcription factors Sp6 and Sp8 are expressed in the limb ectoderm and AER during limb development. Sp6 mutant mice display a mild syndactyly phenotype while Sp8 mutants exhibit severe limb truncations. Both mutants show defects in AER maturation and in dorsal-ventral patterning. To gain further insights into the role Sp6 and Sp8 play in limb development, we have produced mice lacking both Sp6 and Sp8 activity in the limb ectoderm. Remarkably, the elimination or significant reduction in Sp6;Sp8 gene dosage leads to tetra-amelia; initial budding occurs, but neither Fgf8 nor En1 are activated. Mutants bearing a single functional allele of Sp8 (Sp6−/−;Sp8+/−) exhibit a split-hand/foot malformation phenotype with double dorsal digit tips probably due to an irregular and immature AER that is not maintained in the center of the bud and on the abnormal expansion of Wnt7a expression to the ventral ectoderm. Our data are compatible with Sp6 and Sp8 working together and in a dose-dependent manner as indispensable mediators of Wnt/βcatenin and Bmp signaling in the limb ectoderm. We suggest that the function of these factors links proximal-distal and dorsal-ventral patterning. PMID:25166858

  7. Fresh Water Cyanobacteria Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as an Anticancer Drug Resource


    Srivastava, Akanksha; Tiwari, Ratnakar; Srivastava, Vikas; Singh, Tej Bali; Asthana, Ravi Kumar


    An increasing number of cancer patients worldwide, especially in third world countries, have raised concern to explore natural drug resources, such as the less explored fresh water filamentous cyanobacteria. Six strains of cyanobacteria (Phormidium sp. CCC727, Geitlerinema sp. CCC728, Arthrospira sp. CCC729, Phormidium sp. CCC731, Phormidium sp. CCC730, and Leptolyngbya sp. CCC732) were isolated (paddy fields and ponds in the Banaras Hindu University, campus) and five strains screened for ant...

  8. Pengendalian Hayati Penyakit Layu Fusarium Pisang (Fusarium Oxysporum F.sp. Cubense) dengan Trichoderma SP.


    Sudirman, Albertus; Sumardiyono, Christanti; Widyastuti, Siti Muslimah


    The aim of this research was to study the inhibiting ability of Trichoderma sp. to control fusarium wilt of banana in greenhouse condition. The experiments consisted of the antagonism test between Trichoderma sp. and Fusarium oxysporum f.sp. cubense (Foc) in vitro using dual culture method and glass house experiment which was arranged in 3×3 Factorial Complete Randomized Design. First factor of the latter experiment was the dose of Trichoderma sp. culture (0, 25, and 50 g per polybag), second...

  9. The Effect of Acupuncture to SP6 on Skin Temperature Changes of SP6 and SP10: An Observation of “Deqi”

    Directory of Open Access Journals (Sweden)

    Jia-Min Yang


    Full Text Available Background. Deqi sensation is a complex but an important component for acupuncture effect. In this study, we tried to observe the relationship between Deqi and skin temperature changes and whether there was some relativity between Deqi and needle stimulations on cold congealing and dysmenorrhea rat model. Thirty-two female Sprague Dawley (SD rats were randomly divided into four groups (Saline Control Group, Model Group, Group A with strong stimulation, and Group B with small stimulation. Group A and Group B were performed with different stimulations. We found that, compared with saline control group, model group, and Group B, Group A showed that the skin temperature changes on right acupoint SP6 and SP10 increased significantly at 5 min–10 min interval. The skin temperature changes on left SP6 decreased at instant–5 min interval. The skin temperature changes on right SP10 decreased significantly at instant–5 min interval and 10 min–20 min interval. Thermogenic action along Spleen Meridian of Foot Greater Yin was manifested as simultaneous skin temperature increase on right SP6 and SP10 at 5 min–10 min interval after needling SP6, which was helpful to illustrate the relationship between the characteristic of Deqi and needle stimulations.

  10. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    International Nuclear Information System (INIS)

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun


    Research highlights: → Sp1 zinc fingers themselves interact with importin α. → Sp1 zinc finger domains play an essential role as a nuclear localization signal. → Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin α in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin α including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin α. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  11. Role of surfactant protein A (SP-A)/lipid interactions for SP-A functions in the lung. (United States)

    Casals, C


    Surfactant protein A (SP-A), an oligomeric glycoprotein, is a member of a group of proteins named collectins that contain collagen-like and Ca(2+)-dependent carbohydrate recognition domains. SP-A interacts with a broad range of amphipathic lipids (glycerophospholipids, sphingophospholipids, glycosphingolipids, lipid A, and lipoglycans) that are present in surfactant or microbial membranes. This review summarizes SP-A/lipid interaction studies regarding the lipid system used (i.e., phospholipid vesicles, phospholipid monolayers, and lipids immobilized on silica or adsorbed on a solid support). The effect of calcium, ionic strength, and pH on the binding of SP-A to lipids and the subsequent lipid aggregation process is discussed. Current evidence suggests that hydrophobic-binding forces are involved in the peripherical association of SP-A to membranes. It is also proposed that fluid and liquid-ordered phase coexistence in surfactant membranes might favor partition of SP-A into those membranes. The binding of SP-A to surfactant membranes containing hydrophobic surfactant peptides makes possible the formation of a membrane reservoir in the alveolar fluid that is protected by SP-A against inactivation and improves the rate of surfactant film formation. In addition, the interaction of SP-A with membranes might enhance the affinity of SP-A for terminal carbohydrates of glycolipids or glycoproteins on the surface of invading microorganisms.

  12. Five novel Wickerhamomyces- and Metschnikowia-related yeast species, Wickerhamomyces chaumierensis sp. nov., Candida pseudoflosculorum sp. nov., Candida danieliae sp. nov., Candida robnettiae sp. nov. and Candida eppingiae sp. nov., isolated from plants

    NARCIS (Netherlands)

    Groenewald, Marizeth; Robert, Vincent; Smith, Maudy Th

    On the basis of nucleotide divergences in the D1/D2 domain of the 26S rRNA gene and the internal transcribed spacers (ITS) domain of the rRNA gene, five novel yeast species, Wickerhamomyces chaumierensis sp. nov. (CBS 8565(T)  = JCM 17246(T)), Candida pseudoflosculorum sp. nov. (CBS 8584(T)  = JCM

  13. Truncated recombinant human SP-D attenuates emphysema and type II cell changes in SP-D deficient mice

    Directory of Open Access Journals (Sweden)

    Mühlfeld Christian


    Full Text Available Abstract Background Surfactant protein D (SP-D deficient mice develop emphysema-like pathology associated with focal accumulations of foamy alveolar macrophages, an excess of surfactant phospholipids in the alveolar space and both hypertrophy and hyperplasia of alveolar type II cells. These findings are associated with a chronic inflammatory state. Treatment of SP-D deficient mice with a truncated recombinant fragment of human SP-D (rfhSP-D has been shown to decrease the lipidosis and alveolar macrophage accumulation as well as production of proinflammatory chemokines. The aim of this study was to investigate if rfhSP-D treatment reduces the structural abnormalities in parenchymal architecture and type II cells characteristic of SP-D deficiency. Methods SP-D knock-out mice, aged 3 weeks, 6 weeks and 9 weeks were treated with rfhSP-D for 9, 6 and 3 weeks, respectively. All mice were sacrificed at age 12 weeks and compared to both PBS treated SP-D deficient and wild-type groups. Lung structure was quantified by design-based stereology at the light and electron microscopic level. Emphasis was put on quantification of emphysema, type II cell changes and intracellular surfactant. Data were analysed with two sided non-parametric Mann-Whitney U-test. Main Results After 3 weeks of treatment, alveolar number was higher and mean alveolar size was smaller compared to saline-treated SP-D knock-out controls. There was no significant difference concerning these indices of pulmonary emphysema within rfhSP-D treated groups. Type II cell number and size were smaller as a consequence of treatment. The total volume of lamellar bodies per type II cell and per lung was smaller after 6 weeks of treatment. Conclusion Treatment of SP-D deficient mice with rfhSP-D leads to a reduction in the degree of emphysema and a correction of type II cell hyperplasia and hypertrophy. This supports the concept that rfhSP-D might become a therapeutic option in diseases that are

  14. Quality improvement on half-fin anchovy (Setipinna taty) fish sauce by Psychrobacter sp. SP-1 fermentation. (United States)

    Zheng, Bin; Liu, Yu; He, Xiaoxia; Hu, Shiwei; Li, Shijie; Chen, Meiling; Jiang, Wei


    A method of improving fish sauce quality during fermentation was investigated. Psychrobacter sp. SP-1, a halophilic protease-producing bacterium, was isolated from fish sauce with flavor-enhancing properties and non-biogenic amine-producing activity. The performance of Psychrobacter sp. SP-1 in Setipinna taty fish sauce fermentation was investigated further. The inoculation of Psychrobacter sp. SP-1 did not significantly affect pH or NaCl concentration changes (P > 0.05), although it significantly increased total moderately halophilic microbial count, protease activity, total soluble nitrogen content and amino acid nitrogen content, and also promoted the umami taste and meaty aroma (P sauce quality by fermentation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. From spent graphite to amorphous sp2+sp3 carbon-coated sp2 graphite for high-performance lithium ion batteries (United States)

    Ma, Zhen; Zhuang, Yuchan; Deng, Yaoming; Song, Xiaona; Zuo, Xiaoxi; Xiao, Xin; Nan, Junmin


    Today, with the massive application of lithium ion batteries (LIBs) in the portable devices and electric vehicles, to supply the active materials with high-performances and then to recycle their wastes are two core issues for the development of LIBs. In this paper, the spent graphite (SG) in LIBs is used as raw materials to fabricate two comparative high-capacity graphite anode materials. Based on a microsurgery-like physical reconstruction, the reconstructed graphite (RG) with a sp2+sp3 carbon surface is prepared through a microwave exfoliation and subsequent spray drying process. In contrast, the neural-network-like amorphous sp2+sp3 carbon-coated graphite (AC@G) is synthesized using a self-reconfigurable chemical reaction strategy. Compared with SG and commercial graphite (CG), both RG and AC@G have enhanced specific capacities, from 311.2 mAh g-1 and 360.7 mAh g-1 to 409.7 mAh g-1 and 420.0 mAh g-1, at 0.1C after 100 cycles. In addition, they exhibit comparable cycling stability, rate capability, and voltage plateau with CG. Because the synthesis of RG and AC@G represents two typical physical and chemical methods for the recycling of SG, these results on the sp2+sp3 carbon layer coating bulk graphite also reveal an approach for the preparation of high-performance graphite anode materials derived from SG.

  16. Halobacterium sp. SP1(1) as a starter culture for accelerating fish sauce fermentation. (United States)

    Akolkar, A V; Durai, D; Desai, A J


    Application of Halobacterium sp. SP1(1) for the acceleration of fish sauce fermentation. Traditional fish sauce fermentation was mimicked using Halobacterium sp. SP1(1) as starter culture. Protease activity, peptide release and α-amino content (parameters used to monitor the progress of the fermentation) were high at day 10 in tests and day 20 in un-inoculated controls. The total protein and nitrogen contents were also high in tests compared with controls. The amino acid profile observed at the end of fermentation in experimental samples, when compared with the commercial sauce preparation, was found to be better with respect to flavour and aroma contributing amino acids as well as essential amino acid lysine. Microflora analysis of the final fish sauce revealed the absence of any nonhalophilic or halotolerant micro-organisms. The protease-producing halophilic isolates obtained from the fish sauce of eviscerated and uneviscerated controls were identified as Halobacterium sp. F1 and F2, respectively, by 16S rDNA sequence analysis. Exogenous augmentation of Halobacterium sp. SP1(1) accelerated the fish sauce fermentation process with an additive effect on the existing natural microflora present in the fish during fermentation. Halobacterium sp SP1(1), therefore, can be used as an important starter culture for accelerating the fish fermentation process, which is attributed to its extracellular protease. The present study is the first report on use of Halobacterium species as a starter culture for accelerating fish sauce fermentation. Use of halobacterial starter cultures may revolutionize the process in fish sauce industries by reducing the fermentation time and making the process more economical with improved nutritive value of product. Journal compilation © 2009 The Society for Applied Microbiology. No claim to Indian Government works.

  17. ExaSP2

    Energy Technology Data Exchange (ETDEWEB)


    ExaSP2 is a reference implementation of typical linear algebra algorithms and workloads for a quantum molecular dynamics (QMD) electronic structure code. The algorithm is based on a recursive second-order Fermi-Operator expansion method (SP2) and is tailored for density functional based tight-binding calculations of material systems.

  18. Fresh Water Cyanobacteria Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as an Anticancer Drug Resource.

    Directory of Open Access Journals (Sweden)

    Akanksha Srivastava

    Full Text Available An increasing number of cancer patients worldwide, especially in third world countries, have raised concern to explore natural drug resources, such as the less explored fresh water filamentous cyanobacteria. Six strains of cyanobacteria (Phormidium sp. CCC727, Geitlerinema sp. CCC728, Arthrospira sp. CCC729, Phormidium sp. CCC731, Phormidium sp. CCC730, and Leptolyngbya sp. CCC732 were isolated (paddy fields and ponds in the Banaras Hindu University, campus and five strains screened for anticancer potential using human colon adenocarcinoma (HT29 and human kidney adenocarcinoma (A498 cancer cell lines. Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 were the most potent as determined by examination of morphological features and by inhibition of growth by graded concentrations of crude extracts and thin-layer chromatography (TLC eluates. Cell cycle analysis and multiplex assays using cancer biomarkers also confirmed Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as cancer drug resources. Apoptotic studies in the cells of A498 (cancer and MCF-10A (normal human epithelial exposed to crude extracts and TLC fractions revealed no significant impact on MCF-10A cells emphasizing its importance in the development of anticancer drug. Identification of biomolecules from these extracts are in progress.

  19. Fresh Water Cyanobacteria Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as an Anticancer Drug Resource. (United States)

    Srivastava, Akanksha; Tiwari, Ratnakar; Srivastava, Vikas; Singh, Tej Bali; Asthana, Ravi Kumar


    An increasing number of cancer patients worldwide, especially in third world countries, have raised concern to explore natural drug resources, such as the less explored fresh water filamentous cyanobacteria. Six strains of cyanobacteria (Phormidium sp. CCC727, Geitlerinema sp. CCC728, Arthrospira sp. CCC729, Phormidium sp. CCC731, Phormidium sp. CCC730, and Leptolyngbya sp. CCC732) were isolated (paddy fields and ponds in the Banaras Hindu University, campus) and five strains screened for anticancer potential using human colon adenocarcinoma (HT29) and human kidney adenocarcinoma (A498) cancer cell lines. Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 were the most potent as determined by examination of morphological features and by inhibition of growth by graded concentrations of crude extracts and thin-layer chromatography (TLC) eluates. Cell cycle analysis and multiplex assays using cancer biomarkers also confirmed Geitlerinema sp. CCC728 and Arthrospira sp. CCC729 as cancer drug resources. Apoptotic studies in the cells of A498 (cancer) and MCF-10A (normal human epithelial) exposed to crude extracts and TLC fractions revealed no significant impact on MCF-10A cells emphasizing its importance in the development of anticancer drug. Identification of biomolecules from these extracts are in progress.

  20. Superhard sp{sup 2}–sp{sup 3} hybrid carbon allotropes with tunable electronic properties

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Meng; Ma, Mengdong; Zhao, Zhisheng; Yu, Dongli; He, Julong, E-mail: [State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China)


    Four sp{sup 2}–sp{sup 3} hybrid carbon allotropes are proposed on the basis of first principles calculations. These four carbon allotropes are energetically more favorable than graphite under suitable pressure conditions. They can be assembled from graphite through intralayer wrinkling and interlayer buckling, which is similar to the formation of diamond from graphite. For one of the sp{sup 2}–sp{sup 3} hybrid carbon allotropes, mC24, the electron diffraction patterns match these of i-carbon, which is synthesized from shock-compressed graphite (H. Hirai and K. Kondo, Science, 1991, 253, 772). The allotropes exhibit tunable electronic characteristics from metallic to semiconductive with band gaps comparable to those of silicon allotropes. They are all superhard materials with Vickers hardness values comparable to that of cubic BN. The sp{sup 2}–sp{sup 3} hybrid carbon allotroes are promising materials for photovoltaic electronic devices, and abrasive and grinding tools.

  1. Bifidobacterium reuteri sp. nov., Bifidobacterium callitrichos sp. nov., Bifidobacterium saguini sp. nov., Bifidobacterium stellenboschense sp. nov. and Bifidobacterium biavatii sp. nov. isolated from faeces of common marmoset (Callithrix jacchus) and red-handed tamarin (Saguinus midas). (United States)

    Endo, Akihito; Futagawa-Endo, Yuka; Schumann, Peter; Pukall, Rüdiger; Dicks, Leon M T


    Five strains of bifidobacteria were isolated from faeces of a common marmoset (Callithrix jacchus) and a red-handed tamarin (Saguinus midas). The five isolates clustered inside the phylogenetic group of the genus Bifidobacterium but did not show high sequence similarities between the isolates and to known species in the genus by phylogenetic analysis based on 16S rRNA gene sequences. Sequence analyses of dnaJ1 and hsp60 also indicated their independent phylogenetic positions to each other in the Bifidobacterium cluster. DNA G+C contents of the species ranged from 57.3 to 66.3 mol%, which is within the values recorded for Bifidobacterium species. All isolates showed fructose-6-phosphate phosphoketolase activity. Based on the data provided, the five isolates represent five novel species, for which the names Bifidobacterium reuteri sp. nov. (type strain: AFB22-1(T) = JCM 17295(T) = DSM 23975(T)), Bifidobacterium callitrichos sp. nov. (type strain: AFB22-5(T) = JCM 17296(T) = DSM 23973(T)), Bifidobacterium saguini sp. nov. (type strain: AFB23-1(T) = JCM 17297(T) = DSM 23967(T)), Bifidobacterium stellenboschense sp. nov. (type strain: AFB23-3(T) = JCM 17298(T) = DSM 23968(T)) and Bifidobacterium biavatii sp. nov. (type strain: AFB23-4(T) = JCM 17299(T) = DSM 23969(T)) are proposed. Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Microbiologically influenced corrosion of galvanized steel by Desulfovibrio sp. and Desulfosporosinus sp. in the presence of Ag–Cu ions

    Energy Technology Data Exchange (ETDEWEB)

    Ilhan-Sungur, Esra, E-mail: [Istanbul University, Faculty of Science, Department of Biology, 34134 Vezneciler, Istanbul (Turkey); Unsal-Istek, Tuba [Istanbul University, Faculty of Science, Department of Biology, 34134 Vezneciler, Istanbul (Turkey); Cansever, Nurhan [Yıldız Technical University, Faculty of Chemistry-Metallurgy, Metallurgical and Materials Engineering Department, 34210 Esenler, Istanbul (Turkey)


    The effects of Ag–Cu ions on the microbiologically induced corrosion of galvanized steel in the presence of Desulfovibrio sp. and Desulfosporosinus sp. were investigated. The corrosion behavior of galvanized steel was analyzed by potentiodynamic polarization and electrochemical impedance spectroscopy. The biofilm, corrosion products and Ag–Cu ions on the surfaces were investigated by using scanning electron microscopy, energy dispersive X-ray spectrometry and elemental mapping. The biofilm layer formed by the Desulfovibrio sp. was stable covering the all surface of galvanized steel coupons, while that by Desulfosporosinus sp. was intermittent, highly porous and heterogeneous. It was found that both of the sulfate reducing bacteria species accelerated corrosion of the galvanized steel. However, it was detected that Desulfosporosinus sp. was more corrosive for galvanized steel than Desulfovibrio sp. Scanning electron microscopy images showed that Desulfovibrio sp. and Desulfosporosinus sp. in biofilm clustered into patches on the galvanized steel surface when the culture contained toxic Ag–Cu ions. The ions affected the growth of the sulfate reducing bacteria strains in different ways and hence the corrosion behaviors. It was observed that the Ag–Cu ions affected negatively growth of Desulfosporosinus sp. especially after 24 h of exposure leading to a decrease in the corrosion rate of galvanized steel. However, Desulfovibrio sp. showed more corrosive effect in the presence of the ions according to the ions-free culture. Energy dispersive X-ray spectrometry analysis showed that corrosion products on the surfaces were mainly composed of Zn, S, Na, O and P. - Highlights: • Galvanized steel was corroded by Desulfosporosinus sp. and Desulfovibrio sp. • Desulfosporosinus sp. is more corrosive than Desulfovibrio sp. • The Ag–Cu ions affected corrosion behavior of Desulfosporosinus sp. and Desulfovibrio sp. on galvanized steel.

  3. Microbiologically influenced corrosion of galvanized steel by Desulfovibrio sp. and Desulfosporosinus sp. in the presence of Ag–Cu ions

    International Nuclear Information System (INIS)

    Ilhan-Sungur, Esra; Unsal-Istek, Tuba; Cansever, Nurhan


    The effects of Ag–Cu ions on the microbiologically induced corrosion of galvanized steel in the presence of Desulfovibrio sp. and Desulfosporosinus sp. were investigated. The corrosion behavior of galvanized steel was analyzed by potentiodynamic polarization and electrochemical impedance spectroscopy. The biofilm, corrosion products and Ag–Cu ions on the surfaces were investigated by using scanning electron microscopy, energy dispersive X-ray spectrometry and elemental mapping. The biofilm layer formed by the Desulfovibrio sp. was stable covering the all surface of galvanized steel coupons, while that by Desulfosporosinus sp. was intermittent, highly porous and heterogeneous. It was found that both of the sulfate reducing bacteria species accelerated corrosion of the galvanized steel. However, it was detected that Desulfosporosinus sp. was more corrosive for galvanized steel than Desulfovibrio sp. Scanning electron microscopy images showed that Desulfovibrio sp. and Desulfosporosinus sp. in biofilm clustered into patches on the galvanized steel surface when the culture contained toxic Ag–Cu ions. The ions affected the growth of the sulfate reducing bacteria strains in different ways and hence the corrosion behaviors. It was observed that the Ag–Cu ions affected negatively growth of Desulfosporosinus sp. especially after 24 h of exposure leading to a decrease in the corrosion rate of galvanized steel. However, Desulfovibrio sp. showed more corrosive effect in the presence of the ions according to the ions-free culture. Energy dispersive X-ray spectrometry analysis showed that corrosion products on the surfaces were mainly composed of Zn, S, Na, O and P. - Highlights: • Galvanized steel was corroded by Desulfosporosinus sp. and Desulfovibrio sp. • Desulfosporosinus sp. is more corrosive than Desulfovibrio sp. • The Ag–Cu ions affected corrosion behavior of Desulfosporosinus sp. and Desulfovibrio sp. on galvanized steel

  4. Analysis list: SP2 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available SP2 Blood,Liver,Pluripotent stem cell + hg19,http:...//,http:...// http://dbarchive.biosciencedbc

  5. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation. (United States)

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L


    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  6. Rhodotorula bloemfonteinensis sp. nov., Rhodotorula eucalyptica sp. nov., Rhodotorula orientis sp. nov. and Rhodotorula pini sp. nov., yeasts isolated from monoterpene-rich environments. (United States)

    Pohl, Carolina H; Smit, Martha S; Albertyn, Jacobus


    Recent rDNA sequencing of 25 isolates from a previous study, during which limonene-utilizing yeasts were isolated from monoterpene-rich environments by using 1,4-disubstituted cyclohexanes as sole carbon sources, led to the identification of four hitherto unknown Rhodotorula species. Analyses of the 26S rDNA D1/D2 region as well as the internal transcribed spacer (ITS) domain indicated that two isolates (CBS 8499(T) and CBS 10736) were identical and were closely related to Rhodotorula cycloclastica, a previously described limonene-utilizing yeast. These novel isolates differed from known yeast species and could be distinguished from R. cycloclastica by standard physiological tests. The other three isolates represent three novel Rhodotorula species, closely related to Sporobolomyces magnisporus. These three species could also be distinguished from other Rhodotorula species by standard physiological tests. Based on these results, we suggest that the new isolates represent novel species, for which the names Rhodotorula eucalyptica sp. nov. (type strain CBS 8499(T)  = NRRL Y-48408(T)), Rhodotorula pini sp. nov. (type strain CBS 10735(T)  = NRRL Y-48410(T)), Rhodotorula bloemfonteinensis sp. nov. (type strain CBS 8598(T)  = NRRL Y-48407(T)) and Rhodotorula orientis sp. nov. (type strain CBS 8594(T)  = NRRL Y-48719(T)) are proposed. R. eucalyptica and R. pini can also utilize limonene.

  7. Detection of Salmonella sp., Vibrio sp. and total plate count bacteria on blood cockle (Anadara granosa) (United States)

    Ekawati, ER; Yusmiati, S. N. H.


    Blood cockle (Anadara granosa) has high level of zinc and protein, which is beneficial for therapeutic function for malnourished particularly stunting case in children. Zinc in animal foods is more absorbable than that from vegetable food. Blood cockle (Anadara granosa) is rich in nutrient and an excellent environment for the growth of microorganisms. This research aimed to identify the contamination of Salmonella sp., Vibrio sp. and total plate count bacteria on blood cockle (Anadara granosa). This was observation research with laboratory analysis. Salmonella sp. and Vibrio sp. were detected from blood cockle. Total plate count was determine of the total amount of the bacteria. Results detected from 20 samples of blood cockle showed that all samples were negative of Salmonella sp. and 1 sample positive Vibrio sp. The result of total plate count bacteria was < 5 x 105 colony/g sample.

  8. Surfactant protein A (SP-A)-mediated clearance of Staphylococcus aureus involves binding of SP-A to the staphylococcal adhesin eap and the macrophage receptors SP-A receptor 210 and scavenger receptor class A. (United States)

    Sever-Chroneos, Zvjezdana; Krupa, Agnieszka; Davis, Jeremy; Hasan, Misbah; Yang, Ching-Hui; Szeliga, Jacek; Herrmann, Mathias; Hussain, Muzafar; Geisbrecht, Brian V; Kobzik, Lester; Chroneos, Zissis C


    Staphylococcus aureus causes life-threatening pneumonia in hospitals and deadly superinfection during viral influenza. The current study investigated the role of surfactant protein A (SP-A) in opsonization and clearance of S. aureus. Previous studies showed that SP-A mediates phagocytosis via the SP-A receptor 210 (SP-R210). Here, we show that SP-R210 mediates binding and control of SP-A-opsonized S. aureus by macrophages. We determined that SP-A binds S. aureus through the extracellular adhesin Eap. Consequently, SP-A enhanced macrophage uptake of Eap-expressing (Eap(+)) but not Eap-deficient (Eap(-)) S. aureus. In a reciprocal fashion, SP-A failed to enhance uptake of Eap(+) S. aureus in peritoneal Raw264.7 macrophages with a dominant negative mutation (SP-R210(DN)) blocking surface expression of SP-R210. Accordingly, WT mice cleared infection with Eap(+) but succumbed to sublethal infection with Eap- S. aureus. However, SP-R210(DN) cells compensated by increasing non-opsonic phagocytosis of Eap(+) S. aureus via the scavenger receptor scavenger receptor class A (SR-A), while non-opsonic uptake of Eap(-) S. aureus was impaired. Macrophages express two isoforms: SP-R210(L) and SP-R210(S). The results show that WT alveolar macrophages are distinguished by expression of SP-R210(L), whereas SR-A(-/-) alveolar macrophages are deficient in SP-R210(L) expressing only SP-R210(S). Accordingly, SR-A(-/-) mice were highly susceptible to both Eap(+) and Eap(-) S. aureus. The lungs of susceptible mice generated abnormal inflammatory responses that were associated with impaired killing and persistence of S. aureus infection in the lung. In conclusion, alveolar macrophage SP-R210(L) mediates recognition and killing of SP-A-opsonized S. aureus in vivo, coordinating inflammatory responses and resolution of S. aureus pneumonia through interaction with SR-A.

  9. Cr(VI) reduction from contaminated soils by Aspergillus sp. N2 and Penicillium sp. N3 isolated from chromium deposits. (United States)

    Fukuda, Tsubasa; Ishino, Yasuhiro; Ogawa, Akane; Tsutsumi, Kadzuyo; Morita, Hiroshi


    Aspergillus sp. N2 and Penicillium sp. N3 are chromate-resistant filamentous fungi that were isolated from Cr(VI) contaminated soil based on their ability to decrease hexavalent chromium levels in the growth medium. After 120 h of growth in a medium containing 50 ppm Cr(VI) at near neutral pH, Aspergillus sp. N2 reduced the Cr(VI) concentration by about 75%. Penicillium sp. N3 was able to reduce the Cr(VI) concentration by only 35%. However, Penicillium sp. N3 reduced the Cr(VI) concentration in the medium by 93% under acidic conditions. Interestingly, the presence of Cu(II) enhanced the Cr(VI) reducing ability of Aspergillus sp. N2 and Penicillium sp. N3 at near neutral pH. Aspergillus sp. N2 and Penicillium sp. N3 reduced the Cr(VI) concentration in the growth medium to a virtually undetectable level within 120 h. For both Aspergillus sp. N2 and Penicillium sp. N3, mycelial seed cultures were more efficient at Cr(VI) reduction than conidium seed cultures. The mechanisms of Cr(VI) reduction in Aspergillus sp. N2 and Penicillium sp. N3 were enzymatic reduction and sorption to mycelia. Enzymatic activity contributed significantly to Cr(VI) reduction. Aspergillus sp. N2 and Penicillium sp. N3 reduced the levels of Cr(VI) in polluted soil samples, suggesting that these strains might be useful for cleaning up chromium-contaminated sites.

  10. Penggunaan Jamur Antagonis Trichoderma SP. Dan Gliocladium SP. Untuk Mengendalikan Penyakit Layu Fusarium Pada Tanaman Bawang Merah (Allium Ascalonicum L.)


    Arie Ramadhina, Arie Ramadhina; Lisnawita, Lisnawita; Lubis, Lahmuddin


    The use of antagonism fungus of Trichoderma sp. and Gliocladium sp. for controlling wilt(Fusarium oxysporum) in red onion plants. The aim of the research was to know the effectiviness ofantagonism fungus of Trichoderma sp. and Gliocladium sp. in controlling wilt in red onion plants.The research used non-factorial RAK (random group design) with eight treatments: control, 10grams of F. oxysporum, 12 grams of Trichoderma sp., 18 grams of Trichoderma sp., 24 grams ofTrichoderma sp., and 12 grams ...

  11. Penggunaan Streptomyces sp. Sebagai Biokontrol Penyakit Layu Pada Tanaman Cabai Merah (Capsicum annuum L. yang Disebabkan Oleh Fusarium oxysporum f.sp. capsici

    Directory of Open Access Journals (Sweden)



    Full Text Available A research has been conducted to find out Streptomyces bacteria at Bukit Jimbaran, to inhibitionpotency of Streptomyces sp. to pathogenic fungi Fusarium oxysporum f.sp. capsici, and to find outantifungal activity of Streptomyces filtrate to F.oxysporum f.sp. capsici in chili (Capsicum annuumL. plants. Streptomyces sp. isolation was done by platting method with selective media YMA (ISP4.Identification of Streptomyces sp. used Bergey’s book entitled Manual Determinative Bacteriology.Test inhibition against F.oxysporum f.sp. capsici and in vivo test used by dying the roots of the chili(C.annuum L. plant with F.oxysporum f.sp. capsici and after 30 seconds the roots were dying withStreptomyces sp. culture, furthermore sterile soil on polybag watered by F.oxysporum f.sp. capsicispore and Streptomyces sp. culture at the same time. The result found five isolates Streptomyces sp.with different morphological. The antagonis test showed Streptomyces sp. 4 had ability (82% againstFusarium, Streptomyces sp.1 (72%, Streptomyces sp.2 (64%, Streptomyces sp.3 (76%, andStreptomyces sp. 5 (32%. All Streptomyces suppressed the growth of Fusarium on chili plants inglass house (p<0,05. Streptomyces sp.4 suppressed Fusarium wilt disease in chili from 80% in controlto 8%.

  12. Guide til gode spørgeskemaer

    DEFF Research Database (Denmark)

    Olsen, Henning

    Spørgeskemaundersøgelser bliver ofte brugt til at dokumentere forskellige forhold og begrunde politiske beslutninger. Men resultaterne kan være forbundet med stor usikkerhed. Det kræver omhu og stor sproglig formåen at udarbejde spørgeskemaer. Seniorforsker Henning Olsen har i flere år arbejdet med...... viden om, hvordan folk forstår sproglige meddelelser og genkalder sig informationer. I guiden behandles emner som fx styrende problemstillinger og spørgsmåls fokus og neutralitet, formulering af åbne eller lukkede spørgsmål og svarkategorier, tematiske spørgeforløb, aflastning af svarpersoners...


    Directory of Open Access Journals (Sweden)

    Eva Ari Wahyuni


    Full Text Available DISTRIBUTION OF Solen sp IN BANGKALAN WATERSSolen sp potential needs to be developed on the island of Madura, particularly in Bangkalan. Solen sp utilization has increased which has the potential to overfishing. Therefore, this study aims to determine the density of Solen sp and their ecology in the waters Modung village, Modung District, Bangkalan. The experiment was conducted in April 2015 using the descriptive method. The materials used include Solen sp and physico-chemical parameters of the environment (temperature, salinity, pH, and substrate. The analyzes were conducted at the Laboratory of Marine Science, Department of Marine Sciences, Trunojoyo University of Madura by using the tool grabsampler, sieveshaker, and pipetting with gravimetric method. The analysis shows the range of values of temperature between 29-300C, salinity between 31-32 ppt, pH were 7.9-8.0 and the type of substrate in the form of sandy mud, as well as the density of Solen sp from 8-10 individuals/m2. All measurement results indicate normal conditions and in accordance with the sea water quality standard for marine life, which can be a suitable habitat for the growth and development of Solen sp. This condition is thought to affect the density of Solen sp.Keywords: Bangkalan, density, distribution, Solen sp, substrate.ABSTRAKPotensi Solen sp perlu dikembangkan di pulau Madura, khususnya di Kabupaten Bangkalan. Pemanfaatan Solen sp mengalami peningkatan sehingga berpotensi overfishing. Untuk itu, penelitian ini bertujuan untuk mengetahui kepadatan Solen sp dan ekologinya di perairan desa Modung, Kecamatan Modung, Kabupaten Bangkalan. Penelitian dilaksanakan pada bulan April 2015 dengan metode deskriptif. Materi dan bahan yang digunakan diantaranya Solen sp dan parameter fisika-kimia lingkungan (suhu, salinitas, pH, dan substrat. Analisa dilakukan di Laboratorium Ilmu Kelautan, Program studi/Jurusan Ilmu Kelautan Universitas Trunojoyo Madura dengan menggunakan alat

  14. Endosulfan induced alteration in bacterial protein profile and RNA yield of Klebsiella sp. M3, Achromobacter sp. M6, and Rhodococcus sp. M2. (United States)

    Singh, Madhu; Singh, Dileep Kumar


    Three bacterial strains identified as Klebsiella sp. M3, Achromobacter sp. M6 and Rhodococcus sp. M2 were isolated by soil enrichment with endosulfan followed by shake flask enrichment technique. They were efficiently degrading endosulfan in the NSM (non sulfur medium) broth. Degradation of endosulfan was faster with the cell free extract of bacterial cells grown in the sulfur deficient medium (NSM) supplemented with endosulfan than that of nutrient rich medium (Luria Bertani). In the cell free extract of NSM supplemented with endosulfan as sole sulfur source, a unique band was visualized on SDS-PAGE but not with magnesium sulfate as the sole sulfur source in NSM and LB with endosulfan. Expression of a unique polypeptide band was speculated to be induced by endosulfan under sulfur starved condition. These unique polypeptide bands were identified as OmpK35 protein, sulfate binding protein and outer membrane porin protein, respectively, in Klebsiella sp. M3, Achromobacter sp. M6 and Rhodococcus sp. M2. Endosulfan showed dose dependent negative effect on total RNA yield of bacterial strains in nutrient rich medium. Absence of plasmid DNA indicated the presence of endosulfan metabolizing gene on genomic DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. SP-A binding sites on bovine alveolar macrophages. (United States)

    Plaga, S; Plattner, H; Schlepper-Schaefer, J


    Surfactant protein A (SP-A) binding to bovine alveolar macrophages was examined in order to characterize SP-A binding proteins on the cell surface and to isolate putative receptors from these cells that could be obtained in large amounts. Human SP-A, unlabeled or labeled with gold particles, was bound to freshly isolated macrophages and analyzed with ELISA or the transmission electron microscope. Binding of SP-A was inhibited by Ca2+ chelation, by an excess of unlabeled SP-A, or by the presence of 20 mg/ml mannan. We conclude that bovine alveolar macrophages expose binding sites for SP-A that are specific and that depend on Ca2+ and on mannose residues. For isolation of SP-A receptors with homologous SP-A as ligand we isolated SP-A from bovine lung lavage. SDS-PAGE analysis of the purified SP-A showed a protein of 32-36 kDa. Functional integrity of the protein was demonstrated. Bovine SP-A bound to Dynabeads was used to isolate SP-A binding proteins. From the fractionated and blotted proteins of the receptor preparation two proteins bound SP-A in a Ca2+-dependent manner, a 40-kDa protein showing mannose dependency and a 210-kDa protein, showing no mannose sensitivity. Copyright 1998 Academic Press.

  16. Remote sensing data of SP Mountain and SP Lava flow in North-Central Arizona (United States)

    Schaber, G.G.; Elachi, C.; Farr, T.G.


    Multifrequency airborne radar image data of SP Mountain [Official name of feature (U.S. Geological Survey, 1970)] and SP flow (and vicinity) in north-central Arizona were obtained in diverse viewing directions and direct and cross-polarization, then compared with surface and aerial photography, LANDSAT multispectral scanner data, airborne thermal infrared imagery, surface geology, and surface roughness statistics. The extremely blocky, basaltic andesite of SP flow is significantly brighter on direct-polarization K-band (0.9-cm wavelength) images than on cross-polarized images taken simultaneously. Conversely, for the longer wavelength (25 cm) L-band radar images, the cross-polarization image returns from SP flow are brighter than the direct-polarized image. This effect is explained by multiple scattering and the strong wavelength dependence of polarization effects caused by the rectilinear basaltic andesite scatters. Two distinct types of surface relief on SP flow, one extremely blocky, the other subdued, are found to be clearly discriminated on the visible and thermal wavelength images but are separable only on the longer wavelength L-band radar image data. The inability of the K- and X- (3-cm wavelength) band radars to portray the differences in roughness between the two SP flow surface units is attributed to the radar frequency dependence of the surface-relief scale, which, described as the Rayleigh criterion, represents the transition between quasispecular and primarily diffuse backscatter. ?? 1980.

  17. Impact of serum SP-A and SP-D levels on comparison and prognosis of idiopathic pulmonary fibrosis (United States)

    Wang, Kai; Ju, Qing; Cao, Jing; Tang, Wenze; Zhang, Jian


    Abstract Background and objective: Idiopathic pulmonary fibrosis (IPF) has a poor prognosis in general; however, it is heterogeneous to detect relative biomarkers for predicting the disease progression. Serum biomarkers can be conveniently collected to detect and help to differentially diagnose IPF and predict IPF prognosis. This meta-analysis aimed to evaluate the use of serum surfactant proteins A and D (SP-A and SP-D) for differential diagnosis and prognosis of IPF. Methods: Relevant articles were searched in PubMed, Embase, and Chinese National Knowledge Infrastructure databases and reviewed by 2 independent readers. Standard mean difference (SMD) and 95% confidence interval (CI) were calculated to assess the difference in serum levels of SP-A/D among patients with IPF, when compared to patients with non-IPF interstitial lung disease (ILD), pulmonary infection, and healthy control. Hazard ratio (HR) and 95% CI were used to compare the relative risk of mortality. Results: Twenty-one articles (totalling 1289 IPF patients) were included in final meta-analysis. Serum SP-A levels were significantly higher in patients with IPF than in patients with non-IPF ILD (SMD: 1.108 [0.584, 1.632], P infection (SMD: 1.320 [0.999, 1.640], P SMD: 2.802 [1.901, 3.702], P SMD: 0.459 [−0.000, 0.919], P = .050). Serum SP-D levels were significantly higher in patients with IPF than in patients with pulmonary infection (SMD: 1.308 [0.813, 1.803], P SMD: 2.235 [1.739, 2.731], P < .001). Risk of death in patients with IPF and elevated serum SP-A was increased 39% compared to patients with low SP-A groups. Elevated SP-D increased risk by 111% when compared to low SP-D. In acute exacerbation of IPF, serum SP-A/D were higher than those in stable stage. The comparisons and prognosis might be different in Asian and Caucasian patients. Conclusions: Serum SP-A/D detection might be useful for differential diagnosis and prediction of survival in patients with IPF. PMID:28591049

  18. The SpTransformer Gene Family (Formerly Sp185/333) in the Purple Sea Urchin and the Functional Diversity of the Anti-Pathogen rSpTransformer-E1 Protein (United States)

    Smith, L. Courtney; Lun, Cheng Man


    The complex innate immune system of sea urchins is underpinned by several multigene families including the SpTransformer family (SpTrf; formerly Sp185/333) with estimates of ~50 members, although the family size is likely variable among individuals of Strongylocentrotus purpuratus. The genes are small with similar structure, are tightly clustered, and have several types of repeats in the second of two exons and that surround each gene. The density of repeats suggests that the genes are positioned within regions of genomic instability, which may be required to drive sequence diversification. The second exon encodes the mature protein and is composed of blocks of sequence called elements that are present in mosaics of defined element patterns and are the major source of sequence diversity. The SpTrf genes respond swiftly to immune challenge, but only a single gene is expressed per phagocyte. Many of the mRNAs appear to be edited and encode proteins with altered and/or missense sequence that are often truncated, of which some may be functional. The standard SpTrf protein structure is an N-terminal glycine-rich region, a central RGD motif, a histidine-rich region, and a C-terminal region. Function is predicted from a recombinant protein, rSpTransformer-E1 (rSpTrf-E1), which binds to Vibrio and Saccharomyces, but not to Bacillus, and binds tightly to lipopolysaccharide, β-1,3-glucan, and flagellin, but not to peptidoglycan. rSpTrf-E1 is intrinsically disordered but transforms to α helical structure in the presence of binding targets including lipopolysaccharide, which may underpin the characteristics of binding to multiple targets. SpTrf proteins associate with coelomocyte membranes, and rSpTrf-E1 binds specifically to phosphatidic acid (PA). When rSpTrf-E1 is bound to PA in liposome membranes, it induces morphological changes in liposomes that correlate with PA clustering and leakage of luminal contents, and it extracts or removes PA from the bilayer. The

  19. Taxonomy Icon Data: Synechocystis sp.PCC 6803 [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available Synechocystis sp.PCC 6803 Synechocystis sp.PCC 6803 Synechocystis_sp_PCC_6803_L.png Synecho...cystis_sp_PCC_6803_NL.png Synechocystis_sp_PCC_6803_S.png Synechocystis_sp_PCC_6803_NS.png

  20. Gilliamella intestini sp. nov., Gilliamella bombicola sp. nov., Gilliamella bombi sp. nov. and Gilliamella mensalis sp. nov.: Four novel Gilliamella species isolated from the bumblebee gut. (United States)

    Praet, Jessy; Cnockaert, Margo; Meeus, Ivan; Smagghe, Guy; Vandamme, Peter


    Spectra of five isolates (LMG 28358 T , LMG 29879 T , LMG 29880 T , LMG 28359 T and R-53705) obtained from gut samples of wild bumblebees of Bombus pascuorum, Bombus lapidarius and Bombus terrestris were grouped into four MALDI-TOF MS clusters. RAPD analysis revealed an identical DNA fingerprint for LMG 28359 T and R-53705 which also grouped in the same MALDI-TOF MS cluster, while different DNA fingerprints were obtained for the other isolates. Comparative 16S rRNA gene sequence analysis of the four different strains identified Gilliamella apicola NCIMB 14804 T as nearest neighbour species. Average nucleotide identity values of draft genome sequences of the four isolates and of G. apicola NCIMB 14804 T were below the 96% threshold value for species delineation and all four strains and G. apicola NCIMB 14804 T were phenotypically distinct. Together, the draft genome sequences and phylogenetic and phenotypic data indicate that the four strains represent four novel Gilliamella species for which we propose the names Gilliamella intestini sp. nov., with LMG 28358 T as the type strain, Gilliamella bombicola sp. nov., with LMG 28359 T as the type strain, Gilliamella bombi sp. nov., with LMG 29879 T as the type strain and Gilliamella mensalis sp. nov., with LMG 29880 T as the type strain. Copyright © 2017 Elsevier GmbH. All rights reserved.


    Directory of Open Access Journals (Sweden)



    Full Text Available Streptomyces sp was conducted from December 2010 - June 2011 at the Laboratoryof Microbiology, Biology Department, Math and Science Faculty, UdayanaUniversity Bukit Jimbaran-Bali. Implementation stages of the research consisted ofisolation and testing of the antibiotic activity Streptomyces sp to inhibit growthbacterial pathogens Erwinia sp as a cause of disease in plants fallen foul (Soft rot ofAloe barbadensis Mill.The results of this study have eight isolates of Streptomyces spwith macroscopic and microscopic characters are varied. Furthermore, all isolateswere obtained and then tested against antibiotic activity to inhibit growth the bacteriaErwinia sp. Test results obtained by Streptomyces sp that has the most effective ininhibiting the ability of the bacteria Erwinia sp isolates are Streptomyces sp2for (45%.

  2. Rhodotorula rosulata sp. nov., Rhodotorula silvestris sp. nov. and Rhodotorula straminea sp. nov., novel myo-inositol-assimilating yeast species in the Microbotryomycetes. (United States)

    Golubev, Wladyslav I; Scorzetti, Gloria


    Three novel species are described as Rhodotorula rosulata sp. nov. (type strain VKM Y-2962(T) =CBS 10977(T)), Rhodotorula silvestris sp. nov. (type strain VKM Y-2971(T) =CBS 11420(T)) and Rhodotorula straminea sp. nov. (type strain VKM Y-2964(T) =CBS 10976(T)) based on the study of eight isolates from needle litter. The new species, phylogenetically located within the Microbotryomycetes, are related to glucuronate-assimilating species of the genus Rhodotorula. Sequencing of the D1/D2 domains of the LSU rDNA gene and the internal transcribed spacer (ITS) region, as well as physiological characterization, revealed their distinct taxonomic positions.

  3. Borrelia bissettiae sp. nov. and Borrelia californiensis sp. nov. prevail in diverse enzootic transmission cycles. (United States)

    Margos, Gabriele; Lane, Robert S; Fedorova, Natalia; Koloczek, Johannes; Piesman, Joseph; Hojgaard, Andrias; Sing, Andreas; Fingerle, Volker


    Two species of the genus Borrelia , Borrelia bissettiae sp. nov. and Borrelia californiensis sp. nov., were first described by Postic and co-workers on the basis of genetic analyses of several loci. Multilocus sequence analysis of eight housekeeping loci confirmed that these two Borrelia genomospecies are distinct members of the Borrelia burgdorferi sensu lato complex. B. bissettiae sp. nov. was initially described in transmission cycles involving Neotoma fuscipes wood rats and Ixodes pacificus ticks in California, and Neotoma mexicana and Ixodes spinipalpis in Colorado. The preferred host of B. californiensis sp. nov. appears to be the California kangaroo rat, Dipodomys californicus ; Ixodes jellisoni , I. spinipalipis and I. pacificus ticks are naturally infected with it. Thus, the ecological associations of the two genomospecies and their genetic distance from all other known Borrelia genomospecies species justify their description as separate genomospecies: B. bissettiae sp. nov. (type strain DN127 T  = DSM 17990 T  =  CIP 109136 T ) and B. californiensis (type strain CA446 T  = DSM 17989 T  = ATCC BAA-2689 T ).

  4. Pengaruh Perbedaan Konsentrasi Ekstrak Sargassum sp. dan Lama Penyimpanan terhadap Oksidasi Lemak pada Fillet Ikan Patin (Pangasius sp.

    Directory of Open Access Journals (Sweden)

    Fatin Hidayati


    Full Text Available ABSTRAK Ikan patin merupakan ikan air tawar yang mengandung lemak dan protein tinggi sehingga apabila dilakukan penyimpanan rentan terjadi oksidasi yang mengakibatkan ketengikan. Sargassum sp. dengan kandungan fenol dan flavonoid mampu menghambat terjadinya oksidasi pada fillet ikan patin. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan ekstrak Sargassum sp. dan lama penyimpanan dalam menghambat terjadinya oksidasi pada fillet ikan patin. Materi yang digunakan dalam penelitian ini adalah ekstrak Sargassum sp. dan fillet ikan patin. Metode penelitian yang digunakan adalah experimental laboratories dengan menggunakan Rancangan Acak Lengkap (RAL faktorial dengan 2 faktor yaitu konsentrasi ekstrak Sargassum sp. (0%, 1%, 1,5% dan 2% dan lama penyimpanan (hari ke-0, hari ke-2, hari ke-4, dan hari ke-6. Hasil penelitian menunjukkan bahwa perbedaan penambahan konsentrasi ekstrak Sargassum sp. dan lama penyimpanan memberikan pengaruh nyata terhadap nilai PV, nilai TBA, kadar lemak, kadar protein, kadar air serta organoleptik (P < 0,05. Hasil penelitian tahap I didapatkan rendemen Sargassum sp. dengan pelarut etanol 96% sebesar 1,39%, kandungan fenol 1,813%, flavonoid 0,278% dan aktivitas antioksidan 99,1659 ppm (kuat. Hasil penelitian tahap II didapatkan nilai PV berkisar antara 2,03 - 19,82 meq/kg, nilai TBA 0,63 - 6,72 mg.mal/kg. Konsentrasi 1,5% merupakan konsentrasi terbaik ekstrak Sargassum sp. dalam menghambat oksidasi lemak pada fillet ikan patin selama penyimpanan. Kata kunci: Antioksidan, Ekstrak Sargassum sp., Lama Penyimpanan, Oksidasi lemak, Fillet Ikan patin ABSTRACT Catfish is a freshwater fish that contain high fat and protein so that if its stored it will susceptible to oxidation process which leads to rancidity. Sargassum sp. with its phenolic and flavonoid content are able to inhibit the oxidation process in catfish fillet. This research was aimed to know the effects of different concentrations of Sargassum sp. extracts and

  5. Scalability of Parallel Spatial Direct Numerical Simulations on Intel Hypercube and IBM SP1 and SP2 (United States)

    Joslin, Ronald D.; Hanebutte, Ulf R.; Zubair, Mohammad


    The implementation and performance of a parallel spatial direct numerical simulation (PSDNS) approach on the Intel iPSC/860 hypercube and IBM SP1 and SP2 parallel computers is documented. Spatially evolving disturbances associated with the laminar-to-turbulent transition in boundary-layer flows are computed with the PSDNS code. The feasibility of using the PSDNS to perform transition studies on these computers is examined. The results indicate that PSDNS approach can effectively be parallelized on a distributed-memory parallel machine by remapping the distributed data structure during the course of the calculation. Scalability information is provided to estimate computational costs to match the actual costs relative to changes in the number of grid points. By increasing the number of processors, slower than linear speedups are achieved with optimized (machine-dependent library) routines. This slower than linear speedup results because the computational cost is dominated by FFT routine, which yields less than ideal speedups. By using appropriate compile options and optimized library routines on the SP1, the serial code achieves 52-56 M ops on a single node of the SP1 (45 percent of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a "real world" simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP supercomputer. For the same simulation, 32-nodes of the SP1 and SP2 are required to reach the performance of a Cray C-90. A 32 node SP1 (SP2) configuration is 2.9 (4.6) times faster than a Cray Y/MP for this simulation, while the hypercube is roughly 2 times slower than the Y/MP for this application. KEY WORDS: Spatial direct numerical simulations; incompressible viscous flows; spectral methods; finite differences; parallel computing.

  6. A sp2+sp3 hybridized carbon allotrope transformed from AB stacking graphyne and THD-graphene

    Directory of Open Access Journals (Sweden)

    Yu Zhang


    Full Text Available New carbon allotropes can be designed by combining sp, sp2 and sp3 three hybridization states. And the hybridization states or coordination numbers of carbon atoms can be changed by applying high pressure on carbon materials. In this study, a common high pressure phase (named as TBBC transformed from AB-stacking graphyne or THD-graphene is predicted. Its kinetic stability is examined using finite displacement method. We find that the sp2 and sp3 hybridized carbon atoms behave different vibration features at high frequency region. Both graphene-like and diamond-like vibration peaks occurs. Phase transition energy barriers from both graphyne and THD-graphene to TBBC are estimated. Electronic structure calculations show that the TBBC is an indirect semiconductor with a bandgap of 0.66 eV. The ideal tensile strength of TBBC is high in [0001] and [11¯00] directions, but is weak along [12¯10] direction.

  7. Biosorption characteristics of copper (II), chromium (III), nickel (II), and lead (II) from aqueous solutions by Chara sp. and Cladophora sp. (United States)

    Elmaci, Ayşe; Yonar, Taner; Ozengin, Nihan


    The aim of this research was to expose individual removals of copper, chromium, nickel, and lead from aqueous solutions via biosorption using nonliving algae species, Chara sp. and Cladophora sp. Optimum pH values for biosorption of copper (II), chromium (III), nickel (II), and lead (II) from aqueous solutions were determined to be 6, 7, 7, and 3 for Cladophora sp. and 5, 3, 5, and 4 for Chara sp. respectively. Maximum adsorption capacities of Chara sp. [10.54 for chromium (III) and 61.72 for lead (II)] and Cladophora sp. [6.59 for chromium (III) and 16.75 and 23.25 for lead (II)] for chromium (III) and lead (II) are similar. On the other hand, copper (II) and nickel (II) biosorption capacity of Cladophora sp. [14.28 for copper (II) and 16.75 for nickel (II)] is greater than Chara sp. [6.506 for copper (II) and 11.76 for nickel (II)]. Significantly high correlation coefficients indicated for the Langmuir adsorption isotherm models can be used to describe the equilibrium behavior of copper, chromium, nickel, and lead adsorption onto Cladophora sp. and Chara sp.

  8. Formulation of a minimal nutritional medium for enhanced lipid productivity in Chlorella sp. and Botryococcus sp. using response surface methodology. (United States)

    Vishwakarma, Rashi; Dhar, Dolly Wattal; Pabbi, Sunil


    Chlorella sp. MCC 7 and Botryococcus sp. MCC 31 were investigated to enable large-scale biodiesel production from minimal constituents in the growth medium. Response surface methodology (RSM) was used to maximise the biomass productivity and lipid yield using only nitrogen (N), phosphorus (P) and potassium (K) as urea, single super phosphate and muriate of potash. The optimum values were 0.42 g/L nitrogen; 0.14 g/L phosphorus and 0.22 g/L potassium for Chlorella sp.; and 0.46 g/L; 0.14 g/L and 0.25 g/L for Botryococcus sp. Lipid yield of 42% for Chlorella sp. and 52% in Botryococcus sp. was observed. An enhancement in lipid yield by approximately 55% for Chlorella sp. and 73% for Botryococcus sp. was registered as compared to original nutrient medium. Fourier transform infrared (FTIR) analysis of extracted lipids revealed characteristic bands for triglycerides. This study provided utilisation of a practicable nutrient recipe in the form of N, P, K input for enhanced lipid yield from the selected microalgal strains.

  9. Effect of garlic solution to Bacillus sp. removal (United States)

    Zainol, N.; Rahim, S. R.


    Biofilm is a microbial derived sessile community characterized by cells that are irreversibly attached to a substratum or interface to each other, embedded in a matrix of extracellular polymeric substances that they have produced. Bacillus sp. was used as biofilm model in this study. The purpose of this study is to determine the effect of Garlic solution in term of ratio of water and Garlic solution (W/G) and ratio of Garlic solution to Bacillus sp. (GS/B) on Bacillus sp removal. Garlic solution was used to remove Bacillus sp. In this study, Garlic solution was prepared by crushing the garlic and mixed it with water. the Garlic solution was added into Bacillus sp. mixture and mixed well. The mixture then was spread on nutrient agar. The Bacillus sp. weight on agar plate was measured by using dry weight measurement method. In this study, initially Garlic solution volume and Garlic solution concentration were studied using one factor at time (OFAT). Later two-level-factorial analysis was done to determine the most contributing factor in Bacillus sp. removal. Design Expert software (Version 7) was used to construct experimental table where all the factors were randomized. Bacilus sp removal was ranging between 42.13% to 99.6%. The analysis of the results showed that at W/G of 1:1, Bacillus sp. removal increased when more Garlic solution was added to Bacillus sp. Effect of Garlic solution to Bacillus sp. will be understood which in turn may be beneficial for the industrial purpose.

  10. Streptomyces sp. Sebagai Biofungisida Patogen Fusarium oxysporum (Schlecht. f.sp. lycopersici (Sacc. Snyd. et Hans. Penyebab Penyakit Layu Pada Tanaman Tomat (Solanum lycopersicum L.

    Directory of Open Access Journals (Sweden)



    Full Text Available A research was conducted to isolate Streptomyces sp. of soil Udayana University campus in theBukit-Jimbaran, to obtain the most effective Streptomyces sp. which is effective in inhibit the growth ofFusarium oxysporum f.sp. lycopersici, and to test response of tomato plants with Streptomyces sp.culture against Fusarium wilt desease. Implementation phases of the research consisted of isolation andidentification of Streptomyces sp, test the inhibition against F. oxysporum f.sp. lycopersici, and in vivotest used by dyeing the roots of the tomato plant (Solanum lycopersicum with Fusarium spores andafter 30 seconds the roots were dyeing Streptomyces culture. Furthermore, sterile soil in polybagwatered by Fusarium spores and Streptomyces culture at the same time. Based on morphologicalcharacteristic it found five isolates of Streptomyces sp.. The antagonist test showed Streptomyces sp.1 had ability (75% against Fusarium, Streptomyces sp 2 (68,3%, Streptomyces sp. 3 (71,6%,Streptomyces sp. 4 (63,3%, and Streptomyces sp. 5 (21,6%. All Streptomyces suppressed thegrowth of Fusarium on tomato plants in glass house (p<0,05. Streptomyces sp.3 suppressed Fusariumwilt disease in tomato from 88% in control to 20%.

  11. Elevated expression and potential roles of human Sp5, a member of Sp transcription factor family, in human cancers

    International Nuclear Information System (INIS)

    Chen Yongxin; Guo Yingqiu; Ge Xijin; Itoh, Hirotaka; Watanabe, Akira; Fujiwara, Takeshi; Kodama, Tatsuhiko; Aburatani, Hiroyuki


    In this report, we describe the expression and function of human Sp5, a member of the Sp family of zinc finger transcription factors. Like other family members, the Sp5 protein contains a Cys2His2 zinc finger DNA binding domain at the C-terminus. Our experiments employing Gal4-Sp5 fusion proteins reveal multiple transcriptional domains, including a N-terminal activity domain, an intrinsic repressive element, and a C-terminal synergistic domain. Elevated expression of Sp5 was noted in several human tumors including hepatocellular carcinoma, gastric cancer, and colon cancer. To study the effects of the Sp5 protein on growth properties of human cancer cells and facilitate the identification of its downstream genes, we combined an inducible gene expression system with microarray analysis to screen for its transcriptional targets. Transfer of Sp5 into MCF-7 cells that expressed no detectable endogenous Sp5 protein elicited significant growth promotion activity. Several of the constitutively deregulated genes have been associated with tumorigenesis (CDC25C, CEACAM6, TMPRSS2, XBP1, MYBL1, ABHD2, and CXCL12) and Wnt/β-Catenin signaling pathways (BAMBI, SIX1, IGFBP5, AES, and p21 WAF1 ). This information could be utilized for further mechanistic research and for devising optimized therapeutic strategies against human cancers

  12. Wnt-mediated down-regulation of Sp1 target genes by a transcriptional repressor Sp5

    Czech Academy of Sciences Publication Activity Database

    Fujimura, Naoko; Vacík, Tomáš; Machoň, Ondřej; Vlček, Čestmír; Scalabrin, S.; Speth, M.; Diep, D.; Krauss, S.; Kozmik, Zbyněk


    Roč. 282, č. 2 (2007), s. 1225-1237 ISSN 0021-9258 Institutional research plan: CEZ:AV0Z50520514 Keywords : Wnt -mediated signaling * Sp5 transcription factor * Sp1 target genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.581, year: 2007

  13. The Role of S P2, SP3 AND SP4 in The Transcriptional Regulation of The Promoter of Nuclear Encoded Mitochondrial Genes

    International Nuclear Information System (INIS)

    Zaid, A.; Salem, Gh.


    The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.

  14. Evaluation of antioxidant and cytotoxic properties of Cynobacteria, Limnothrix sp. and Leptolyngbya sp. from Arabian sea

    Digital Repository Service at National Institute of Oceanography (India)

    Anas, A.; Vinothkumar, S.; Gupta, S.; Jasmin, C.; Joseph, V.; Parameswaran, P.S.; Nair, S.

    The hexane fractions of the marine cyanobacteria: Leptolyngbya sp. and Limnothrix sp., collected from Arabian Sea were found to display promising antioxidant properties than their ethyl acetate fraction during radical scavenging ABTS/DPPH assays (IC...

  15. Progress in SP-100 tribological coatings

    International Nuclear Information System (INIS)

    Ring, P.J.; Roy, P.; Schuster, G.B.; Busboom, H.J.


    The SP-100 reactor will operate at temperatures up to 1500K in high vacuum. To address the SP-100 needs, a tribology development program has been established at GE to investigate candidate coating materials. Materials were selected based on their high thermodynamic stability, high melting point, compatibility with the substrate, and coefficients of thermal expansion similar to niobium-1% zirconium-the candidate structural material for SP-100. An additional requirement was that the deposition processes should be commercially available to coat large components. This paper presents the details regarding the SP-100 Tribology Development Program including background information, specific bearing requirements, basis for coating material selection, testing methods and the initial results covering the early years of this program

  16. Increased constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. and a decrease in microflora diversity may be indicators of ventilator-associated pneumonia: a prospective study in the respiratory tracts of neonates.

    Directory of Open Access Journals (Sweden)

    Wei Lu

    Full Text Available Ventilator-associated pneumonia (VAP is a common complication and cause of death in neonates on mechanical ventilation. However, it is difficult to define the causes of VAP. To understand the causes of VAP, we undertook a prospective study based on the diversity of the microflora in VAP. The experimental group consisted of newborns who suffered from respiratory distress syndrome (RDS and VAP, while the control group suffered from RDS without VAP. Sputa were collected within 1, 3, and 5 days of ventilation and were divided into six groups. DNA was extracted from the samples, and the 16S rDNA was PCR amplified, separated using denaturing gradient gel electrophoresis (DGGE, cloned and sequenced. The resulting sequences were compared using BLAST. The DGGE pictures were measured, and the richness, Shannon-Wiener index, and cluster maps were analyzed. No differences were found regarding the constituent ratio of any genus between the Non-VAP and VAP group within 1 day after intubation. After 1 to 3 days, the constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. in the VAP group were higher than those in the Non-VAP group, and the ratios of Serratia sp. and Achromobacter sp. were lower. After 3 to 5 days, the ratios of Klebsiella sp., Acinetobacter sp., Serratia sp., and Achromobacter sp. were lower than those in the Non-VAP group. The richness and Shannon-Wiener index of the Non-VAP group were higher than those of the VAP group from 1 to 3 days after intubation, while no differences were found within 1 day and from 3 to 5 days. We conclude that during the first three days of intubation, the microflora diversity in the lower respiratory tract was reduced due to VAP, and the greater constituent ratios of Klebsiella sp., Acinetobacter sp., and Streptococcus sp. in the sputum may be indicators of VAP.

  17. Integrative Gene Cloning and Expression System for Streptomyces sp. US 24 and Streptomyces sp. TN 58 Bioactive Molecule Producing Strains

    Directory of Open Access Journals (Sweden)

    Samiha Sioud


    Full Text Available Streptomyces sp. US 24 and Streptomyces sp. TN 58, two strains producing interesting bioactive molecules, were successfully transformed using E. coli ET12567 (pUZ8002, as a conjugal donor, carrying the integrative plasmid pSET152. For the Streptomyces sp. US 24 strain, two copies of this plasmid were tandemly integrated in the chromosome, whereas for Streptomyces sp. TN 58, the integration was in single copy at the attB site. Plasmid pSET152 was inherited every time for all analysed Streptomyces sp. US 24 and Streptomyces sp. TN 58 exconjugants under nonselective conditions. The growth, morphological differentiation, and active molecules production of all studied pSET152 integrated exconjugants were identical to those of wild type strains. Consequently, conjugal transfer using pSET152 integration system is a suitable means of genes transfer and expression for both studied strains. To validate the above gene transfer system, the glucose isomerase gene (xylA from Streptomyces sp. SK was expressed in strain Streptomyces sp. TN 58. Obtained results indicated that heterologous glucose isomerase could be expressed and folded effectively. Glucose isomerase activity of the constructed TN 58 recombinant strain is of about eighteenfold higher than that of the Streptomyces sp. SK strain. Such results are certainly of importance due to the potential use of improved strains in biotechnological process for the production of high-fructose syrup from starch.

  18. Nanocrystalline sp{sup 2} and sp{sup 3} carbons: CVD synthesis and applications

    Energy Technology Data Exchange (ETDEWEB)

    Terranova, M. L. [Università degli Studi di Roma “Tor Vergata,” via Della Ricerca Scientifica, Dipartimento di Scienze e Tecnologie Chimiche—MinimaLab (Italy); Rossi, M. [Università degli Studi di Roma “Sapienza,” via A. Scarpa, Dipartimento di Scienze di Base e Applicate per l’Ingegneria and Centro di Ricerca per le Nanotecnologie Applicate all’Ingegneria (CNIS) (Italy); Tamburri, E., E-mail: [Università degli Studi di Roma “Tor Vergata,” via Della Ricerca Scientifica, Dipartimento di Scienze e Tecnologie Chimiche—MinimaLab (Italy)


    The design and production of innovative materials based on nanocrystalline sp{sup 2}- and sp{sup 3}-coordinated carbons is presently a focus of the scientific community. We present a review of the nanostructures obtained in our labs using a series of synthetic routes, which make use of chemical vapor deposition (CVD) techniques for the selective production of non-planar graphitic nanostructures, nanocrystalline diamonds, and hybrid two-phase nanostructures.

  19. Structural Analysis of Planar sp3 and sp2 Films: Diamond-Like Carbon and Graphene Overlayers

    KAUST Repository

    Mansour, Ahmed


    pure sp2 as in graphene, carbon nanotubes and fullerenes, to pure sp3 as in diamond. Amorphous and diamond-like carbon consists of a mixture of both hybridizations. This variation in hybridization in carbon materials enables a wide spectrum

  20. Dominancy of Trichodesmium sp. in the Biawak Island (United States)

    Prihadi, D. J.


    The Biawak Island is one of the small islands in West Java Province with an abundance of marine biological resources. This research was conducted to collect the primary producer zooplankton and water quality parameters. Direct observation is done by field surveys and measurement in situ for plankton and environmental parameters such as temperature, water transparency, water current, salinity, dissolved oxygen, and pH. Trichodesmium sp. was found dominance in where some other types of zooplankton were found in the area, like Scenedesmus sp., Sagitta sp., Acartia sp. also occurred. Further, the most abundance of Trichodesmium sp. was found in southern of Biawak Island where mangroves, coral and seagrass ecosystem provide nutrients which indirectly support the abundance of planktons. Trichodesmium sp. is plankton that can survive in water with minimum nutrient.

  1. Characterization and Optimization of Bioflocculant Exopolysaccharide Production by Cyanobacteria Nostoc sp. BTA97 and Anabaena sp. BTA990 in Culture Conditions. (United States)

    Tiwari, Onkar Nath; Khangembam, Romi; Shamjetshabam, Minerva; Sharma, Aribam Subhalaxmi; Oinam, Gunapati; Brand, Jerry J


    Bioflocculant exopolysaccharide (EPS) production by 40 cyanobacterial strains during their photoautotrophic growth was investigated. Highest levels of EPS were produced by Nostoc sp. BTA97 and Anabaena sp. BTA990. EPS production was maximum during stationary growth phase, when nitrogenase activity was very low. Maximum EPS production occurred at pH 8.0 in the absence of any combined nitrogen source. The cyanobacterial EPS consisted of soluble protein and polysaccharide that included substantial amounts of neutral sugars and uronic acid. The EPS isolated from Anabaena sp. BTA990 and Nostoc sp. BTA97 demonstrated high flocculation capacity. There was a positive correlation between uronic acid content and flocculation activity. The flocculant bound a cationic dye, Alcian Blue, indicating it to be polyanionic. The 16S rRNA gene sequences for Nostoc sp. BTA97 and Anabaena sp. BTA990 were deposited at NCBI GenBank, and accession numbers were obtained as KJ830951 and KJ830948, respectively. The results of these experiments indicate that strains Anabaena sp. BTA990 and Nostoc sp. BTA97 are good candidates for the commercial production of EPS and might be utilized in industrial applications as an alternative to synthetic and abiotic flocculants.

  2. Two new species of suctorians, Acineta satyanandani sp. nov. and Paracineta karunakarani sp. nov. epizoic on ostracods

    Digital Repository Service at National Institute of Oceanography (India)

    Santhakumari, V.

    Two, species of protozoic suctorians, Acineta satyanandani sp. nov. and Paracineta karunakarani sp. nov., are described. These were found attached on the body of the marine ostracod, Cypridina dentata (Muller), collected from the shelf and slope...

  3. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J


    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  4. Enkapsulasi B. bassiana menggunakan maizena dan daya infeksinya terhadap larva Aedes aegypti, Anopheles sp., Culex sp.

    Directory of Open Access Journals (Sweden)

    Mutiara Widawati


    Full Text Available Abstract. Encapsulation formulae of mycoinsecticide have to be able to maintain fungus viability and pathogenicity. This mycoinsecticide was developed as an alternative way to control mosquito borne disease. The aim of this study was to encapsulate Beauveria bassiana as viable storage and have the capability to kill larvae of Aedes aegypti, Anopheles sp. and Culex sp. Mosquito larvae obtained from laboratory reared at health research laboratory; Loka Litbang P2B2 Ciamis. The treatments made in this study were the formu-lation of cornstarch and controls for comparison. This study showed potential formulation of cornstarch encapsulation as a biolarvacidal. Cornstarch formulations proven to be succeed in maintaining fungus viability, however, the pathogenicity of the microcapsule still not effective to kill Aedes, Culex and Anopheles larvae. Keywords: encapsulation, Beauveria bassiana, Ae.aegypti, Anopheles sp., Culex sp. Abstrak. Pembuatan formula bioinsektisida yang optimal sebagai salah satu alternatif untuk pengen-dalian nyamuk vektor perlu di kembangkan. Sediaan mikoinsektisida yang dibuat harus dapat memper-tahankan viabilitas jamur B. bassiana sehingga masih efektif pada saat penggunaannya. Salah satu cara yang digunakan untuk menjaga kestabilan sediaan mikoinsektisida yang berdampak langsung pada via-bilitas jamur adalah dengan menerapkan metode enkapsulasi. Penelitian ini bertujuan untuk meng-hasilkan sediaan mikokapsul dari Beauvaria bassiana melalui proses enkapsulasi menggunakan maizena yang memiliki kapabilitas tinggi sebagai penyimpan B. bassiana dan efektif dalam membunuh larva dan telur Aedes aegypti, Anopheles sp. dan Culex sp. Semua larva uji berasal dari insektarium laboratorium penelitian kesehatan Loka litbang P2B2 Ciamis. Pembuatan enkapsulasi dimulai dengan kultur dan pema-nenan B. bassiana, uji viabilitas, proses enkapsulasi serta uji larvasida di laboratorium. Uji dilakukan dengan satu perlakuan dan satu kontrol untuk

  5. Effectivity of the Earthworms Pheretima hupiensis, Eudrellus sp. and Lumbricus sp. on the Organic Matter Decomposition Process

    Directory of Open Access Journals (Sweden)

    Ea Kosman Anwar


    Full Text Available The earthworms are the one of soil fauna component in soil ecosystem have an important role in organic matter decomposition procces. The earthworm feed plant leaf and plant matter up to apart and dissolved. Earthworm metabolisms produce like faeces that mixed with decomposed organic matter mean vermicompost. The vermicompost fertility varies because of some kind of earthworm differ in “niche” and attitude. The experiment was to study the effectivity of earthworm on organic matter decomposition which has been conducted in Soil Biological and Healthy Laboratory and Green House of Soil Research Institute Bogor, during 2006 Budget Year. The three kind of earthworms i.e Pheretima hupiensis, Lumbricus sp. and Eudrellus sp. combined with three kind of organic matter sources i.e rice straw, trash and palm oil plant waste (compost heap. The result shows that the Lumbricus sp. are the most effective decomposer compared to Pheretima hupiensis and Eudrellus sp. and the organic matter decomposed by Lumbricus sp. as followed: market waste was decomposed of 100%, palm oil empty fruit bunch (compost heap 95.8 % and rice straw 84.9%, respectively. Earthworm effectively decreased Fe, Al, Mn, Cu dan Zn.


    Directory of Open Access Journals (Sweden)

    Isriyanti Affifah


    Full Text Available Korosi atau perkaratan logam merupakan proses oksidasi suatu logam dengan udara atau elektrolit. Udara atau elektrolit tersebut akan mengalami reduksi, sehingga proses korosi merupakan proses elektrokimia. Pada penelitian sebelumnya diketahui bahwa korosi yang disebabkan mikroorganisme pengoksidasi besi (Thiobacillus ferooxidans memiliki peranan yang cukup signifikan terhadap kerugian ekonomi bagi industri. Lapisan biofilm yang dihasilkan mikroorganisme pada permukaan logam dapat mengubah karakteristik elektrokimia permukaan logam tersebut dan dapat menginduksi terjadinya korosi. Untuk mengatasi masalah tersebut, pada penelitian ini dilakukan ekstraksi Sargassum sp. dan Gracilaria sp. yang diduga efektif menginhibisi pertumbuhan mikroba pengoksidasi besi (Thibacillus ferooxidans yang biasanya terdapat di bangunan bawah laut. Hasil ekstraksi Sargassum sp. dan Gracilaria sp. menggunakan pelarut metanol-kloroform (1:1 memberikan yield terhadap berat basah sebesar 44,5% dan 36,5%. Ekstrak tersebut diuji bioaktivitasnya terhadap pertumbuhan T. ferooxidans secara kualitatif (kasat mata dan kuantitatif (metode weight-loss. Melalui kurva pertumbuhan diketahui bahwa T. ferooxidans mampu tumbuh sampai hari ke-7 dan mengalami fasa stasioner pada hari ke-8. Analisis metode weight-loss dilakukan menggunakan coupon dengan luas permukaan 3,6 cm2. Hasil analisis menunjukkan bahwa ekstrak Gracilaria sp mampu menginhibisi 29,3% lebih efektif daripada biocide komersial.

  7. Botanical pesticides effect from shells of bean’s cashew nut on biological agents of trichoderma sp. and gliocladium sp. (United States)

    Bande, L. O. S.; Mariadi; Gusnawaty, HS; Nuriadi; Trisulpa, L.; Rahmania


    A shell of cashew nut (Anacardium occidentanle) has contained Cashew Nut Shell Liquid (CNSL) that is used as botanical pesticides. CNSL oil consists of active substance such as anacardat acid, cardol and cardanol. Utilization of the pesticides from shells of cashew nut to control pests and diseases of plants would be affected on biological agents. The objective of this research was to investigate pesticides inhibition on the increase of mycelium Trichoderma sp. and Gliocladium sp. by in vitro method. The tested concentration sample consisted of 0.0% (control), 2.5%, 7.5% and 10.0% in PDA media. The results of this research showed that 2.5% botanical pesticides concentration could minimize mycelium of Trichoderma sp. and Gliocladium sp. 22.73% and 21.04% respectively and also the increase shells of cashew extract could be affected the increase of mycelium inhibition. The extract with 2.5% concentration was the recommended concentration to control of fruit rot diseases and if concentration was 10.0% then its inhibition become 54.98% and 49.35%, respectively. The results proved that uncontrolled utilization of the pesticides could be affected on decrease of Trichoderma sp. and Gliocladium sp. growth.

  8. Biosorption of chromium by mangrove-derived Aplanochytrium sp ...

    African Journals Online (AJOL)

    The microbial dried biomass of Thraustochytrids is used as bioadsorbent for the removal of the chromium in aqueous solution. In this investigation, three species of Thraustochydrids namely Aplanochytrium sp., Thraustochytrium sp. and Schizochytrium sp. were tested for the efficiency of chromium accumulation by culturing ...

  9. Trichoderma sp. dalam Pengendalian Penyakit Layu Fusarium pada Tanaman Tomat


    Novita, Trias


    Penelitian ini bertujuan untuk mengetahui peran Trichoderma sp dalam pengendalianpenyakit layu fusarium pada tanaman tomat. Penelitian dilaksanakan di Rumah Kaca FakultasPertanian Universitas Jambi, perlakuannya terdiri dari : t0 = tanpa Trichoderma sp; t1 = 25 gTrichoderma sp/8 kg media; t2 = 50 g Trichoderma sp/8 kg media; t3 = 75 g Trichoderma sp/8 kgmedia; dan t4 = 100 g Trichoderma sp /8 kg media. Hasil penelitian menunjukkan bahwa Trichodermasp berperan dalam mengendalikan penyakit layu...

  10. Penggunaan Jamur Antagonis Trichoderma sp. dan Gliocladium sp. untuk Mengendalikan Penyakit Layu (Fusarium oxysporum) pada Tanaman Bawang Merah (Allium ascalonicum L.)


    Ramadhina, Arie


    Arie Ramadhina, 2012. The Use of Antagonism Fungus of Trichoderma sp and Gliocladium sp. for Controlling Wilt (Fusarium oxysporum) in Red Onion Plants (Allium ascolanicum). Supervised by Lisnawita and Lahmuddin Lubis. The aim of the research was to know the effectiveness of antagonism fungus of Trichoderma sp. and Gliocladium sp. in controlling wilt in red onion plants. The research was performed in the green-house at the faculty of Agriculture, USU, from February until May, 2012. The researc...

  11. Programmēšanas spēle "PyDrone"


    Siliņš, Viesturs


    Darbā “Programmēšanas spēle “PyDrone”” ir dokumentēta atvērtā koda programmas PyDrone izstrāde. PyDrone ir programmēšanas spēle, kas paredzēta izklaidei un izglītošanai, spēles veidā iepazīstinot cilvēkus ar programmēšanu. Programma izstrādāta, izmantojot Python programmēšanas valodu. Programma izstrādāta, izmantojot spējo metodiku programmizstrādes principus. Atslēgvārdi: Python, spējās metodikas, programmēšanas spēle.

  12. Babesia peircei sp. nov. from the jackass penguin

    African Journals Online (AJOL)


    Jan 9, 1992 ... An avian piroplasm, Babesia peircei sp. nov. is described from the jackass penguin Spheniscus demersus. Morphological differences between Babesia peircei sp. nov. and the other valid Babesia spp. are discussed together with the possible vectors. 'n Voal-piroplasma, Babesia peircei sp. nov. afkomstig ...

  13. Pertumbuhan Chlorella sp. pada beberapa konsentrasi limbah batubara (The growth rate of the Chlorella sp. at different concentrations of coal waste water

    Directory of Open Access Journals (Sweden)

    Zerli Selvika


    Full Text Available Chlorella sp. is a single-celled microalga that mostly grows in marine waters. Chlorella sp. can grow in heavy polluted waters and therefore it has potency as a bioremediation agent. This study aimed was to analyze the effect of coal on the growth of Chlorella sp. in plant isolation media and the quality of water in plant isolation media for Chlorella sp. The complete randomized design with 4 treatments of coal concentration was used in this study. Four concentration concentrations were tested namely, 0 ppt, 1 ppt, 3 ppt and 5 ppt. The results revealed that coal with different concentrations gave no significant effect on the growth of Chlorella sp. (p> 0.05. The density among the concentrations of 0 ppt, 1 ppt, 3 ppt and 5 ppt were not significantly different. In addition, the coal concentration gave no significant effect on temperature, salinity and potential hydrogen (pH (p>0.05. The Chlorella sp. can grow in the polluted water by coal, and therefore this alga can be used as potential organisms for bioremediation of coal waste. Chlorella sp. merupakan mikroalga bersel satu yang banyak tumbuh di perairan laut. Chlorella sp. dapat tumbuh di perairan yang tercemar berat sehingga berpotensi sebagai bioremediator. Penelitian ini bertujuan untuk menganalisis pengaruh konsentrasi batubara terhadap pertumbuhan Chlorella sp. dan kualitas air pada media kultur Chlorella sp. Metode yang digunakan dalam penelitian ini adalah metode eksperimen skala laboratorium. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan 4 perlakuan konsentrasi batubara 0 ppt, 1 ppt, 3 ppt dan 5 ppt. Hasil penelitian menunjukkan bahwa batubara dengan konsentrasi yang berbeda tidak berpengaruh nyata terhadap laju pertumbuhan Chlorella sp (P>0,05. Kepadatan antara konsentrasi 0 ppt, 1 ppt, 3 ppt dan 5 ppt tidak terlalu jauh berbeda. Konsentrasi batubara juga tidak berpengaruh nyata terhadap parameter suhu, salinitas dan derajat keasaman (pH (p>0,05. Chlorella sp

  14. Cdc20 mediates D-box-dependent degradation of Sp100

    International Nuclear Information System (INIS)

    Wang, Ran; Li, Ke-min; Zhou, Cai-hong; Xue, Jing-lun; Ji, Chao-neng; Chen, Jin-zhong


    Highlights: ► Cdc20 is a co-activator of APC/C complex. ► Cdc20 recruits Sp100 and mediates its degradation. ► The D-box of Sp100 is required for Cdc20-mediated degradation. ► Sp100 expresses consistently at both the mRNA and protein levels in cell cycle. -- Abstract: Cdc20 is a co-activator of the anaphase-promoting complex/cyclosome (APC/C complex), which recruits substrates at particular phases of the cell cycle and mediates their degradation. Sp100 is a PML-NB scaffold protein, which localizes to nuclear particles during interphase and disperses from them during mitosis, participates in viral resistance, transcriptional regulation, and apoptosis. However, its metabolism during the cell cycle has not yet been fully characterized. We found a putative D-box in Sp100 using the Eukaryotic Linear Motif (ELM) predictor database. The putative D-box of Sp100 was verified by mutational analysis. Overexpression of Cdc20 resulted in decreased levels of both endogenous Sp100 protein and overexpressed Sp100 mRNA in HEK 293 cells. Only an overexpressed D-box deletion mutant of Sp100 accumulated in HEK293 cells that also overexpressed Cdc20. Cdc20 knockdown by cdc20 specific siRNA resulted in increased Sp100 protein levels in cells. Furthermore, we discovered that the Cdc20 mediated degradation of Sp100 is diminished by the proteasome inhibitor MG132, which suggests that the ubiquitination pathway is involved in this process. However, unlike the other Cdc20 substrates, which display oscillating protein levels, the level of Sp100 protein remains constant throughout the cell cycle. Additionally, both overexpression and knockdown of endogenous Sp100 had no effect on the cell cycle. Our results suggested that sp100 is a novel substrate of Cdc20 and it is degraded by the ubiquitination pathway. The intact D-box of Sp100 was necessary for this process. These findings expand our knowledge of both Sp100 and Cdc20 as well as their role in ubiquitination.

  15. TurboSP and the Topological Trigger

    CERN Document Server

    Belavin, Vladislav


    TurboSP was originally proposed as an alternative to Full stream in LHCb data flow. TurboSP is a data flow strategy which not only selects events that should be preserved, like in Full stream, but also provides selective persistence. This is achieved by saving candidates and subset of the reconstruction. During this summer project we investigated the physics viability of using TurboSP with the topological lines and found out a possibility to reduce the number of kept tracks per event by two times while keeping a ratio of fully picked up interesting decay modes on $\\sim 97 \\%$ level.

  16. Interaction of uranium with Pleurotus sp

    International Nuclear Information System (INIS)

    Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad


    Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

  17. Evidence for cooperative mineralization of diuron by Arthrobacter sp. BS2 and Achromobacter sp. SP1 isolated from a mixed culture enriched from diuron exposed environments. (United States)

    Devers-Lamrani, Marion; Pesce, Stéphane; Rouard, Nadine; Martin-Laurent, Fabrice


    Diuron was found to be mineralized in buffer strip soil (BS) and in the sediments (SED) of the Morcille river in the Beaujolais vineyard repeatedly treated with this herbicide. Enrichment cultures from BS and SED samples led to the isolation of three bacterial strains transforming diuron to 3,4-dichloroaniline (3,4-DCA) its aniline derivative. 16S rRNA sequencing revealed that they belonged to the genus Arthrobacter (99% of similarity to Arthrobacter globiformis strain K01-01) and were designated as Arthrobacter sp. BS1, BS2 and SED1. Diuron-degrading potential characterized by sequencing of the puhA gene, characterizing the diuron-degradaing potential, revealed 99% similarity to A. globiformis strain D47 puhA gene isolated a decade ago in the UK. These isolates were also able to use chlorotoluron for their growth. Although able to degrade linuron and monolinuron to related aniline derivatives they were not growing on them. Enrichment cultures led to the isolation of a strain from the sediments entirely degrading 3,4-DCA. 16S rRNA sequence analysis showed that it was affiliated to the genus Achromobacter (99% of similarity to Achromobacter sp. CH1) and was designated as Achromobacter sp. SP1. The dcaQ gene encoding enzyme responsible for the transformation of 3,4-DCA to chlorocatechol was found in SP1 with 99% similarity to that of Comamonas testosteroni WDL7. This isolate also used for its growth a range of anilines (3-chloro-4-methyl-aniline, 4-isopropylaniline, 4-chloroaniline, 3-chloroaniline, 4-bromoaniline). The mixed culture composed of BS2 and SP1 strains entirely mineralizes (14)C-diuron to (14)CO2. Diuron-mineralization observed in the enrichment culture could result from the metabolic cooperation between these two populations. Copyright © 2014. Published by Elsevier Ltd.

  18. Microfibril-associated Protein 4 Binds to Surfactant Protein A (SP-A) and Colocalizes with SP-A in the Extracellular Matrix of the Lung

    DEFF Research Database (Denmark)

    Schlosser, Anders; Thomsen, Theresa H.; Shipley, J. Michael


    for phagocytes. Here we describe the molecular interaction between the extracellular matrix protein microfibril-associated protein 4 (MFAP4) and SP-A. MFAP4 is a collagen-binding molecule containing a C-terminal fibrinogen-like domain and a N-terminal located integrin-binding motif. We produced recombinant MFAP4......-A composed of the neck region and carbohydrate recognition domain of SP-A indicating that the interaction between MFAP4 and SP-A is mediated via the collagen domain of SP-A. Monoclonal antibodies directed against MFAP4 and SP-A were used for immunohistochemical analysis, which demonstrates that the two...... molecules colocalize both on the elastic fibres in the interalveolar septum and in elastic lamina of pulmonary arteries of chronically inflamed lung tissue. We conclude, that MFAP4 interacts with SP-A via the collagen region in vitro, and that MFAP4 and SP-A colocates in different lung compartments...

  19. Introduction to the SP theory of intelligence


    Wolff, J Gerard


    This article provides a brief introduction to the "Theory of Intelligence" and its realisation in the "SP Computer Model". The overall goal of the SP programme of research, in accordance with long-established principles in science, has been the simplification and integration of observations and concepts across artificial intelligence, mainstream computing, mathematics, and human learning, perception, and cognition. In broad terms, the SP system is a brain-like system that takes in "New" infor...

  20. Comparative study on the degradation of dibutyl phthalate by two newly isolated Pseudomonas sp. V21b and Comamonas sp. 51F

    Directory of Open Access Journals (Sweden)

    Vinay Kumar


    Full Text Available Dibutyl phthalate is (DBP the top priority toxicant responsible for carcinogenicity, teratogenicity and endocrine disruption. This study demonstrates the DBP degradation capability of the two newly isolated bacteria from municipal solid waste leachate samples. The isolated bacteria were designated as Pseudomonas sp. V21b and Comamonas sp. 51F after scanning electron microscopy, transmission electron microscopy, Gram-staining, antibiotic sensitivity tests, biochemical characterization, 16S-rRNA gene identification and phylogenetic studies. They were able to grow on DBP, benzyl butyl phthalate, monobutyl phthalate, diisodecyl phthalate, dioctyl phthalate, and protocatechuate. It was observed that Pseudomonas sp. V21b was more efficient in DBP degradation when compared with Comamonas sp. 51F. It degraded 57% and 76% of the initial DBP in minimal salt medium and in DBP contaminated samples respectively. Kinetics for the effects of DBP concentration on Pseudomonas sp. V21b and Comamonas sp. 51F growth was also evaluated. Stoichiometry for DBP degradation and biomass formation were compared for both the isolates. Two major metabolites diethyl phthalate and monobutyl phthalates were identified using GC–MS in the extracts. Key genes were amplified from the genomes of Pseudomonas sp. V21b and Comamonas sp. 51F. DBP degradation pathway was also proposed.

  1. Sp1/Sp3 and DNA-methylation contribute to basal transcriptional activation of human podoplanin in MG63 versus Saos-2 osteoblastic cells

    Directory of Open Access Journals (Sweden)

    Puri Christina


    Full Text Available Abstract Background Podoplanin is a membrane mucin that, among a series of tissues, is expressed on late osteoblasts and osteocytes. Since recent findings have focussed on podoplanin's potential role as a tumour progression factor, we aimed at identifying regulatory elements conferring PDPN promoter activity. Here, we characterized the molecular mechanism controlling basal PDPN transcription in human osteoblast-like MG63 versus Saos-2 cells. Results We cloned and sequenced 2056 nucleotides from the 5'-flanking region of the PDPN gene and a computational search revealed that the TATA and CAAT box-lacking promoter possesses features of a growth-related gene, such as a GC-rich 5' region and the presence of multiple putative Sp1, AP-4 and NF-1 sites. Reporter gene assays demonstrated a functional promoter in MG63 cells exhibiting 30-fold more activity than in Saos-2 cells. In vitro DNase I footprinting revealed eight protected regions flanked by DNaseI hypersensitive sites within the region bp -728 to -39 present in MG63, but not in Saos-2 cells. Among these regions, mutation and supershift electrophoretic mobility shift assays (EMSA identified four Sp1/Sp3 binding sites and two binding sites for yet unknown transcription factors. Deletion studies demonstrated the functional importance of two Sp1/Sp3 sites for PDPN promoter activity. Overexpression of Sp1 and Sp3 independently increased the stimulatory effect of the promoter and podoplanin mRNA levels in MG63 and Saos-2 cells. In SL2 cells, Sp3 functioned as a repressor, while Sp1 and Sp3 acted positively synergistic. Weak PDPN promoter activity of Saos-2 cells correlated with low Sp1/Sp3 nuclear levels, which was confirmed by Sp1/Sp3 chromatin immunoprecipitations in vivo. Moreover, methylation-sensitive Southern blot analyses and bisulfite sequencing detected strong methylation of CpG sites upstream of bp -464 in MG63 cells, but hypomethylation of these sites in Saos-2 cells. Concomitantly

  2. Sp(2) covariant quantisation of general gauge theories

    Energy Technology Data Exchange (ETDEWEB)

    Vazquez-Bello, J L


    The Sp(2) covariant quantization of gauge theories is studied. The geometrical interpretation of gauge theories in terms of quasi principal fibre bundles Q(M{sub s}, G{sub s}) is reviewed. It is then described the Sp(2) algebra of ordinary Yang-Mills theory. A consistent formulation of covariant Lagrangian quantisation for general gauge theories based on Sp(2) BRST symmetry is established. The original N = 1, ten dimensional superparticle is considered as an example of infinitely reducible gauge algebras, and given explicitly its Sp(2) BRST invariant action. (author). 18 refs.

  3. Sp(2) covariant quantisation of general gauge theories

    International Nuclear Information System (INIS)

    Vazquez-Bello, J.L.


    The Sp(2) covariant quantization of gauge theories is studied. The geometrical interpretation of gauge theories in terms of quasi principal fibre bundles Q(M s , G s ) is reviewed. It is then described the Sp(2) algebra of ordinary Yang-Mills theory. A consistent formulation of covariant Lagrangian quantisation for general gauge theories based on Sp(2) BRST symmetry is established. The original N = 1, ten dimensional superparticle is considered as an example of infinitely reducible gauge algebras, and given explicitly its Sp(2) BRST invariant action. (author). 18 refs

  4. Optisk scanning af spørgeskemaer

    DEFF Research Database (Denmark)

    Paulsen, Aksel

    / 1000 felter= 0.370 (95% CI: 0.160-0.729), (p= 0.020)). Der var ingen statistisk forskel mellem optisk scanning (fejl/ 1000 felter= 0.046 (95% CI: 0.001-0.258)) og manuel dobbelt indtastning (p=1.000). Konklusioner: Optisk scanning er et godt alternativ til manuel dobbelt indtastning for spørgeskema med......Formål og baggrund: Patient rapporterede outcomes i form af spørgeskemaer bruges i øgende grad i sundhedssektoren både i klinisk praksis og forskning. Ofte bruges spørgeskemaer i papirformat. Manuel dobbelt indtastning er defineret som guld standard for overføring af data til et elektronisk format......, men processen er tidkrævende. Optisk scanning af spørgeskemaer med automatisk registrering af svar kan være et alternativ, men videre validering af metoden er nødvendig. Design: 200 patienter blev tilfældigt udvalgt fra en kohorte på 5777 patienter der tidligere havde svaret på to forskellige...


    Directory of Open Access Journals (Sweden)

    Juliana Jerásio Bianche

    Full Text Available ABSTRACT To evaluate the adhesive efficiency on the union of glued joints in a particular temperature and humidity conditions for a specified time the adhesive must be submitted to specific load tests, such as shear in the glue line. The objective of this study was to evaluate the shear strength in the glue line of Eucalyptus sp and Pinus sp.woods. Five adhesives (castor oil, sodium silicate, modified silicate, , PVA and resorcinol-formaldehyde, three weights (150 g/m2, 200 g/m2, and 250 g/m2 and two species (Eucalyptus sp. and Pinus sp. of wood were used. Twelve specimens were obtained from each repetition per treatment, corresponding to 108 specimens that were conditioned at a temperature of 23 ± 1°C and relative humidity of 50 ± 2%. The interaction between the weight and type of adhesive was significant for the shear strength in the glue line of eucalyptus wood. However, no interaction between the weight and the adhesive was found for pinus, only the isolated from the adhesive effect. Chemical bonds originated in the polymerization of resorcinol-formaldehyde adhesives and castor bi-component conferred upon these adhesives the greatest resistance in the glue line. Castor and resorcinol-formaldehyde adhesives showed the highest shear strength values in the line of glue and wood failure. Castor adhesive presented satisfactory performance for bonding of eucalyptus and pine woods.

  6. Caracterización ecológica de lombrices nativas (Pheretima sp., Eudovoscolex sp. y Periscolex sp. bajo diferentes usos del suelo (Guaviare, Colombia Ecological characterization of nature earthworm (Pheretima sp., Eudovoscolex sp. y Periscolex sp. under different soil uses (Guaviare, Colombia

    Directory of Open Access Journals (Sweden)

    Fuentes Baca Anamaría


    Full Text Available Se caracterizaron las poblaciones de lombrices de tierr.a de las especies Pheretimasp., Eudovoscolexsp. y Periscolex sp., presentes en un Typic Dystropept del municipio El Retorno (Guaviare, Colombia, bajo ocho tipos de usos (pradera sin pastoreo, pradera con semipastoreo, arreglo silvopastoril, cultivos de chontaduro y cacao socolado, rastrojo de cinco años, rastrojo de segundo crecimiento y bosque, utilizando 10 unidades de muestreo por cobertura y evaluando parámetros de abundancia, densidad y biomasa en relación con algunas características físico-químicas del suelo. Los resultados mostraron diferencias significativas entre las cantidades totales de huevos y adultos en el sistema silvopastoril vs. las praderas y en la pradera con semipastoreo vs. pradera sin pastoreo y de adultos en la cobertura chontaduro (Bactrys gasipaes - kudzu vs. cacao (Theobroma cacao. En varios casos, las respuestas de biomasa y densidad no fueron coincidentes. Mientras que en bosque natural las especies se distribuyen por igual, en las demás coberturas se presentan diferentes patrones de distribución. Se encontraron correlaciones entre biomasa, densidad y abundancia de lombrices con los contenidos de fósforo y magnesio y con la densidad aparente del suelo.
    Earthworm populations of Pheretima sp., Eudovoscolex sp. and Periscolex sp found in Typic Dystropepts from El Retorno (Guaviare, Colombia were evaluated for eight different soil uses. Ten experimental units were used to evaluate abundance, density and biomass, as related to soil physico-chemical characteristics. Results showed significant differences between total amount of eggs and adults under forest pasture combinet use vs grazing, and, grazing plus partially grazing vs non-pasture grazing, and, adults in chontaduro (Bactrys gasipaes - Kudzu vs cacao (Theobroma cacao covering. Biomass and densities answers did not show similar results while in undisturbed forest the species have the same pattern

  7. Biodegradation of hexavalent chromium (Cr+6) in wastewater using Pseudomonas sp. and Bacillus sp. bacterial strains

    Energy Technology Data Exchange (ETDEWEB)

    Qasim, Muhammad [Department of Chemical Engineering, American University of Sharjah (United Arab Emirates)


    The recovery of toxic metal compounds is a deep concern in all industries. Hexavalent chromium is particularly worrying because of its toxic influence on human health. In this paper, biodegradation of hexavalent chromium (Cr+6) present in wastewater has been studied using two different bacterial strains; Pseudomonas sp. and Bacillus sp. A chemostat (with and without recycle of cells) with 10 L liquid culture volume was used to study the substrate and the biomass cell concentrations with time. Also, the degree of substrate conversion was studied by the varying the dilution rate as an independent parameter. The dilution rate (ratio of feed flow rate to the culture volume) was varied by varying the feed volumetric rate from 110-170 mL/h for inlet hexavalent chromium concentrations of 70 mg/dm3. The results show that a chemostat with recycle gives a better performance in terms of substrate conversion than a chemostat without a recycle. Moreover, the degree of substrate conversion decreases as the dilution rate is increased. Also, Bacillus sp. was found to give higher conversions compared to pseudomonas sp.

  8. Analisis Fosfor pada Cacing Tanah (Megascolex sp. dan Fridericia sp.) Secara Spektrofotometri Sinar Tampak


    Safira, Cut Shafa


    Earthworm is natural resource which can be used for medication due to its highly amount of minerals. One of these minerals is phosphorus. The aim of this research are to identify, determine and know the difference content of phosphorus in Megascolex sp. and Fridericia sp. Qualitative analysis shows positive results with addition of ammonium molybdate 4% and BaCl2 5%. Quantitative analysis was done using visible spectrophotometer with ascorbic acid method, measuring blu-colored molybdenum ...

  9. Cdc20 mediates D-box-dependent degradation of Sp100

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ran; Li, Ke-min; Zhou, Cai-hong; Xue, Jing-lun [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai (China); Ji, Chao-neng, E-mail: [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai (China); Chen, Jin-zhong, E-mail: [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai (China)


    Highlights: Black-Right-Pointing-Pointer Cdc20 is a co-activator of APC/C complex. Black-Right-Pointing-Pointer Cdc20 recruits Sp100 and mediates its degradation. Black-Right-Pointing-Pointer The D-box of Sp100 is required for Cdc20-mediated degradation. Black-Right-Pointing-Pointer Sp100 expresses consistently at both the mRNA and protein levels in cell cycle. -- Abstract: Cdc20 is a co-activator of the anaphase-promoting complex/cyclosome (APC/C complex), which recruits substrates at particular phases of the cell cycle and mediates their degradation. Sp100 is a PML-NB scaffold protein, which localizes to nuclear particles during interphase and disperses from them during mitosis, participates in viral resistance, transcriptional regulation, and apoptosis. However, its metabolism during the cell cycle has not yet been fully characterized. We found a putative D-box in Sp100 using the Eukaryotic Linear Motif (ELM) predictor database. The putative D-box of Sp100 was verified by mutational analysis. Overexpression of Cdc20 resulted in decreased levels of both endogenous Sp100 protein and overexpressed Sp100 mRNA in HEK 293 cells. Only an overexpressed D-box deletion mutant of Sp100 accumulated in HEK293 cells that also overexpressed Cdc20. Cdc20 knockdown by cdc20 specific siRNA resulted in increased Sp100 protein levels in cells. Furthermore, we discovered that the Cdc20 mediated degradation of Sp100 is diminished by the proteasome inhibitor MG132, which suggests that the ubiquitination pathway is involved in this process. However, unlike the other Cdc20 substrates, which display oscillating protein levels, the level of Sp100 protein remains constant throughout the cell cycle. Additionally, both overexpression and knockdown of endogenous Sp100 had no effect on the cell cycle. Our results suggested that sp100 is a novel substrate of Cdc20 and it is degraded by the ubiquitination pathway. The intact D-box of Sp100 was necessary for this process. These findings expand

  10. Kinerja probiotik Bacillus sp. pada pendederan benih ikan lele Clarias sp. yang diinfeksi Aeromonas hydrophila

    Directory of Open Access Journals (Sweden)

    , Sukenda


    Full Text Available ABSTRACT This experiment was conducted to assess performance of Bacillus sp. probiotic on catfish juvenile Clarias sp. infected by Aeromonas hydrophila. The probiotic content in the diets were 0% (K+ and K-, 1%, and 2% in duplicates. This experiment used randomized design with four treatments and two replications. Juveniles with average body weight of 3.22±0.15 g/fish were reared in the 1.5×2.8×0.5 m3 pond with density of 800 fish/pond. Fish were reared for 30 days and fed three times a day at rate 8% of  total body weight. At day 31, catfish were challenged by A. hydrophila 0.1 mL (106 cfu/mL. Post infection observation was carried out ten days with density 10 fish/aquaria. The result showed that fish fed diet containing 2% probiotic gave the best probiotic performance with survival rate of catfish 83.33% after challenged, spesific growth rate 5.40%, and 0,75 of feed conversion ratio. The results of the blood profile showed significantly better results in the treatment of probiotics compared to the positive control after challenge test A. hydrophila. Probiotic Bacillus sp. has given as much as 2% on feed provides better performance on catfish juvenile. Keywords: probiotic, Bacillus sp., A. hydrophila, catfish juvenille, growth  ABSTRAK Penelitian ini bertujuan untuk menguji kinerja probiotik Bacillus sp. dalam pakan pada pendederan benih ikan lele Clarias sp. yang diinfeksi bakteri Aeromonas hydrophila. Penelitian ini menggunakan rancangan acak lengkap dengan empat perlakuan yaitu kandungan probiotik dalam pakan perlakuan yaitu 0% (K+ dan K-, 1%,  dan 2%, masing-masing dengan dua ulangan. Ikan lele yang digunakan memiliki bobot rata-rata 3,22±0,15 g/ekor, dipelihara dalam kolam terpal berukuran 1,5×2,8×0,5 m3 dengan kepadatan 800 ekor/kolam. Ikan dipelihara selama 30 hari dengan frekuensi pemberian pakan tiga kali sehari sebanyak 8% dari bobot tubuh ikan. Hari ke-31 benih lele diinjeksi bakteri A. hydrophila dosis 0,1 m

  11. Growth kinetics and biodeterioration of polypropylene microplastics by Bacillus sp. and Rhodococcus sp. isolated from mangrove sediment. (United States)

    Auta, H S; Emenike, C U; Jayanthi, B; Fauziah, S H


    Interest in the biodegradation of microplastics is due to their ubiquitous distribution, availability, high persistence in the environment and deleterious impact on marine biota. The present study evaluates the growth response and mechanism of polypropylene (PP) degradation by Bacillus sp. strain 27 and Rhodococcus sp. strain 36 isolated from mangrove sediments upon exposure to PP microplastics. Both bacteria strains were able to utilise PP microplastic for growth as confirmed by the reduction of the polymer mass. The weight loss was 6.4% by Rhodococcus sp. strain 36 and 4.0% by Bacillus sp. strain 27 after 40days of incubation. PP biodegradation was further confirmed using Fourier-transform infrared spectroscopy and scanning electron microscopy analyses, which revealed structural and morphological changes in the PP microplastics with microbial treatment. These analyses showed that the isolates can colonise, modify and utilise PP microplastics as carbon source. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. The dynamics of the fungal aerospores Alternaria sp. and Cladosporium sp. in Parisian atmospheric air, in France (United States)

    Brezoczki, V. M.


    The bioallergens occurring naturally in the atmospheric air are microorganisms, pollen grains, plant seeds, leaf and stem scrap, or their protein molecules. The presence of various airborne fungal spores determines a high allergenic potential for public health. This effect is due to the high number of produced spores, which under favourable meteorological conditions (dry weather and wind) reach the surrounding air. This paper traces the dynamics of two types of fungi, Alternaria sp and Cladosporium sp, fungi which can be found outdoors, in the surrounding air, as well as indoors, inside houses (especially the conidia of Cladosporium sp). The effects of these fungal spores on human health are varies, ranging from seasonal allergies (hay fever, rhinitis, sinusitis etc.) to sever afflictions of the respiratory system, onset of asthma, disfunctionalities of the nervous systems, of the immune system, zymoses etc. The monitoring of the dynamics of the aerospores Alternaria sp and Cladosporium sp was carried out between 2010 and 2013, over a period of 42 weeks during one calendar year, from February to the end of September, in the surrounding air in the French capital, Paris. The regional and global climate and meteorological conditions are directly involved in the occurrence and development of fungi colonies, the transportation and dispersion of fungal spores in the atmospheric air, as well as in the creation of the environment required for the interaction of chemical and biological components in the air. Knowledge of the dynamics of the studied fungal aerospores, coupled with climate and meteorological changes, offers a series of information on the magnitude of the allergenic potential these airborne spores can determine. Legal regulations in this domain set the allergen risk threshold for the Alternaria sp aerospores at 3500 ÷ 7000 spores/m3 air/week, and for the Cladosporium sp aerospores at 56,000 spores/m3 air/week. Besides these regulations there exist a series of

  13. Enhanced photocatalytic activity induced by sp 3 to sp 2 transition of carbon dopants in BiOCl crystals

    KAUST Repository

    Sun, Jianguo


    The insufficient light absorption and low quantum efficiency limit the photocatalytic performance of wide bandgap semiconductors. Here, we report a facile strategy to engineer the surface disordered defects of BiOCl nanosheets via carbon doping. The surface defects boost the light absorption and also the quantum yields, as the doped carbon atoms exhibit a transition from sp3 to sp2 hybridization at elevated temperature, corresponding to a change of assembly state from 3D cluster to 2D graphite-like structure. This transition results in an effective charge separation and thus one order of enhancement in photocatalytic activity toward phenol degradation under visible light. The current study opens an avenue to introduce sp3 to sp2 transition of carbon dopants for simultaneous increment of light absorption and quantum efficiency for application in photocatalysis and energy conversion.

  14. Indirect Manganese Removal by Stenotrophomonas sp. and Lysinibacillus sp. Isolated from Brazilian Mine Water

    Directory of Open Access Journals (Sweden)

    Natália Rocha Barboza


    Full Text Available Manganese is a contaminant in the wastewaters produced by Brazilian mining operations, and the removal of the metal is notoriously difficult because of the high stability of the Mn(II ion in aqueous solutions. To explore a biological approach for removing excessive amounts of aqueous Mn(II, we investigated the potential of Mn(II oxidation by both consortium and bacterial isolates from a Brazilian manganese mine. A bacterial consortium was able to remove 99.7% of the Mn(II. A phylogenetic analysis of isolates demonstrated that the predominant microorganisms were members of Stenotrophomonas, Bacillus, and Lysinibacillus genera. Mn(II removal rates between 58.5% and 70.9% were observed for Bacillus sp. and Stenotrophomonas sp. while the Lysinibacillus isolate 13P removes 82.7%. The catalytic oxidation of Mn(II mediated by multicopper oxidase was not properly detected; however, in all of the experiments, a significant increase in the pH of the culture medium was detected. No aggregates inside the cells grown for a week were found by electronic microscopy. Nevertheless, an energy-dispersive X-ray spectroscopy of the isolates revealed the presence of manganese in Stenotrophomonas sp. and Lysinibacillus sp. grown in K medium. These results suggest that members of Stenotrophomonas and Lysinibacillus genera were able to remove Mn(II by a nonenzymatic pathway.

  15. Fermentation of Azolla sp. leaves and the utilization as a feed ingredient of tilapia Oreochromis sp.

    Directory of Open Access Journals (Sweden)

    Nur Bambang Priyo Utomo


    Full Text Available ABSTRACTThe objective of this study was to study the effect of incubation period on the nutritional content of Azolla sp. meal fermented by Trichoderma harzianum, and its optimum supplementation level in the feed of tilapia Oreochromis sp. In incubation period treatments, fermentation of Azolla meal was performed in two, six, eight, and ten days (AF2, AF6, AF8, AF10 using Trichoderma harzianum as the fermentor. The fish used in this study was tilapia Oreochromis sp. with an average weight of 10.59±1.29 g. The design of the feeding treatments was repeletting commercial feed with Azolla leaves by with different supplementation levels, i.e. 0% (A/control, 30% (B, 60% (C, and 90% (D. Faecal collection for digestibility measurement was conducted for 15 days and fish growth rate was observed for 40 days. Azolla meal fermented for two days (AF2 showed the best results among the other treatments with a crude fiber decrease of 37.19% and protein increase of 38.65%. The results of this study indicate that fermentation can increase the nutritional quality of Azolla meal and its most optimal supplementation level in the diet of tilapia is 30%.Keywords: crude fiber, Azolla sp., tilapiaABSTRAKPenelitian ini bertujuan untuk mengetahui pengaruh lama waktu fermentasi daun mata lele Azolla sp. menggunakan kapang Trichoderma harzianum serta dosis optimal dalam pakan ikan nila Oreochromis sp. Proses fermentasi tepung daun mata lele dilakukan selama dua, enam, delapan, dan sepuluh hari (AF2, AF6, AF8, AF10. Ikan uji pada penelitian ini menggunakan ikan nila Oreochromis sp. dengan bobot rata-rata 10,59±1,29 g yang ditebar sebanyak 6 ekor/akuarium berukuran 50×45×30 cm3. Sebagai pakan perlakuan yakni repeletting daun mata lele dengan pakan komersil pada tingkat suplementasi 0% (A/kontrol, 30% (B, 60% (C, dan 90% (D. Pemeliharaan ikan uji dan pengumpulan data dilakukan dengan mengumpulkan feses ikan untuk uji ketercernaan selama 15 hari dan mengamati pertumbuhan

  16. Methylobacterium suomiense sp. nov. and Methylobacterium lusitanum sp. nov., aerobic, pink-pigmented, facultatively methylotrophic bacteria. (United States)

    Doronina, Nina V; Trotsenko, Yuri A; Kuznetsov, Boris B; Tourova, Tatjana P; Salkinoja-Salonen, Mirja S


    Two aerobic, pink-pigmented, facultatively methylotrophic bacteria, strains F20T and RXM(T), are described taxonomically. On the basis of their phenotypic and genotypic properties, the isolates are proposed as novel species of the genus Methylobacterium, Methylobacterium suomiense sp. nov. (type strain F20T = VKM B-2238T = NCIMB 13778T) and Methylobacterium lusitanum sp. nov. (type strain RXMT = VKM B-2239T = NCIMB 13779T).

  17. Diaphite, a new type of surface with mixed sp{sup 2}-sp{sup 3} hybridization for adsorption and functionalization

    Energy Technology Data Exchange (ETDEWEB)

    Radosinski, Lukasz, E-mail: [Wroclaw University of Science and Technology, Chemistry Department, Group of Bioprocess and Biomedical Engineering, Wybrzeze Wyspianskiego 27, 50-370 Wroclaw (Poland); Formalik, Filip [Wroclaw University of Science and Technology, Chemistry Department, Group of Bioprocess and Biomedical Engineering, Wybrzeze Wyspianskiego 27, 50-370 Wroclaw (Poland); Olejniczak, Adam [Department of Spectroscopy of Excited States, Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna 2, 50-422 Wroclaw (Poland); Radosz, Andrzej [Wroclaw University of Science and Technology, Faculty of Fundamental Problems of Technology, Department of Quantum Technologies, Wybrzeze Wyspianskiego 27, 50-370 Wroclaw (Poland)


    Highlights: • Recent discoveries show a possibility of photoinduced formation of a structure of mixed sp{sub 2}-sp{sub 3} hybridization out of graphite and graphene–diaphite. • Ab initio and molecular mechanics calculations indicate that the surface exhibits large enhancement of binding energy due to favorable sp{sub 3} like hybridization. • The binding energy varies upon configuration of occupied adsorption sites and the adsorption sites form a regular bed-like matrix. - Abstract: We theoretically study a new carbon phase with mixed sp{sup 2}-sp{sup 3} bond hybridization called diaphite. Using ab initio calculations and the adaptive intermolecular reactive bond order (AIREBO) potential approach, we show that the surface of this structure exhibits enhanced adsorption capabilities. Specifically, using hydrogen as a test adsorbate, we calculate that the chemical binding energy, depending on the configuration of hydrogen atoms, varies from 2.08 to 2.9 eV. Furthermore, the adsorption sites form a regular matrix; thus, we postulate that this new stable carbon phase may be a universal matrix for functionalization.

  18. Diversity and antimicrobial susceptibility of oxytetracycline-resistant isolates of Stenotrophomonas sp. and Serratia sp. associated with Costa Rican crops. (United States)

    Rodríguez, C; Wachlin, A; Altendorf, K; García, F; Lipski, A


    To ameliorate the identification, evaluate the diversity, and determine the antimicrobial sensitivity of 19 oxytetracycline-resistant isolates of Stenotrophomonas sp. and Serratia sp. associated with Costa Rican crops. Phenotypical, chemotaxonomical, and molecular data allocated most isolates to the species Sten. maltophilia and Ser. marcescens. The API profiles, antimicrobial resistance patterns (ATB system), and BOX-polymerase chain reaction (PCR) genomic fingerprints of isolates of Stenotrophomonas sp. exhibited a higher degree of heterogeneity than those obtained for the isolates of Serratia sp. The former group of bacteria exhibited multiresistance to antimicrobials. In contrast, isolates of Serratia sp. were sensitive to the majority of the drugs tested. Changes in the results of the antibiograms throughout incubation, which indicate an induction of tolerance, were observed for isolates of both the species. Minimum inhibitory concentration of oxytetracycline, determined using E-test stripes, were rather elevated. The occurrence of two species of opportunistic pathogens in crop-associated materials poses a risk to consumers in the community. The phenotypic and genotypic data presented could support epidemiologist and physicians dealing with infections caused by environmental strains of these taxa.

  19. Isolation of C11 Cyclopentenones from Two Didemnid Species, Lissoclinum sp. and Diplosoma sp.

    Directory of Open Access Journals (Sweden)

    Katsuhiro Ueda


    Full Text Available A series of new C11 cyclopentenones 1-7 was isolated, together with four known metabolites 9/10, 12 and 13, from the extract of the didemnid ascidian Lissoclinum sp. The other didemnid ascidian Diplosoma sp. contained didemnenones 1, 2 and 5, and five known metabolites 8-12. The structures of 1-7 were elucidated by spectroscopic analyses. Cytotoxicity of the isolated compounds was evaluated against three human cancer cell lines (HCT116, A431 and A549.

  20. Green Decision Making: Sustainable Transport and Systemic Planning (SP)

    DEFF Research Database (Denmark)

    Leleur, Steen

    and infrastructure assessment and on the methodology and process of systemic planning (SP). SP theory development has interchanged with practical application and testing of the SP approach in a large number of cases. The word systemic in SP indicates that complex planning problems and provision of decision support...... in today’s strategic planning needs a focus on what may be addressed as systemic insights in balance with more conventional, systematically-based findings where causal linkages can be modelled and made use of. In practice this means that SP is based on a study-specific combination of hard (quantitative......) and soft (qualitative) operations research (OR) methods; especially the latter have a function as regards knowledge generation that relates to obtaining systemic insights. Furthermore, SP applies a process that drives group-based learning forward. The group should be formed with the different stakeholder...

  1. A superhard sp3 microporous carbon with direct bandgap (United States)

    Pan, Yilong; Xie, Chenlong; Xiong, Mei; Ma, Mengdong; Liu, Lingyu; Li, Zihe; Zhang, Shuangshuang; Gao, Guoying; Zhao, Zhisheng; Tian, Yongjun; Xu, Bo; He, Julong


    Carbon allotropes with distinct sp, sp2, and sp3 hybridization possess various different properties. Here, a novel all-sp3 hybridized tetragonal carbon, namely the P carbon, was predicted by the evolutionary particle swarm structural search. It demonstrated a low density among all-sp3 carbons, due to the corresponding distinctive microporous structure. P carbon is thermodynamically stable than the known C60 and could be formed through the single-walled carbon nanotubes (SWCNTs) compression. P carbon is a direct bandgap semiconductor displaying a strong and superhard nature. The unique combination of electrical and mechanical properties constitutes P carbon a potential superhard material for semiconductor industrial fields.

  2. Characterization of Ethanolic Extract of Streptomyces sp. as a Pancreatic Lipase Inhibitors Produced by Endophytic Streptomyces sp. AEBg12

    Directory of Open Access Journals (Sweden)

    Lenni Fitri


    Full Text Available Endophytic Streptomyces sp. AEBg12 isolated from Zingiber cassumunar (Bangle is known to produce pancreatic lipase inhibitory compound. However, the characteristics of this active compound has not been reported yet. This study aimed to determine the characteristics of pancreatics inhibitory compound produced by Streptomyces sp. AEBg12 and to assess the role of endophytic actinobacteria in producing pancreatic lipase inhibitor using endophytic-free bangle tissue culture, wild bangle and compared with the activity of Streptomyces sp. AEBg12 endophytes. Supernatant of Streptomyces sp. AEBg12 was extracted using ethanol, ethyl acetate, and n-hexane solvents. Toxicity test was performed using larvae of shrimp Artemia salina. The results showed that the best solvent to obtain pancreatic lipase inhibitor compounds was ethanol. Phytochemical analysis showed that ethanolic extract of endophytic Streptomyces sp. AEBg12 contained flavonoids. IC50 value of ethanol extract was 180.83 µg/ml. The result of TLC showed that ethanolic extract of Streptomyces AEBg12 had a blue luminescence band indicated that there were either flavone, flavanones, flavonols or isoflavones. Inhibitory activity of Streptomyces sp. AEBg12 was higher than wild bangle and bangle tissue culture. The information from this study can be be used as a basic data for further characterization of the active compound, which might be developed as an antiobesity agent through its pancreatic lipase inhibitory activity.

  3. Role of Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 as Bioindicators and Immobilizers of Chromium in a Contaminated Natural Environment. (United States)

    Millach, Laia; Solé, Antoni; Esteve, Isabel


    The aim of this work was to study the potential of the two phototrophic microorganisms, both isolated from Ebro Delta microbial mats, to be used as bioindicators and immobilizers of chromium. The results obtained indicated that (i) the Minimum Metal Concentration (MMC) significantly affecting Chlorophyll a intensity in Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 was 0.25 µM and 0.75 µM, respectively, these values being lower than those established by current legislation, and (ii) Scenedesmus sp. DE2009 was able to immobilize chromium externally in extracellular polymeric substances (EPS) and intracellularly in polyphosphate (PP) inclusions. Additionally, this microorganism maintained high viability, including at 500 µM. Based on these results, we postulate that Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 are good chromium-indicators of cytotoxicity and, further, that Scenedesmus sp. DE2009 plays an important role in immobilizing this metal in a contaminated natural environment.

  4. Role of Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 as Bioindicators and Immobilizers of Chromium in a Contaminated Natural Environment

    Directory of Open Access Journals (Sweden)

    Laia Millach


    Full Text Available The aim of this work was to study the potential of the two phototrophic microorganisms, both isolated from Ebro Delta microbial mats, to be used as bioindicators and immobilizers of chromium. The results obtained indicated that (i the Minimum Metal Concentration (MMC significantly affecting Chlorophyll a intensity in Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 was 0.25 µM and 0.75 µM, respectively, these values being lower than those established by current legislation, and (ii Scenedesmus sp. DE2009 was able to immobilize chromium externally in extracellular polymeric substances (EPS and intracellularly in polyphosphate (PP inclusions. Additionally, this microorganism maintained high viability, including at 500 µM. Based on these results, we postulate that Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 are good chromium-indicators of cytotoxicity and, further, that Scenedesmus sp. DE2009 plays an important role in immobilizing this metal in a contaminated natural environment.


    Guliy, O I; Karavaeva, O A; Velikov, V A; Sokolov, O I; Pavily, S A; Larionova, O S; Burov, A M; Ignatov, O V


    The bacteriophage ΦAb-Sp7 was isolated from the cells of the Azospirillum brasilense Sp7. The morphology, size of the gram-negative colonies, and range of lytic activity against other strains and species of the genus Azospirillum was tested. The isolated phage DNA was examined using electrophoretic and restriction analysis, and the size of the genome were established. The electron microscopy. resuIts show that the phage (capsid) has a strand-like form. The electron microscopy study of the bacteriophage ΦAb-Sp7 adsorption on the A. brasilense Sp7 bacterial surface was performed.

  6. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto


    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  7. Screening of biodiesel production from waste tuna oil (Thunnus sp.), seaweed Kappaphycus alvarezii and Gracilaria sp. (United States)

    Alamsjah, Mochammad Amin; Abdillah, Annur Ahadi; Mustikawati, Hutami; Atari, Suci Dwi Purnawa


    Biodiesel has several advantages over solar. Compared to solar, biodiesel has more eco-friendly characteristic and produces lower greenhouse gas emissions. Biodiesel that is made from animal fats can be produced from fish oil, while other alternative sources from vegetable oils are seaweed Kappaphycus alvarezii and Gracilaria sp. Waste tuna oil (Thunnus sp.) in Indonesia is commonly a side product of tuna canning industries known as tuna precook oil; on the other hand, seaweed Gracilaria sp. and Kappaphycus alvarezii are commonly found in Indonesia's seas. Seaweed waste that was used in the present study was 100 kg and in wet condition, and the waste oil was 10 liter. The seaweed was extracted with soxhletation method that used n-hexane as the solvent. To produce biodiesel, trans esterification was performed on the seaweed oil that was obtained from the soxhletation process and waste tuna oil. Biodiesel manufactured from seaweed K. alvarezii obtained the best score in flash point, freezing point, and viscosity test. However, according to level of manufacturing efficiency, biodiesel from waste tuna oil is more efficient and relatively easier compared to biodiesel from waste K. alvarezii and Gracilaria sp.

  8. Potential topical natural repellent against Ae. aegypti, Culex sp. and Anopheles sp. mosquitoes

    Directory of Open Access Journals (Sweden)

    Dewi Nur Hodijah


    Full Text Available AbstrakLatar belakang:Minyak atsiri daun sirih diketahui mempunyai daya proteksi. Dibuatkan losion berdasarkan pengantar sediaan farmasi yang ditambahkan minyak atsiri daun nilam. Sediaan losion dipilih agar dapat menempel lebih lama di permukaan kulit. Tujuan penelitian ini untuk membandingkan daya proteksi antara losion dengan penambahan minyak nilam dan losion tanpa penambahan minyak nilam dibandingkan daya proteksi dengan DEET. Metode: Penelitian ini merupakan penelitian eksperimental laboratorium. Semua nyamuk uji berasal dari insektarium laboratorium penelitian kesehatan Loka litbang P2B2 Ciamis. Konsentrasi minyak atsiri daun sirih dalam losion adalah 4%; konsentrasi minyak nilam sebagai zat pengikat adalah 0,4%. Formula yang digunakan yaitu formula dasar yang ada pada pengantar sediaan farmasi. Uji repelensi dilakukan dengan menggunakan metoda yang direkomendasikan oleh Komisi pestisida.Hasil: Dihasilkan formulasi losion yang stabil dan masih memenuhi standar formulasi sediaan. Berdasarkan hasil, diperoleh data bahwa DEET dan losion hasil modifikasi memiliki rata-rata daya proteksi di atas 90% selama 6 jam terhadap nyamuk Ae.aegypti dan Culex sp. Kesimpulan: Penambahan minyak nilam pada losion sirih dapat meningkatkan daya proteksi terhadap hinggapan nyamuk Ae. aegypti dan Culex sp. (Health Science Indones 2014;1:44-8Kata kunci:repelen alamiah, minyak atsiri, daun sirih, daun nilam, Ae. aegypti, Culex sp.AbstractBackground: Betel leaf essential oil lotion has been known to have insect repellent properties. A lotion was made based on a pharmaceutical formula from a monograph where patchouli leaf essential oil was added. A lotion preparation was intended to enhance adherence of the formula on the surface of the skin. The purpose of this study was to compare protection percentage of lotion with patchouli oil and without patchouli oil lotion compared to DEET.Methods: This study is an experimental laboratory-based research. All mosquitoes

  9. Transcriptional Regulation of Frizzled-1 in Human Osteoblasts by Sp1.

    Directory of Open Access Journals (Sweden)

    Shibing Yu

    Full Text Available The wingless pathway has a powerful influence on bone metabolism and is a therapeutic target in skeletal disorders. Wingless signaling is mediated in part through the Frizzled (FZD receptor family. FZD transcriptional regulation is poorly understood. Herein we tested the hypothesis that Sp1 plays an important role in the transcriptional regulation of FZD1 expression in osteoblasts and osteoblast mineralization. To test this hypothesis, we conducted FZD1 promoter assays in Saos2 cells with and without Sp1 overexpression. We found that Sp1 significantly up-regulates FZD1 promoter activity in Saos2 cells. Chromatin immunoprecipitation (ChIP and electrophoretic mobility shift (EMSA assays identified a novel and functional Sp1 binding site at -44 to -40 from the translation start site in the FZD1 promoter. The Sp1-dependent activation of the FZD1 promoter was abolished by mithramycin A (MMA, an antibiotic affecting both Sp1 binding and Sp1 protein levels in Saos2 cells. Similarly, down-regulation of Sp1 in hFOB cells resulted in less FZD1 expression and lower alkaline phosphatase activity. Moreover, over-expression of Sp1 increased FZD1 expression and Saos2 cell mineralization while MMA decreased Sp1 and FZD1 expression and Saos2 cell mineralization. Knockdown of FZD1 prior to Sp1 overexpression partially abolished Sp1 stimulation of osteoblast differentiation markers. Taken together, our results suggest that Sp1 plays a role in human osteoblast differentiation and mineralization, which is at least partially mediated by Sp1-dependent transactivation of FZD1.

  10. Occurrence of Pyemotes sp. on Tuta absoluta (Meyrick

    Directory of Open Access Journals (Sweden)

    Carlos Romero Ferreira de Oliveira


    Full Text Available The aim of this work was to study the population reduction of the tomato leafminer moth, Tuta absoluta (Meyrick, by Pyemotes sp. in the laboratory. The mite became greenish when fed on caterpillars, pupae, and adults of T. absoluta. The caterpillars and adults of T. absoluta were quickly paralyzed by the mite venom. A single T. absoluta could host many Pyemotes sp, physogastric females, which were allowed to grow on the moth. Pyemotes sp. can be a new alternative for the biological control of T. absoluta. However, this possibility must be better understood before it could be recommended, because Pyemotes sp. could also cause dermatitis in the humans.O ácaro Pyemotes sp. (Acari: Pyemotidae é um parasita de várias espécies de insetos e exibe o processo de fisogastria na reprodução. É registrada a ocorrência de Pyemotes sp. sobre a traça-do-tomateiro, Tuta absoluta (Meyrick, que sofreu redução considerável de suas populações em condições de laboratório. Este ácaro foi observado parasitando larvas, pupas e adultos de T. absoluta e suas fêmeas fisogástricas apresentaram coloração esverdeada. As larvas e adultos de T. absoluta atacados por Pyemotes sp. exibiram paralisia em poucos minutos, devido à injeção de toxinas por parte do ácaro. Observou-se que um único indivíduo de T. absoluta pode suportar muitas fêmeas fisogástricas de Pyemotes sp., permitindo que outra geração do ácaro continuasse a se reproduzir. O ácaro Pyemotes sp. surge como uma possibilidade para o controle biológico de T. absoluta, mas sua utilização deve ser melhor avaliada já que é uma espécie causadora de dermatites em humanos.

  11. Prevention of White Spot Syndrome Virus Infection on Penaeus monodon by Immersion in CEPM Extract of Avicennia sp. and Sonneratia sp.

    Directory of Open Access Journals (Sweden)

    D. Wahjuningrum


    Full Text Available The quality and survival rate are still being the problem that hampers the productivity of black tiger shrimp, Penaeus monodon culture.  Impaired quality of larval shrimp and environmental conditions can confer shrimp be infected by diseases, including viruses such as white spot syndrome virus (WSSV.  Prevention of disease infection using chemicals can offer negative impacts on water, pathogen resistance and consumers.  This study was conducted to examine the efficacy of an alternative prevention compound as liquid mangrove extract (CEPM from Avicennia sp. and Sonneratia sp. By immersion in different dose of CEPM, i.e. 250, 500, 750 and 1000 ppm, the patogenicity of WSSV was found to be different.  Patogenicity of WSSV decreased after treatment by CEPM, hence this could be used to induce shrimp immunity.  Optimum dose of CEPM was 250 ppm, which could increased survival rate of shrimp after challenging by WSSV, up to 98.4% shrimp survived. Keywrods: WSSV, black tiger shrimp, extract, Avicennia sp., Sonneratia sp.   ABSTRAK Kualitas dan kelangsungan hidup merupakan masalah yang masih membatasi produktivitas budidaya udang windu Penaeus monodon. Kondisi udang dan kualitas lingkungan yang kurang baik dapat menyebabkan udang terserang penyakit, termasuk yang disebabkan oleh virus termasuk white spot syndrome virus (WSSV. Upaya pengendaliannya menggunakan bahan kimia secara berlebih dapat menimbulkan dampak negatif bagi lingkungan perairan, kesehatan konsumen dan menimbulkan resistensi patogen. Penelitian ini dilakukan untuk mengetahui efektivitas bahan alternatif berupa cairan ekstrak pohon mangrove (CEPM dari jenis Avicennia sp. dan Sonneratia sp. sebagai upaya pencegahan. Dengan perendaman beberapa konsentrasi yang berbeda (250, 500, 750 dan 1000 ppm penggunaan cairan ekstrak pohon mangrove (CEPM Avicennia sp. dan Sonneratia sp., memberikan pengaruh yang berbeda terhadap patogenitas WSSV dan udang uji pada setiap perlakuan. Tingkat


    Directory of Open Access Journals (Sweden)

    Lili Sholichah


    Full Text Available Pemeliharaan ikan rainbow (Melanotaenia sp. di Balai Penelitian dan Pengembangan Budidaya Ikan Hias selalu terjadi kematian secara bertahap mulai calon induk hingga proses pemijahan. Hal ini terjadi berulang kali sehingga ketersediaan induk Melanotaenia sp. sangat terancam. Ikan ini berasal dari Papua yang diperoleh mengandalkan penangkapan di alam. Tujuan dari penelitian ini adalah untuk menginventarisir dan mengidentifikasi berbagai patogen (parasit, jamur, bakteri potensial yang menginfeksi ikan rainbow yang dipelihara di dalam akuarium berukuran 50 cm x 50 cm x 50 cm dengan sistem aliran air stagnan. Tiga jenis rainbow yang dipelihara yaitu: rainbow Sungai Salawati, asal Sungai Sawiat, dan asal Danau Kurumoi. Setiap ikan masing-masing berjumlah 100 ekor dipelihara di akuarium dengan penambahan batu karang dan tanpa penambahan karang (kontrol ke dalam akuarium. Ikan diberi pakan sekenyangnya berupa jentik nyamuk dan cacing rambut beku setiap pagi dan sore hari. Sampling dilakukan secara random sebulan sekali dan secara unrandom setiap ada kejadian ikan sakit. Gejala klinis ikan yang sakit sebagai berikut: ikan berenang di permukaan dan menggosok-gosokkan badan di dinding akuarium, nafsu makan berkurang, gerakan berputar-putar, warna memudar menjadi putih, penekanan warna hitam pada sirip punggung dan perut meningkat, pendarahan pada perut, lendir berlebihan dan sangat berbau, serta sisik berdiri/terbuka. Diagnosa dan deteksi penyakit awal berupa pengamatan parasit baik ektoparasit maupun endoparasit, pengamatan dan isolasi jamur pada media selektif jamur, dan isolasi bakteri dilakukan untuk mengetahui jenis-jenis patogen yang menginfeksi ketiga jenis ikan rainbow. Selanjutnya dilakukan uji histologi dan analisa DNA beberapa patogen. Hasil pengamatan diperoleh patogen berupa parasit (Ichthyophthirius sp., Dactylogyrus sp., Gyrodactylus sp., dan Trichodina sp. dan bakteri (Aeromonas hydrophila, Acinetobacter sp

  13. Impacts of varying light regimes on phycobiliproteins of Nostoc sp. HKAR-2 and Nostoc sp. HKAR-11 isolated from diverse habitats. (United States)

    Kannaujiya, Vinod K; Sinha, Rajeshwar P


    The adaptability of cyanobacteria in diverse habitats is an important factor to withstand harsh conditions. In the present investigation, the impacts of photosynthetically active radiation (PAR; 400-700 nm), ultraviolet-B (UV-B; 280-315 nm), and PAR + UV-B radiations on two cyanobacteria viz., Nostoc sp. HKAR-2 and Nostoc sp. HKAR-11 inhabiting diverse habitats such as hot springs and rice fields, respectively, were studied. Cell viability was about 14 % in Nostoc sp. HKAR-2 and Nostoc sp. HKAR-11 after 48 h of UV-B exposure. PAR had negligible negative impact on the survival of both cyanobacteria. The continuous exposure of UV-B and PAR + UV-B showed rapid uncoupling, bleaching, fragmentation, and degradation in both phycocyanin (C-PC) and phycoerythrin (C-PE) subunits of phycobiliproteins (PBPs). Remarkable bleaching effect of C-PE and C-PC was not only observed with UV-B or PAR + UV-B radiation, but longer period (24-48 h) of exposure with PAR alone also showed noticeable negative impact. The C-PE and C-PC subunits of the rice field isolate Nostoc sp. HKAR-11 were severely damaged in comparison to the hot spring isolate Nostoc sp. HKAR-2 with rapid wavelength shifting toward shorter wavelengths denoting the bleaching of both the accessory light harvesting pigments. The results indicate that PBPs of the hot spring isolate Nostoc sp. HKAR-2 were more stable under various light regimes in comparison to the rice field isolate Nostoc sp. HKAR-11 that could serve as a good source of valuable pigments to be used in various biomedical and biotechnological applications.

  14. Impact of serum SP-A and SP-D levels on comparison and prognosis of idiopathic pulmonary fibrosis: A systematic review and meta-analysis. (United States)

    Wang, Kai; Ju, Qing; Cao, Jing; Tang, Wenze; Zhang, Jian


    Idiopathic pulmonary fibrosis (IPF) has a poor prognosis in general; however, it is heterogeneous to detect relative biomarkers for predicting the disease progression. Serum biomarkers can be conveniently collected to detect and help to differentially diagnose IPF and predict IPF prognosis. This meta-analysis aimed to evaluate the use of serum surfactant proteins A and D (SP-A and SP-D) for differential diagnosis and prognosis of IPF. Relevant articles were searched in PubMed, Embase, and Chinese National Knowledge Infrastructure databases and reviewed by 2 independent readers. Standard mean difference (SMD) and 95% confidence interval (CI) were calculated to assess the difference in serum levels of SP-A/D among patients with IPF, when compared to patients with non-IPF interstitial lung disease (ILD), pulmonary infection, and healthy control. Hazard ratio (HR) and 95% CI were used to compare the relative risk of mortality. Twenty-one articles (totalling 1289 IPF patients) were included in final meta-analysis. Serum SP-A levels were significantly higher in patients with IPF than in patients with non-IPF ILD (SMD: 1.108 [0.584, 1.632], P infection (SMD: 1.320 [0.999, 1.640], P SMD: 2.802 [1.901, 3.702], P SMD: 0.459 [-0.000, 0.919], P = .050). Serum SP-D levels were significantly higher in patients with IPF than in patients with pulmonary infection (SMD: 1.308 [0.813, 1.803], P SMD: 2.235 [1.739, 2.731], P < .001). Risk of death in patients with IPF and elevated serum SP-A was increased 39% compared to patients with low SP-A groups. Elevated SP-D increased risk by 111% when compared to low SP-D. In acute exacerbation of IPF, serum SP-A/D were higher than those in stable stage. The comparisons and prognosis might be different in Asian and Caucasian patients. Serum SP-A/D detection might be useful for differential diagnosis and prediction of survival in patients with IPF.

  15. Genetic polymorphism of horse serum protein 3 (SP3). (United States)

    Juneja, R K; Sandberg, K; Kuryl, J; Gahne, B


    Two-dimensional agarose gel (pH 8.6)-horizontal polyacrylamide gel (pH 9.0) electrophoresis of horse serum samples, followed by general protein staining, revealed genetic polymorphism of an unidentified protein tentatively designated serum protein 3 (SP3). The SP3 fractions appeared distinctly when a 14% concentration of acrylamide was used in the separation gels. The 2-D mobilities of SP3 fractions were quite similar to that of albumin. Family data were consistent with the hypothesis that the observed SP3 phenotypes were controlled by four co-dominant, autosomal alleles (D, F, I, S). Evidence was provided that the F allele can be further divided into two alleles (F1 and F2); the mobilities of F1 and F2 variants were very similar. Each of the SP3 alleles gave rise to one fraction and each of the heterozygous types showed two fractions. More than 600 horses representing five different breeds (Swedish Trotter, North-Swedish Trotter, Thoroughbred, Arab and Polish Tarpan) were typed for SP3, and allele frequency estimates were calculated. SP3 was highly polymorphic in all breeds studied.


    Directory of Open Access Journals (Sweden)

    Yunus Syafie


    Full Text Available Penelitian ini bertujuan untuk mengetahui aktivitas proteolitik yang dihasilkan jamur Aspergillus sp. dan Rhizopus sp. dalam tahapan unhairing (buang rambut pada proses penyamakan kulit domba serta pengaruh penggunaan dengan konsentrasi berbeda, terhadap kuat tarik, kemuluran, suhu kerut, dan kualitas limbah (pH, BOD, dan COD. Materi yang digunakan yaitu 15 lembar kulit domba awetan garam dibagi 2 bagian sepanjang garis lurus punggung sehingga diperoleh 30 lembar kulit, kulit dibagi secara acak menjadi 10 kelompok. Perlakuan terdiri dari dua belas kombinasi yaitu protease dari Aspergillus sp., Rhizopus sp. serta gabungan antara Aspergillus sp. dan Rhizopus sp. dengan konsentrasi protease 2% (P1, 2,5% (P2, 3% (P3, dan sebagai kontrol P0. Proses unhairing secara konvensional menggunakan bahan kimia Na2S (3% dan kapur Ca(OH2 6% dengan 3 ulangan. Sampel air limbah setelah proses unhairing diambil dan dibawa ke laboratorium untuk uji kualitas. Kulit diproses lebih lanjut menjadi kulit samak glazed. Data yang diperoleh dianalisis menggunakan Rancangan Acak Lengkap pola faktorial 3 x 4, apabila berbeda nyata dilakukan uji banding dengan uji Duncan’s new Multiple Range Test (DMRT. Hasil uji aktivitas proteolitik paling tinggi adalah gabungan antara protease dari Aspergillus sp. dan Rhizopus sp. yaitu sebesar 1.079,17 μM/ml/menit, sedangkan protease Aspergillus sp. dan Rhizopus sp. masing-masing memiliki aktivitas proteolitik sebesar 542,96 μM/ml/menit dan 392,89 μM/ml/menit. Hasil penelitian menunjukkan bahwa penggunaan protease dengan konsentrasi yang berbeda dapat memberikan efek yang positif terhadap kualitas fisik dan limbah cair proses unhairing kulit domba. Konsentrasi protease 2,5% dan 3% dapat meningkatkan nilai kuat tarik dan suhu kerut kulit domba serta menghasilkan kulit yang bersih tanpa ada rambut yang menempel dan struktur serabut kolagen terbuka. Perlakuan protease sangat potensial karena dapat menekan angka BOD dan COD limbah

  17. Possible linkage of SP6 transcriptional activity with amelogenesis by protein stabilization. (United States)

    Utami, Trianna W; Miyoshi, Keiko; Hagita, Hiroko; Yanuaryska, Ryna Dwi; Horiguchi, Taigo; Noma, Takafumi


    Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis.

  18. Possible Linkage of SP6 Transcriptional Activity with Amelogenesis by Protein Stabilization

    Directory of Open Access Journals (Sweden)

    Trianna W. Utami


    Full Text Available Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis.

  19. Chaenorhinum semispeluncarum sp. nov. and C. yildirimlii sp. nov. (Scrophulariaceae) from east Anatolia, Turkey

    DEFF Research Database (Denmark)

    Yildirim, Hasan; Tan, Kit; Senol, Serdar


    Chaenorhinum semispeluncarum H. Yildirim, Kit Tan, S. Senol & A. Pirhan sp. nov. and C. yildirimlii Kit Tan, H. Yildirim, S. Senol & A. Pirhan sp. nov. (Scrophulariaceae, C. sect. Microrrhinum) from east Anatolia are described and illustrated. They are both narrow endemics related to the rare C. ...

  20. AÇÃO ANTIFÚNGICA in vitro DE ISOLADOS DE Bacillu s sp. SOBRE Fusarium oxysporum f. sp. lycopersici

    Directory of Open Access Journals (Sweden)



    Full Text Available This study aimed to evaluate antagonism and metabolites produced by different species of Ba- cillus in the inhibition of mycelial growth in vitro against F. oxysporum f. sp . lycopersici . For evaluating the antagonism of Bacillus spp. F. oxysporum f. sp . lycopersici was performed pairing of fungus and bacteria by the method of the circle. In the method for detection for the quality for thermostable metabolites liquids. Media BD were used for growth of the isolated Bacillus sp. And incubated for 15 days. After this period, was added 3 g of agar in each flask, and autoclaved broth and poured into Petri dishes. In the center of the plates were placed discs culture of the pathogen. The experimental design was completely randomized with 11 treatments and six repetitions in both experiments. Statistical difference was found between the isolate and the control. Special mention to strains B12 ( Bacillus sp., B41 ( B. cereus , B22' ( B.pentothenticus , B45 ( B. cereus , B47 ( B. cereus that exhibited the lowest average diameter of the colony. To study the inhibition of mycelial growth of F. oxysporum f. sp. lycopersici by thermostatable metabolites five differ statistically from the control they are: B35 ( B. pumilus , B47 ( B. cereus , B22' ( B. pentothenticus , B12 ( Bacillus sp. and B41 ( B. cereus the latter two treatments showed the best results of the pathogen colony diameters and 3.81 to 2.89 cm, respective- ly. B12 and B41 Isolates showed that their antibiotic products were able to inhibit 67.88 % and 57,66 % of F. oxysporum f. sp. lycopersici . These results highlight the possibility of using isolates of the genus Bacillus in the fight against fusarium wilt in tomato.

  1. SP-100 Program overview

    International Nuclear Information System (INIS)

    Truscello, V.C.


    The SP-100 Program is expected to go through three phases: technology assessment and advancement, ground testing, and flight qualification. Currently the program is in the two- to three-year technology assessment and advancement stage. Goals are to identify the space nuclear power system concept that best meets anticipated requirements of future space missions, assess the technical feasibility of that concept, and establish a cost and schedule for developing the concept. The SP-100 Project Office has begun the implementation activities needed to meet these goals. With regard to refractory alloys, a better data base will be required before we move ahead in the program from technology assessment to ground demonstration

  2. Environmental interactions and the SP-100 power system

    International Nuclear Information System (INIS)

    Ferguson, D.C.


    The Civil Space Technology Initiative High-Capacity-Power Environmental Interactions Program has made great progress in defining and evaluating the interactions of the SP-100 power system with its expected ambient environments. The NASCAP/LEO and POLAR computer codes demonstrated that local electric fields at the user interface module are high. Therefore, particular attention must be paid to geometries and materials in this region to prevent arcing at conductor-insulator junctions in low Earth orbit. NASCAP/LEO and EPSAT computer models revealed that SP-100 payloads float about 100 V negative of the LEO plasma. In addition, ground tests and modeling done for the Space Station Freedom Electrical Grounding Tiger Team found that dielectric coatings often break down at such voltages in a plasma. Thus, surface coatings for SP-100 payloads should be carefully selected. Sputtering may also be a concern for long-duration missions in LEO at these voltages. Much work has been done on a sputtering model to evaluate surface material loss rates on SP-100 payloads. In ground plasma chamber tests of cables and cable insulators at SP-100 voltages, parasitic power losses due to the plasma current collected from possible pinholes or coating defects were quantified and shown to be small. Modeling revealed that the power loss from currents to other surfaces is also small. The atomic oxygen durability of SP-100 materials and coatings continues to be investigated in ground tests. In the upcoming Evaluation of Oxygen Interaction with Materials (EOIM-3) Shuttle flight experiment, a host of SP-100 materials will be evaluated for atomic oxygen durability in LEO. Finally, an evaluation of the interactions of the SP-100 power system with lunar and planetary environments has started. At a workshop on chemical and electrical interactions on Mars recently held at the NASA Lewis Research Center, many of primary interactions were identified

  3. SP-100/Brayton power system concepts

    International Nuclear Information System (INIS)

    Owen, D.F.


    Use of closed Brayton cycle (CBC) power conversion technology has been investigated for use with SP-100 reactors for space power systems. The CBC power conversion technology is being developed by Rockwell International under the Dynamic Isotype Power System (DIPS) and Space Station Freedom solar dynamic power system programs to provide highly efficient power conversion with radioisotype and solar collector heat sources. Characteristics including mass, radiator area, thermal power, and operating temperatures for systems utilizing SP-100 reactor and CBC power conversion technology were determined for systems in the 10-to 100-kWe power range. Possible SP-100 reactor/CBC power system configurations are presented. Advantages of CBC power conversion technology with regard to reactor thermal power, operating temperature, and development status are discussed

  4. Superficial disposition of the N-terminal region of the surfactant protein SP-C and the absence of specific SP-B-SP-C interactions in phospholipid bilayers

    DEFF Research Database (Denmark)

    Plasencia, I; Cruz, A; Casals, C


    . The fluorescence emission spectrum of Dns-SP-C in phospholipid bilayers is similar to the spectrum of dansyl-phosphatidylethanolamine, and indicates that the N-terminal end of the protein is located at the surface of the membranes and is exposed to the aqueous environment. In membranes containing...... phosphatidylglycerol (PG), the fluorescence of Dns-SP-C shows a 3-fold increase with respect to the fluorescence of phosphatidylcholine (PC), suggesting that electrostatic lipid-protein interactions induce important effects on the structure and disposition of the N-terminal segment of the protein in these membranes...... of the N-terminal segment of the protein into less polar environments that originate during protein lateral segregation. This suggests that conformation and interactions of the N-terminal segment of SP-C could be important in regulating the lateral distribution of the protein in surfactant bilayers...

  5. 76 FR 56876 - Proposed Collection; Comment Request for Forms 9779, 9779(SP), 9783, 9783(SP), 9787, 9787(SP... (United States)


    ... and 9789(SP), Electronic Federal Tax Payment System (EFTPS). DATES: Written comments should be received on or before November 14, 2011 to be assured of consideration. ADDRESSES: Direct all [email protected] . SUPPLEMENTARY INFORMATION: Title: Electronic Federal Tax Payment System (EFTPS). OMB...

  6. Mineralization of a Malaysian crude oil by Pseudomonas sp. and Achromabacter sp. isolated from coastal waters

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, J.; Ahmad, M.F.


    Regarded as being a potentially effective tool to combat oil pollution, bioremediation involves mineralization, i.e., the conversion of complex hydrocarbons into harmless CO{sub 2} and water by action of microorganisms. Therefore, in achieving optimum effectiveness from the application of these products on crude oil in local environments, the capability of the bacteria to mineralize hydrocarbons was evaluated. The microbial laboratory testing of mineralization on local oil degraders involved, first, isolation of bacteria found at a port located on the west coast of Peninsular Malaysia. Subsequently, these bacteria were identified by means of Biomereux`s API 20E and 20 NE systems and later screened by their growth on a Malaysian crude oil. Selected strains of Pseudomonas sp. and Achromabacter sp. were then exposed individually to a similar crude oil in a mineralization unit and monitored for 16 days for release of CO{sub 2}. Pseudomonas paucimobilis was found to produce more CO{sub 2} than Achromobacter sp. When tested under similar conditions, mixed populations of these two taxa produced more CO{sub 2} than that produced by any individual strain. Effective bioremediation of local crude in Malaysian waters can therefore be achieved from biochemically developed Pseudomonas sp. strains.

  7. SP (4,R) symmetry in light nuclei

    International Nuclear Information System (INIS)

    Peterson, D.R.


    A classification of nuclear states according to the noncompact sympletic Lie algebras sp(2n,R), n = 1, 2, 3, is investigated. Such a classification has recently been shown to be physically meaningful. This classification scheme is the appropriate generalization fo Elliott's SU 3 model of rotational states in deformed light nuclei to include core excitations. A restricted classification according to the Lie algebra, sp(4,R), is motivated. Truncation of the model space to a single sp(4,R) irreducible representation allows the inclusion of states possessing very high excitation energy. An sp(4,R) model study is performed on S = T = 0 positive-parity rotational bands in the deformed light nuclei 16 O and 24 Mg. States are included in the model space that possess up to 10h ω in excitation energy. Results for the B(E2) transition rates compare favorable with experiment, without resort to effective charges



    Padma Singh, Rekha Negi*, Vani Sharma, Alka Rani, Pallavi and Richa Prasad


    During present study Nattokinase which is a novel fibrinolytic enzyme was produced by Bacillus sp. To screen and extract nattokinase enzyme from Bacillus sp. were isolated from soil of different agricultural field by serial dilution method. Out of 10 isolate, one strain i.e. B3 produced nattokinase on screening medium. B3 was identified by biochemical characterization. The caseinolytic activity of Nattokinase was 0.526 U/ml and the selected isolate Bacillus sp. could produce active nattokinas...

  9. Wheat TaSP gene improves salt tolerance in transgenic Arabidopsis thaliana. (United States)

    Ma, Xiaoli; Cui, Weina; Liang, Wenji; Huang, Zhanjing


    A novel salt-induced gene with unknown functions was cloned through analysis of gene expression profile of a salt-tolerant wheat mutant RH8706-49 under salt stress. The gene was named Triticum aestivum salt-related protein (TaSP) and deposited in GenBank (Accession No. KF307326). Quantitative polymerase chain reaction (qPCR) results showed that TaSP expression was induced under salt, abscisic acid (ABA), and polyethylene glycol (PEG) stresses. Subcellular localization revealed that TaSP was mainly localized in cell membrane. Overexpression of TaSP in Arabidopsis could improve salt tolerance of 35S::TaSP transgenic Arabidopsis. 35S::TaSP transgenic Arabidopsis lines after salt stress presented better physiological indexes than the control group. In the non-invasive micro-test (NMT), an evident Na(+) excretion was observed at the root tip of salt-stressed 35S::TaSP transgenic Arabidopsis. TaSP promoter was cloned, and its beta-glucuronidase (GUS) activities before and after ABA, salt, cold, heat, and salicylic acid (SA) stresses were determined. Full-length TaSP promoter contained ABA and salt response elements. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. SP-100 initial startup and restart control strategy (United States)

    Halfen, Frank J.; Wong, Kwok K.; Switick, Dennis M.; Shukla, Jaikaran N.

    Startup control strategies for SP-100 are described. Revised control and operating strategies are discussed which have been developed and tested using the SP-100 dynamic simulation model Aries-GFS (Generic Flight System).

  11. Modular Stereoselective Synthesis of (1 -> 2)-C-Glycosides based on the sp(2)-sp(3) Suzuki-Miyaura Reaction

    Czech Academy of Sciences Publication Activity Database

    Oroszová, B.; Choutka, J.; Pohl, Radek; Parkan, K.


    Roč. 21, č. 19 (2015), s. 7043-7047 ISSN 0947-6539 Grant - others:GA ČR(CZ) GPP207/12/P713; GA ČR(CZ) GA15-17572S Institutional support: RVO:61388963 Keywords : C-disaccharides * C-glycosides * diastereoselectivity * Mitsunobu reaction * sp(2)-sp(3) coupling Subject RIV: CC - Organic Chemistry Impact factor: 5.771, year: 2015

  12. Cellulose powder from Cladophora sp. algae. (United States)

    Ek, R; Gustafsson, C; Nutt, A; Iversen, T; Nyström, C


    The surface are and crystallinity was measured on a cellulose powder made from Cladophora sp. algae. The algae cellulose powder was found to have a very high surface area (63.4 m2/g, N2 gas adsorption) and build up of cellulose with a high crystallinity (approximately 100%, solid state NMR). The high surface area was confirmed by calculations from atomic force microscope imaging of microfibrils from Cladophora sp. algae.

  13. Specialised predation by Palpimanus sp. (Araneae: Palpimanidae ...

    African Journals Online (AJOL)

    This is the first detailed report on the natural prey and the prey-capture tactics of a Palpimanus sp. from Entebbe (Uganda). Although this species fed occasionally on insects, its dominant prey in the field was other spiders, especially jumping spiders (Salticidae) and their eggs. Encounters between Palpimanus sp. and ...

  14. Preservacão de micélio de Batkoa sp. E. Furia sp. (Entomophthorales) em combinaçao com dessecantes e rudutores de oxigênio


    Leite, Luis G.; Alves, Sérgio B.; Filho, Antonio Batista; Almeida, J. E. M.; Roberts, Donald W.


    PRESERVATION OF BATKOA SP. AND FURIA SP. (ENTOMOPHTHORALES )DRY MYCELIUM WITH COMBINATIONS OF DESICCANTS AND OXYGEN REDUCERS. Formulation is the most difficult part of Entomophthorales development as biopesticides and bioacaricides, and has caused difficulty in evaluating the Batkoa sp. and Furia sp. for the control of the cercopids Mahanarva fimbriolata and Deois schach, pests of sugar-cane and pastures. A technique for producing dry mycelium of Entomophthorales was previously developed to a...

  15. Correlation of sp{sup 3} and sp{sup 2} fraction of carbon with electrical, optical and nano-mechanical properties of argon-diluted diamond-like carbon films

    Energy Technology Data Exchange (ETDEWEB)

    Dwivedi, Neeraj [Physics of Energy Harvesting Division, National Physical Laboratory (CSIR), Dr. K.S. Krishnan Road, New Delhi (India); Department of Physics, Indian Institute of Technology Delhi, New Delhi 110016 (India); Kumar, Sushil, E-mail: [Physics of Energy Harvesting Division, National Physical Laboratory (CSIR), Dr. K.S. Krishnan Road, New Delhi (India); Malik, H.K. [Department of Physics, Indian Institute of Technology Delhi, New Delhi 110016 (India); Govind [Surface Physics and Nano Structures Group, National Physical Laboratory (CSIR), Dr. K.S. Krishnan Road, New Delhi 110012 (India); Rauthan, C.M.S.; Panwar, O.S. [Physics of Energy Harvesting Division, National Physical Laboratory (CSIR), Dr. K.S. Krishnan Road, New Delhi (India)


    In the present work the correlation of electrical, optical and nano-mechanical properties of argon-diluted diamond-like carbon (Ar-DLC) thin films with sp{sup 3} and sp{sup 2} fractions of carbon have been explored. These Ar-DLC thin films have been deposited, under varying C{sub 2}H{sub 2} gas pressures from 25 to 75 mTorr, by radio frequency-plasma enhanced chemical vapor deposition technique. X-ray photoelectron spectroscopy studies are performed to estimate the sp{sup 3} and sp{sup 2} fractions of carbon by deconvoluting C 1s core level spectra. Various electrical, optical and nano-mechanical parameters such as conductivity, I-V characteristics, optical band gap, stress, hardness, elastic modulus, plastic resistance parameter, elastic recovery and plastic deformation energy have been estimated and then correlated with calculated sp{sup 3} and sp{sup 2} fractions of carbon and sp{sup 3}/sp{sup 2} ratios. Observed tremendous electrical, optical and nano-mechanical properties in Ar-DLC films deposited under high base pressure conditions made it a cost effective material for not only hard and protective coating applications but also for electronic and optoelectronic applications.

  16. Efficacy of Artesunate + Sulphadoxine-Pyrimethamine (AS + SP and Amodiaquine + Sulphadoxine-Pyrimethamine (AQ + SP for Uncomplicated falciparum Malaria in Equatorial Guinea (Central Africa

    Directory of Open Access Journals (Sweden)

    Pilar Charle


    Full Text Available Objectives. The objectives of the study were (i to evaluate the efficacy of combination drugs, such as artesunate + sulphadoxine-pyrimethamine (AS + SP and amodiaquine + sulphadoxine-pyripethamine (AQ + SP in treatment of uncomplicated falciparum malaria (ii to differentiate recrudescence from reinfection by analysing msp-1 and msp-2 genes of Plasmodium falciparum in treatment failure cases. Methods. We carried out an in vivo study in the year 2005 in 206 children between 6 to 59 months age groups. Of the 206, 120 received AQ + SP, and 86 received AS + SP. A clinical and parasitological followup during 14 days was undertaken. Finger-prick blood sample from each patient was taken on Whatman filter paper (no. 3 on days 0, 7, 14 and also the day when the parasite and symptoms reappeared for PCR analysis. Results. Late treatment failure was observed in 3.5% (4/114 with AQ + SP, and 2.5% (2/79 with AS + SP. The success rate was 96.5% with AQ + SP and 97.5% with AS + SP. No deaths and severe reactions were recorded. Out of the 6 treatment failure cases, one was reinfection as observed by PCR analysis of msp-1 and msp-2 genes on day 14. Discussion. Both the combinations found to be efficacious and safe and could be used as a first-line treatment for uncomplicated falciparum malaria in Equatorial Guinea.

  17. Potential Marine Fungi Hypocreaceae sp. as Agarase Enzyme to Hydrolyze Macroalgae Gelidium latifolium (Potensi Jamur Hypocreaceae sp. sebagai Enzim Agarase untuk menghidrolisis Makroalga Gelidium latifolium

    Directory of Open Access Journals (Sweden)

    Mujizat Kawaroe


    Full Text Available Agarase dapat mendegradasi agar ke oligosakarida dan memiliki banyak manfaat untuk makanan, kosmetik, dan lain-lain. Banyak spesies pendegradasi agar adalah organismelaut. Beberapa agarase telah diisolasi dari genera yang berbeda dari mikroorganisme yang ditemukan di air dan sedimen laut. Hypocreaceae sp. diisolasi dari air laut Pulau Pari, Kepulauan Seribu, Jakarta, Indonesia. Berdasarkan hasil identifikasi gen 16S rDNA dari 500 basis pasangan, isolat A10 memiliki 99% kesamaan dengan Hypocreaceae sp. Enzim agarase ekstraseluler dari Hypocreaceae sp. memiliki pH dan suhu optimum pada 8 TrisHCl (0,148 μ.mL-1 dan 50°C (0,182 μ.mL-1, masing-masing. Enzim Agarase dari Hypocreaceae sp. mencapai kondisi optimum pada aktivitas enzim tertinggi selama inkubasi dalam 24 jam (0,323 μ.mL-1. SDS page mengungkapkan bahwa ada dua band dari protein yang dihasilkan oleh agarase dari Hypocreaceae sp. yang berada di berat molekul 39 kDa dan 44 kDa dan hidrolisis Gelidium latifolium diperoleh 0,88% etanol. Kata kunci: enzim agarase, Hypocreaceae sp., hidrolisis, fungi, rDNA. Agarase can degradedagarto oligosaccharide and has a lot of benefits for food, cosmetics, and others. Many species of agar- degrader are marine-organism. Several agarases have been isolated from different genera of microorganisms found in seawater and marine sediments. Hypocreaceae sp. was isolated from sea water of Pari Islands, Seribu Islands, Jakarta, Indonesia. Based on the results of the 16S rDNA gene identification of 500 base pairs, A10 isolates had 99 % similarity toHypocreaceae sp. The extracellular agarase enzyme from Hypocreaceae sp. have optimum pH and temperature at 8 TrisHCl (0.148 µ.mL-1 and 50 °C (0.182 µ.mL-1, respectively. Agarase enzyme of Hypocreaceae sp. reach an optimum condition at the highest enzyme activity during incubation in 24 hours (0.323 µ.mL-1. SDS Page revealed that there are two bands of protein produced by agarase of Hypocreaceae sp. which are at

  18. Isolation of high-salinity-tolerant bacterial strains, Enterobacter sp., Serratia sp., Yersinia sp., for nitrification and aerobic denitrification under cyanogenic conditions. (United States)

    Mpongwana, N; Ntwampe, S K O; Mekuto, L; Akinpelu, E A; Dyantyi, S; Mpentshu, Y


    Cyanides (CN(-)) and soluble salts could potentially inhibit biological processes in wastewater treatment plants (WWTPs), such as nitrification and denitrification. Cyanide in wastewater can alter metabolic functions of microbial populations in WWTPs, thus significantly inhibiting nitrifier and denitrifier metabolic processes, rendering the water treatment processes ineffective. In this study, bacterial isolates that are tolerant to high salinity conditions, which are capable of nitrification and aerobic denitrification under cyanogenic conditions, were isolated from a poultry slaughterhouse effluent. Three of the bacterial isolates were found to be able to oxidise NH(4)-N in the presence of 65.91 mg/L of free cyanide (CN(-)) under saline conditions, i.e. 4.5% (w/v) NaCl. The isolates I, H and G, were identified as Enterobacter sp., Yersinia sp. and Serratia sp., respectively. Results showed that 81% (I), 71% (G) and 75% (H) of 400 mg/L NH(4)-N was biodegraded (nitrification) within 72 h, with the rates of biodegradation being suitably described by first order reactions, with rate constants being: 4.19 h(-1) (I), 4.21 h(-1) (H) and 3.79 h(-1) (G), respectively, with correlation coefficients ranging between 0.82 and 0.89. Chemical oxygen demand (COD) removal rates were 38% (I), 42% (H) and 48% (G), over a period of 168 h with COD reduction being highest at near neutral pH.

  19. In Vitro Antimicrobial Potential of the Lichen Parmotrema sp. Extracts against Various Pathogens. (United States)

    Chauhan, Ritika; Abraham, Jayanthi


    The ongoing increasing antibiotic resistance is one of the biggest challenges faced by global public health. The perennial need for new antimicrobials against a background of increasing antibiotic resistance in pathogenic and opportunistic microorganisms obliges the scientific community to constantly develop new drugs and antimicrobial agents. Lichens are known prolific sources of natural antimicrobial drugs and biologically active natural products. This study was aimed to explore in vitro antimicrobial activity of lichen Parmotrema sp. The methanol and aqueous extracts of lichen Parmotrema sp. was extracted using Soxhlet extractor. Antibiotic assessment of methanol and aqueous extracts was done against eight bacterial (Escherichia coli, Staphylococcus aureus, Proteus mirabilis, Salmonella sp., Shigella sp., Enterococci faecalis, Pseudomonas aeruginosa, Klebsiella pneumoniae,) clinical pathogens and five plant pathogenic fungal strains (Aspergillus terreus strain JAS1, Scedosporium sp. JAS1, Ganoderma sp. JAS4, Candida tropicalis and Fusarium sp.) by Kirby-Bauer method. The methanol lichen Parmotrema sp. extract inhibited all the test organisms. The highest antibacterial activity was found against Pseudomonas aeruginosa and Staphylococcus aureus. The weakest activity was manifested in Salmonella sp. and Scedosporium sp. JAS1. Strong antifungal effect was found against Ganoderma sp. JAS4 and Fusarium sp. The aqueous lichen Parmotrema sp. extract revealed neither antibacterial nor antifungal activity. The present study shows that tested lichen Parmotrema sp. extracts demonstrated a strong antimicrobial effect. That suggests the active components from methanol extracts of the investigated lichen Parmotrema sp. can be used as natural antimicrobial agent against pathogens.

  20. Inhibition of Sp1 functions by its sequestration into PML nuclear bodies.

    Directory of Open Access Journals (Sweden)

    June Li

    Full Text Available Promyelocytic leukemia nuclear bodies (PML NBs are comprised of PML and a striking variety of its associated proteins. Various cellular functions have been attributed to PML NBs, including the regulation of gene expression. We report here that induced expression of PML recruits Sp1 into PML NBs, leading to the reduction of Sp1 transactivation function. Specifically, Chromatin immunoprecipitation (ChIP assay demonstrated that induced expression of PML significantly diminishes the amount of Sp1 binding to its target gene promoter, immunofluorescence staining showed dramatic increase in the co-localization between PML and Sp1 upon induction of PML expression, moreover, PML and Sp1 co-fractionated in the core nuclear matrix. Our study further showed that PML promotes SUMOylation of Sp1 in a RING-motif-dependent manner, SUMOylation of Sp1 facilitates physical interaction between Sp1 and PML and recruitment of Sp1 into the PML NBs, the SUMO binding motif of PML was also important for its interaction with Sp1. The results of this study demonstrate a novel mechanism by which PML regulates gene expression through sequestration of the transcription factor into PML NBs.

  1. Linking surfactant protein SP-D and IL-13

    DEFF Research Database (Denmark)

    Qaseem, Asif S; Sonar, Sanchaita; Mahajan, Lakshna


    of allergen-IgE interaction, histamine release by sensitised mast cells, downregulation of specific IgE production, suppression of pulmonary and peripheral eosinophilia, inhibition of mechanisms that cause airway remodelling, and induction of apoptosis in sensitised eosinophils. SP-D can also shift helper T......Surfactant protein D (SP-D) is an innate immune molecule that plays a protective role against lung infection, allergy, asthma and inflammation. In vivo experiments with murine models have shown that SP-D can protect against allergic challenge via a range of mechanisms including inhibition...... cell polarisation following in vivo allergenic challenge, from pathogenic Th2 to a protective Th1 cytokine response. Interestingly, SP-D gene deficient (-/-) mice show an IL-13 over-expressing phenotype. IL-13 has been shown to be involved in the development of asthma. Transgenic mice over...

  2. Nutritional comparison of Spirulina sp powder by solid-state fermentation using Aspergillus sp (FNCL 6088) and Lactobacillus plantarum (FNCL 0127) (United States)

    Dewi, E. N.; Amalia, U.


    The Spirulina sp powder contains high levels of protein and Solid-State Fermentation (SSF) improved protein level. The aims of the study was to find the proximate contents in Spirulina sp’s powder fermentation. The experiments were conducted by SSF of Spirulina sp’s powder using fungi Aspergillus sp (FNCL 6088) and lactic acid bacteria Lactobacillus plantarum (FNCL 0127). SSF was carried out for 10 days at 35% moisture level. The protein contents of Spirulina sp’s powder fermented by L. plantarum were consistently lower (p fermentation. The Spirulina sp fermented products contained the highest level of protein after 6 days.

  3. Nanoscale transformation of sp2 to sp3 of graphite by slow highly charged ion irradiation

    International Nuclear Information System (INIS)

    Meguro, T.; Hida, A.; Koguchi, Y.; Miyamoto, S.; Yamamoto, Y.; Takai, H.; Maeda, K.; Aoyagi, Y.


    Nanoscale transformation of electronic states by highly charged ion (HCI) impact on graphite surfaces is described. The high potential energy of slow HCI, which induces multiple emission of electrons from the surface, provides a strong modification of the electronic states of the local area upon graphite surfaces. The HCI impact and the subsequent surface treatment either by electron injection from a scanning tunneling microscopy tip or by He-Cd laser irradiation induce a localized transition from sp 2 to sp 3 hybridization in graphite, resulting in the formation of nanoscale diamond-like structures (nanodiamond) at the impact region. From Raman spectroscopic measurements on sp 2 related peaks, it is found that the HCI irradiation creates vacancy complexes in contrast to ions having a lower charge state, which generate single vacancies. It is of interest that a single impact of HCI creates one nanodiamond structure, suggesting potential applications of HCI in nanoscale material processing

  4. Impact of serum SP-A and SP-D levels on comparison and prognosis of idiopathic pulmonary fibrosis


    Wang, Kai; Ju, Qing; Cao, Jing; Tang, Wenze; Zhang, Jian


    Abstract Background and objective: Idiopathic pulmonary fibrosis (IPF) has a poor prognosis in general; however, it is heterogeneous to detect relative biomarkers for predicting the disease progression. Serum biomarkers can be conveniently collected to detect and help to differentially diagnose IPF and predict IPF prognosis. This meta-analysis aimed to evaluate the use of serum surfactant proteins A and D (SP-A and SP-D) for differential diagnosis and prognosis of IPF. Methods: Relevant artic...

  5. Kultivasi Scenedesmus SP. Pada Medium Air Limbah


    Kawaroe, Mujizat


    Proses fotosintesis pada mikroalga membutuhkan CO2 dan cahaya matahari serta nutrien untuk pertumbuhannya. Kultivasi Scenedesmus sp. pada medium air limbah bertujuan guna mencukupi kebutuhan mikroalga akan nutrien dan mengurangi masukan dari bahan kimia yang terkandung dalam air limbah tersebut ke lingkungan. Kultivasi Scenedesmus sp. dilakukan selama tujuh hari pada medium air limbah industri tanpa penambahan nutri...

  6. Neorickettsia risticii, Rickettsia sp. and Bartonella sp. in Tadarida brasiliensis bats from Buenos Aires, Argentina. (United States)

    Cicuttin, Gabriel L; De Salvo, María N; La Rosa, Isabel; Dohmen, Federico E Gury


    Bats are potential reservoirs of many vector-borne bacterial pathogens. The aim of the present study was to detect species of Anaplasma, Ehrlichia, Neorickettsia, Rickettsia, Borrelia and Bartonella in Brazilian free-tailed bats (Tadarida brasiliensis, Molossidae) from Buenos Aires city, Argentina. Between 2012 and 2013, 61 T. brasiliensis from urban areas of Buenos Aires city were studied. The samples were molecularly screened by PCR and sequencing. Five bats (8.2%) were positive to Neorickettsia risticii, one (1.6%) was positive to Rickettsia sp. and three bats (4.9%) to Bartonella sp. For molecular characterization, the positive samples were subjected to amplification and sequencing of a fragment of p51 gene for N. risticii, a fragment of citrate synthase gene (gltA) for Rickettsia genus and a fragment of gltA for Bartonella genus. Phylogenetic tree was constructed using the maximum-likelihood method. Phylogenetic analysis of N. risticii detect in our study revealed that it relates to findings in the USA West Coast; Rickettsia sp. detected is phylogenetically within R. bellii group, which also includes many other Rickettsia endosymbionts of insects; and Bartonella sp. found is related to various Bartonella spp. described in Vespertilionidae bats, which are phylogenetically related to Molossidae. Our results are in accordance to previous findings, which demonstrate that insectivorous bats could be infected with vector-borne bacteria representing a potential risk to public health. Future research is necessary to clarify the circulation of these pathogens in bats from Buenos Aires. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Production of *sp67*Ga at the Oslo Cyclotron

    International Nuclear Information System (INIS)

    Bjoernstad, T.; Holtebekk, T.


    A method for production of *sp67*Ga at the Oslo Cyclotron is described. The method is based on the nuclear reaction *sp68*Zn (p,2n)*sp67*Ga. The target is natural zinc metal of thickness 1.3 mm fixed by a thin alloy layer to a copper disc for efficient cooling during irradiation. By applying a beam of 29 MeV protons, a maximum production yield of approx. 1.8 mCi/*my*Ah was obtained. By demanding a contamination level of *sp66*Ga <=1%, the ''useful'' yield after a decaytime of 88 h is approx. 0.8 mCi/*my*Ah. Gallium has been separated carrierfree from the zinc matrix by cation exchange from 7.5M hydrocloric acid solutions and prepared as citrate complex at pH 5.5. After sterile filtering, autoclavation, pyrogene testing and analysis for iron and zinc, the *sp67*Ga-radiopharmaceutical has been applied in human investigations at the Ullevaal hospital in Oslo. (Auth.)

  8. The effect of various concentration of tilapia (Oreochromis sp.) surimi for edible coating on the shelf-life of Pangasius sp. fillets (United States)

    Purnama, M. A. P.; Agustono; Sahidu, A. M.


    Pangasius sp. fillets prone to deterioration the quality that will affect the appearance and the shelf life of fillets. The effort to extend the shelf life of fish fillet that is by using an edible coating. Surimi can be used as a protein-based edible coating because they have superior inhibitory and mechanical properties compared to the polysaccharides based material. Surimi can be made from freshwater tilapia (Oreochromis sp.) fish. The experimental design used was Completely Randomized Design (CRD) with five treatments of surimi (0 gr, 2 gr, 4 gr, 6 gr, 8 gr) with four replications. The results showed that Pangasius sp. fillets with an edible coating 8 gr surimi have the highest value in the organoleptic test. The pH testing on Pangasius sp. fillets with edible coating 2 gr, 4 gr, 6 gr, and 8 gr surimi from the 0th hour to 18th hour have increased but slower than Pangasius sp. fillets without edible coating surimi. The best value of Total Plate Count (TPC) test is in edible coating 6 gr and 8 gr surimi as it is in accordance with SNI 2696:2013 at room temperature storage until the 18th hours.

  9. Draft Genome Sequence of Deep-Sea Alteromonas sp. Strain V450 Isolated from the Marine Sponge Leiodermatium sp. (United States)

    Wang, Guojun; Barrett, Nolan H; McCarthy, Peter J


    The proteobacterium Alteromonas sp. strain V450 was isolated from the Atlantic deep-sea sponge Leiodermatium sp. Here, we report the draft genome sequence of this strain, with a genome size of approx. 4.39 Mb and a G+C content of 44.01%. The results will aid deep-sea microbial ecology, evolution, and sponge-microbe association studies. Copyright © 2017 Wang et al.

  10. Bioremediation of acid fast red dye by Streptomyces globosus under ...

    African Journals Online (AJOL)

    Two different azo dyes known as acid fast red (AFR) and Congo red (CR) were examined for their decolorization by five strains of actinomycetes (Streptomyces globosus, Streptomyces alanosinicus, Streptomyces ruber, Streptomyces gancidicus, and Nocardiopsis aegyptia) under shake and static conditions. Streptomyces ...

  11. Vibrio sp. DSM 14379 pigment production--a competitive advantage in the environment? (United States)

    Starič, Nejc; Danevčič, Tjaša; Stopar, David


    The ability to produce several antibacterial agents greatly increases the chance of producer's survival. In this study, red-pigmented Vibrio sp. DSM 14379 and Bacillus sp., both isolated from the same sampling volume from estuarine waters of the Northern Adriatic Sea, were grown in a co-culture. The antibacterial activity of the red pigment extract was tested on Bacillus sp. in microtiter plates. The MIC(50) for Bacillus sp. was estimated to be around 10⁻⁵ mg/L. The extract prepared form the nonpigmented mutant of Vibrio sp. had no antibacterial effect. The pigment production of Vibrio sp. was studied under different physicochemical conditions. There was no pigment production at high or low temperatures, high or low salt concentrations in peptone yeast extract (PYE) medium, low glucose concentration in mineral growth medium or high glucose concentration in PYE medium. This indicates that the red pigment production is a luxurious good that Vibrio sp. makes only under favorable conditions. The Malthusian fitness of Bacillus sp. in a co-culture with Vibrio sp. under optimal environmental conditions dropped from 4.0 to -7.6, which corresponds to three orders of magnitude decrease in the number of CFU relative to the monoculture. The nonpigmented mutant of Vibrio sp. in a co-culture with Bacillus sp. had a significant antibacterial activity. This result shows that studying antibacterial properties in isolation (i.e. pigment extract only) may not reveal full antibacterial potential of the bacterial strain. The red pigment is a redundant antibacterial agent of Vibrio sp.

  12. On the fourth Diadema species (Diadema-sp) from Japan. (United States)

    Chow, Seinen; Kajigaya, Yoshikazu; Kurogi, Hiroaki; Niwa, Kentaro; Shibuno, Takuro; Nanami, Atsushi; Kiyomoto, Setuo


    Four long-spined sea urchin species in the genus Diadema are known to occur around the Japanese Archipelago. Three species (D. savignyi, D. setosum, and D. paucispinum) are widely distributed in the Indo-Pacific Ocean. The fourth species was detected by DNA analysis among samples originally collected as D. savignyi or D. setosum in Japan and the Marshall Islands and tentatively designated as Diadema-sp, remaining an undescribed species. We analyzed nucleotide sequences of the cytochrome oxidase I (COI) gene in the "D. savignyi-like" samples, and found all 17 individuals collected in the mainland of Japan (Sagami Bay and Kyushu) to be Diadema-sp, but all nine in the Ryukyu Archipelago (Okinawa and Ishigaki Islands) to be D. savignyi, with large nucleotide sequence difference between them (11.0%±1.7 SE). Diadema-sp and D. savignyi shared Y-shaped blue lines of iridophores along the interambulacrals, but individuals of Diadema-sp typically exhibited a conspicuous white streak at the fork of the Y-shaped blue iridophore lines, while this feature was absent in D. savignyi. Also, the central axis of the Y-shaped blue lines of iridophores was approximately twice as long as the V-component in D. savignyi whereas it was of similar length in Diadema-sp. Two parallel lines were observed to constitute the central axis of the Y-shaped blue lines in both species, but these were considerably narrower in Diadema-sp. Despite marked morphological and genetic differences, it appears that Diadema-sp has been mis-identified as D. savignyi for more than half a century.

  13. Draft Whole-Genome Sequence of Serratia sp. Strain TEL, Associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae) Isolated from a Grassland in South Africa


    Lephoto, Tiisetso E.; Featherston, Jonathan; Gray, Vincent M.


    Here, we report on the draft genome sequence of Serratia sp. strain TEL, associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae, KM492926) isolated from a grassland in Suikerbosrand Nature Reserve near Johannesburg in South Africa. Serratia sp. strain TEL has a genome size of 5,000,541 bp with 4,647 genes and a G+C content of 59.1%.

  14. Späte Mutterschaft – (keine biografische Entscheidung

    Directory of Open Access Journals (Sweden)

    Martina Beham


    Full Text Available Der Übergang in die Mutterschaft findet zunehmend später statt. Über die Gründe liegen zahlreiche Vermutungen und einige theoretische Diskussionen, aber kaum empirische Befunde vor. Die Autorinnen möchten mit ihrer Studie einen Beitrag zum Abbau dieses Forschungsdefizits leisten. In ihrer empirisch-biografischen Untersuchung gehen Ingrid Herlyn und Dorothea Krüger der Frage nach, ob späte Erstmutterschaft ein neues biografisches Muster der Familiengründung darstellt oder ob Mutterschaft nach wie vor eine selbstverständlich anerkannte Norm ist, deren Realisierung im Lebenslauf lediglich zeitlich später stattfindet.

  15. Post-neonatal drop in alveolar SP-A expression

    DEFF Research Database (Denmark)

    Stray-Pedersen, Arne; Vege, Ashild; Stray-Pedersen, Asbjorg


    BACKGROUND: Surfactant protein A (SP-A) is synthesized in the lung and is a part of the innate immune system. The aim of this study was to evaluate the expression of SP-A in lung tissue from fetuses, infants, children and adults with special regard to sudden infant death syndrome (SIDS). METHODS......: A total of 160 cases were studied; 19 fetuses and neonates, 59 SIDS and 49 explained infant deaths below 1 year of age, 19 toddlers and 14 adults. Immunohistochemical detection of SP-A using monoclonal antibodies was performed by microscopy of lung tissue specimens collected at autopsy. A scoring system...

  16. The SP Theory of Intelligence: Benefits and Applications

    Directory of Open Access Journals (Sweden)

    J. Gerard Wolff


    Full Text Available This article describes existing and expected benefits of the SP theory ofintelligence, and some potential applications. The theory aims to simplify and integrate ideasacross artificial intelligence, mainstream computing, and human perception and cognition,with information compression as a unifying theme. It combines conceptual simplicitywith descriptive and explanatory power across several areas of computing and cognition.In the SP machine—an expression of the SP theory which is currently realized in theform of a computer model—there is potential for an overall simplification of computingsystems, including software. The SP theory promises deeper insights and better solutions inseveral areas of application including, most notably, unsupervised learning, natural languageprocessing, autonomous robots, computer vision, intelligent databases, software engineering,information compression, medical diagnosis and big data. There is also potential inareas such as the semantic web, bioinformatics, structuring of documents, the detection ofcomputer viruses, data fusion, new kinds of computer, and the development of scientifictheories. The theory promises seamless integration of structures and functions within andbetween different areas of application. The potential value, worldwide, of these benefits andapplications is at least $190 billion each year. Further development would be facilitatedby the creation of a high-parallel, open-source version of the SP machine, available toresearchers everywhere.

  17. SP-100 reactor cell activation

    International Nuclear Information System (INIS)

    Wilcox, A.D.


    There are plans to test the SP-100 space reactor for 2 yr in the test facility shown in Figure 1. The vacuum vessel will be in the reactor experiment (RX) cell surrounded by an inert gas atmosphere. It is proposed that the reactor test cell could contain removable-water- shielding tanks to reduce the residual activation dose rates in the test cell after the tests are completed. This reduction will allow the facility to be considered for other uses after the SP-100 tests are completed. The radiation dose rates in the test cell were calculated for several configurations of water-shielding tanks to help evaluate this concept

  18. The gamma ray spectrometer GA.SP

    Energy Technology Data Exchange (ETDEWEB)

    Bazzacco, D [Instituto Nazionale di Fisica Nucleare, Sezione di Padova, Padova (Italy)


    GA.SP is a general purpose 4{pi} detector array for advanced {gamma}-spectroscopy and, in the same time, a suitable system for reaction mechanism studies. The detector is sited at the LNL Tandem+Linac accelerator and has been built as a joint project of INFN Padova, LNL, Milano and Firenze. The array consists of 40 Compton suppressed HPGe detectors and of a 4{pi} calorimeter composed of 80 BGO crystals. The detector houses a reaction chamber of 34 cm diameter where a charged particles multiplicity filter composed of 40 Si detectors is going to be installed. Evaporation residues produced in the centre of GA.SP can be injected into the recoil mass spectrometer (RMS, named CAMEL) in use at LNL, without the need to remove any of the gamma detectors. The coupled operation of GA.SP, RMS and Si ball will give a unique instrument for identification and study of weak reaction channels. (author). 6 figs.

  19. The gamma ray spectrometer GA.SP

    International Nuclear Information System (INIS)

    Bazzacco, D.


    GA.SP is a general purpose 4π detector array for advanced γ-spectroscopy and, in the same time, a suitable system for reaction mechanism studies. The detector is sited at the LNL Tandem+Linac accelerator and has been built as a joint project of INFN Padova, LNL, Milano and Firenze. The array consists of 40 Compton suppressed HPGe detectors and of a 4π calorimeter composed of 80 BGO crystals. The detector houses a reaction chamber of 34 cm diameter where a charged particles multiplicity filter composed of 40 Si detectors is going to be installed. Evaporation residues produced in the centre of GA.SP can be injected into the recoil mass spectrometer (RMS, named CAMEL) in use at LNL, without the need to remove any of the gamma detectors. The coupled operation of GA.SP, RMS and Si ball will give a unique instrument for identification and study of weak reaction channels. (author). 6 figs

  20. *sp131*I-3-iodobenzylguanidine (*sp131*I-3-IBG) as a scintigraphic agent for the visualization of adrenal medulla tumors

    International Nuclear Information System (INIS)

    Heggeli, D.E.; Brorson, B.I.; Bremper, P.O.


    A method of labelling 3-iodobenzylguanidine with *sp131*I is described. 3-IBG . 0.5 H*sb2*SO*sb4* and Cu(II)SO*sb4* were dissolved in a 0.1 M NH*sb4*H*sb2*PO*sb4* buffer and mixed with *sp131*I-NaI. The solution was evaporated to dryness by heating. After addition of water, the solution was heated with reflux for two hours. The I*sp-* ions were removed after labelling by anionic exchange chromatography. The final product was made isotonic and bacteriostatic by the addition of acetate buffer, saline and benzylalcohol. The product was filtered through a membrane filter with a pore size of 0.22*my*m and was apyrogenically tested by limulus test. The tumors of adrenal medulla, pheochromocytomas and neuroplastomas may in some cases be small or located extra-adrenally. In those cases *sp131*I-labelled 3-IBG is a valuable tool, since 3-IBG concentrates in adrenal medulla tumors because ot its analogy to the catecholamines. Injecting a dose of 0.5 mCi *sp131*I-3-IBG (2.5 mCi/mg), which is an adult dose, allows the scintigraphic localization of the tumours, thus guiding the surgeon. Adrenal uptake in mice and dog is described in the report, as well as a rapid method for the control of radiochemical purity. The radioactive concentration of the *sp131*I-3-IBG has been found to be important for the radiochemical stability of the product. (RF)

  1. Sp1 and Sp3 Are the Transcription Activators of Human ek1 Promoter in TSA-Treated Human Colon Carcinoma Cells. (United States)

    Kuan, Chee Sian; See Too, Wei Cun; Few, Ling Ling


    Ethanolamine kinase (EK) catalyzes the phosphorylation of ethanolamine, the first step in the CDP-ethanolamine pathway for the biosynthesis of phosphatidylethanolamine (PE). Human EK exists as EK1, EK2α and EK2β isoforms, encoded by two separate genes, named ek1 and ek2. EK activity is stimulated by carcinogens and oncogenes, suggesting the involvement of EK in carcinogenesis. Currently, little is known about EK transcriptional regulation by endogenous or exogenous signals, and the ek gene promoter has never been studied. In this report, we mapped the important regulatory regions in the human ek1 promoter. 5' deletion analysis and site-directed mutagenesis identified a Sp site at position (-40/-31) that was essential for the basal transcription of this gene. Treatment of HCT116 cells with trichostatin A (TSA), a histone deacetylase inhibitor, significantly upregulated the ek1 promoter activity through the Sp(-40/-31) site and increased the endogenous expression of ek1. Chromatin immunoprecipitation assay revealed that TSA increased the binding of Sp1, Sp3 and RNA polymerase II to the ek1 promoter in HCT116 cells. The effect of TSA on ek1 promoter activity was cell-line specific as TSA treatment did not affect ek1 promoter activity in HepG2 cells. In conclusion, we showed that Sp1 and Sp3 are not only essential for the basal transcription of the ek1 gene, their accessibility to the target site on the ek1 promoter is regulated by histone protein modification in a cell line dependent manner.

  2. Anomalous self potential (sp) log signatures observed in a water ...

    African Journals Online (AJOL)

    Geophysical logging was done after drilling had been completed in a water well at Okwudor, South Eastern Nigeria. Three electric logs were run viz: Self Potential (SP), Resistivity N16″ and N64″ logs. An anomaly was observed in the SP log. The SP results from this well show some deviation from the standard norm.

  3. Biosorption of uranium by Azolla, SP, Brazil

    International Nuclear Information System (INIS)

    Vieira, Ludmila C.; Alves, Eliakim G.; Marumo, Julio T.; Ferreira, Rafael V. de P.; Canevesi, Rafael L.S.; Silva, Edson A.


    Radioactive liquid waste needs special attention and requires suitable treatment before deposition. Among the potential technologies under development for the treatment of liquid radioactive wastes the biosorption has been highlighted by being an efficient and low cost technique. Biosorption process involves the exchange of ions contained in the biomass matrix by others present in solution. There are many biomasses that could be applied in treatment of radioactive wastes, for example, agricultural residues and macrophyte. The aim of this study is evaluate the ability of the Azolla sp., a floating aquatic plant, to absorb uranium in solution. Azolla sp. is a macrophyte that has been used to treat effluents containing heavy metals. The biosorption capacity of uranium by Azolla sp. was experimentally determined and modeled by isotherms. Experiments were performed to determine metal uptake, and then the solutions were analyzed by inductively coupled plasma optical emission spectrometry (ICP-OES). The isotherms applied to model the data was Langmuir, Freundlich, Sips Toth, Redlich Peternson, Two-Site-Langmuir, Radke Prausnitz to develop a technique for the treatment of radioactive liquid waste generated at the Nuclear and Energy Research Institute (IPEN-CNEN/SP), Brazil. (author)

  4. Biosorption of uranium by Azolla, SP, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, Ludmila C.; Alves, Eliakim G.; Marumo, Julio T., E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Ferreira, Rafael V. de P., E-mail: [Itatijuca Biotech, Sao Paulo, SP (Brazil); Canevesi, Rafael L.S.; Silva, Edson A., E-mail: [Universidade Estadual do Oeste Parana (UNIOESTE), Toledo, PR (Brazil)


    Radioactive liquid waste needs special attention and requires suitable treatment before deposition. Among the potential technologies under development for the treatment of liquid radioactive wastes the biosorption has been highlighted by being an efficient and low cost technique. Biosorption process involves the exchange of ions contained in the biomass matrix by others present in solution. There are many biomasses that could be applied in treatment of radioactive wastes, for example, agricultural residues and macrophyte. The aim of this study is evaluate the ability of the Azolla sp., a floating aquatic plant, to absorb uranium in solution. Azolla sp. is a macrophyte that has been used to treat effluents containing heavy metals. The biosorption capacity of uranium by Azolla sp. was experimentally determined and modeled by isotherms. Experiments were performed to determine metal uptake, and then the solutions were analyzed by inductively coupled plasma optical emission spectrometry (ICP-OES). The isotherms applied to model the data was Langmuir, Freundlich, Sips Toth, Redlich Peternson, Two-Site-Langmuir, Radke Prausnitz to develop a technique for the treatment of radioactive liquid waste generated at the Nuclear and Energy Research Institute (IPEN-CNEN/SP), Brazil. (author)

  5. A comparative study on phyllosphere nitrogen fixation by newly isolated Corynebacterium sp. & Flavobacterium sp. and their potentialities as biofertilizer. (United States)

    Giri, S; Pati, B R


    A number of nitrogen fixing bacteria has been isolated from forest phyllosphere on the basis of nitrogenase activity. Among them two best isolates are selected and identified as Corynebacterium sp. AN1 & Flavobacterium sp. TK2 able to reduce 88 and 132 n mol of acetylene (10(8)cells(-1)h(-1)) respectively. They were grown in large amount and sprayed on the phyllosphere of maize plants as a substitute for nitrogenous fertilizer. Marked improvements in growth and total nitrogen content of the plant have been observed by the application of these nitrogen-fixing bacteria. An average 30-37% increase in yield was obtained, which is nearer to chemical fertilizer treatment. Comparatively better effect was obtained by application of Flavobacterium sp.

  6. SP@CE - An SP-based programming model for consumer electronics streaming applications

    NARCIS (Netherlands)

    Varbanescu, Ana Lucia; Nijhuis, Maik; Escribano, Arturo González; Sips, Henk; Bos, Herbert; Bal, Henri


    Efficient programming of multimedia streaming applications for Consumer Electronics (CE) devices is not trivial. As a solution for this problem, we present SP@CE, a novel programming model designed to balance the specific requirements of CE streaming applications with the simplicity and efficiency

  7. Draft Whole-Genome Sequence of Serratia sp. Strain TEL, Associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae) Isolated from a Grassland in South Africa. (United States)

    Lephoto, Tiisetso E; Featherston, Jonathan; Gray, Vincent M


    Here, we report on the draft genome sequence of Serratia sp. strain TEL, associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae, KM492926) isolated from a grassland in Suikerbosrand Nature Reserve near Johannesburg in South Africa. Serratia sp. strain TEL has a genome size of 5,000,541 bp with 4,647 genes and a G+C content of 59.1%. Copyright © 2015 Lephoto et al.

  8. Evolution of space food in Nostoc sp. HK-01 (United States)

    Tomita-Yokotani, Kaori; Yamashita, Masamichi; Hashimoto, Hirofumi; Sato, Seigo; Kimura, Yasuko; Katoh, Hiroshi; Arai, Mayumi


    Habitation in outer space is one of our challenges. We have been studying future space agriculture to provide food and oxygen for the habitation area in the space environment, on Mars. A cyanobacteria, Nostoc sp. HK-01, has high several outer space environmental tolerance. We have already confirmed that Nostoc sp.HK-01 had an ability to grow for over several years on the Martian regolith simulant in a laboratory experiment. Nostoc sp HK-01 would have high contribution to change the atmosphere in Mars as a photosynthetic creature. In outer environment, all of materials have to circulate for all of creature living in artificial eco-systems on Mars. This material has several functions as the utilization in space agriculture. Here, we are proposing using them as a food after its growing on Mars. We are trying to determine the best conditions and evolution for space food using Nostoc sp.HK-01 and studying the proposal of utilization of cyanobacteria, Nostoc sp HK-01, for the variation of meal as space agriculture.

  9. Functions for fission yeast splicing factors SpSlu7 and SpPrp18 in alternative splice-site choice and stress-specific regulated splicing.

    Directory of Open Access Journals (Sweden)

    Geetha Melangath

    Full Text Available Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3'ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5'ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5'ss in dtd1+ intron 1 and of an upstream alternative 3'ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5'ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5' ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3'ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional

  10. Ocorrência de Babesia sp em pequenos roedores no Brasil Occurrence of Babesia sp in small rodents in Brazil

    Directory of Open Access Journals (Sweden)

    G.S. Gazeta


    Full Text Available Foi analisada a ocorrência de babesiose em pequenos roedores nos municípios de Silva Jardim e Nova lguaçu, Estado do Rio de Janeiro. Foram capturados 44 roedores de seis espécies diferentes e entre eles a prevalência da infecção foi de 27,3%. Rattus norvegicus foi considerado o principal reservatório (50,0% e Oligoryzomys nigripes como novo hospedeiro para Babesia sp. Este foi o primeiro relato de Babesia sp. em roedores no Brasil. A freqüência de roedores positivos e o risco de infecção dos roedores não diferiram entre as áreas estudadas.The occurrence of babesiosis was studied in 44 small rodents of six species captured in Silva Jardim and Nova lguaçu counties, State of Rio de Janeiro, Brazil. The prevalence of injection was 27.3%. Rattus norvegicus was considered as the main reservoir and Oligoryzomys nigripes as a new host to Babesia sp. The frequency and the risk of rodent infection were considered equal among the studied areas. This is the first report of Babesia sp in small rodents in Brazil.

  11. Uji Aktivitas Antibakteri Ekstrak Daun Mayana Jantan (Coleus Atropurpureus Benth) Terhadap Pertumbuhan Bakteri Streptococcus SP. Dan Pseudomonas SP.


    Muljono, Patrick; Fatimawali; Manampiring, Aaltje E


    : The painted nettle (Coleus atropurpureus benth) is a plant that is known to have medicinal properties, especially the leaf. The active compounds that are contained in the leafs are thought to work as an antibacterial. This study aims to measure the inhibitory strength of painted nettle leaf (Coleus atropurpureus benth) extract against the growth of Streptococcus sp. and Pseudomonas sp. This was an experimental laboratory study. The polar extract of painted nettle leaf (Coleus atropurpureus ...

  12. On the fourth Diadema species (Diadema-sp from Japan.

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    Full Text Available Four long-spined sea urchin species in the genus Diadema are known to occur around the Japanese Archipelago. Three species (D. savignyi, D. setosum, and D. paucispinum are widely distributed in the Indo-Pacific Ocean. The fourth species was detected by DNA analysis among samples originally collected as D. savignyi or D. setosum in Japan and the Marshall Islands and tentatively designated as Diadema-sp, remaining an undescribed species. We analyzed nucleotide sequences of the cytochrome oxidase I (COI gene in the "D. savignyi-like" samples, and found all 17 individuals collected in the mainland of Japan (Sagami Bay and Kyushu to be Diadema-sp, but all nine in the Ryukyu Archipelago (Okinawa and Ishigaki Islands to be D. savignyi, with large nucleotide sequence difference between them (11.0%±1.7 SE. Diadema-sp and D. savignyi shared Y-shaped blue lines of iridophores along the interambulacrals, but individuals of Diadema-sp typically exhibited a conspicuous white streak at the fork of the Y-shaped blue iridophore lines, while this feature was absent in D. savignyi. Also, the central axis of the Y-shaped blue lines of iridophores was approximately twice as long as the V-component in D. savignyi whereas it was of similar length in Diadema-sp. Two parallel lines were observed to constitute the central axis of the Y-shaped blue lines in both species, but these were considerably narrower in Diadema-sp. Despite marked morphological and genetic differences, it appears that Diadema-sp has been mis-identified as D. savignyi for more than half a century.

  13. Optimization of Culture Medium for the Growth of Candida sp. and Blastobotrys sp. as Starter Culture in Fermentation of Cocoa Beans (Theobroma cacao) Using Response Surface Methodology (RSM). (United States)

    Mahazar, N H; Zakuan, Z; Norhayati, H; MeorHussin, A S; Rukayadi, Y


    Inoculation of starter culture in cocoa bean fermentation produces consistent, predictable and high quality of fermented cocoa beans. It is important to produce healthy inoculum in cocoa bean fermentation for better fermented products. Inoculum could minimize the length of the lag phase in fermentation. The purpose of this study was to optimize the component of culture medium for the maximum cultivation of Candida sp. and Blastobotrys sp. Molasses and yeast extract were chosen as medium composition and Response Surface Methodology (RSM) was then employed to optimize the molasses and yeast extract. Maximum growth of Candida sp. (7.63 log CFU mL-1) and Blastobotrys sp. (8.30 log CFU mL-1) were obtained from the fermentation. Optimum culture media for the growth of Candida sp., consist of 10% (w/v) molasses and 2% (w/v) yeast extract, while for Blastobotrys sp., were 1.94% (w/v) molasses and 2% (w/v) yeast extract. This study shows that culture medium consists of molasses and yeast extract were able to produce maximum growth of Candida sp. and Blastobotrys sp., as a starter culture for cocoa bean fermentation.

  14. Evaluación de la estabilidad de Trichoderma sp. y Azotobacter sp. conservados por diferentes métodos

    Directory of Open Access Journals (Sweden)

    Yvonne Sarmiento Rangel


    Full Text Available Título en ingles: Evaluation of the stability of Trichoderma sp. and Azotobacter sp.  preserved by different methods Resumen En el Laboratorio de Microbiología Aplicada de la Universidad Francisco de Paula Santander (Cúcuta, Colombia constantemente ingresan al Banco de Cepas, cultivos microbianos de interés biotecnológico, especialmente del sector agrícola, los cuales son utilizados en las actividades de docencia e investigación.  Por esta razón, existe el interés de mantener viables a través del tiempo estos cultivos microbianos, para lo cual se realizó en esta investigación, la evaluación de la estabilidad de los aislados de Trichoderma sp. y Azotobacter sp., utilizando  las técnicas de conservación  en viales con solución salina estéril (0,85% NaCl en refrigeración (4°C y temperatura ambiente (30°C, suelo estéril en refrigeración (4°C, comparados con la metodología de repiques sucesivos como tratamiento control.  Los resultados no mostraron diferencias significativas según el Test de Duncan (P≤0,05 en  la tasa de supervivencia microbiana entre los métodos de conservación. Sin embargo, se observó en las técnicas de viales con solución salina  estéril y suelo estéril mantenidos en refrigeración, mayor estabilidad en la concentración celular durante los cuatros meses de evaluación, sin registrar contaminación en los cultivos.  Así mismo, se registró un óptimo crecimiento macroscópico de los cultivos microbianos y sus características microscópicas se mantuvieron estables en estos dos métodos de conservación.  Por esta razón, se seleccionaron como técnicas de conservación de estos microorganismos, teniendo en cuenta además, ventajas como la facilidad de la técnica, disponibilidad de equipos, materiales y personal con los que se cuenta en el laboratorio.  Palabras clave: banco de cepas, conservación de microorganismos, viabilidad celular, Trichoderma sp., Azotobacter sp. Abstract In the

  15. SpF: Enabling Petascale Performance for Pseudospectral Dynamo Models (United States)

    Jiang, W.; Clune, T.; Vriesema, J.; Gutmann, G.


    Pseudospectral (PS) methods possess a number of characteristics (e.g., efficiency, accuracy, natural boundary conditions) that are extremely desirable for dynamo models. Unfortunately, dynamo models based upon PS methods face a number of daunting challenges, which include exposing additional parallelism, leveraging hardware accelerators, exploiting hybrid parallelism, and improving the scalability of global memory transposes. Although these issues are a concern for most models, solutions for PS methods tend to require far more pervasive changes to underlying data and control structures. Further, improvements in performance in one model are difficult to transfer to other models, resulting in significant duplication of effort across the research community. We have developed an extensible software framework for pseudospectral methods called SpF that is intended to enable extreme scalability and optimal performance. High-level abstractions provided by SpF unburden applications of the responsibility of managing domain decomposition and load balance while reducing the changes in code required to adapt to new computing architectures. The key design concept in SpF is that each phase of the numerical calculation is partitioned into disjoint numerical 'kernels' that can be performed entirely in-processor. The granularity of domain-decomposition provided by SpF is only constrained by the data-locality requirements of these kernels. SpF builds on top of optimized vendor libraries for common numerical operations such as transforms, matrix solvers, etc., but can also be configured to use open source alternatives for portability. SpF includes several alternative schemes for global data redistribution and is expected to serve as an ideal testbed for further research into optimal approaches for different network architectures. In this presentation, we will describe the basic architecture of SpF as well as preliminary performance data and experience with adapting legacy dynamo codes

  16. Shewanella hafniensis sp. nov. and Shewanella morhuae sp. nov., isolated from marine fish of the Baltic Sea

    DEFF Research Database (Denmark)

    Satomi, M.; Vogel, Birte Fonnesbech; Gram, Lone


    Two novel species belonging to the genus Shewanella are described on the basis of their phenotypic characteristics, phylogenetic analyses of 16S rRNA and gyrB gene sequences and levels of DNA-DNA hybridization. A total of 47 strains belonging to two novel Gram-negative, psychrotolerant, H2S-produ...... species, Shewanella hafniensis sp. nov. (type strain P010T=ATCC BAA-1207T=NBRC 100975T) and Shewanella morhuae sp. nov. (type strain U1417T=ATCC BAA-1205T=NBRC 100978T), are described....

  17. Kroyeria deetsi n.sp. (Kroyeriidae: Siphonostomatoida), a parasitic ...

    African Journals Online (AJOL)

    Kroyeria deetsi n.sp. (Kroyeriidae: Siphonostomatoida) is described from both sexes collected from the gills of spinner sharks, Carcharhinus brevipinna (Müller & Henle, 1839), captured in the Indian Ocean off the coast of South Africa. Kroyeria deetsi n.sp. can easily be distinguished from all of its congeners because the ...

  18. Nota sobre infecção por Salmonella sp. e Shigella sp. em bugios-ruivos, Alouatta clamitans Cabrera, 1940 (Primates: Atelidae mantidos em cativeiro

    Directory of Open Access Journals (Sweden)

    Júlio César de Souza Júnior


    Full Text Available Amostras de fezes de bugios-ruivos cativos foram investigadas quanto a presença de Salmonella sp. e Shigella sp. O padrão de sensibilidade a antibióticos foi testado. Este é o primeiro relato de infecção assintomática por Salmonella sp. nesta espécie. Não foi detectada infecção por Shigella sp. Destaca-se a importância de investigação em animais submetidos a translocação ou a reintrodução e a necessidade de inquéritos periódicos em populações cativas a fim de se evitar agravos ocupacionais.

  19. Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: Tick-Borne Parasites Associated with Mortality in the Black Rhinoceros (Diceros bicornis)


    Nijhof, Ard M.; Penzhorn, Banie L.; Lynen, Godelieve; Mollel, Johnson O.; Morkel, Pete; Bekker, Cornelis P. J.; Jongejan, Frans


    A novel Babesia species, designated Babesia bicornis sp. nov., was identified in three black rhinoceroses (Diceros bicornis) that died in wildlife areas in Tanzania and South Africa. Screening of black rhinoceroses in South Africa revealed, in addition to B. bicornis, a second parasite, designated Theileria bicornis sp. nov.

  20. Multimeric and trimeric subunit SP-D are interconvertible structures with distinct ligand interaction

    DEFF Research Database (Denmark)

    Sørensen, Grith Lykke; Hoegh, Silje V; Leth-Larsen, Rikke


    -D compared to Met11 SP-D. Multimerization has proven important for enhancement of microbial phagocytosis. In the present study defined multimeric forms of Met11Thr SP-D were isolated from human amniotic fluid. Implementation of ManNAc-affinity chromatography allowed high recovery of natural trimeric SP......-D multimers. Trimeric SP-D subunits also showed greater binding to endogenous lipoproteins: LDL, oxLDL, and HDL, than multimeric SP-D. In conclusion, purified trimeric and multimeric SP-D represent separate and only partly interconvertible molecular populations with distinct biochemical properties....

  1. Adsorption of procion red and congo red dyes using microalgae Spirulina sp

    Directory of Open Access Journals (Sweden)

    Risfidian Mohadi


    Full Text Available Adsorption of procion red and congo red dyes using microalgae Spirulina sp was conducted. Spirulina sp was obtained by cultivation and production in laboratory scale. Spirulina sp was used as adsorbent for adsorption of dyes. Adsorption process was studied by kinetic and thermodynamic in order to know the adsorption phenomena. The results showed that kinetically congo red is reactive than procion red on Spirulina sp. On the other hand, thermodynamically procion red was stable than congo red on Spirulina sp which was indicated by adsorption capacity, enthalpy, and entropy.


    Directory of Open Access Journals (Sweden)

    C. I. De Campos


    Full Text Available Estudos sobre novos adesivos ou resinas para colagem de madeira e derivados estão sendo realizados com a intenção de diminuir o impacto ambiental sem alterar suas propriedades. Por este motivo, novas formulações de adesivos PVA (Acetato de Polivinila vêm sendo desenvolvidas. Este trabalho testou a utilização deste adesivo na produção de compensado de Eucalyptus sp. e Pinus sp., com tempo e temperatura de prensagem, respectivamente, de 10 minutos e90°C. Foram realizados os ensaios físicos de densidade, teor de umidade e absorção, e os ensaios mecânicos de flexão estática e de resistência ao cisalhamento na linha de cola, todos de acordo com as normas ABNT. Obtiveram-se bons resultados com relação à resistência ao cisalhamento na linha de cola, a qual foi superior para os adesivos PVA, se comparados com compensados produzidos com ureia-formaldeído e o fenol-formaldeído, enquanto que os resultados de MOE e MOR apresentaram-se inferiores em ambos os casos. 

  3. Uranium and thorium uptake by live and dead cells of Pseudomonas Sp

    International Nuclear Information System (INIS)

    Siva Prasath, C.S.; Manikandan, N.; Prakash, S.


    This study presents uptake of uranium (U) and thorium (Th) by live and dead cells of Pseudomonas Sp. Increasing concentration of U and Tb showed decrease in absorption by Pseudomonas Sp. Dead cells of Pseudomonas Sp. exhibited same or more uptake of U and Th than living cells. Increasing temperature promotes uptake of U and Th by Pseudomonas Sp. (author)

  4. Six New Polyacetylenic Alcohols from the Marine Sponges Petrosia sp. and Halichondria sp. (United States)

    Gabriel, Adeyemi Francis; Li, Zhen; Kusuda, Ryouhei; Tanaka, Chiaki; Miyamoto, Tomofumi


    Six new polyacetylenic alcohols, termed strongylotriols A and B; pellynols J, K, and L; and isopellynol A, together with three known polyacetylenic alcohols, pellynols A, B, and C were isolated from the marine sponges Petrosia sp., and Halichondria sp. collected in Okinawa, Japan. Their planer structures were determined based on 2D-NMR and mass spectrometric analysis of the degraded products by RuCl3 oxidation. The absolute stereochemistry of isolates was examined by their Mosher's esters. The strongylotriols were found to be optically pure compounds, whereas the pellynols are diastereomeric mixtures at the C-6 position. Proliferation experiments using the HeLa and K562 cell lines suggested that the essential structural units for activity are the "hexa-2,4-diyn-1,6-diol" and "pent-1-en-4-yn-3-ol" on the termini.

  5. Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma sp. in dogs with splenic disease. (United States)

    Varanat, M; Maggi, R G; Linder, K E; Breitschwerdt, E B


    Among diseases that cause splenomegaly in dogs, lymphoid nodular hyperplasia (LNH), splenic hemangiosarcoma (HSA), and fibrohistiocytic nodules (FHN) are common diagnoses. The spleen plays an important role in the immunologic control or elimination of vector-transmitted, blood-borne pathogens, including Bartonella sp., Babesia sp., and hemotropic Mycoplasma sp. To compare the prevalence of Bartonella sp., Babesia sp., and hemotropic Mycoplasma sp. DNA in spleens from dogs with LNH, HSA, and FHN. Paraffin-embedded, surgically obtained biopsy tissues from LNH (N = 50), HSA (N = 50), and FHN (N = 37) were collected from the anatomic pathology archives. Spleens from specific pathogen-free (SPF) dogs (N = 8) were used as controls. Bartonella sp., Babesia sp., and Mycoplasma sp. DNA was amplified by PCR, followed by DNA sequencing. Bartonella sp. DNA was more prevalent in FHN (29.7%) and HSA (26%) as compared to LNH (10%) (P = .019, .0373, respectively) or control spleens (0.0%). The prevalence of Babesia sp. and hemotropic Mycoplasma sp. DNA was significantly lower than Bartonella sp. DNA in HSA (P = .0005, .006, respectively) and FHN (P = .003, .0004, respectively). There was no statistically significant difference in DNA prevalence among the 3 genera in the LNH group. The higher prevalence of Bartonella sp. in FHN and HSA warrants future investigations to determine if this bacterium plays a role in the development of these splenic diseases. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  6. Surfactant protein D (SP-D) deficiency is attenuated in humanised mice expressing the Met(11)Thr short nucleotide polymorphism of SP-D

    DEFF Research Database (Denmark)

    Knudsen, Lars; Ochs, Katharina; Boxler, Laura


    Surfactant protein D (SP-D) is part of the innate immune system involved in lung homeostasis. SP-D knockout mice show accumulations of foamy alveolar macrophages, alveolar lipoproteinosis and pulmonary emphysema. Three single nucleotide polymorphisms (SNPs) have been described in the coding...

  7. Time-dependent migration of citations through PubMed and OvidSP subsets: a study on a series of simultaneous PubMed and OvidSP searches. (United States)

    Boeker, Martin; Vach, Werner; Motschall, Edith


    To quantitatively describe (1) differences between search results derived at consecutive time points with the PubMed and OvidSP literature search interfaces over a five day interval, and (2) the migration of citations through different subsets to estimate the timeliness of OvidSP. PubMed-Identifiers (PMIDs) of the following subsets were retrieved from PubMed and OvidSP simultaneously (within 8 h) at 11 days in March and April 2010 including 5 consecutive days: as supplied by publisher, in process, PubMed not MEDLINE, and OLDMEDLINE. Search results were compared for difference and intersection sets. The migration of citations on individual level was determined by comparison of corresponding sets over several days. The "in process" set was stable with about 446,000 - 452,000 citations; a small fraction of up to 3 % of the total subsets were in PubMed only and OvidSP only subsets. About 96 % of the ca. 10,500 citations in the OvidSP only subset migrated within 2 days out of the "in process" subset. The database of OvidSP is updated within a period of two days.

  8. Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: Tick-Borne Parasites Associated with Mortality in the Black Rhinoceros (Diceros bicornis) (United States)

    Nijhof, Ard M.; Penzhorn, Banie L.; Lynen, Godelieve; Mollel, Johnson O.; Morkel, Pete; Bekker, Cornelis P. J.; Jongejan, Frans


    A novel Babesia species, designated Babesia bicornis sp. nov., was identified in three black rhinoceroses (Diceros bicornis) that died in wildlife areas in Tanzania and South Africa. Screening of black rhinoceroses in South Africa revealed, in addition to B. bicornis, a second parasite, designated Theileria bicornis sp. nov. PMID:12734294

  9. SP2Bench: A SPARQL Performance Benchmark (United States)

    Schmidt, Michael; Hornung, Thomas; Meier, Michael; Pinkel, Christoph; Lausen, Georg

    A meaningful analysis and comparison of both existing storage schemes for RDF data and evaluation approaches for SPARQL queries necessitates a comprehensive and universal benchmark platform. We present SP2Bench, a publicly available, language-specific performance benchmark for the SPARQL query language. SP2Bench is settled in the DBLP scenario and comprises a data generator for creating arbitrarily large DBLP-like documents and a set of carefully designed benchmark queries. The generated documents mirror vital key characteristics and social-world distributions encountered in the original DBLP data set, while the queries implement meaningful requests on top of this data, covering a variety of SPARQL operator constellations and RDF access patterns. In this chapter, we discuss requirements and desiderata for SPARQL benchmarks and present the SP2Bench framework, including its data generator, benchmark queries and performance metrics.

  10. Transcriptional regulation of HIV-1 host factor COMMD1 by the Sp family. (United States)

    Kudo, Eriko; Taura, Manabu; Suico, Mary Ann; Goto, Hiroki; Kai, Hirofumi; Okada, Seiji


    Copper metabolism Murr1 domain containing 1 (COMMD1) has multiple functions in the regulation of protein stability at the plasma membrane and in the cytoplasm. However, the regulation of COMMD1 transcriptional has remained to be elucidated. In the present study, the 5'‑flanking region (‑1,192/+83 bp) of the human COMMD1 gene was cloned. It was observed that the COMMD1 promoter region contains GC‑rich region that has 7 putative Sp1‑binding sites via in silico analysis. The proximal promoter region at ‑289/+83 bp was required for COMMD1 basal promoter activity by deletion constructs of COMMD1 promoter. Moreover, Sp1 inhibitor, mithramycin A, suppressed basal COMMD1 promoter activity. The Sp1‑binding site (‑11/‑1 bp) in the proximal promoter region was a critical site for COMMD1 gene regulation by Sp1 and Sp3. Sp1 upregulated COMMD1 promoter activity, whereas Sp3 suppressed it. Endogenous Sp1 and Sp3 bound to the proximal promoter region of COMMD1. Taken together, Sp1 constitutively regulates the basal expression of the COMMD1 gene in human epithelial cell lines.

  11. Hydrolysis of surimi wastewater for production of transglutaminase by Enterobacter sp. C2361 and Providencia sp. C1112. (United States)

    H-Kittikun, Aran; Bourneow, Chaiwut; Benjakul, Soottawat


    Surimi wastewater (SWW) is an industrial wastewater, released during the washing step of surimi preparation from minced fish, that causes environmental problem. In this study, SWW produced from ornate threadfin bream (Nemipterus hexodon) was hydrolysed and used to cultivate Enterobacter sp. C2361 and Providencia sp. C1112 for the production of microbial transglutaminase (MTGase, EC The SWW was repeatedly used to wash the fish mince that gained a final protein content of 3.20% (w/v). The commercial protease, Delvolase was the most appropriate protease used to produce fish protein hydrolysate (FPH) from SWW. The FPH at 40% degree of hydrolysis was used instead of a peptone portion in the SPY medium (3.0% starch, 2.0% peptone, 0.2% yeast extract, 0.2% MgSO(4), 0.2% K(2)HPO(4) and 0.2% KH(2)HPO(4), pH 7.0) to cultivate the tested strains at 37°C, shaking speed at 150rpm. Providencia sp. C1112 produced higher MTGase activity (1.78±0.05U/ml) than Streptoverticillium mobaraense (1.61±0.02U/ml) at 18h of cultivation in FPH medium. On the other hand, the Enterobacter sp. C2361 produced lower MTGase activity (1.18±0.03U/ml). Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Novel genetic linkage of rat Sp6 mutation to Amelogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    Muto Taro


    Full Text Available Abstract Background Amelogenesis imperfecta (AI is an inherited disorder characterized by abnormal formation of tooth enamel. Although several genes responsible for AI have been reported, not all causative genes for human AI have been identified to date. AMI rat has been reported as an autosomal recessive mutant with hypoplastic AI isolated from a colony of stroke-prone spontaneously hypertensive rat strain, but the causative gene has not yet been clarified. Through a genetic screen, we identified the causative gene of autosomal recessive AI in AMI and analyzed its role in amelogenesis. Methods cDNA sequencing of possible AI-candidate genes so far identified using total RNA of day 6 AMI rat molars identified a novel responsible mutation in specificity protein 6 (Sp6. Genetic linkage analysis was performed between Sp6 and AI phenotype in AMI. To understand a role of SP6 in AI, we generated the transgenic rats harboring Sp6 transgene in AMI (Ami/Ami + Tg. Histological analyses were performed using the thin sections of control rats, AMI, and Ami/Ami + Tg incisors in maxillae, respectively. Results We found the novel genetic linkage between a 2-bp insertional mutation of Sp6 gene and the AI phenotype in AMI rats. The position of mutation was located in the coding region of Sp6, which caused frameshift mutation and disruption of the third zinc finger domain of SP6 with 11 cryptic amino acid residues and a stop codon. Transfection studies showed that the mutant protein can be translated and localized in the nucleus in the same manner as the wild-type SP6 protein. When we introduced the CMV promoter-driven wild-type Sp6 transgene into AMI rats, the SP6 protein was ectopically expressed in the maturation stage of ameloblasts associated with the extended maturation stage and the shortened reduced stage without any other phenotypical changes. Conclusion We propose the addition of Sp6 mutation as a new molecular diagnostic criterion for the

  13. Novel genetic linkage of rat Sp6 mutation to Amelogenesis imperfecta (United States)


    Background Amelogenesis imperfecta (AI) is an inherited disorder characterized by abnormal formation of tooth enamel. Although several genes responsible for AI have been reported, not all causative genes for human AI have been identified to date. AMI rat has been reported as an autosomal recessive mutant with hypoplastic AI isolated from a colony of stroke-prone spontaneously hypertensive rat strain, but the causative gene has not yet been clarified. Through a genetic screen, we identified the causative gene of autosomal recessive AI in AMI and analyzed its role in amelogenesis. Methods cDNA sequencing of possible AI-candidate genes so far identified using total RNA of day 6 AMI rat molars identified a novel responsible mutation in specificity protein 6 (Sp6). Genetic linkage analysis was performed between Sp6 and AI phenotype in AMI. To understand a role of SP6 in AI, we generated the transgenic rats harboring Sp6 transgene in AMI (Ami/Ami + Tg). Histological analyses were performed using the thin sections of control rats, AMI, and Ami/Ami + Tg incisors in maxillae, respectively. Results We found the novel genetic linkage between a 2-bp insertional mutation of Sp6 gene and the AI phenotype in AMI rats. The position of mutation was located in the coding region of Sp6, which caused frameshift mutation and disruption of the third zinc finger domain of SP6 with 11 cryptic amino acid residues and a stop codon. Transfection studies showed that the mutant protein can be translated and localized in the nucleus in the same manner as the wild-type SP6 protein. When we introduced the CMV promoter-driven wild-type Sp6 transgene into AMI rats, the SP6 protein was ectopically expressed in the maturation stage of ameloblasts associated with the extended maturation stage and the shortened reduced stage without any other phenotypical changes. Conclusion We propose the addition of Sp6 mutation as a new molecular diagnostic criterion for the autosomal recessive AI patients

  14. Calibration of PIXE-SP system of elementary analysis

    International Nuclear Information System (INIS)

    Tabacniks, M.H.


    The set-up and calibration of the PIXE-SP System of Elementary Analysis located at the Institute of Physics of the University of Sao Paulo is described. The PIXE-SP, that operates with 8 MeV alpha beam, has been calibrated for elements with Z >= 11, by means of homemade evaporated standard targets of Al, Si, Bacl 2 , K 2 CrO 4 , Ti, Cr, Mn, Fe, Cu, Ge, Ag, Sn, and Au. Those targets are thin, homogeneous, and have been calbrated on a microbalance within an average precision of 6%. The overall precision of the PIXE-SP System is estimated in 10% for elements with 16 2 thick, irradiated with a 10 μC electric charge, shows a minimum of about 0,1 ng (approximated 4 ppm) for Mn. The PIXE-SP System has also been intercalibrated with the PIXE located at University of Gent, Belgium, by means of 12 atmospheric aerosol targets collected on two Batelle Cascade Impactors. The analyzed masses of elements with 16 [pt

  15. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.


    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  16. Major metabolites from Monostroma sp. and Porphyra vietnamensis Tan. et. Ho

    Digital Repository Service at National Institute of Oceanography (India)

    Jagtap, T.G.

    in Monostroma sp. Total calorific value of P. vietnamensis was observed to be 3164 cal/g (ash free dry weight) while that of Monostroma sp. was 1941 cal/g (ash free dry weight). C:N ratio was found lower (13.7) in P. vietnamensis than in Monostroma sp. (16.6%)...

  17. Flow chemistry as a discovery tool to access sp2-sp3 cross-coupling reactions via diazo compounds. (United States)

    Tran, Duc N; Battilocchio, Claudio; Lou, Shing-Bong; Hawkins, Joel M; Ley, Steven V


    The work takes advantage of an important feature of flow chemistry, whereby the generation of a transient species (or reactive intermediate) can be followed by a transfer step into another chemical environment, before the intermediate is reacted with a coupling partner. This concept is successfully applied to achieve a room temperature sp 2 -sp 3 cross coupling of boronic acids with diazo compounds, these latter species being generated from hydrazones under flow conditions using MnO 2 as the oxidant.

  18. Structural Analysis of Planar sp3 and sp2 Films: Diamond-Like Carbon and Graphene Overlayers

    KAUST Repository

    Mansour, Ahmed


    The special electronic configuration of carbon enables the existence of wide ranging allotropes taking all possible dimensionalities. The allotropes of carbon are characterized by the type of hybridized bonding forming its structure, ranging from pure sp2 as in graphene, carbon nanotubes and fullerenes, to pure sp3 as in diamond. Amorphous and diamond-like carbon consists of a mixture of both hybridizations. This variation in hybridization in carbon materials enables a wide spectrum of properties, ranging from high bulk mechanical hardness, tribological properties and chemical inertness made possible by moving towards pure sp3 bonding to the extraordinary electrical conductivity, optical properties and in-plane mechanical strength resulting from pure sp2 bonding. Two allotropes at the extremes of this spectrum, diamond like carbon (DLC) and graphene, are investigated in this thesis; the former is investigated as a protective coating in hard drive applications, while the latter is investigated in the context of chemically derived graphene as material for transparent conducting electrode applications. DLC thin films are a main component in computer hard drives, acting as a protective coating against corrosion and mechanical wear of the magnetic layer and read-write head. The thickness of DLC films greatly affects the storage density in such devices, as larger separation between the read/write head and the magnetic layer decreases the storage density. A targeted DLC thickness of 2 nm would increase the storage density towards 1 Tbits/inch2. However, difficulty achieving continuous films at such thicknesses by commonly used sputtering methods challenges the industry to investigate alternative methods. Filtered cathodic vacuum arc (FCVA) has been proposed as an efficient technique to provide continuous, smooth and ultra-thin DLC films. We investigate the influence of deposition angle, deposition time, and substrate biasing to define the optimum process window to obtain

  19. Suitable conditions for xylanases activities from Bacillus sp. GA2(1 and Bacillus sp. GA1(6 and their properties for agricultural residues hydrolysis

    Directory of Open Access Journals (Sweden)

    Sudathip Chantorn


    Full Text Available Bacillus sp. GA2(1 and Bacillus sp. GA1(6 were isolated from soybean field in Khon Kaen province, Thailand. Crude enzymes from both isolates showed the activities of cellulase, xylanase, and mannanase at 37°C for 24 h. The highest xylanase activities of Bacillus sp. GA2(1 and Bacillus sp. GA1(6 were 1.58±0.25 and 0.82±0.16 U/ml, respectively. The relative xylanase activities from both strains were more than 60% at pH 5.0 to 8.0. The optimum temperature of xylanases was 50°C in both strains. The residual xylanase activities from both strains were more than 70% at 60°C for 60 min. Five agricultural wastes (AWs, namely coffee residue, soybean meal, potato peel, sugarcane bagasse, and corn cobs, were used as substrates for hydrolysis properties. The highest reducing sugar content of 101±1.32 µg/ml was obtained from soybean meal hydrolysate produced by Bacillus sp. GA2(1 xylanase.

  20. Production and partial characterization of polygalacturonases produced by thermophilic Monascus sp N8 and by thermotolerant Aspergillus sp N12 on solid-state fermentation Produção e caracterização parcial de poligalacturonases produzidas pelo fungo termofílico Monascus sp N8 e pelo termotolerante Aspergillus sp N12 em fermentação em estado sólido

    Directory of Open Access Journals (Sweden)

    Paula Mendes de Freitas


    Full Text Available Polygalacturonases production by newly isolated Monascus sp N8 and Aspergillus sp N12 strains was carried out in solid-state fermentation using mixtures of wheat bran, sugar cane bagasse and orange bagasse as carbon sources. The maximal activity values of exo-polygalacturonases (exo-Pg from Monascus sp and Aspergillus sp were obtained using wheat bran/sugar cane bagasse/orange bagasse mixture (6.6 U/mL and wheat bran/orange bagasse mixture (10 U/mL, respectively. Enzyme production by both strains was higher at 45ºC after 72 h and 1.6 U/mL at 50ºC after 120 h. Endo-polygalacturonase (endo-Pg production was higher in wheat bran/orange bagasse mixture and was not affected by temperature of incubation for both fungi. Endo-Pg production by Monascus was 1.8 U/mL at 45ºC and 50ºC, after 72. Similar values were obtained in Aspergillus sp culture, 1.9 U/mL at 45ºC and 1.8 U/mL at 50ºC. Exo-Pg from both strains showed optimum activity at pH 5.5. Maximal activity was determined at 60ºC for enzyme from Monascus sp and 50ºC for that produced by Aspergillus sp. Exo-Pg from Monascus sp was stable at pH range 4.5-6.0 whereas that from Aspergillus sp enzyme was stable at pH 4.0. Both enzymes showed stability when incubated at 50ºC for 1 h, in absence of substrate.A produção de poligalacturonases pelas linhagens fúngicas recentemente isoladas, Monascus sp N8 e Aspergillus sp N12, foi estudada através de fermentação em estado sólido usando como substratos misturas de farelo de trigo, bagaço da cana-de-açúcar e bagaço de laranja. A atividade máxima de exo-Pg produzida por Monascus sp (6,6 U/mL foi obtida quando o meio de cultivo utilizado continha mistura de farelo de trigo, bagaço da cana-de-açúcar e bagaço de laranja (1:1:1, enquanto que Aspergillus sp produziu maior quantidade da enzima (10 U/mL em meio de farelo de trigo e bagaço de laranja. A maior produção de exo-Pg foi obtida através de incubação das culturas a 45ºC quando

  1. Cryptosporidium sp. in lizards

    Czech Academy of Sciences Publication Activity Database

    Koudela, Břetislav; Modrý, D.


    Roč. 45, č. 1 (1998), s. 8 ISSN 1066-5234. [Cryptosporidium sp. in lazards. 01.01.1998-02.01.1998, Praha] R&D Projects: GA ČR GA508/95/0273; GA AV ČR IPP2020702 Subject RIV: fp - Other Medical Disciplines

  2. Unusual surface and edge morphologies, sp2 to sp3 hybridized transformation and electronic damage after Ar+ ion irradiation of few-layer graphene surfaces. (United States)

    Al-Harthi, Salim Hamood; Elzain, Mohammed; Al-Barwani, Muataz; Kora'a, Amal; Hysen, Thomas; Myint, Myo Tay Zar; Anantharaman, Maliemadom Ramaswamy


    Roughness and defects induced on few-layer graphene (FLG) irradiated by Ar+ ions at different energies were investigated using X-ray photoemission spectroscopy (XPS) and atomic force microscopy techniques. The results provide direct experimental evidence of ripple formation, sp2 to sp3 hybridized carbon transformation, electronic damage, Ar+ implantation, unusual defects and edge reconstructions in FLG, which depend on the irradiation energy. In addition, shadowing effects similar to those found in oblique-angle growth of thin films were seen. Reliable quantification of the transition from the sp2-bonding to sp3-hybridized state as a result of Ar+ ion irradiation is achieved from the deconvolution of the XPS C (1s) peak. Although the ion irradiation effect is demonstrated through the shape of the derivative of the Auger transition C KVV spectra, we show that the D parameter values obtained from these spectra which are normally used in the literature fail to account for the sp2 to sp3 hybridization transition. In contrast to what is known, it is revealed that using ion irradiation at large FLG sample tilt angles can lead to edge reconstructions. Furthermore, FLG irradiation by low energy of 0.25 keV can be a plausible way of peeling graphene layers without the need of Joule heating reported previously.

  3. Bioactive metabolites produced by Penicillium sp. 1 and sp. 2, two endophytes associated with Alibertia macrophylla (Rubiaceae). (United States)

    Oliveira, Camila M; Silva, Geraldo H; Regasini, Luis O; Zanardi, Lisinéia M; Evangelista, Alana H; Young, Maria C M; Bolzani, Vanderlan S; Araujo, Angela R


    In the course of our continuous search for bioactive metabolites from endophytic fungi living in plants from the Brazilian flora, leaves of Alibertia macrophylla (Rubiaceae) were submitted to isolation of endophytes, and two species of Penicillium were isolated. The acetonitrile fraction obtained in corn from a culture of Penicillium sp. 1 afforded orcinol (1). On the other hand, Penicillium sp. 1 cultivated in potato-dextrose-broth furnished two different compounds, cyclo-(L-Pro-L-Val) (2) and uracil (3). The chromatographic fractionation of the acetonitrile fraction obtained from Penicillium sp. 2 led to three dihydroisocoumarins, 4-hydroxymellein (4), 8-methoxymellein (5) and 5-hydroxymellein (6). Compounds 5 and 6 were obtained from the Penicillium genus for the first time. Additionally, metabolites 1-6 were evaluated for their antifungal and acetylcholinesterase (AChE) inhibitory activities. The most active compounds 1 and 4 exhibited detection limits of 5.00 and 10.0 microg against Cladosporium cladosporioides and C. sphaerospermum, respectively. Compound 2 showed a detection limit of 10.0 microg, displaying potent AChE inhibitory activity.


    Directory of Open Access Journals (Sweden)

    Lina Herlina


    Full Text Available AbstrakMikroorganisme tanah seperti Gliocladium sp dapat bertindak sebagai dekomposer dan juga sebagai agen pengendali hayati patogen tanaman hal ini memberikan harapan untuk mengurangi penggunaan pupuk dan fungisida sintetik. Tujuan penelitian untuk menguji potensi biofertililzer Gliocladium sp terhadap pertumbuhan dan produksi buah tomat. Variabel bebas yaitu bioferlizer Gliocladium sp  dengan dosis (g/tanaman 0,50, 100, 150, dan 200 .Variabel tergantung adalah pertumbuhan dan produksi tanaman tomat. Parameter pertumbuhan yang diukur adalah  tinggi tanaman, kandungan klorofil a dan b. Parameter hasil tanaman yang diukur adalah berat buah setelah panen. Hasil uji Anava satu jalan menunjukkan bahwa pemberian Gliocladium sp perpengaruh terhadap tinggi tanaman, kandungan klorofil a dan klorofil b, berat tomat  . Hasil uji lanjut Duncan menunjukkan bahwa dosis 100, g 150 g dan 200 g tidak berbeda signifikan terhadap tinggi tanaman, dosis 150g dan 200 g tidak berbedan nyata dalam pembentukan klorofil a dan klorofil b. Pemberian Gliocladium dosis 150g paling tinggi terhadap berat buah. Simpulan dalam penelitian ini bahwa pemberian Gliokompos sp berpengaruh terhadap pertumbuhan dan produksi buah tomat. AbstractSoil microorganisms such as Gliocladium sp. can play role in the decomposition and can also become the biological control of pathogenic plants. The animal is potentially reduce the use of fertilizers and synthetic fungidid. The aim of the study was to test the potential effect of biofertililzer Gliocladium sp. on the growth and production of tomatoes. The independent variables was biofertilizer Gliocladium sp. at various dosages (g/plant of 0, 50, 100, 150, dan 200. The dependent variables were the growth and the production of tomatoes. The growth parameter measured were plant height, as well as a and b chlorophyl contents.  The crop parameter was the fruit weight post-harvest.  A one-way anova showed that Gliocladium sp. affected the

  5. Bioremediation of crude oil waste contaminated soil using petrophilic consortium and Azotobacter sp.

    Directory of Open Access Journals (Sweden)

    M. Fauzi


    Full Text Available This study was aimed to determine the effect Petrophilic and Azotobacter sp. consortium on the rate of degradation of hydrocarbons, Azotobacter growth, and Petrophilic fungi growth in an Inceptisol contaminated with crude oil waste originating from Balongan refinery, one of Pertamina (Indonesia’s largest state-owned oil and gas company units in Indramayu – West Java. This study was conducted from March to April 2014 in the glasshouse of research station of the Faculty of Agriculture, Padjadjaran University at Ciparanje, Jatinangor District, Sumedang Regency of West Java. This study used a factorial completely randomized design with two treatments. The first treatment factor was Petrophilic microbes (A consisting of four levels (without treatment, 2% Petrophilic fungi, 2% Petrophilic bacteria, and the 2% Petrophilic consortium, and Azotobacter sp. The second treatment factor was Azotobacter sp. (B consisting of four levels (without treatment, 0.5%, Azotobacter sp., 1% Azotobacter sp., and 1.5% Azotobacter sp. The results demonstrated interaction between Petrophilic microbes and Azotobacter sp. towards hydrocarbon degradation rate, but no interaction was found towards the growth rate of Azotobacter sp. and Petrophilic fungi. Treatments of a1b3 (2% consortium of Petrophilic fungi with 1.5% Azotobacter sp. and a3b3 (2% Petrophilic consortium and 1.5% Azotobacter sp. had hydrocarbon degradation rate at 0.22 ppm/day for each treatment, showing the highest hydrocarbon degradation rate.

  6. Rhipidocotyle gibsoni n. sp. from a Brazilian Freshwater Fish and Rhipidocotyle froesi n.sp. for r. baculum (linton, 1905 of Eckmann (1932 (Bucephalidae; Digenea

    Directory of Open Access Journals (Sweden)

    Anna Kohn


    Full Text Available Rhipidocotyle gibsoni n.sp. is described from Acestrorhynchus lacustris from Paraná River, brazil. It is most closely related to r. froesi n. sp. and to R. eckmanni in the shape of the cephalic hood, differing in the extent of the uterus, in the position of the vitelline follicles and in that the host is a freshwater fish. Rhipidocotyle froesi n. sp. is proposed for the marine specimens described by Eckmann (1932 as R. baculum (Linton, 1905.

  7. Azolla filiculoides Nitrogenase Activity Decrease Induced by Inoculation with Chlamydomonas sp. † (United States)

    Habte, Mitiku


    Experiments were conducted to determine the influence of Chlamydomonas sp. on nitrogen fixation (C2H2 → C2H4) in Azolla filiculoides and on the nitrogen fixation and growth of free-living Anabaena azollae 2B organisms. Inoculation of azolla medium with Chlamydomonas sp. was associated with decreased nitrogenase activity in A. filiculoides and with increases in the density of a fungal population identified as Acremonium sp. Subsequent inoculation of azolla medium with this fungus was also accompanied by a significant decrease in nitrogenase activity of A. filiculoides. However, the extent of depression of nitrogenase activity was significantly higher when azolla medium was inoculated with Chlamydomonas sp. than when it was inoculated with Acremonium sp. Inoculation of nitrogen-free Stanier medium with either Acremonium sp. or Chlamydomonas sp. did not adversely affect the growth or nitrogenase activity of free-living A. azollae. Decreased nitrogenase activity in A. filiculoides is apparently related to the adverse influence of the green alga and the fungus on the macrosymbiont. The mechanisms that might be involved are discussed. PMID:16347211

  8. Corrosive Metabolic Activity of Desulfovibrio sp. on 316L Stainless Steel (United States)

    Arkan, Simge; Ilhan-Sungur, Esra; Cansever, Nurhan


    The present study investigated the effects of chemical parameters (SO4 2-, PO4 3-, Cl-, pH) and the contents of extracellular polymeric substances (EPS) regarding the growth of Desulfovibrio sp. on the microbiologically induced corrosion of 316L stainless steel (SS). The experiments were carried out in laboratory-scaled test and control systems. 316L SS coupons were exposed to Desulfovibrio sp. culture over 720 h. The test coupons were removed at specific sampling times for enumeration of Desulfovibrio sp., determination of the corrosion rate by the weight loss measurement method and also for analysis of carbohydrate and protein in the EPS. The chemical parameters of the culture were also established. Biofilm/film formation and corrosion products on the 316L SS surfaces were investigated by scanning electron microscopy and energy-dispersive x-ray spectrometry analyses in the laboratory-scaled systems. It was found that Desulfovibrio sp. led to the corrosion of 316L SS. Both the amount of extracellular protein and chemical parameters (SO4 2- and PO4 3-) of the culture caused an increase in the corrosion of metal. There was a significantly positive relationship between the sessile and planktonic Desulfovibrio sp. counts ( p < 0.01). It was detected that the growth phases of the sessile and planktonic Desulfovibrio sp. were different from each other and the growth phases of the sessile Desulfovibrio sp. vary depending on the subspecies of Desulfovibrio sp. and the type of metal when compared with the other published studies.

  9. PML nuclear body component Sp140 is a novel autoantigen in primary biliary cirrhosis. (United States)

    Granito, Alessandro; Yang, Wei-Hong; Muratori, Luigi; Lim, Mark J; Nakajima, Ayako; Ferri, Silvia; Pappas, Georgios; Quarneti, Chiara; Bianchi, Francesco B; Bloch, Donald B; Muratori, Paolo


    Some patients with primary biliary cirrhosis (PBC) have antinuclear antibodies (ANAs). These ANAs include the "multiple nuclear dots" (MND) staining pattern, targeting promyelocytic leukemia protein (PML) nuclear body (NB) components, such as "speckled 100-kD" protein (Sp100) and PML. A new PML NB protein, designated as Sp140, was identified using serum from a PBC patient. The aim of this study was to analyze the immune response against Sp140 protein in PBC patients. We studied 135 PBC patients and 157 pathological controls with type 1 autoimmune hepatitis, primary sclerosing cholangitis, and systemic lupus erythematosus. We used indirect immunofluorescence and a neuroblastoma cell line expressing Sp140 for detecting anti-Sp140 antibodies, and a commercially available immunoblot for detecting anti-Sp100 and anti-PML antibodies. Anti-Sp140 antibodies were present in 20 (15%) PBC patients but not in control samples, with a higher frequency in antimitochondrial antibody (AMA)-negative cases (53 vs. 9%, P<0.0001). Anti-Sp140 antibodies were found together with anti-Sp100 antibodies in all but one case (19 of 20, 90%) and with anti-PML antibodies in 12 (60%) cases. Anti-Sp140 positivity was not associated with a specific clinical feature of PBC. Our study identifies Sp140 as a new, highly specific autoantigen in PBC for the first time. The very frequent coexistence of anti-Sp140, anti-Sp100 and anti-PML antibodies suggests that the NB is a multiantigenic complex in PBC and enhances the diagnostic significance of these reactivities, which are particularly useful in AMA-negative cases.

  10. Burkholderia humisilvae sp. nov., Burkholderia solisilvae sp. nov. and Burkholderia rhizosphaerae sp. nov., isolated from forest soil and rhizosphere soil. (United States)

    Lee, Jae-Chan; Whang, Kyung-Sook


    Strains Y-12(T) and Y-47(T) were isolated from mountain forest soil and strain WR43(T) was isolated from rhizosphere soil, at Daejeon, Korea. The three strains grew at 10-55 °C (optimal growth at 28-30 °C), at pH 3.0-8.0 (optimal growth at pH 6.0) and in the presence of 0-4.0% (w/v) NaCl, growing optimally in the absence of added NaCl. On the basis of 16S rRNA gene sequence analysis, the three strains were found to belong to the genus Burkholderia, showing the closest phylogenetic similarity to Burkholderia diazotrophica JPY461(T) (97.2-97.7%); the similarity between the three sequences ranged from 98.3 to 98.7%. Additionally, the three strains formed a distinct group in phylogenetic trees based on the housekeeping genes recA and gyrB. The predominant ubiquinone was Q-8, the major fatty acids were C16 : 0 and C17  : 0 cyclo and the DNA G+C content of the novel isolates was 61.6-64.4 mol%. DNA-DNA relatedness among the three strains and the type strains of the closest species of the genus Burkholderia was less than 50%. On the basis of 16S rRNA, recA and gyrB gene sequence similarities, chemotaxonomic and phenotypic data, the three strains represent three novel species within the genus Burkholderia, for which the names Burkholderia humisilvae sp. nov. (type strain Y-12(T)= KACC 17601(T) = NBRC 109933(T) = NCAIM B 02543(T)), Burkholderia solisilvae sp. nov. (type strain Y-47(T) = KACC 17602(T)= NBRC 109934(T) = NCAIM B 02539(T)) and Burkholderia rhizosphaerae sp. nov. (type strain WR43(T) = KACC 17603(T) = NBRC 109935(T) = NCAIM B 02541(T)) are proposed.

  11. Itinerant ferromagnetism in fermionic systems with SP (2 N) symmetry (United States)

    Yang, Wang; Wu, Congjun

    The Ginzburg-Landau free energy of systems with SP (2 N) symmetry describes a second order phase transition on the mean field level, since the Casimir invariants of the SP (2 N) group can be only of even order combinations of the generators of the SP (2 N) group. This is in contrast with systems having the SU (N) symmetry, where the allowance of cubic term generally makes the phase transition into first order. In this work, we consider the Hertz-Millis type itinerant ferromagnetism in an interacting fermionic system with SP (2 N) symmetry, where the ferromagnetic orders are enriched by the multi-component nature of the system. The quantum criticality is discussed near the second order phase transition point.

  12. Effect of Rhodococcus sp. on desulfurization, swelling and extraction of coal

    Energy Technology Data Exchange (ETDEWEB)

    Wang De-qiang; Shui Heng-fu [University of Technology of Anhui, Maanshang (China). School of Chemical Engineering


    Bio-desulfurization of coal by rhodococcus sp. was studied. Some kinds of coal were swelled with different organic solvents, and then the swelled coals were treated by rhodococcus sp. The results show that the ratios of desulfurization of coals increase after they are swelled, especially swelled with NMP, the ratio is more than 80%. The swelling and extraction of coal were also studied after the coal had been treated by rhodococcus sp. The results show that the ratios of swelling increase more than 65%, but the extraction yield decreases for the coal treated by rhodococcus sp. 11 refs., 5 tabs.

  13. Suicide in Sorocaba-SP: an epidemiological study

    Directory of Open Access Journals (Sweden)

    Melissa Nobrega Vasques de Freitas


    Introduction: suicide is a major worldwide public health issue and appears as one of the ten most frequent causes of death in all ages. Objective: to perform an epidemiological analysis of suicide rates recorded between 2000 and 2009 in the city of Sorocaba-SP and compare them to national epidemiological data. Methods: We performed a descriptive analysis of suicide data in Sorocaba-SP in the period 2000 to 2009 collected by the Surveillance of Violence and Injuries (VIVA and the Municipal Health Secretariat of Sorocaba-SP. Results: a total of 229 suicide cases were recorded between 2000 and 2009. Total suicide rate suffered an increase of 3.8% in 2005, as compared to previous years, and remained constant in subsequent years. The highest average rates were recorded in 2005 and 2007. Men are more likely to commit suicide. The highest rates of suicide were recorded in the age group 35-44 years. Being single was the most common sociodemographic characteristic of suicides during the study period. The most common methods of suicide were hanging and firearms. Conclusion: The rate of suicide in Sorocaba-SP, despite low, is consistent with the national and international growth trends. Members of the younger population are killing themselves with increasing frequency, although the highest rates of suicide are still found among those aged 35 - 44 years

  14. THE PREVALENCE OF Salmonella sp., Listeria sp. AND Aeromonas spp. IN CATFISH (CLARIAS (Clarias gariepinus AND TILAPIA (Tilapia mossambica BY PELLETING METHOD

    Directory of Open Access Journals (Sweden)

    Titik Budiati


    Full Text Available The aim of this study was to modify the isolation methods of Aeromonas sp., Salmonella spp., and Listeria sp. in catfish (Clarias gariepinus and tilapia (Tilapia mossambica obtained from wet markets and ponds in Malaysia by pelleting the sample. A total of 108 samples (32 catfish intestines, 32 tilapia intestines, and 44 water samples were obtained from nine wet markets and eight ponds. The modified method was employed by pelleting the samples and followed by either implementing pre-enrichment or without pre-enrichment on the isolation of Salmonella and Listeria spp. The modified method (by pelleting the sample in combination with pre-enrichment was the most efficient for Salmonella and Listeria isolation. The sensitivity of the modified Salmonella isolation method was 0.53 and 0.73 for fish and water samples, respectively. The sensitivity of the modified Listeria method was 1 and 0.92 for fish and water samples, respectively. However, the sensitivity of the method by pelleting the sample was similar to those of non-pelleting the sample on Aeromonas isolation. Five species of Aeromonas spp., seven serovars of Salmonella sp., and four species of Listeria sp. were observed in catfish, tilapia and water samples. Overall, by pelleting the sample offered the beneficial to isolate Aeromonas spp., Salmonella sp. and Listeria spp. in catfish, tilapia and water.

  15. The Growth of Monoraphidium sp. and Scenedesmus sp. Cells in the Presence of Thorium

    Directory of Open Access Journals (Sweden)

    Juliana Cristina de Queiroz


    Full Text Available Toxicity of thorium by Monoraphidium sp. and Scenedesmus sp. was studied. Microalgal cultures were inoculated in ASM-1 medium in presence and absence of thorium. Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with software. The toxicity of thorium over the species was observed for concentrations over 50.0 mg/L. After 30 days, Monoraphidium cells decreased their concentration from 4.23×106 to 4.27×105 and 8.57×105 cells/mL, in the presence of 50.0 and 100.0 mg/L of thorium, respectively. Scenedesmus sp. cells were more resistant to thorium: for an initial cell concentration of 7.65×104 cells/mL it was observed a change to 5.25×105 and 5.12×105 cells/mL, in the presence of thorium at 50.0 and 100.0 mg/L, respectively. This is an indication that low concentrations of the radionuclide favored the growth, and that Scenedesmus cells are more resistant to thorium than Monoraphidium cells. The software used for comparison with direct count method proved to be useful for the improvement of accuracy of the results obtained, a decrease in the uncertainty and allowed recording of the data. The presence of thorium suggests that low concentrations have a positive effect on the growth, due to the presence of the nitrate, indicating its potential for ecotoxicological studies.

  16. The Growth of Monoraphidium sp. and Scenedesmus sp. Cells in the Presence of Thorium (United States)

    de Queiroz, Juliana Cristina; Ferreira, Ana Cristina de Melo; da Costa, Antonio Carlos Augusto


    Toxicity of thorium by Monoraphidium sp. and Scenedesmus sp. was studied. Microalgal cultures were inoculated in ASM-1 medium in presence and absence of thorium. Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with software. The toxicity of thorium over the species was observed for concentrations over 50.0 mg/L. After 30 days, Monoraphidium cells decreased their concentration from 4.23 × 106 to 4.27 × 105 and 8.57 × 105 cells/mL, in the presence of 50.0 and 100.0 mg/L of thorium, respectively. Scenedesmus sp. cells were more resistant to thorium: for an initial cell concentration of 7.65 × 104 cells/mL it was observed a change to 5.25 × 105 and 5.12 × 105 cells/mL, in the presence of thorium at 50.0 and 100.0 mg/L, respectively. This is an indication that low concentrations of the radionuclide favored the growth, and that Scenedesmus cells are more resistant to thorium than Monoraphidium cells. The software used for comparison with direct count method proved to be useful for the improvement of accuracy of the results obtained, a decrease in the uncertainty and allowed recording of the data. The presence of thorium suggests that low concentrations have a positive effect on the growth, due to the presence of the nitrate, indicating its potential for ecotoxicological studies. PMID:22649297

  17. Enhancement of clavulanic acid production by Streptomyces sp MU ...

    African Journals Online (AJOL)

    Purpose: To enhance clavulanic acid production using UV-mutagenesis on Streptomyces sp. NRC77. Methods: UV-mutagenesis was used to study the effect of Streptomyces sp. NRC77 on CA production. Phenotypic and genotypic identification methods of the promising mutant strain were characterized. Optimization of the ...

  18. Moniliella sojae sp. nov., a species of black yeasts isolated from Vietnamese soy paste (tuong), and reassignment of Moniliella suaveolens strains to Moniliella pyrgileucina sp. nov., Moniliella casei sp. nov. and Moniliella macrospora emend. comb. nov. (United States)

    Thanh, Vu Nguyen; Duc Hien, Dinh; Yaguchi, Takashi; Sampaio, Jose Paulo; Lachance, Marc-André


    The presence of yeasts at different steps of Vietnamese soy paste production was studied. Yeast growth occurred during primary soybean fermentation, with the cell density reaching 4.10 6 c.f.u. ml -1 , and terminated during brine fermentation. The dominant species were Pichia kudriavzevii and Millerozyma farinosa. Over the span of 14 years, nine strains of Moniliella were isolated. The strains had identical PCR fingerprints generated with primer (GAC)5 and identical D1/D2 and internal transcribed spacer (ITS) sequences. A D1/D2-based phylogeny indicated that the strains were closest to a group of four previously assigned as Moniliella suaveolens strains. Together they form a new lineage that is well separated from all known species, including M. suaveolens (over 12.7 % divergence). ITS sequences indicated the presence of four species differing from each other by 9-57 nt. The name Moniliella sojae sp. nov. is proposed to accommodate the strains isolated from Vietnamese soy paste, Moniliella pyrgileucina sp. nov. is proposed for PYCC 6800 and Moniliella casei sp. nov. is proposed for CBS 157.58. An emended combination Moniliella macrospora is proposed for CBS 221.32 and CBS 223.32. The type strains and MycoBank numbers are: M. sojae sp. nov., SS 4.2 T =CBS 126448 T =NRRL Y-48680 T and MB 822871; M. pyrgileucina sp. nov., PYCC 6800 T =CBS 15203 T and MB 823030; M. casei sp. nov., CBS 157.58 T =IFM 60348 T and MB 822872; M. macrospora emend. comb. nov., CBS 221.32 T (=MUCL 11527 T ) and MB 822874.

  19. Field evidence for leech-borne transmission of amphibian Ichthyophonus sp. (United States)

    Raffel, Thomas R; Dillard, James R; Hudson, Peter J


    Parasites have been implicated in mass mortality events and population declines of amphibians around the world. One pathogen associated with mortality events in North America is an Ichthyophonus sp.-like organism that affects red-spotted newts (Notophthalmus viridescens) and several frog species, yet little is known about the distribution of this pathogen in wild populations or the mechanism of transmission. In an effort to identify factors influencing the distribution and abundance of this pathogen, we measured Ichthyophonus sp. prevalence and a series of factors that could contribute to transmission in 16 newt populations during spring 2004. In contrast to our initial hypotheses of trophic transmission, several lines of evidence suggested a role for the amphibian leech (Placobdella picta) in Ichthyophonus sp. transmission. We propose the mechanistic hypothesis that a leech acquires Ichthyophonus sp. infection when inserting its proboscis into the muscles beneath the skin of infected newts and transmits the infection to other newts in subsequent feeding bouts. We also found effects of host sex, body mass, and breeding condition on Ichthyophonus sp. prevalence and the number of attached leeches. The number of leeches attached to newts was strongly related to the proportion of newt habitat containing emergent vegetation, suggesting that anthropogenic eutrophication might lead to more frequent or severe outbreaks of Ichthyophonus sp. infection in amphibians.

  20. Descriptions of Deladenus albizicus n. sp. and D. processus n. sp. (Nematoda: Hexatylina) from Haryana, India. (United States)

    Tomar, V V S; Somvanshi, Vishal S; Bajaj, Harish K


    Two different nematodes were isolated from the bark of Albizia lebbeck trees; one from insect infested and another from noninfested, healthy tree. Based on the biological, morphological, and molecular evidences, the nematodes are described as Deladenus albizicus n. sp. and D. processus n. sp. (Nematoda: Hexatylina). Deladenus albizicus n. sp., isolated from insect-infested tree, multiplied on the fungus Nigrospora oryzae. Myceliophagous females of this nematode reproduced by parthenogenesis and spermathecae were indistinct. Infective females, readily produced in the cultures, are dorsally curved. Only one type of males containing small-sized sperms in their genital tracts were produced in the culture. Myceliophagous females: L = 0.75 to 1.71 mm, a = 32.3 to 50.8, b = 9.3 to 11.2, b' = 5.2 to 7.3, c = 27.2 to 35.6, V = 91.0 to 93.3, c' = 2.0 to 2.9, stylet = 11 to 12 µm, excretory pore in the region of median pharyngeal bulb, 43 to 47 µm anterior to hemizonid. Deladenus processus n. sp., isolated from bark of healthy A. lebbeck tree, was cultured on Alternaria alternata. Myceliophagous females reproduced by amphimixis and their spermathecae contained rounded sperms. Infective females were never produced, even in old cultures. Myceliophagous females: L = 0.76 to 0.99 mm, a = 34 to 49, b = 13.3 to 17.7, b' = 3.8 to 5.8, c = 19.6 to 22.8, V = 92.2 to 93.5, c' = 2.7 to 3.5, stylet = 6 to 7 µm, excretory pore in the proximity of hemizonid, tail conoid, tapering from both sides to a long pointed central process. It is proposed to classify Deladenus species in three groups: durus, siricidicola, and laricis groups based on female and spermatogonia dimorphism, mode of reproduction, and insect parasitism.

  1. Evaluation of Culture Conditions to Obtain Fatty Acids from Saline Microalgae Species: Dunaliella salina, Sinecosyfis sp., and Chroomonas sp.

    Directory of Open Access Journals (Sweden)

    D. A. Castilla Casadiego


    Full Text Available The use of the saline microalgae, Dunaliella salina, Sinecosyfis sp., and Chroomonas sp., was explored as an alternative source for the production of fatty acids using fertilizer and glycerol as culture media. The nutrient medium used contained “Nutrifoliar,” a commercial fertilizer, and/or glycerol, in natural sea water. The microalgae were placed in cultures with different conditions. The parameters that favored the largest production of fatty acids were 24 hours of agitation and illumination, 1620 L/day of air supply, 2.25 L of air/min, and a temperature of 32°C using “Nutrifoliar” as the culture media. Results indicated that, from 3 g of microalgae in wet base of Chroomonas sp., 54.43 mg of oil was produced. The chromatographic characterization of oil obtained revealed the presence of essential fatty acids such as 9,12,15-octadecatrienoic acid (omega-3 and 4,7,10-hexadecatrienoic acid (omega-6 from the species Dunaliella salina. On the other hand, 9,12-octadecadienoic acid (omega-6 and cis-11-eicosenoic acid (omega-9 were identified from the species Chroomonas sp. The temperature variations played an important role in the velocity of growth or the production of the algae biomass, the amount of oil, and the ability to produce fatty acids.

  2. Development of Streptomyces sp. FR-008 as an emerging chassis

    Directory of Open Access Journals (Sweden)

    Qian Liu


    Full Text Available Microbial-derived natural products are important in both the pharmaceutical industry and academic research. As the metabolic potential of original producer especially Streptomyces is often limited by slow growth rate, complicated cultivation profile, and unfeasible genetic manipulation, so exploring a Streptomyces as a super industrial chassis is valuable and urgent. Streptomyces sp. FR-008 is a fast-growing microorganism and can also produce a considerable amount of macrolide candicidin via modular polyketide synthase. In this study, we evaluated Streptomyces sp. FR-008 as a potential industrial-production chassis. First, PacBio sequencing and transcriptome analyses indicated that the Streptomyces sp. FR-008 genome size is 7.26 Mb, which represents one of the smallest of currently sequenced Streptomyces genomes. In addition, we simplified the conjugation procedure without heat-shock and pre-germination treatments but with high conjugation efficiency, suggesting it is inherently capable of accepting heterologous DNA. In addition, a series of promoters selected from literatures was assessed based on GusA activity in Streptomyces sp. FR-008. Compared with the common used promoter ermE*-p, the strength of these promoters comprise a library with a constitutive range of 60–860%, thus providing the useful regulatory elements for future genetic engineering purpose. In order to minimum the genome, we also target deleted three endogenous polyketide synthase (PKS gene clusters to generate a mutant LQ3. LQ3 is thus an “updated” version of Streptomyces sp. FR-008, producing fewer secondary metabolites profiles than Streptomyces sp. FR-008. We believe this work could facilitate further development of Streptomyces sp. FR-008 for use in biotechnological applications.

  3. Biosorption of 241Am by Candida sp

    International Nuclear Information System (INIS)

    Luo Shunzhong; Zhang Taiming; Liu Ning; Yang Yuanyou; Jin Jiannan; Hua Xinfeng


    The biosorption of radionuclide 241 Am from solutions by Candida sp., and the influences of experimental conditions on the adsorption were studied. The results showed that the adsorption equilibrium was achieved within 4h and the optimum pH=2. No significant differences on 241 Am biosorption were observed at 10-45 degree C, or challenged with Au 3+ or Ag + , even 1500 times or 4500 times over 241 Am, respectively. The adsorption rate could reach 97.8% by dry Candida sp. of 0.82 g/L in 241 Am solutions (pH=2) of 5.6-111 MBq/L (44.04-873.0 μg/L) (C 0 ), with maximum adsorption capacity (W) of 63.5 MBq/g (501.8 μg/g), implying that the removal of 241 Am by Candida sp. from solutions was feasible. The relationship between activities (C 0 ) and adsorption capacities (W) of 241 Am indicated that the biosorption process could be described by Langmuir adsorption isotherm

  4. Spanish version of the Oral Health Impact Profile (OHIP-Sp

    Directory of Open Access Journals (Sweden)

    Baelum Vibeke


    Full Text Available Abstract Background The need for appraisal of oral health-related quality of life has been increasingly recognized over the last decades. The aims of this study were to develop a Spanish version (OHIP-Sp of the Oral Health Impact Profile and to evaluate its convergent and discriminative validity, and its internal consistency. Methods The original 49-items OHIP was translated to Spanish, revised for understanding and semantics by two independent dentists, and then translated back to English by an independent bilingual dentist. The data originated in a cross sectional study conducted among high school students from the Province of Santiago, Chile. The study group was sampled using a multistage random cluster procedure yielding 9,203 students aged 12–21 years. All selected students were invited to participate and all filled a questionnaire with information on socio-demographic factors; oral health related behaviors; and self-reported oral health status (good, fair or poor. From this group, 9,163 students also accepted to fill a detailed questionnaire on socio-economic indicators and to receive a clinical examination comprising direct recordings of clinical attachment levels (CAL in molars and incisors, tooth loss, and the presence of necrotizing ulcerative gingival lesions. Results The participation rate and the questionnaire completeness were high with OHIP-Sp total scores being computed for 9,133 subjects. Self-perceived oral health status was associated with the total OHIP-Sp score and all its domains (Spearman rank correlation. The OHIP-Sp total score was also directly associated with the 4 dental outcomes investigated (Mann-Whitney test and the largest impact was found for the outcomes, 'tooth loss' with a mean OHIP-Sp score = 13.5 and 'CAL >= 3 mm' with a mean OHIP-Sp score = 13.0. Conclusion The OHIP-Sp revealed suitable convergent and discriminative validity and appropriate internal consistency (Cronbach's α. Further studies on OHIP-Sp

  5. Prolonged Ketamine Effects in Sp4 Hypomorphic Mice: Mimicking Phenotypes of Schizophrenia.

    Directory of Open Access Journals (Sweden)

    Baohu Ji

    Full Text Available It has been well established that schizophrenia patients display impaired NMDA receptor (NMDAR functions as well as exacerbation of symptoms in response to NMDAR antagonists. Abnormal NMDAR signaling presumably contributes to cognitive deficits which substantially contribute to functional disability in schizophrenia. Establishing a mouse genetic model will help investigate molecular mechanisms of hypoglutmatergic neurotransmission in schizophrenia. Here, we examined the responses of Sp4 hypomorphic mice to NMDAR antagonists in electroencephalography and various behavioral paradigms. Sp4 hypomorphic mice, previously reported to have reduced NMDAR1 expression and LTP deficit in hippocampal CA1, displayed increased sensitivity and prolonged responses to NMDAR antagonists. Molecular studies demonstrated reduced expression of glutamic acid decarboxylase 67 (GAD67 in both cortex and hippocampus, consistent with abnormal gamma oscillations in Sp4 hypomorphic mice. On the other hand, human SP4 gene was reported to be deleted in schizophrenia. Several human genetic studies suggested the association of SP4 gene with schizophrenia and other psychiatric disorders. Therefore, elucidation of the Sp4 molecular pathway in Sp4 hypomorphic mice may provide novel insights to our understanding of abnormal NMDAR signaling in schizophrenia.

  6. Lactobacillus micheneri sp. nov., Lactobacillus timberlakei sp. nov. and Lactobacillus quenuiae sp. nov., lactic acid bacteria isolated from wild bees and flowers. (United States)

    McFrederick, Quinn S; Vuong, Hoang Q; Rothman, Jason A


    Gram-stain-positive, rod-shaped, non-spore forming bacteria have been isolated from flowers and the guts of adult wild bees in the families Megachilidae and Halictidae. Phylogenetic analysis of the 16S rRNA gene indicated that these bacteria belong to the genus Lactobacillus, and are most closely related to the honey-bee associated bacteria Lactobacillus kunkeei (97.0 % sequence similarity) and Lactobacillus apinorum (97.0 % sequence similarity). Phylogenetic analyses of 16S rRNA genes and six single-copy protein coding genes, in situ and in silico DNA-DNA hybridization, and fatty-acid profiling differentiates the newly isolated bacteria as three novel Lactobacillus species: Lactobacillus micheneri sp. nov. with the type strain Hlig3 T (=DSM 104126 T ,=NRRL B-65473 T ), Lactobacillus timberlakei with the type strain HV_12 T (=DSM 104128 T ,=NRRL B-65472 T ), and Lactobacillus quenuiae sp. nov. with the type strain HV_6 T (=DSM 104127 T ,=NRRL B-65474 T ).

  7. Adaptively loaded SP-offset-QAM OFDM for IM/DD communication systems. (United States)

    Zhao, Jian; Chan, Chun-Kit


    In this paper, we propose adaptively loaded set-partitioned offset quadrature amplitude modulation (SP-offset-QAM) orthogonal frequency division multiplexing (OFDM) for low-cost intensity-modulation direct-detection (IM/DD) communication systems. We compare this scheme with multi-band carrier-less amplitude phase modulation (CAP) and conventional OFDM, and demonstrate >40 Gbit/s transmission over 50-km single-mode fiber. It is shown that the use of SP-QAM formats, together with the adaptive loading algorithm specifically designed to this group of formats, results in significant performance improvement for all these three schemes. SP-offset-QAM OFDM exhibits greatly reduced complexity compared to SP-QAM based multi-band CAP, via parallelized implementation and minimized memory length for spectral shaping. On the other hand, this scheme shows better performance than SP-QAM based conventional OFDM at both back-to-back and after transmission. We also characterize the proposed scheme in terms of enhanced tolerance to fiber intra-channel nonlinearity and the potential to increase the communication security. The studies show that adaptive SP-offset-QAM OFDM is a promising IM/DD solution for medium- and long-reach optical access networks and data center connections.

  8. SP-100 converter multicouple thermoelectric cell

    International Nuclear Information System (INIS)

    Kull, R.A.; Terrill, W.R.


    The General Electric Company is under contract to DOE to design, fabricate, and test an SP-100 Ground Engineering System. This paper provides a description of the SP-100 space reactor power system configuration, and a more detailed description of the power conversion subsystem (PCSS) and the key building block of the power converter, the thermoelectric cell. The functions of the various elements of the PCSS and the cells are also presented. These cells convert the thermal energy from the reactor into electrical power at the desired voltage while being conductively coupled to the hot and cold side heat exchangers to maximize the power output and system specific power

  9. A Verhulst model for microalgae Botryococcus sp. growth and nutrient removal in wastewater (United States)

    Jamaian, Siti Suhana; Bakeri, Noorhadila Mohd; Sunar, Norshuhaila Mohamed; Gani, Paran


    Microalgae Botryococcus sp. is a colonial green alga found in lakes and reservoirs in Malaysia. Previous studies reported that the potential of Botryococcus sp. photosynthesis as a source of fuel. The Botryococcus sp. contains hydrocarbon up to 75% of dry weight, which can be converted into petrol, diesel or turbine fuel or other liquid or gaseous hydrocarbons. Recently, an experimental study was conducted on phycoremediation technology for wastewater using Botryococcus sp. The phycoremediation technology is useful to remove the excess of nutrients such as nitrogen, phosphorus and also have the ability to remove various pollutants from wastewater. This research implements the Verhulst model to estimate the nutrient removal by microalgae Botryococcus sp. from the wastewater. This model has been validated with the experiments of microalgae Botryococcus sp. grown in domestic and palm oil wastewater. The results suggested that microalgae Botryococcus sp. could be cultured in domestic and palm oil wastewater while nutrients are reduced from these wastewaters.

  10. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    International Nuclear Information System (INIS)

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji; Kuwahara, Jun


    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  11. Radioimmunoassay of serum SP 1 and HPL in normal and abnormal pregnancies

    International Nuclear Information System (INIS)

    Pluta, M.; Hardt, W.; Schmidt-Gollwitzer, K.; Schmidt-Gollwitzer, M.


    Serum concentrations of the pregnancy-specific β 1 -glycoprotein (SP 1) and human placental lactogen (HPL) were measured by radioimmunoassay in 372 blood samples obtained from 40 women in the second half of a normal singleton pregnancy. The mean level of SP 1 steadily increased from 40 μg/ml in the 22nd week of pregnancy to 168 μg/ml in the 36th week of gestation and thereafter reached a plateau. The half-life of SP 1 during the first week after delivery was about 39 h. The clinical value of SP 1 in comparison to HPL estimation was assessed in a prospective study of a few high risk pregnancies. There were no significant differences between serum SP 1 and HPL levels in pregnancies complicated by preeclampsia with or without intrauterine growth retardation and in twin pregnancies. Serum HPL and SP 1 levels were equally effective in predicting placental insufficiency with fetal growth retardation. (orig./AJ) [de

  12. Antimicrobial peptides from Capsicum sp.

    African Journals Online (AJOL)

    ajl yemi


    Dec 30, 2011 ... Key words: Antimicrobial peptides, Capsicum sp, Capsicum chinense, chili pepper, agronomical options, ..... of this human activity is resumed by the simple phrase: produce .... It will be interesting to scale the AMPs extraction.

  13. Ground testing of an SP-100 prototypic reactor

    International Nuclear Information System (INIS)

    Motwani, K.; Pflasterer, G.R.; Upton, H.; Lazarus, J.D.; Gluck, R.


    SP-100 is a space power system which is being developed by GE to meet future space electrical power requirements. The ground testing of an SP-100 prototypic reactor system will be conducted at the Westinghouse Hanford Company site located at Richland, Washington. The objective of this test is to demonstrate the performance of a full scale prototypic reactor system, including the reactor, control system and flight shield. The ground test system is designed to simulate the flight operating conditions while meeting all the necessary nuclear safety requirements in a gravity environment. The goal of the reactor ground test system is to establish confidence in the design maturity of the SP-100 space reactor power system and resolve the technical issues necessary for the development of a flight mission design

  14. IAA-producing Penicillium sp. NICS01 triggers plant growth and suppresses Fusarium sp.-induced oxidative stress in sesame (Sesamum indicum L.). (United States)

    Radhakrishnan, Ramalingam; Shim, Kang-Bo; Lee, Byeong-Won; Hwang, Chung-Dong; Pae, Suk-Bok; Park, Chang-Hwan; Kim, Sung-Up; Lee, Choon-Ki; Baek, In-Youl


    Application of rhizospheric fungi is an effective and environmentally friendly method of improving plant growth and controlling many plant diseases. The current study was aimed to identify phytohormone-producing fungi from soil, to understand their roles in sesame plant growth, and to control Fusarium disease. Three predominant fungi (PNF1, PNF2, and PNF3) isolated from the rhizospheric soil of peanut plants were screened for their growth-promoting efficiency on sesame seedlings. Among these isolates, PNF2 significantly increased the shoot length and fresh weight of seedlings compared with controls. Analysis of the fungal culture filtrate showed a higher concentration of indole acetic acid in PNF2 than in the other isolates. PNF2 was identified as Penicillium sp. on the basis of phylogenetic analysis of ITS sequence similarity. The in vitro biocontrol activity of Penicillium sp. against Fusarium sp. was exhibited by a 49% inhibition of mycelial growth in a dual culture bioassay and by hyphal injuries as observed by scanning electron microscopy. In addition, greenhouse experiments revealed that Fusarium inhibited growth in sesame plants by damaging lipid membranes and reducing protein content. Co-cultivation with Penicillium sp. mitigated Fusarium-induced oxidative stress in sesame plants by limiting membrane lipid peroxidation, and by increasing the protein concentration, levels of antioxidants such as total polyphenols, and peroxidase and polyphenoloxidase activities. Thus, our findings suggest that Penicillium sp. is a potent plant growthpromoting fungus that has the ability to ameliorate damage caused by Fusarium infection in sesame cultivation.

  15. Deinococcus frigens sp. nov., Deinococcus saxicola sp. nov., and Deinococcus marmoris sp. nov., low temperature and draught-tolerating, UV-resistant bacteria from continental Antarctica. (United States)

    Hirsch, Peter; Gallikowski, Claudia A; Siebert, Jörg; Peissl, Klaus; Kroppenstedt, Reiner; Schumann, Peter; Stackebrandt, Erko; Anderson, Robert


    Six Gram-positive, non-motile, UV- and draught-tolerant bacteria were isolated from antarctic soil and rock samples. The pink to orange cocci grew well on oligotrophic medium PYGV (pH 7.5) at 9-18 degrees C. They tolerated 0-10% NaCl, were aerobic to facultatively anaerobic and contained ornithine in their cell wall (type A3beta, Orn-Gly2). The lipid profiles of four strains were found to be typical for those of D. radiodurans. Major fatty acids were 16:1cis9, 15:1cis9, 17:1cis9 and i17:1cis9, the respiratory quinone of three strains was MK-8. Comparative 16S rDNA gene sequencing revealed phylogenetic relationships to the Deinococcus clade, especially to D. radiopugnans. The levels of 16S rRNA gene sequence similarity and DNA-DNA hybridisation data showed the six isolates represented new taxa. Phenotypic properties supported the description of three new species which were different from the eight known Deinococcus species and particularly from D. radiopugnans. Soil isolate AA-692T (DSM 12807T) is the type strain of Deinococcus frigens sp. nov., with AA-752 (DSM 15993) and AA-829 (DSM 15994) as additional strains from soil. The endolithic isolate AA-1444T, Deinococcus saxicola sp. nov., (DSM 15974T) came from antarctic sandstone, and Deinococcus marmoris sp. nov. (isolate AA-63T [DSM 12784T]) as well as AA-69 (DSM 15951) were isolated from antarctic marble.

  16. Oxygen uptake from aquatic macrophyte decomposition from Piraju Reservoir (Piraju, SP, Brazil

    Directory of Open Access Journals (Sweden)

    I. Bianchini Jr.

    Full Text Available The kinetics of oxygen consumption related to mineralisation of 18 taxa of aquatic macrophytes (Cyperus sp, Azolla caroliniana, Echinodorus macrophyllus, Eichhornia azurea, Eichhornia crassipes, Eleocharis sp1, Eleocharis sp2, Hetereanthera multiflora, Hydrocotyle raniculoides, Ludwigia sp, Myriophyllum aquaticum, Nymphaea elegans, Oxycaryum cubense, Ricciocarpus natans, Rynchospora corymbosa, Salvinia auriculata, Typha domingensis and Utricularia foliosa from the reservoir of Piraju Hydroelectric Power Plant (São Paulo state, Brazil were described. For each species, two incubations were prepared with ca. 300.0 mg of plant (DW and 1.0 L of reservoir water sample. The incubations were maintained in the dark and at 20 ºC. Periodically the dissolved oxygen (DO concentrations were measured; the accumulated DO values were fitted to 1st order kinetic model and the results showed that: i high oxygen consumption was observed for Ludwigia sp (533 mg g-1 DW, while the lowest was registered for Eleocharis sp1 (205 mg g-1 DW mineralisation; ii the higher deoxygenation rate constants were verified in the mineralisation of A. caroliniana (0.052 day-1, H. raniculoides (0.050 day-1 and U. foliosa (0.049 day-1. The oxygen consumption rate constants of Ludwigia sp and Eleocharis sp2 mineralisation (0.027 day-1 were the lowest. The half-time of oxygen consumption varied from 9 to 26 days. In the short term, the detritus of E. macrophyllus, H. raniculoides, Ludwigia sp, N. elegans and U. foliosa were the critical resources to the reservoir oxygen demand; while in the long term, A. caroliniana, H. multiflora and T. domingensis were the resources that can potentially contribute to the benthic oxygen demand of this reservoir.

  17. Prauserella endophytica sp. nov., an endophytic actinobacterium isolated from Tamarix taklamakanensis. (United States)

    Liu, Jia-Meng; Habden, Xugela; Guo, Lin; Tuo, Li; Jiang, Zhong-Ke; Liu, Shao-Wei; Liu, Xian-Fu; Chen, Li; Li, Rong-Feng; Zhang, Yu-Qin; Sun, Cheng-Hang


    A novel endophytic actinobacterium, designated strain SP28S-3(T), was isolated from a surface-sterilized stem of Tamarix taklamakanensis collected from the southern edge of Taklamakan desert, Xinjiang, China. Strain SP28S-3(T) was found to show chemotaxonomic and morphological properties consistent with its classification in the genus Prauserella. The polar lipids were found to consist of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, phosphatidylmethylethanolamine, phosphoglycolipid, phosphatidylcholine, phosphatidylinositol, a glycolipid, an aminolipid and unidentified phospholipids. The major fatty acids (>10 %) were identified as iso-C16:0 and C16:0. The genomic DNA G+C content was determined to be 69.7 mol%. Phylogenetic analysis of strain SP28S-3(T) clearly showed that the strain had the highest similarity of 16S rRNA gene sequence with Prauserella coralliicola SCSIO 11529(T) (99.9 %), followed by Prauserella marina DSM 45268(T) (97.0 %) and is affiliated with the genus Prauserella. The low level (47.8 ± 5.5 %) of DNA-DNA relatedness between strain SP28S-3(T) and P. coralliicola SCSIO 11529(T) combined with other polyphasic taxonomic evidence clearly support the conclusion that strain SP28S-3(T) represents a novel Prauserella species, for which the name Prauserella endophytica sp. nov. is proposed. The type strain is SP28S-3(T) (=DSM 46655(T) = CGMCC 4.7182 (T)).

  18. Blastocystis sp. and other intestinal parasites in hemodialysis patients. (United States)

    Kulik, Rose Anne; Falavigna, Dina Lúcia Morais; Nishi, Letícia; Araujo, Silvana Marques


    Chronic renal insufficiency disease (CRI) leads to uremia in hemodialysis patients and induces a state of immunodepression that results in higher frequencies of infections and diarrhea. Hemodialysis patients resident in the city of Campo Mourão, Paraná, Brazil were analyzed from April 2006 through September 2007 for Blastocystis sp. and other intestinal parasites and for associated diarrhea. Fecal samples from 86 hemodialysis patients and 146 healthy (reference) persons were examined by standard methods for detecting ova, larvae and cysts, which included preservation in 10% formalin and the Kinyoun method. Thirty-three hemodialysis patients (45.1%) and 36 reference individuals (25.7%) were found to be parasitized. The differences in the percentages of parasitism and polyparasitism between the reference group and the chronic renal patients was significant (p= 0.0318 and 0.0019, respectively). Blastocystis sp. (18%-20.1%), Endolimax nana (14%-16.3%), Cryptosporidium sp. (4%-4.7%) and Entamoeba coli (4%-4.7%) were the most frequent protozoa found in the hemodialysis patients. Parasitism was not significantly associated with diarrhea (p=0.9947) or with decreased white blood cell counts (p=0.7046) in these individuals. Because parasitic infections may be an important comorbidity factor in hemodialysis patients, we suggest that parasitological stool examinations, especially for Blastocystis sp. and Cryptosporidium sp., be included in routine medical follow-up examinations of these patients.

  19. Blastocystis sp. and other intestinal parasites in hemodialysis patients

    Directory of Open Access Journals (Sweden)

    Rose Anne Kulik

    Full Text Available Chronic renal insufficiency disease (CRI leads to uremia in hemodialysis patients and induces a state of immunodepression that results in higher frequencies of infections and diarrhea. Hemodialysis patients resident in the city of Campo Mourão, Paraná, Brazil were analyzed from April 2006 through September 2007 for Blastocystis sp. and other intestinal parasites and for associated diarrhea. Fecal samples from 86 hemodialysis patients and 146 healthy (reference persons were examined by standard methods for detecting ova, larvae and cysts, which included preservation in 10% formalin and the Kinyoun method. Thirty-three hemodialysis patients (45.1% and 36 reference individuals (25.7% were found to be parasitized. The differences in the percentages of parasitism and polyparasitism between the reference group and the chronic renal patients was significant (p= 0.0318 and 0.0019, respectively. Blastocystis sp. (18%-20.1%, Endolimax nana (14%-16.3%, Cryptosporidium sp. (4%-4.7% and Entamoeba coli (4%-4.7% were the most frequent protozoa found in the hemodialysis patients. Parasitism was not significantly associated with diarrhea (p=0.9947 or with decreased white blood cell counts (p=0.7046 in these individuals. Because parasitic infections may be an important comorbidity factor in hemodialysis patients, we suggest that parasitological stool examinations, especially for Blastocystis sp. and Cryptosporidium sp., be included in routine medical follow-up examinations of these patients.

  20. Serum-surfactant SP-D correlates inversely to lung function in cystic fibrosis

    DEFF Research Database (Denmark)

    Olesen, Hanne Vebert; Holmskov, Uffe; Schiøtz, Peter Oluf


    BACKGROUND: Cystic fibrosis (CF) affects the lungs causing infections and inflammation. Surfactant protein D (SP-D) is an innate defense lectin primarily secreted in the lungs. We investigated the influence of the SP-D Met11Thr polymorphism on CF lung function; and serum SP-D as a marker for CF...

  1. Sp5 induces the expression of Nanog to maintain mouse embryonic stem cell self-renewal. (United States)

    Tang, Ling; Wang, Manman; Liu, Dahai; Gong, Mengting; Ying, Qi-Long; Ye, Shoudong


    Activation of signal transducer and activator of transcription 3 (STAT3) by leukemia inhibitory factor (LIF) maintains mouse embryonic stem cell (mESC) self-renewal. Our previous study showed that trans-acting transcription factor 5 (Sp5), an LIF/STAT3 downstream target, supports mESC self-renewal. However, the mechanism by which Sp5 exerts these effects remains elusive. Here, we found that Nanog is a direct target of Sp5 and mediates the self-renewal-promoting effect of Sp5 in mESCs. Overexpression of Sp5 induced Nanog expression, while knockdown or knockout of Sp5 decreased the Nanog level. Moreover, chromatin immunoprecipitation (ChIP) assays showed that Sp5 directly bound to the Nanog promoter. Functional studies revealed that knockdown of Nanog eliminated the mESC self-renewal-promoting ability of Sp5. Finally, we demonstrated that the self-renewal-promoting function of Sp5 was largely dependent on its zinc finger domains. Taken together, our study provides unrecognized functions of Sp5 in mESCs and will expand our current understanding of the regulation of mESC pluripotency.


    Directory of Open Access Journals (Sweden)

    Blondine Ch. P


    Full Text Available Abstrak Bacillus thuringiensis serotipe H-14 strain lokal adalah bakteri patogen bersifat target spesifiknya larva nyamuk, aman bagi mamalia dan lingkungan. Penelitian bertujuan menentukan efektivitas B. thuringiensis H-14 strain lokal yang dikembangbiakkan dalam buah kelapa untuk pengendalian larva Anopheles sp dan Culex sp. Rancangan eksperimental semu, terdiri dari kelompok perlakuan dan kontrol. Bacillus thuringiensis H-14 strain lokal dikembangbiakan dalam10 buah kelapa umur 6–8 bulan, dengan berat kira-kira 1 kg, telah berisi air kelapa sekitar 400-500 ml/buah kelapa yang diperoleh dari Desa Klaces, Kampung Laut, Kabupaten Cilacap. Diinkubasi selama 14 hari pada temperatur kamar dan ditebarkan di 6 kolam yang menjadi habitat perkembangbiakan larva nyamuk dengan luas berkisar 3–100 m2.Hasil yang diperoleh menunjukkan efektivitas B. thuringiensis H-14 strain lokal terhadap larva Anopheles sp dan Culex sp selama 1 hari sesudah penebaran kematian larva berturut-turut sebesar 80–100% dan 79,31–100%. Sedangkan pada hari ke-14 sebesar 69,30–76,71% dan 67,69–86,04%. Buah kelapa dapat digunakan sebagai media lokal alternatif untuk pengembangbiakan B. thuringiensis H-14 strain lokal Kata kunci: B. thuringiensis H-14,  strain  lokal, buah kelapa, pengendalian larva Abstract Bacillus thuringiensis serotype H-14 local strain is pathogenic bacteria which specific  target to mosquito larvae. It is safe for mammals and enviroment. The aims of this study was to determine the effectivity of B. thuringiensis H-14 local strain which culturing in thecoconut wates against Anopheles sp and Culex sp mosquito larvae. This research is quasi experiment which consist of treated  and control groups. Bacillus thuringiensis H-14 local strain was cultured in 10 coconuts with 6–8 months age with weight around 1 kg that contained were approximately 400-500 ml/coconut were taken from Klaces village, Kampung Laut. After that the coconuts incubated for 14

  3. .i.Aspergillus baeticus./i. sp. nov. and .i.Aspergillus thesauricus./i. sp. nov., two species in section .i.Usti./i. from Spanish caves

    Czech Academy of Sciences Publication Activity Database

    Nováková, Alena; Hubka, Vít; Saiz-Jimenez, C.; Kolařík, Miroslav


    Roč. 62, November (2012), s. 2778-2785 ISSN 1466-5026 Grant - others:GAUK(CZ) 607812 Institutional research plan: CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Aspergillus baeticus sp. nov. * Aspergillus thesauricus sp.nov. * Spanish caves Subject RIV: EH - Ecology, Behaviour Impact factor: 2.112, year: 2012

  4. Infection Vibrio sp. Bacteria on Kappaphycus Seaweed Varieties Brown and Green (United States)

    Irmawati, Yuni; Sudirjo, Fien


    Disease in seaweed or ice-ice, until today is still a major problem in the cultivation of seaweed. Changes in extreme environmental conditions is a trigger factor of ice-ice, which can result in seaweed susceptible to infection with pathogenic microorganisms, such as bacteria Vibrio sp. This research aims to determine the bacteria Vibrio sp. infection in seaweed Kappaphycus varieties of brown and green. Vibrio sp. bacteria isolated in the infected seaweed thallus ice-ice, grown on TCBS media, purification, gram staining and biochemical tests. Vibrio sp. infected to seaweed Kappaphycus brown and green varieties in containers controlled by different density, 105 CFU/ml, 106 CFU/ml and 107CFU/ml. Observations were made to change clinical effect in thallus seaweed for 14 days of observation. The results obtained show that the levels of infection bacteria Vibrio sp. higher in seaweed Kappaphycus green varieties both in density 105 CFU/ml, 106 CFU/ml and 107CFU/ml, when compared with varieties brown.

  5. Effect of Indigenous Pseudomonas sp. and Bacillus sp. Strains on Yield and Main Chemical Growth Parameters of Radicchio

    Directory of Open Access Journals (Sweden)

    Stanojković-Sebić Aleksandra


    Full Text Available Pseudomonas sp. and Bacillus sp. belong to plant growth promoting rhizobacteria which are able to colonize the plants roots and stimulate growth. In this study, the effect of two indigenous plant growth promoting rhizobacterial strains Pseudomonas sp. Q4 and Bacillus sp. Q10 and their mixture (mix Q4+Q10 on content of the main chemical growth parameters (nitrogen, phosphorus, potassium, calcium and magnesium and the yield of dry biomass of radicchio (Cichorium spp. var. rossa di treviso aerial parts and root, was investigated. The study was carried out with stagnosol type of soil in pot experiments under semi-controlled conditions in the Institute of Soil Science (Belgrade, in the period from July to October in 2013. Phosphorus was determined by spectrophotometer, potassium - by flame emission photometry and total nitrogen and carbon - using elemental CNS analyzer, while calcium and magnesium were determined by AAS. The data on yield of both aerial parts and root dry biomass of radicchio showed that its treatment with Q4 and Q10 strains, as well as with their mixture, caused noticeably increase in this parameter in relation to the control, whereby the strain Q4 was more effective for aerial parts, while mix Q4+Q10 - for roots. The obtained data on the studied chemical parameters of radicchio root and aerial parts were in total accordance with their yield. Concluding, studied strains have a potential in promoting the biomass yield and main chemical growth parameters of both aerial parts and root of radicchio.

  6. Modifications of Sp(2) covariant superfield quantization

    Energy Technology Data Exchange (ETDEWEB)

    Gitman, D.M.; Moshin, P.Yu


    We propose a modification of the Sp(2) covariant superfield quantization to realize a superalgebra of generating operators isomorphic to the massless limit of the corresponding superalgebra of the osp(1,2) covariant formalism. The modified scheme ensures the compatibility of the superalgebra of generating operators with extended BRST symmetry without imposing restrictions eliminating superfield components from the quantum action. The formalism coincides with the Sp(2) covariant superfield scheme and with the massless limit of the osp(1,2) covariant quantization in particular cases of gauge-fixing and solutions of the quantum master equations.

  7. Radioiodinate labeling of atherosclerotic plaque imaging agent SP-4 and preliminary experiments

    International Nuclear Information System (INIS)

    Zhang, Y.; Wu, Z.


    SP-4 was oligopeptide contained 18 amino-acid. It was a part of apolipoprotein B. To study labeling SP-4 with 131 I and its clinical prospect as an atherosclerotic plaque imaging agent. SP-4 was synthesized by solid phase method and identified by amino acid analysis after purification with preparation-model HPLC. SP-4 was labeled with 131 I by the Chloramine-T method and purified through Sephadex G-25, then the radiochemical purity of 131 SP-4 and its stability in vitro were analyzed. 12 New Zealand rabbits were divided into atherosclerosis group (n=7, group A) and control group (n=5, group B). All of them were administrated with bovine serum albumen through i.v., then the rabbits of group A were fed on high cholesterol and high fat diet and group B, on normal diet. Purified 131 I-SP-4 was injected intravenously. %ID/g in blood and thoracic aorta and abdominal aorta at 4 hrs after injection and biodistribution of 131 I-SP-4 was investigated. The amino acid formation of the pure product was identified to be correct through amino-acid analysis. The radiochemical purity of 131 I-SP-4 was 96.2% after being purified, but less than 90% after being stored for 20 hrs. One of 7 rabbits in group A died after being fed for three weeks, the others were alive and atherosclerotic lesions were found after being fed for two mon. On the contrary, 5 rabbits in group B were visualized not to have atherosclerotic lesions. The uptakes of group A and group B at 4 hr after injection were 0.0378±0.0028 and 0.0371±0.038 in blood (p>0.05), 0.0882 ±0.0101 and 0.0276 ±0.0044 in abdominal aorta (p 131 I-SP-4 was mainly excreted through kidneys. SP-4 remained its biological activity after radioiodination and was located at atherosclerotic lesions. It was potentially useful as an atherosclerotic plaque imaging agent

  8. Spiribacter curvatus sp. nov., a moderately halophilic bacterium isolated from a saltern. (United States)

    León, María José; Rodríguez-Olmos, Angel; Sánchez-Porro, Cristina; López-Pérez, Mario; Rodríguez-Valera, Francisco; Soliveri, Juan; Ventosa, Antonio; Copa-Patiño, José Luis


    A novel pink-pigmented bacterial strain, UAH-SP71T, was isolated from a saltern located in Santa Pola, Alicante (Spain) and the complete genome sequence was analysed and compared with that of Spiribacter salinus M19-40T, suggesting that the two strains constituted two separate species, with a 77.3% ANI value. In this paper, strain UAH-SP71T was investigated in a taxonomic study using a polyphasic approach. Strain UAH-SP71T was a Gram-stain-negative, strictly aerobic, non-motile curved rod that grew in media containing 5-20% (w/v) NaCl (optimum 10% NaCl), at 5-40 °C (optimum 37 °C) and at pH 5-10 (optimum pH 8). Phylogenetic analysis based on the comparison of 16S rRNA gene sequences revealed thatstrain UAH-SP71T is a member of the genus Spiribacter, showing a sequence similarity of 96.5% with Spiribacter salinus M19-40T. Other related species are also members of the family Ectothiorhodospiraceae, including Arhodomonas recens RS91T (95.5% 16S rRNA gene sequence similarity), Arhodomonas aquaeolei ATCC 49307T (95.4 %) and Alkalilimnicola ehrlichii MLHE-1T (94.9 %). DNA-DNA hybridization between strain UAH-SP71T and Spiribacter salinus M19-40T was 39 %. The major cellular fatty acids of strain UAH-SP71T were C18 : 1ω6c and/or C18 : 1ω7c, C16 : 0, C16 : 1ω6c and/or C16 : 1ω7c, C10 : 0 3-OH and C12 : 0, a pattern similar to that of Spiribacter salinus M19-40T. Phylogenetic, phenotypic and genotypic differences between strain UAH-SP71T and Spiribacter salinus M19-40T indicate that strainUAH-SP71T represents a novel species of the genus Spiribacter, for which the name Spiribacter curvatus sp. nov. is proposed. The type strain is UAH-SP71T (5CECT8396T5DSM 28542T).

  9. Interaction of calcitonin gene related peptide (CGRP) and substance P (SP) in human skin. (United States)

    Schlereth, Tanja; Schukraft, Jonas; Krämer-Best, Heidrun H; Geber, Christian; Ackermann, Tatiana; Birklein, Frank


    Calcitonin gene related peptide (CGRP) and substance P (SP) are neuropeptides that are simultaneously released from nociceptive C-fibers. CGRP is a potent vasodilator, inducing a long-lasting increase in superficial skin blood flow, whereas SP induces only a brief vasodilation but a significant plasma extravasation. CGRP and SP may play important roles in the pathophysiology of various pain states but little is known about their interaction. Different concentrations of SP (ranging from 10 -5 M to 10 -9 M) were applied to the volar forearm of 24 healthy subjects via dermal microdialysis. SP was applied either alone or in combination with CGRP10 -9 M and CGRP 10 -6 M. As expected, SP induced a transient increase in skin blood flow that decayed shortly after application. This transient blood flow peak was blunted with co-application of CGRP 10 -9 M and inhibited with co-application of CGRP10 -6 M. SP alone induced plasma protein extravasation (PPE). However, when CGRP10 -6 M was added, the PPE significantly increased. Our results demonstrate a complex interaction of the neuropeptides CGRP and SP. CGRP10 -6 M prevented SP-induced early vasodilation but augmented SP-induced PPE. These interactions might explain why vascular symptoms in chronic pain can differ strikingly between individuals. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Pemacuan Pertumbuhan Melon (Cucumis melo L. dengan Cendawan Mikoriza Arbuskula dan Bakteri Azospirillum sp.

    Directory of Open Access Journals (Sweden)

    Lady Diana Tetelepta


    Full Text Available ABSTRACTMelon (Cucumis melo L. is a high economic value horticultural crop that is cultivated in some regions of Indonesia under fertilization management. Application of inorganic fertilizer continuously can reduce soil microbial abundance. One of the soil microbial that promote plant growth is arbuscular mycorrhizal fungi (AMF and Azospirillum sp. The aim of this study was to analysed the effect of AMF and Azospirillum sp. in promoting growth and production of melon. The experiment was carried out in a greenhouse and was arranged in a completely randomized design with five replicates. Five treatments tested were: control, fertilized with NPK, inoculated with AMF, inoculated with Azospirillum sp., inoculated with AMF + Azospirillum sp. The results showed that the effect of AMF on root growth and shoot growth were similar to NPK fertilizer. Azospirillum sp. increased root growth. On the other side, the effect of Azospirillum sp. on shoot growth was similar to NPK fertilizer. However, AMF and Azospirillum sp. inoculation solely increased plant height, fruit weight, fruit diameter, flavor and length of fruit storage. Meanwhile, combination of AMF and Azospirillum sp. increased plant height, root growth, shoot growth, fruit weight, fruit diameter, flavor and length of fruit storage. This study revealed that application of AMF and Azospirillum sp. in melon cultivation was more effective and efficient than NPK fertilizer.Keywords: arbuscular mycorrhizal fungi, Azospirillum sp., Cucumis melo L.

  11. Synthetic lung surfactants containing SP-B and SP-C peptides plus novel phospholipase-resistant lipids or glycerophospholipids

    Directory of Open Access Journals (Sweden)

    Robert H. Notter


    Full Text Available Background This study examines the biophysical and preclinical pulmonary activity of synthetic lung surfactants containing novel phospholipase-resistant phosphonolipids or synthetic glycerophospholipids combined with Super Mini-B (S-MB DATK and/or SP-Css ion-lock 1 peptides that replicate the functional biophysics of surfactant proteins (SP-B and SP-C. Phospholipase-resistant phosphonolipids used in synthetic surfactants are DEPN-8 and PG-1, molecular analogs of dipalmitoyl phosphatidylcholine (DPPC and palmitoyl-oleoyl phosphatidylglycerol (POPG, while glycerophospholipids used are active lipid components of native surfactant (DPPC:POPC:POPG 5:3:2 by weight. The objective of the work is to test whether these novel lipid/peptide synthetic surfactants have favorable preclinical activity (biophysical, pulmonary for therapeutic use in reversing surfactant deficiency or dysfunction in lung disease or injury. Methods Surface activity of synthetic lipid/peptide surfactants was assessed in vitro at 37 °C by measuring adsorption in a stirred subphase apparatus and dynamic surface tension lowering in pulsating and captive bubble surfactometers. Shear viscosity was measured as a function of shear rate on a Wells-Brookfield micro-viscometer. In vivo pulmonary activity was determined by measuring lung function (arterial oxygenation, dynamic lung compliance in ventilated rats and rabbits with surfactant deficiency/dysfunction induced by saline lavage to lower arterial PO2 to <100 mmHg, consistent with clinical acute respiratory distress syndrome (ARDS. Results Synthetic surfactants containing 5:3:2 DPPC:POPC:POPG or 9:1 DEPN-8:PG-1 combined with 3% (by wt of S-MB DATK, 3% SP-Css ion-lock 1, or 1.5% each of both peptides all adsorbed rapidly to low equilibrium surface tensions and also reduced surface tension to ≤1 mN/m under dynamic compression at 37 °C. However, dual-peptide surfactants containing 1.5% S-MB DATK + 1.5% SP-Css ion-lock 1 combined with

  12. Characterization of diazotrophic bacteria non-symbiotic associated with eucalyptus (eucalyptus sp.) in Codazzi, Cesar (Colombia)

    International Nuclear Information System (INIS)

    Obando Castellanos, Dolly Melissa; Burgos Zabala, Ludy Beatriz; Rivera Botia, Diego Mauricio; Rubiano Garrido, Maria Fernanda; Divan Baldini, Vera Lucia; Bonilla Buitrago, Ruth Rebeca


    The effect of climatic seasons (rainy and dry) and the stratum sample (rhizospheric soil, roots and leaves) the population of the genera Azotobacter, Beijerinckia, Derxia, Azospirillum, Herbaspirillum, Gluconacetobacter and Burkholderia in soil rhizosphere, roots and leaves of eucalyptus (eucalyptus sp.). It also assesses their ability to produce indoles compounds as plant growth promoters and their acetylene reduction activity as an indicator of biological fixation of nitrogen. The results showed no statistically significant differences in the Duncan test (p ≤ 0.05) in the population with respect to the climate epoch, suggesting that these bacteria are able to tolerate stress conditions by different physiological mechanisms. With respect to the stratum sample isolates attempts of Herbaspirillum sp. and Azospirillum sp. significant differences in rhizospheric soil and roots. we obtained 44 isolates of which were grouped by phenotypic characterization as 14 suspected of Beijerinckia sp., 12 Azotobacter sp., 8 Derxia sp., 4 Herbaspirillum sp., 5 Azospirillum sp., 1 Gluconacetobacter sp. and 1 Burkholderia sp. due to their high potential were selected isolates C27, C26 and C25. These four strains present the best values of efficiency in vitro, exceeding production values of the reference strains used (A. chroococcum (AC1) and a. brasilense (SP7)).

  13. [Influence of staphylococcin T on Enterococcus sp. growth]. (United States)

    Białucha, Agata; Kozuszko, Sylwia; Gospodarek, Eugenia; Bugalski, Roman Marian; Gierlotka, Krzysztof


    Bacteriocins are ribosomally synthesised, extracellular bacterial products. Generally, spectrum of inhibition is limited to the same or closely related species to bacteriocin producer. Staphylococcin T is produced by Staphylococcus cohnii strain. The present study concerns influence of StT to 267 Enterococcus sp. strains growth isolated between 2003 and 2006 in Department of Microbiology University Hospital of dr. A. Jurasz in Bydgoszcz. S. cohnii T antagonistic ability evaluated towards bacteries on Mueller-Hinton Agar (bio Mérieux) in aerobic conditions. After 24 and 48 hours tested enterococci suspensions were plated perpendiculary. Susceptibility to antibiotics was assessed by disc diffusion method according to the guideless of Clinical and Laboratory Standards Institute and National Reference Centre for Antimicrobial Susceptibility. Among Enterococcus sp. strains tested 7.1% were sensitive to StT. The highest percentage of sensitive enterococci isolated from wound swabs, urine, blood and pus. Enterococcus faecium strains dominated (63.2%) among enterococci sensitive to StT. Moderate inhibition degree on S. cohnii T bacteriocin action was observed in majority sensitive enterococci strains. Enterococcus sp. sensitive to StT strains were frequently multidrug resistant (68.4%). According to the study results and increasing resistance to antibiotics, StT could be an alternative agent used to treat infections caused by Enterococcus sp.

  14. Microbiota Influences Morphology and Reproduction of the Brown Alga Ectocarpus sp. (United States)

    Tapia, Javier E; González, Bernardo; Goulitquer, Sophie; Potin, Philippe; Correa, Juan A


    Associated microbiota play crucial roles in health and disease of higher organisms. For macroalgae, some associated bacteria exert beneficial effects on nutrition, morphogenesis and growth. However, current knowledge on macroalgae-microbiota interactions is mostly based on studies on green and red seaweeds. In this study, we report that when cultured under axenic conditions, the filamentous brown algal model Ectocarpus sp. loses its branched morphology and grows with a small ball-like appearance. Nine strains of periphytic bacteria isolated from Ectocarpus sp. unialgal cultures were identified by 16S rRNA sequencing, and assessed for their effect on morphology, reproduction and the metabolites secreted by axenic Ectocarpus sp. Six of these isolates restored morphology and reproduction features of axenic Ectocarpus sp. Bacteria-algae co-culture supernatants, but not the supernatant of the corresponding bacterium growing alone, also recovered morphology and reproduction of the alga. Furthermore, colonization of axenic Ectocarpus sp. with a single bacterial isolate impacted significantly the metabolites released by the alga. These results show that the branched typical morphology and the individuals produced by Ectocarpus sp. are strongly dependent on the presence of bacteria, while the bacterial effect on the algal exometabolome profile reflects the impact of bacteria on the whole physiology of this alga.

  15. Toleransi Tanaman Peneduh Polyalthia longifolia dan Pterocarpus indicus terhadap Ganoderma sp.

    Directory of Open Access Journals (Sweden)

    Siti Muslimah Widyastuti


    Full Text Available Susceptibility of Urban Trees Polyalthia longifolia and Pterocarpus indicus to Infection of  the red root rot fungus Ganoderma sp. Urban trees on the Gadjah Mada University (UGM area play an important role in increasing environmental qualities as well as in supporting the teaching and learning processes. However, red root rot disease caused by Basidiomycete Ganoderma sp. has severely infected some existing urban trees. This experiment was aimed to determine the susceptibility of Polyalthia longifolia (glodokan and Pterocarpus indicus (angsana to the infection of Ganoderma sp. Identification of infected trees was performed in UGM area. Further steps were carried out to achieve those objectives : (1 isolation of Ganoderma spp. and testing of Koch’s postulate and (2 examination of the susceptibility of  P. longifolia and P. indicus to infection of Ganoderma sp. The susceptibility test of P. longifolia and P. indicus to Ganoderma sp. indicated that P. longifolia was more resistant to fungal pathogen infection than that of P. indicus. Based on this experiment, it can be concluded that P. longifolia is a species that is more suitable than P. indicus.  P. longifolia should be planted on the areas that have been infested with inocula of Ganoderma sp..

  16. The astaxanthin dideoxyglycoside biosynthesis pathway in Sphingomonas sp. PB304

    DEFF Research Database (Denmark)

    Kim, Se Hyeuk; Kim, Jin Ho; Lee, Bun Yeol


    A major carotenoid in Sphingomonas sp. PB304, originally isolated from a river in Daejon City, South Korea, was identified as astaxanthin dideoxyglycoside. Gene clusters encoding the astaxanthin dideoxyglycoside biosynthetic enzymes were identified by screening Sphingomonas sp. PB304 fosmid...

  17. Bioreduction of chromate by immobilized cells of Halomonas sp

    Energy Technology Data Exchange (ETDEWEB)

    Murugavelh, S.; Mohanty, Kaustubha [Department of Chemical Engineering, Indian Institute of Technology Guwahati, Guwahati – 781039, Assam (India)


    In this work, the bioreduction of Cr(VI) by immobilized cells of Halomonas sp was reported. Ca alginate, acryl amide and agar were tested as the matrices for immobilization. Ca alginate was found to be the suitable matrix among the different matrices studied. Of the various dosages of inoculum studied 2 g/L was found to be the optimum. Glucose at 1 g L-1 was completely utilized by the immobilized Halomonas sp even in the presence of Cr(VI) at 40 mg L-1. The optimum pH for the bioreduction of Cr(VI) by immobilized Halomonas sp was found to be pH 6. The mechanical strength of the beads plays an essential role in the bioreduction process. Halomonas sp entrapped in a alginate matrix reported a maximum of 98.9 % of reduction for an initial Cr(VI) concentration of 10 mg L-1. The alginate beads can be reused for 3 times with slight drop in the percentage reduction. The presence of other metals decreased the bioreduction percentage.

  18. Overexpression of transcription factor Sp1 leads to gene expression perturbations and cell cycle inhibition.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Deniaud

    Full Text Available BACKGROUND: The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. METHODOLOGY AND PRINCIPAL FINDINGS: We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. CONCLUSION: This study shows that the binding to DNA

  19. Genetic diversity in Fusarium oxysporum f.sp. dianthi and F. redolens f.sp. dianthi

    NARCIS (Netherlands)

    Baayen, R.P.; Dreven, van F.; Krijger, M.C.; Waalwijk, C.


    Pathogenic isolates were selected representing all known vegetative compatibility groups (VCGs) and races of Fusarium oxysporum sensu lato from Dianthus spp. On basis of differences in the internal transcribed spacer region of the ribosomal DNA, six VCGs were classified as F. oxysporum f.sp. dianthi

  20. SP mountain data analysis (United States)

    Rawson, R. F.; Hamilton, R. E.; Liskow, C. L.; Dias, A. R.; Jackson, P. L.


    An analysis of synthetic aperture radar data of SP Mountain was undertaken to demonstrate the use of digital image processing techniques to aid in geologic interpretation of SAR data. These data were collected with the ERIM X- and L-band airborne SAR using like- and cross-polarizations. The resulting signal films were used to produce computer compatible tapes, from which four-channel imagery was generated. Slant range-to-ground range and range-azimuth-scale corrections were made in order to facilitate image registration; intensity corrections were also made. Manual interpretation of the imagery showed that L-band represented the geology of the area better than X-band. Several differences between the various images were also noted. Further digital analysis of the corrected data was done for enhancement purposes. This analysis included application of an MSS differencing routine and development of a routine for removal of relief displacement. It was found that accurate registration of the SAR channels is critical to the effectiveness of the differencing routine. Use of the relief displacement algorithm on the SP Mountain data demonstrated the feasibility of the technique.

  1. Radioiodine labelled SP-4 as an imaging agent for atherosclerotic plaques

    International Nuclear Information System (INIS)

    Zhang Yongxue; Wu Zhijian; Cao Wei


    The clinical prospect of radioiodinated SP-4 as an atherosclerotic plaque imaging agent was studied. The SP-4 was synthesized by a solid phase method and identified by an amino acid analysis after purification with HPLC. SP-4 was labelled with 131 I and 125 I by the Chloramine-T method and purified through Sephadex G-25 column. Twelve New Zealand rabbits were divided into an atherosclerotic group (n = 7, AR) and a control group (n = 5, NR). All of the atherosclerotic rabbits were intravenous administrated with bovine serum albumin, then feb with high cholesterol and fat diet. 125 I-SP-4 was intravenous administrated to the rabbits of both groups. The biodistribution of 125 I-SP-4 in rabbits was investigated. The uptakes (% ID/g) in blood and thoracic aorta and abdominal aorta were calculated 4 hours postinjection. Macro-autoradiography and micro-autoradiography were performed in 2 AR atherosclerotic abdominal aortas. The clearance of radioactivity from plasma was very rapid. 125 I-SP-4 was mainly excreted through kidneys. The radioactive uptakes of abdominal aorta and thoracic aorta of AR at 4 hours postinjection were significantly higher than that of NR. The films of macro-autoradiography showed focal accumulation of the radioactivity in the areas of a newly formed edges of atherosclerotic plaques. On the slices of micro-autoradiography, the obvious radioactive accumulation could be found in the atherosclerotic plaques. Thus it was seen that the SP-4 remained its biological activity after radioiodination and was located at atherosclerotic lesions, it is potentially useful as an atherosclerotic plaque imaging agent


    Directory of Open Access Journals (Sweden)



    Full Text Available The Use of Aglaophenia sp. Marine Biota Extract to Control Fusarium oxysporum f. sp. vanillae, a Pathogen of Vanilla Stem Rot The use of marine biota for organic fungicide material has enormous potential to be developed. The organic fungicide was directed to substitute synthetic fungicide for vanilla cultivation. Application of synthetic fungicide degraded environmental quality, therefore its applications does not support sustainable agriculture. The objective of this research was to know the potence of Aglaopheniain suppressing the growth of F. oxysporum f. sp.vanillae, the pathogen of vanilla stem rot. The research was done in green house in order to find the best substance for formulation of the extract. The substances screened were water, tween-80, and detergents with two different concentrations. Subsequently, two best formulas were chosen to apply in endemic area in Tabanan. The green house and field trial research used Randomized Completely Design with three and five replications respectively. Results showed that tween was the best substance used for formulation and concentration of 0.2% was better than other concentrations. The extract diluted in tween-80 on the concentration of 0.2% showed the lowest rot on stem, longest shoot, and the most leaves on vanilla shoot. Because of its significant performance, the 0.1% extract ofAglaopheniain 0.1% tween-80 was proposed to be the best formula to suppress the vanilla stem rot disease.

  3. Production of diketopiperazine derivative cyclo (l-leu-l-arg) by streptomyces sp. tn262 after exposure to heat-killed fungus fusarium sp

    International Nuclear Information System (INIS)

    Elleuch, L.; Smaoui, S.; Najah, S.; Sellem, I


    In a screening program for new active secondary metabolites producers, a strain of Streptomyces called TN262 was isolated from Tunisian soil and selected for its ability to produce eleven active compounds in pure culture conditions. In this work, the effect of different concentrations of heat-killed fungus Fusarium sp. on the production of active compounds by TN262 strain was studied. The ethyl acetate extract from the culture of Streptomyces sp. TN262 combined with heat-killed Fusarium sp. at 50 micro g/ml inhibited the growth of the three used indicator microorganisms. In fact, an increase of 36%, 21% and 20% in inhibitory activity was obtained against Micrococcus luteus LB 14110, Escherichia coli ATCC 8739 and Fusarium sp. respectively. The HPLC chromatographic profiles of the ethyl acetate extracts from both culture conditions were different and an additional active compound was produced only under induced conditions. This active component was isolated and identified as Cyclo (L-Leu-L-Arg) (1), a diketopiperazine derivative, possessing antibacterial and antifungal activity. Consequently, this study showed that the addition of heat-killed fungus is a useful method for inducing the production of bioactive compounds. (author)

  4. Optimization of cellulase production by Penicillium sp. (United States)

    Prasanna, H N; Ramanjaneyulu, G; Rajasekhar Reddy, B


    The production of cellulolytic enzymes (β-exoglucanase, β-endoglucanase and β-glucosidase) by Penicillium sp. on three different media in liquid shake culture conditions was compared. The organism exhibited relatively highest activity of endoglucanase among three enzymes measured at 7-day interval during the course of its growth on Czapek-Dox medium supplemented with 0.5 % (w/v) cellulose. Cellulose at 0.5 %, lactose at 0.5 %, sawdust at 0.5 %, yeast extract at 0.2 % as a nitrogen source, pH 5.0 and 30 °C temperature were found to be optimal for growth and cellulase production by Penicillium sp. Yields of Fpase, CMCase and β-glucosidase, attained on optimized medium with Penicillium sp. were 8.7, 25 and 9.52 U/ml, respectively with increment of 9.2, 5.9 and 43.8-folds over titers of the respective enzyme on unoptimised medium. Cellulase of the fungal culture with the ratio of β-glucosidase to Fpase greater than one will hold potential for biotechnological applications.

  5. Efektivitas Bacillus thuringiensis dalam Pengendalian Larva Nyamuk Anopheles sp.

    Directory of Open Access Journals (Sweden)

    Citra Inneke Wibowo


    Full Text Available Nyamuk Anopheles sp adalah vektor penyakit malaria. Pengendalian vektor penyakit malaria dapat dilakukan secara biologis yaitu dengan menggunakan Bacillus thuringiensis. Tujuan penelitian adalah untuk mengetahui efektivitas konsentrasi Bacillus thuringiensis dalam pengendalian larva nyamuk Anopheles sp.Penelitian ini dilakukan secara eksperimental menggunakan Rancangan Acak Lengkap Faktorial (RAL Faktorial yang terdiri atas dua faktor yaitu konsentrasi Bacillus thuringiensis dan stadia larva Anopheles dengan pengulangan tiga kali.Perlakuan yang dicobakan adalahkonsentrasi Bacillus thuringiensis (A yang terdiri atas 5 taraf:A0: konsentrasi B.thuringiensis 0 CFU.mL-1, A1: konsentrasi B.thuringiensis 102 CFU.mL-1, A2: konsentrasi B.thuringiensis 104 CFU.mL-1, A3: konsentrasi B.thuringiensis 106CFU.mL-1, A4: konsentrasi B.thuringiensis 108CFU.mL-1. Perlakuan tahapan instar larva Anopheles sp. (B adalah sebagai berikut:B1: stadia larva instar I, B2: stadia larva instar II, B3: stadia larva instar III, B4: stadia larva instar IVsehingga terdapat 60 satuan percobaan. Hasil penelitian  menunjukkan konsentrasi B. thuringiensis isolat CK dan IPB CC yang paling berpengaruh dalam pengendalian larva Anopheles sp adalah 108 CFU.mL-1 . Instar larva yang paling peka terhadap B. thuringiensis isolat IPB CC adalah instar I dan II sedangkan instar yang peka terhadap isolat CK adalah instar II, Perlakuan konsentrasi isolat B. thuringiensis dan tingkat instar larva yang paling baik dalam pengendalian larva Anopheles sp. adalah 108 CFU.mL-1, dan instar I dan II.

  6. Molecular evidence of a new Babesia sp. in goats. (United States)

    Ozubek, Sezayi; Aktas, Munir


    In this study, a novel Babesia sp. infecting goats was detected and its phylogenetic relationship to related species was determined. A total of 200 blood samples collected from sheep (n=78) and goats (n=122) were examined in the study. The V4 hypervariable region of the 18S rRNA gene of the novel Babesia sp. was amplified by PCR and analysed using a reverse line blot hybridization assay adapted for small ruminants. Samples from seven goats hybridized to Theileria/Babesia catch-all and Babesia catch-all probes and did not hybridize to any species-specific probe tested, suggesting the presence of an unrecognized Babesia species or genotype. Sequencing results showed the isolate to clearly differ from ovine Babesia species and genotypes currently available in the GenBank database. The isolate showed 90.9%, 93.5%, and 93.4% identity to B. ovis, B. motasi, and B. crassa, respectively and 91-93% similarity to Babesia genotypes recently described in small ruminants. The highest homology (∼96-97%) observed was with Babesia odocoilei, Babesia sp. EU1, and Babesia divergens. The new isolate was provisionally designated Babesia sp. The study contributes to better insight into the distribution and phylogenetic diversity of piroplasms in small ruminants. The survey indicated a high prevalence of piroplasms in small ruminants (21.5%). Of those detected, T. ovis was the most prevalent (17%), followed by Babesia sp. (3.5%), and B. ovis (2%). Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Microbiological Quality of Panicum maximum Grass Silage with Addition of Lactobacillus sp. as Starter (United States)

    Sumarsih, S.; Sulistiyanto, B.; Utama, C. S.


    The aim of the research was to evaluate microbiological quality of Panicum maximum grass silage with addition Lactobacillus sp as starter. The completely randomized design was been used on this research with 4 treaments and 3 replications. The treatments were P0 ( Panicum maximum grass silage without addition Lactobacillus sp ), P1 ( Panicum maximum grass silage with 2% addition Lactobacillus sp), P2 (Panicum maximum grass silage with 4% addition Lactobacillus sp) and P3 (Panicum maximum grass silage with 6% addition Lactobacillus sp).The parameters were microbial populations of Panicum maximum grass silage (total lactic acid bacteria, total bacteria, total fungi, and Coliform bacteria. The data obtained were analyzed variance (ANOVA) and further tests performed Duncan’s Multiple Areas. The population of lactic acid bacteria was higher (PMicrobiological quality of Panicum maximum grass silage with addition Lactobacillus sp was better than no addition Lactobacillus sp.

  8. Structural studies of the polysaccharides from the lipopolysaccharides of Azospirillum brasilense Sp246 and SpBr14. (United States)

    Sigida, Elena N; Fedonenko, Yuliya P; Shashkov, Alexander S; Grinev, Vyacheslav S; Zdorovenko, Evelina L; Konnova, Svetlana A; Ignatov, Vladimir V; Knirel, Yuriy A


    Lipopolysaccharides from closely related Azospirillum brasilense strains, Sp246 and SpBr14, were obtained by phenol-water extraction. Mild acid hydrolysis of the lipopolysaccharides followed by GPC on Sephadex G-50 resulted in polysaccharide mixtures. On the basis of sugar and methylation analyses, Smith degradation and (1)H and (13)C NMR spectroscopy data, it was concluded that both bacteria possess the same two distinct polysaccharides having structures 1 and 2: [structure: see text]. Structure 1 has been reported earlier for a polysaccharide of A. brasilense 54 [Fedonenko et al., 2011] whereas to our knowledge structure 2 has not been hitherto found in bacterial polysaccharides. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Analysis of Salmonella sp bacterial contamination on Vannamei Shrimp using binary logit model approach (United States)

    Oktaviana, P. P.; Fithriasari, K.


    Mostly Indonesian citizen consume vannamei shrimp as their food. Vannamei shrimp also is one of Indonesian exports comodities mainstay. Vannamei shrimp in the ponds and markets could be contaminated by Salmonella sp bacteria. This bacteria will endanger human health. Salmonella sp bacterial contamination on vannamei shrimp could be affected by many factors. This study is intended to identify what factors that supposedly influence the Salmonella sp bacterial contamination on vannamei shrimp. The researchers used the testing result of Salmonella sp bacterial contamination on vannamei shrimp as response variable. This response variable has two categories: 0 = if testing result indicate that there is no Salmonella sp on vannamei shrimp; 1 = if testing result indicate that there is Salmonella sp on vannamei shrimp. There are four factors that supposedly influence the Salmonella sp bacterial contamination on vannamei shrimp, which are the testing result of Salmonella sp bacterial contamination on farmer hand swab; the subdistrict of vannamei shrimp ponds; the fish processing unit supplied by; and the pond are in hectare. This four factors used as predictor variables. The analysis used is Binary Logit Model Approach according to the response variable that has two categories. The analysis result indicates that the factors or predictor variables which is significantly affect the Salmonella sp bacterial contamination on vannamei shrimp are the testing result of Salmonella sp bacterial contamination on farmer hand swab and the subdistrict of vannamei shrimp ponds.

  10. Serine proteases SP1 and SP13 mediate the melanization response of Asian corn borer, Ostrinia furnacalis, against entomopathogenic fungus Beauveria bassiana. (United States)

    Chu, Yuan; Liu, Yang; Shen, Dongxu; Hong, Fang; Wang, Guirong; An, Chunju


    Exposure to entomopathogenic fungi is one approach for insect pest control. Little is known about the immune interactions between fungus and its insect host. Melanization is a prominent immune response in insects in defending against pathogens such as bacteria and fungi. Clip domain serine proteases in insect plasma have been implicated in the activation of prophenoloxidase, a key enzyme in the melanization. The relationship between host melanization and the infection by a fungus needs to be established. We report here that the injection of entomopathogenic fungus Beauveria bassiana induced both melanin synthesis and phenoloxidase activity in its host insect, the Asian corn borer, Ostrinia furnacalis (Guenée). qRT-PCR analysis showed several distinct patterns of expression of 13 clip-domain serine proteases in response to the challenge of fungi, with seven increased, two decreased, and four unchanged. Of special interest among these clip-domain serine protease genes are SP1 and SP13, the orthologs of Manduca sexta HP6 and PAP1 which are involved in the prophenoloxidase activation pathway. Recombinant O. furnacalis SP1 was found to activate proSP13 and induce the phenoloxidase activity in corn borer plasma. Additionally, SP13 was determined to directly cleave prophenoloxidase and therefore act as the prophenoloxidase activating protease. Our work thus reveals a biochemical mechanism in the melanization in corn borer associated with the challenge by B. bassiana injection. These insights could provide valuable information for better understanding the immune responses of Asian corn borer against B. bassiana. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. The production of *sp81m*Kr generators at the Oslo cyclotron

    International Nuclear Information System (INIS)

    Bjroenstad, T.; Holtebekk, T.; Ruud, A.


    The techniques developed for the production of *sp81m*Kr(13s) ventilation generators at the Oslo cyclotron are described. The procedure is based on the reaction *sp82*Kr(p,2n)*sp81*Rb using krypton gas of natural composition as target. The target chamber is designed for a gas pressure of 10 bar. The production unit is dimensioned for a parallel production of five generators, but this number may easily be increased. Attention is drawn to the fact that *sp81m*Rb(31 min) is produced in about the same amount as the *sp81*Rb (4.57 h) ground state. The consequences for the calibration procedure is discussed. Routine production has been exerted without major difficulties for nearly 1.5 years. The procedure has proven to be inexpensive and reliable. (Auth.)

  12. Sp1 transcriptional activity is up-regulated by phosphatase 2A in dividing T lymphocytes. (United States)

    Lacroix, Isabelle; Lipcey, Carol; Imbert, Jean; Kahn-Perlès, Brigitte


    We have followed Sp1 expression in primary human T lymphocytes induced, via CD2 plus CD28 costimulation, to sustained proliferation and subsequent return to quiescence. Binding of Sp1 to wheat germ agglutinin lectin was not modified following activation, indicating that the overall glycosylation of the protein was unchanged. Sp1 underwent, instead, a major dephosphorylation that correlated with cyclin A expression and, thus, with cell cycle progression. A similar change was observed in T cells that re-entered cell cycle following secondary interleukin-2 stimulation, as well as in serum-induced proliferating NIH/3T3 fibroblasts. Phosphatase 2A (PP2A) appears involved because 1) treatment of dividing cells with okadaic acid or cantharidin inhibited Sp1 dephosphorylation and 2) PP2A dephosphorylated Sp1 in vitro and strongly interacted with Sp1 in vivo. Sp1 dephosphorylation is likely to increase its transcriptional activity because PP2A overexpression potentiated Sp1 site-driven chloramphenicol acetyltransferase expression in dividing Kit225 T cells and okadaic acid reversed this effect. This increase might be mediated by a stronger affinity of dephosphorylated Sp1 for DNA, as illustrated by the reduced DNA occupancy by hyperphosphorylated Sp factors from cantharidin- or nocodazole-treated cells. Finally, Sp1 dephosphorylation appears to occur throughout cell cycle except for mitosis, a likely common feature to all cycling cells.

  13. Mesorhizobium shonense sp. nov., Mesorhizobium hawassense sp. nov. and Mesorhizobium abyssinicae sp. nov., isolated from root nodules of different agroforestry legume trees. (United States)

    Degefu, Tulu; Wolde-Meskel, Endalkachew; Liu, Binbin; Cleenwerck, Ilse; Willems, Anne; Frostegård, Åsa


    A total of 18 strains, representing members of the genus Mesorhizobium, obtained from root nodules of woody legumes growing in Ethiopia, have been previously shown, by multilocus sequence analysis (MLSA) of five housekeeping genes, to form three novel genospecies. In the present study, the phylogenetic relationship between representative strains of these three genospecies and the type strains of their closest phylogenetic neighbours Mesorhizobium plurifarium, Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium huakuii was further evaluated using a polyphasic taxonomic approach. In line with our earlier MLSA of other housekeeping genes, the phylogenetic trees derived from the atpD and glnII genes grouped the test strains into three well-supported, distinct lineages that exclude all defined species of the genus Mesorhizobium. The DNA-DNA relatedness between the representative strains of genospecies I-III and the type strains of their closest phylogenetic neighbours was low (≤59 %). They differed from each other and from their closest phylogenetic neighbours by the presence/absence of several fatty acids, or by large differences in the relative amounts of particular fatty acids. While showing distinctive features, they were generally able to utilize a wide range of substrates as sole carbon and nitrogen sources. The strains belonging to genospecies I, II and III therefore represent novel species for which we propose the names Mesorhizobium shonense sp. nov., Mesorhizobium hawassense sp. nov. and Mesorhizobium abyssinicae sp. nov. The isolates AC39a(T) ( = LMG 26966(T) = HAMBI 3295(T)), AC99b(T) ( = LMG 26968(T) = HAMBI 3301(T)) and AC98c(T) ( = LMG 26967(T) = HAMBI 3306(T)) are proposed as type strains for the respective novel species.

  14. Evolution of sp2 networks with substrate temperature in amorphous carbon films: Experiment and theory

    International Nuclear Information System (INIS)

    Gago, R.; Vinnichenko, M.; Jaeger, H.U.; Maitz, M.F.; Belov, A.Yu.; Jimenez, I.; Huang, N.; Sun, H.


    The evolution of sp 2 hybrids in amorphous carbon (a-C) films deposited at different substrate temperatures was studied experimentally and theoretically. The bonding structure of a-C films prepared by filtered cathodic vacuum arc was assessed by the combination of visible Raman spectroscopy, x-ray absorption, and spectroscopic ellipsometry, while a-C structures were generated by molecular-dynamics deposition simulations with the Brenner interatomic potential to determine theoretical sp 2 site distributions. The experimental results show a transition from tetrahedral a-C (ta-C) to sp 2 -rich structures at ∼500 K. The sp 2 hybrids are mainly arranged in chains or pairs whereas graphitic structures are only promoted for sp 2 fractions above 80%. The theoretical analysis confirms the preferred pairing of isolated sp 2 sites in ta-C, the coalescence of sp 2 clusters for medium sp 2 fractions, and the pronounced formation of rings for sp 2 fractions >80%. However, the dominance of sixfold rings is not reproduced theoretically, probably related to the functional form of the interatomic potential used

  15. A 3-factor model for the FACIT-Sp. (United States)

    Canada, Andrea L; Murphy, Patricia E; Fitchett, George; Peterman, Amy H; Schover, Leslie R


    The 12-item Functional Assessment of Chronic Illness Therapy-Spiritual Well-being Scale (FACIT-Sp) is a popular measure of the religious/spiritual (R/S) components of quality of life (QoL) in patients with cancer. The original factor analyses of the FACIT-Sp supported two factors: Meaning/Peace and Faith. Because Meaning suggests a cognitive aspect of R/S and Peace an affective component, we hypothesized a 3-factor solution: Meaning, Peace, and Faith. Participants were 240 long-term female survivors of cancer who completed the FACIT-Sp, the SF-12, and the BSI 18. We used confirmatory factor analysis to compare the 2- and 3-factor models of the FACIT-Sp and subsequently assessed associations between the resulting solutions and QoL domains. Survivors averaged 44 years of age and 10 years post-diagnosis. A 3-factor solution of the FACIT-Sp significantly improved the fit of the model to the data over the original 2-factor structure (Delta chi(2)=72.36, df=2, p<0.001). Further adjustments to the 3-factor model resulted in a final solution with even better goodness-of-fit indices (chi(2)=59.11, df=1, p=0.13, CFI=1.00, SMRM=0.05).The original Meaning/Peace factor controlling for Faith was associated with mental (r=0.63, p<0.000) and physical (r=0.22, p<0.01) health on the SF-12, and the original Faith factor controlling for Meaning/Peace was negatively associated with mental health (r=-0.15, p<0.05). The 3-factor model was more informative. Specifically, using partial correlations, the Peace factor was only related to mental health (r=0.53, p<0.001); Meaning was related to both physical (r=0.18, p<0.01) and mental (r=0.17, p<0.01) health; and Faith was negatively associated with mental health (r=-0.17, p<0.05). The results of this study support a 3-factor solution of the FACIT-Sp. The new solution not only represents a psychometric improvement over the original, but also enables a more detailed examination of the contribution of different dimensions of R/S to QoL. (c

  16. Efektivitas Ovitrap Bambu terhadap Jumlah Jentik Aedes sp yang Terperangkap

    Directory of Open Access Journals (Sweden)

    Wiwit Aditama


    places of 10 subdistricts. Data of trapped Aedes sp larvae numbers was collected four times repeatedly within one week time-lapse. Analysis was conducted using the mean number of larvae in ovitraps and ovitrap index. The number of Aedes sp larvae trapped was 1,265. The most effective ovitrap is piece of bamboo, mean = 123, p value = 0.006, HI = 10.01% (16.66 26.67%, CI = 36.8% (336.06 - 39.74%, BI = 29.97% (73.33 - 103.3%. Health authorities should promote bamboo ovitrap, especially to public as an effort to control Aedes sp.

  17. Reparation and Immunomodulating Properties of Bacillus sp. Metabolites from Permafrost. (United States)

    Kalenova, L F; Melnikov, V P; Besedin, I M; Bazhin, A S; Gabdulin, M A; Kolyvanova, S S


    An ointment containing metabolites of Bacillus sp. microorganisms isolated from permafrost samples was applied onto the skin wound of BALB/c mice. Metabolites isolated during culturing of Bacillus sp. at 37°C produced a potent therapeutic effect and promoted wound epithelialization by 30% in comparison with the control (ointment base) and by 20% in comparison with Solcoseryl. Treatment with Bacillus sp. metabolites stimulated predominantly humoral immunity, reduced the time of wound contraction and the volume of scar tissue, and promoted complete hair recovery. These metabolites can be considered as modulators of the wound process with predominance of regeneration mechanisms.

  18. Lipid profile remodeling in response to nitrogen deprivation in the microalgae Chlorella sp. (Trebouxiophyceae and Nannochloropsis sp. (Eustigmatophyceae.

    Directory of Open Access Journals (Sweden)

    Gregory J O Martin

    Full Text Available Many species of microalgae produce greatly enhanced amounts of triacylglycerides (TAGs, the key product for biodiesel production, in response to specific environmental stresses. Improvement of TAG production by microalgae through optimization of growth regimes is of great interest. This relies on understanding microalgal lipid metabolism in relation to stress response in particular the deprivation of nutrients that can induce enhanced TAG synthesis. In this study, a detailed investigation of changes in lipid composition in Chlorella sp. and Nannochloropsis sp. in response to nitrogen deprivation (N-deprivation was performed to provide novel mechanistic insights into the lipidome during stress. As expected, an increase in TAGs and an overall decrease in polar lipids were observed. However, while most membrane lipid classes (phosphoglycerolipids and glycolipids were found to decrease, the non-nitrogen containing phosphatidylglycerol levels increased considerably in both algae from initially low levels. Of particular significance, it was observed that the acyl composition of TAGs in Nannochloropsis sp. remain relatively constant, whereas Chlorella sp. showed greater variability following N-deprivation. In both algae the overall fatty acid profiles of the polar lipid classes were largely unaffected by N-deprivation, suggesting a specific FA profile for each compartment is maintained to enable continued function despite considerable reductions in the amount of these lipids. The changes observed in the overall fatty acid profile were due primarily to the decrease in proportion of polar lipids to TAGs. This study provides the most detailed lipidomic information on two different microalgae with utility in biodiesel production and nutraceutical industries and proposes the mechanisms for this rearrangement. This research also highlights the usefulness of the latest MS-based approaches for microalgae lipid research.

  19. The effectiveness of Penicillium sp. mixed with silica nanoparticles in controlling Myzus persicae (United States)

    Hersanti, Hidayat, Syarif; Susanto, Agus; Virgiawan, Regi; Joni, I. Made


    Myzus persicae is one of the major potato plant pests, and also a vector of potato viruses. This pest may cause low quality as well as quantity of potato production. Entomopathogenic fungi can be used to control M. persicae. Penicillium sp. and has been reported as pathogenic to many insect pests. However, it was not that effective in controlling M. persicae. To increase its effectiveness, it can be mixed with plant micro nutrients such as silica, which also protects plants from biotic stress. This experiment was aimed to study the effect of applications of the mixture of Penicillium sp.+ nanosilica in various concentrations on the mortality of M. persicae. There were 8 treatments i.e., applications of single Penicillium sp, single nanosilica 1, 3, and 5 %, and the mixture of Penicillium sp.+ nanosilica 1, 3, and 5 %, and a control (without Penicillium sp.and nanosilica). Each cabbage plant grown in the greenhouse was infested with 20 Penicillium sp. instar II-III, and sprayed according to the treatments. Mortality of M. persicae was assessed after five days of application. The results showed that application of the mixture of Penicillium sp.106spora/ml+nanosilica 5%, and single nanosilica 5% increased the mortality of M. persicae. The mortalities were 37.5%, and 32.5% respectively, compared with 12.5% mortality on the treatment of single Penicillium sp.

  20. FEM-analyse af termiske Spændinger i Svejsning

    DEFF Research Database (Denmark)

    Hansen, Jan Langkjær


    Undersøgelser af de transiente temperaturfelter og de heraf inducerede spændinger og deformationer som følge af en stumpsøm-svejsning i plader af konstruktionsstål modelleret i henholdsvis 2D plan spændings-/tøjningstilstand og 3D er foretaget ved brug af det generelt anvendelige finite-element p......-element program ABAQUS....

  1. SP600125 Induces Src and Type I IGF Receptor Phosphorylation Independent of JNK

    Directory of Open Access Journals (Sweden)

    Qingbin Kong


    Full Text Available c-Jun N-terminal kinases (JNK are members of the mitogen-activated protein kinase (MAPK family that have important roles in signal transduction. The small molecule SP600125 is widely used in biochemical studies as a JNK inhibitor. However, recent studies indicate that SP600125 may also act independent of JNK. Here, we report that SP600125 can induce Src, type I insulin-like growth factor receptor (IGF-IR, Akt and Erk1/2 phosphorylation. Notably, these effects are independent of its inhibition of JNK. Inhibition of Src abrogates the stimulation of IGF-IR, Akt and Erk1/2 phosphorylation. IGF-IR knockdown blunts the induction of both Akt and Erk1/2 phosphorylation by SP600125. Moreover, combination of SP600125 and the Src inhibitor saracatinib synergistically inhibits cell proliferation. We conclude that SP600125 can activate Src-IGF-IR-Akt/Erk1/2 signaling pathways independent of JNK.

  2. Biosynthesis of size-controlled gold nanoparticles using fungus, Penicillium sp. (United States)

    Zhang, Xiaorong; He, Xiaoxiao; Wang, Kemin; Wang, Yonghong; Li, Huimin; Tan, Weihong


    The unique optoelectronic and physicochemical properties of gold nanoparticles are significantly dependent on the particle size, shape and structure. In this paper, biosynthesis of size-controlled gold nanoparticles using fungus Penicillium sp. is reported. Fungus Penicillium sp. could successfully bioreduce and nucleate AuCl4(-) ions, and lead to the assembly and formation of intracellular Au nanoparticles with spherical morphology and good monodispersity after exposure to HAuCl4 solution. Reaction temperature, as an important physiological parameter for fungus Penicillium sp. growth, could significantly control the size of the biosynthesized Au nanoparticles. The biological compositions and FTIR spectra analysis of fungus Penicillium sp. exposed to HAuCl4 solution indicated the intracellular reducing sugar played an important role in the occurrence of intracellular reduction of AuCl4(-) ions and the growth of gold nanoparticles. Furthermore, the intracellular gold nanoparticles could be easily separated from the fungal cell lysate by ultrasonication and centrifugation.

  3. Selective sp3 C–H alkylation via polarity-match-based cross-coupling (United States)

    Le, Chip; Liang, Yufan; Evans, Ryan W.; Li, Ximing; MacMillan, David W. C.


    The functionalization of carbon–hydrogen (C–H) bonds is one of the most attractive strategies for molecular construction in organic chemistry. The hydrogen atom is considered to be an ideal coupling handle, owing to its relative abundance in organic molecules and its availability for functionalization at almost any stage in a synthetic sequence1. Although many C–H functionalization reactions involve C(sp3)–C(sp2) coupling, there is a growing demand for C–H alkylation reactions, wherein sp3 C–H bonds are replaced with sp3 C–alkyl groups. Here we describe a polarity-match-based selective sp3 C–H alkylation via the combination of photoredox, nickel and hydrogen-atom transfer catalysis. This methodology simultaneously uses three catalytic cycles to achieve hydridic C–H bond abstraction (enabled by polarity matching), alkyl halide oxidative addition, and reductive elimination to enable alkyl–alkyl fragment coupling. The sp3 C–H alkylation is highly selective for the α-C–H of amines, ethers and sulphides, which are commonly found in pharmaceutically relevant architectures. This cross-coupling protocol should enable broad synthetic applications in de novo synthesis and late-stage functionalization chemistry. PMID:28636596

  4. Selective sp3 C-H alkylation via polarity-match-based cross-coupling. (United States)

    Le, Chip; Liang, Yufan; Evans, Ryan W; Li, Ximing; MacMillan, David W C


    The functionalization of carbon-hydrogen (C-H) bonds is one of the most attractive strategies for molecular construction in organic chemistry. The hydrogen atom is considered to be an ideal coupling handle, owing to its relative abundance in organic molecules and its availability for functionalization at almost any stage in a synthetic sequence. Although many C-H functionalization reactions involve C(sp 3 )-C(sp 2 ) coupling, there is a growing demand for C-H alkylation reactions, wherein sp 3 C-H bonds are replaced with sp 3 C-alkyl groups. Here we describe a polarity-match-based selective sp 3 C-H alkylation via the combination of photoredox, nickel and hydrogen-atom transfer catalysis. This methodology simultaneously uses three catalytic cycles to achieve hydridic C-H bond abstraction (enabled by polarity matching), alkyl halide oxidative addition, and reductive elimination to enable alkyl-alkyl fragment coupling. The sp 3 C-H alkylation is highly selective for the α-C-H of amines, ethers and sulphides, which are commonly found in pharmaceutically relevant architectures. This cross-coupling protocol should enable broad synthetic applications in de novo synthesis and late-stage functionalization chemistry.

  5. Selective sp3 C-H alkylation via polarity-match-based cross-coupling (United States)

    Le, Chip; Liang, Yufan; Evans, Ryan W.; Li, Ximing; MacMillan, David W. C.


    The functionalization of carbon-hydrogen (C-H) bonds is one of the most attractive strategies for molecular construction in organic chemistry. The hydrogen atom is considered to be an ideal coupling handle, owing to its relative abundance in organic molecules and its availability for functionalization at almost any stage in a synthetic sequence. Although many C-H functionalization reactions involve C(sp3)-C(sp2) coupling, there is a growing demand for C-H alkylation reactions, wherein sp3 C-H bonds are replaced with sp3 C-alkyl groups. Here we describe a polarity-match-based selective sp3 C-H alkylation via the combination of photoredox, nickel and hydrogen-atom transfer catalysis. This methodology simultaneously uses three catalytic cycles to achieve hydridic C-H bond abstraction (enabled by polarity matching), alkyl halide oxidative addition, and reductive elimination to enable alkyl-alkyl fragment coupling. The sp3 C-H alkylation is highly selective for the α-C-H of amines, ethers and sulphides, which are commonly found in pharmaceutically relevant architectures. This cross-coupling protocol should enable broad synthetic applications in de novo synthesis and late-stage functionalization chemistry.

  6. Transcription factor SP4 is a susceptibility gene for bipolar disorder.

    Directory of Open Access Journals (Sweden)

    Xianjin Zhou

    Full Text Available The Sp4 transcription factor plays a critical role for both development and function of mouse hippocampus. Reduced expression of the mouse Sp4 gene results in a variety of behavioral abnormalities relevant to human psychiatric disorders. The human SP4 gene is therefore examined for its association with both bipolar disorder and schizophrenia in European Caucasian and Chinese populations respectively. Out of ten SNPs selected from human SP4 genomic locus, four displayed significant association with bipolar disorder in European Caucasian families (rs12668354, p = 0.022; rs12673091, p = 0.0005; rs3735440, p = 0.019; rs11974306, p = 0.018. To replicate the genetic association, the same set of SNPs was examined in a Chinese bipolar case control sample. Four SNPs displayed significant association (rs40245, p = 0.009; rs12673091, p = 0.002; rs1018954, p = 0.001; rs3735440, p = 0.029, and two of them (rs12673091, rs3735440 were shared with positive SNPs from European Caucasian families. Considering the genetic overlap between bipolar disorder and schizophrenia, we extended our studies in Chinese trios families for schizophrenia. The SNP7 (rs12673091, p = 0.012 also displayed a significant association. The SNP7 (rs12673091 was therefore significantly associated in all three samples, and shared the same susceptibility allele (A across all three samples. On the other hand, we found a gene dosage effect for mouse Sp4 gene in the modulation of sensorimotor gating, a putative endophenotype for both schizophrenia and bipolar disorder. The deficient sensorimotor gating in Sp4 hypomorphic mice was partially reversed by the administration of dopamine D2 antagonist or mood stabilizers. Both human genetic and mouse pharmacogenetic studies support Sp4 gene as a susceptibility gene for bipolar disorder or schizophrenia. The studies on the role of Sp4 gene in hippocampal development may provide novel insights for the contribution of hippocampal abnormalities in these

  7. Single-Particle Soot Photometer (SP2) Instrument Handbook

    Energy Technology Data Exchange (ETDEWEB)

    Sedlacek, Arthur [Brookhaven National Lab. (BNL), Upton, NY (United States)


    The SP2 is an instrument that measures, in situ, the time-dependent scattering and incandescence signals produced by individual BC-containing particles as they travel through a continuous-wave laser beam. Any particle traversing the laser beam will scatter light, and the BC component of a BC-containing particle will absorb some of the laser energy until its temperature is raised to the point at which it incandesces (hereafter we adopt the standard terminology of the SP2 community and denote any substance determined by the SP2 to be BC as refractory black carbon (rBC)). The amplitude of the rBC incandescence signal is related to the amount of refractory material contained in the illuminated particle. By binning the individual incandescence signals per unit sample volume, the mass concentration [ng/m3] of rBC can be derived. By binning the individual signals by volume equivalent diameter the size distribution (dN/dlogDVED) per unit time can be derived. The rBC mass loading per unit time and the rBC size distribution unit time are the core data products produced by the SP2. Additionally, the scattering channel can be used to provide information on the rBC particle population-based mixing states within ambient aerosols. However, this data product is produced on a requested-basis since additional detailed analysis and QC/QA must be conducted.

  8. Anaerobic Co-Digestion of the Microalgae Scenedesmus Sp.

    Energy Technology Data Exchange (ETDEWEB)

    Ramos-Suarez, J. L.; Carreras, N.


    Microalgae biomass has been widely studied for biogas production over the last years and results show that anaerobic digestion is often limited by the low C/N ratio of this type of biomass. Therefore, codigestion with substrates of high C/N ratio is necessary. The objectives of this study are to set up an experimental method that ease reproducibility and control of anaerobic digestion processes in laboratory conditions and to determine the biodegradability and biogas production potential of the co-digestion process of microalgae Scenedesmus sp. and energy crop Opuntia ficus indica (L.) Miller. Results obtained showed that higher C/N ratios are preferred in order to maximize methane production. Highest methane yield obtained was 0.252m3CH4/Kg VS and degradability expressed as percentage COD reduced is around 30% for the ideal mixture found, made up of 75% O. ficus-indica and 25% Scenedesmus sp. in VS basis. A laboratory setup using MicroOxymax respirometer, after its adaptation to work under anaerobic conditions, can be used for the monitoring of anaerobic digestion processes. Scenedesmus sp. as sole substrate for anaerobic digestion does not give good results due to low C/N ratio. However, when codigesting it with O. ficus-indica methane production is satisfactory. Best mixture was made up of 75% O. ficus-indica and 25% Scenedesmus sp. in VS basis. (Author)

  9. FTIR spectroscopic study of biofilms formed by the rhizobacterium Azospirillum brasilense Sp245 and its mutant Azospirillum brasilense Sp245.1610 (United States)

    Tugarova, Anna V.; Scheludko, Andrei V.; Dyatlova, Yulia A.; Filip'echeva, Yulia A.; Kamnev, Alexander A.


    Biofilms are spatially and metabolically structured communities of microorganisms, representing a mode of their existence which is ubiquitous in nature, with cells localised within an extracellular biopolymeric matrix, attached to each other, at an interface. For plant-growth-promoting rhizobacteria (PGPR), the formation of biofilms is of special importance due to their primary localisation at the surface of plant root systems. In this work, FTIR spectroscopy was used, for the first time for bacteria of the genus Azospirillum, to comparatively study 6-day-mature biofilms formed on the surface of ZnSe discs by the rhizobacterium Azospirillum brasilense Sp245 and its mutant A. brasilense Sp245.1610. The mutant strain, having an Omegon Km insertion in the gene of lipid metabolism fabG1 on the plasmid AZOBR_p1, as compared to the wild-type strain Sp245 (see

  10. Metagenome-Assembled Genome Sequences of Acetobacterium sp. Strain MES1 and Desulfovibrio sp. Strain MES5 from a Cathode-Associated Acetogenic Microbial Community. (United States)

    Ross, Daniel E; Marshall, Christopher W; May, Harold D; Norman, R Sean


    Draft genome sequences of Acetobacterium sp. strain MES1 and Desulfovibrio sp. strain MES5 were obtained from the metagenome of a cathode-associated community enriched within a microbial electrosynthesis system (MES). The draft genome sequences provide insight into the functional potential of these microorganisms within an MES and a foundation for future comparative analyses. Copyright © 2017 Ross et al.

  11. Komunikācija video spēlēs: semiotiskie aspekti


    Kļaviņš, Andrejs


    “Komunikācija video spēlēs: semiotiskie aspekti” ir pētnieciskais darbs, kas ir rakstīts, lai aplūkotu 20. gadsimtā radušos fenomenu – specifisku spēļu tipu – video spēles. Darba mērķis ir izpētīt, vai un kā strukturālistu pieeja var tikt izmantota, lai apskatītu video spēles kā jaunu mediju un komunikācijas formu. Apskates metodes pamatā ir itāļu profesora Umberto Eko izstrādātā semiotisko kodu teorija, kuru viņš apraksta savā grāmatā „A Theory of Semiotics”. Darba teorētiskajā daļā tiek apl...

  12. Ocorrência de Babesia sp em pequenos roedores no Brasil Occurrence of Babesia sp in small rodents in Brazil


    G.S. Gazeta; R.W. Carvalho; R.F. Avelar; M. Amorim; A.E. Aboud-Dutra


    Foi analisada a ocorrência de babesiose em pequenos roedores nos municípios de Silva Jardim e Nova lguaçu, Estado do Rio de Janeiro. Foram capturados 44 roedores de seis espécies diferentes e entre eles a prevalência da infecção foi de 27,3%. Rattus norvegicus foi considerado o principal reservatório (50,0%) e Oligoryzomys nigripes como novo hospedeiro para Babesia sp. Este foi o primeiro relato de Babesia sp. em roedores no Brasil. A freqüência de roedores positivos e o risco de infecção dos...

  13. Babesia peircei sp. nov. from the jackass penguin | Earlé | African ...

    African Journals Online (AJOL)

    An avian piroplasm, Babesia peircei sp. nov. is described from the jackass penguin Spheniscus demersus. Morphological differences between Babesia peircei sp. nov. and the other valid Babesia spp. are discussed together with the possible vectors.

  14. Continuity of care of emergency surgical admissions: impact on SpR training. (United States)

    Ledwidge, S F C; Bryden, E; Halestrap, P; Galland, R B


    Continuity of patient care is an important component of surgical education. This study assesses continuity of care in the current working climate. Data were collected prospectively on consecutive emergency general surgical admissions during one month. Our SpR rota is a partial shift 24 hour on call with the SpR's own consultant. The SpR is free of commitments the next day following post-take work. The on call general surgery SpR was designated the 'assessor'. Data were analysed according to involvement of the 'assessor' at subsequent stages of the admission--consent, operation, review during admission and review on discharge. Data were also collected defining whether the 'assessor' and operator followed-up the patient. There were 200 admissions; 108 female and 92 male. Overall 23% admissions had the same 'assessor' for all stages of patient care. The 'assessor' dealt with an aspect of patient care in 11% of admissions who underwent an operation and 29% of admissions who were conservatively managed. SpR follow-up of admissions on whom they operated was 70% but only 41% of admissions who were conservatively managed were followed-up by the assessing SpR. Complete in-hospital continuity of care was poor, although SpR follow-up of patients on whom they had operated was better. Introduction of shift patterns has reduced continuity of patient care. This will have a negative impact on both surgical training and patient care.

  15. Cryptosporidium homai n. sp. (Apicomplexa: Cryptosporidiiae) from the guinea pig (Cavia porcellus). (United States)

    Zahedi, Alireza; Durmic, Zoey; Gofton, Alexander W; Kueh, Susan; Austen, Jill; Lawson, Malcolm; Callahan, Lauren; Jardine, John; Ryan, Una


    The morphological, biological, and molecular characterisation of a new Cryptosporidium species from the guinea pig (Cavia porcellus) are described, and the species name Cryptosporidium homai n. sp. is proposed. Histological analysis conducted on a post-mortem sample from a guinea pig euthanised due to respiratory distress, identified developmental stages of C. homai n. sp. (trophozoites and meronts) along the intestinal epithelium. Molecular analysis at 18S rRNA (18S), actin and hsp70 loci was then conducted on faeces from an additional 7 guinea pigs positive for C. homai n. sp. At the 18S, actin and hsp70 loci, C. homai n. sp. exhibited genetic distances ranging from 3.1% to 14.3%, 14.4% to 24.5%, and 6.6% to 20.9% from other Cryptosporidium spp., respectively. At the 18S locus, C. homai n. sp. shared 99.1% similarity with a previously described Cryptosporidium genotype in guinea pigs from Brazil and it is likely that they are the same species, however this cannot be confirmed as actin and hsp70 sequences from the Brazilian guinea pig genotype are not available. Phylogenetic analysis of concatenated 18S, actin and hsp70 sequences showed that C. homai n. sp. exhibited 9.1% to 17.3% genetic distance from all other Cryptosporidium spp. This clearly supports the validity of C. homai n. sp. as a separate species. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Måling på ikke sinusformede AC strømme og spændinger

    DEFF Research Database (Denmark)

    Nielsen, Arne Hejde


    Målinger på en- og trefasede spændinger og strømme i elforsyningen. Specielt gennemgås forholdene ved ikke symetriske systemer med overtoner i spændinger og strømme.......Målinger på en- og trefasede spændinger og strømme i elforsyningen. Specielt gennemgås forholdene ved ikke symetriske systemer med overtoner i spændinger og strømme....

  17. Investigation of SP94 Peptide as a Specific Probe for Hepatocellular Carcinoma Imaging and Therapy (United States)

    Li, Yanli; Hu, Yan; Xiao, Jie; Liu, Guobing; Li, Xiao; Zhao, Yanzhao; Tan, Hui; Shi, Hongcheng; Cheng, Dengfeng


    SP94 (SFSIIHTPILPL), a novel peptide, has shown specific binding to hepatocellular carcinoma (HCC) cells. We aimed to investigate the capability of SP94 as a targeting probe for HCC imaging and therapy following labeling with technetium-99m (99mTc) and rhenium-188 (188Re). HYNIC-SP94 was prepared by solid phase synthesis and then labeled with 99mTc. Cell competitive binding, internalization assay, in vitro and in vivo stability, biodistribution and micro-single photon emission computed tomography /computed tomography (SPECT/CT) imaging studies were performed to investigate the capability of 99mTc tricine-EDDA/HYNIC-SP94 as a specific HCC imaging probe. Initial promising targeting results inspired evaluation of its therapeutic effect when labeled by 188Re. HYNIC-SP94 was then labeled again with 188Re to perform cell apoptosis, microSPECT/CT imaging evaluation and immunohistochemistry. Huh-7 cells exhibited typical apoptotic changes after 188Re irradiation. According to 99mTc tricine-EDDA/HYNIC-SP94 microSPECT/CT imaging, tumor uptake was significantly decreased compared with that of pre-treatment with 188Re-HYNIC-SP94. The immunohistochemistry also displayed obvious necrosis and apoptosis as well as inhibition of proliferation in the 188Re-HYNIC-SP94 treatment group. The results supported that 99mTc tricine-EDDA/HYNIC-SP94 is able to target HCC cells and 188Re-HYNIC- SP94 holds potential as a therapeutic agent for HCC, making 99mTc/188Re-HYNIC-SP94 a promising targeting probe for HCC imaging and therapy. PMID:27649935

  18. Commercial technologies from the SP-100 program

    International Nuclear Information System (INIS)

    Truscello, V.C.; Fujita, T.; Mondt, J.F.


    For more than a decade, Jet Propulsion Labortory and Los Alamos have managed a multi-agency funded effort to develop a space reactor power system. This SP-100 Program has developed technologies required for space power systems that can be implemented in the industrial and commercial sectors to improve competitiveness in the global economy. Initial steps taken to transfer this technology from the laboratories to industrial and commercial entities within United States include: (1) identifying specific technologies having commercial potential; (2) distributing information describing the identified technologies and interacting with interested commercial and industrial entities to develop application-specific details and requirements; and (3) providing a technological data base that leads to transfer of technology or the forming of teaming arrangements to accomplish the transfer by tailoring the technology to meet application-specific requirements. SP-100 technologies having commercial potential encompass fabrication processes, devices, and components. Examples: a process for bonding refractory metals to graphite, a device to sense the position of an actuator and a component to enable rotating machines to operate without supplying lubrication (self-lubricating ball bearing). Shortly after the NASA Regional Technology Transfer Centers widely disseminated information covering SP-100 technologies, over one hundred expressions of interest were received, which indicate that there is a large potential benefit in transferring SP-100 technology. Interactions with industrial and commercial entities have identified a substantial need for creating teaming arrangements involving the interested entity and personnel from laboratories and their contractors, who have the knowledge and ability to tailor the technology to meet application-specific requirements. copyright 1995 American Institute of Physics

  19. Sp1-CD147 positive feedback loop promotes the invasion ability of ovarian cancer. (United States)

    Zhao, Jing; Ye, Wei; Wu, Juan; Liu, Lijuan; Yang, Lina; Gao, Lu; Chen, Biliang; Zhang, Fanglin; Yang, Hong; Li, Yu


    CD147 is a novel cancer biomarker that has been confirmed to be overexpressed in ovarian carcinoma, which is significantly associated with poor prognosis. Although the Sp1 protein regulates the expression level of CD147, it remains unclear whether Sp1 phosphorylation plays a role in this regulation. A dual-luciferase assay revealed that T453 and T739 mutations decreased the activity of Sp1 binding to the promoter of CD147, followed by a decrease in CD147 mRNA and protein expression. Western blot analysis showed that CD147 promoted Sp1 phosphorylation at T453 and T739 through the PI3K/AKT and MAPK/ERK pathways. In addition, blocking the Sp1-CD147 positive feedback loop reduced the invasion ability of HO-8910pm cells. Immunohistochemical staining showed that the components of the feedback loop were overexpressed in ovarian cancer tissues. The correlation analysis revealed a significant correlation between phospho-Sp1 (T453), phospho-Sp1 (T739) and CD147 expression levels, with correlation coefficients of r=0.477 and r=0.461, respectively. Collectively, our results suggest that a Sp1-CD147 positive feedback loop plays a critical role in the invasion ability of ovarian cancer cells.

  20. Applications Performance Under MPL and MPI on NAS IBM SP2 (United States)

    Saini, Subhash; Simon, Horst D.; Lasinski, T. A. (Technical Monitor)


    On July 5, 1994, an IBM Scalable POWER parallel System (IBM SP2) with 64 nodes, was installed at the Numerical Aerodynamic Simulation (NAS) Facility Each node of NAS IBM SP2 is a "wide node" consisting of a RISC 6000/590 workstation module with a clock of 66.5 MHz which can perform four floating point operations per clock with a peak performance of 266 Mflop/s. By the end of 1994, 64 nodes of IBM SP2 will be upgraded to 160 nodes with a peak performance of 42.5 Gflop/s. An overview of the IBM SP2 hardware is presented. The basic understanding of architectural details of RS 6000/590 will help application scientists the porting, optimizing, and tuning of codes from other machines such as the CRAY C90 and the Paragon to the NAS SP2. Optimization techniques such as quad-word loading, effective utilization of two floating point units, and data cache optimization of RS 6000/590 is illustrated, with examples giving performance gains at each optimization step. The conversion of codes using Intel's message passing library NX to codes using native Message Passing Library (MPL) and the Message Passing Interface (NMI) library available on the IBM SP2 is illustrated. In particular, we will present the performance of Fast Fourier Transform (FFT) kernel from NAS Parallel Benchmarks (NPB) under MPL and MPI. We have also optimized some of Fortran BLAS 2 and BLAS 3 routines, e.g., the optimized Fortran DAXPY runs at 175 Mflop/s and optimized Fortran DGEMM runs at 230 Mflop/s per node. The performance of the NPB (Class B) on the IBM SP2 is compared with the CRAY C90, Intel Paragon, TMC CM-5E, and the CRAY T3D.

  1. Optimasi Air Perasan Buah Merah (Pandanus sp. Pada Pemeriksaan Telur Cacing

    Directory of Open Access Journals (Sweden)

    Anita Oktari


    Full Text Available Worm infections or can be called by worming included into an infection caused by a parasite. Soil Transmitted Helminths Intestinal Nematodes are worms groups are in their life cycle to reach the infective stage requires soil with certain conditions. Eosin 2% is the dye that is used in the examination of Intestinal Nematode worm eggs. Red fruit (Pandanus sp. which is a natural plant material and acidic contain carotenoids which produces orange-red pigment. Beta carotene is the predominant pigment of red-orange color that is found naturally in plants and fruits. The aim of this research is to determine the best concentration from variation of red fruit (Pandanus sp. juice that optimally to color the eggs of the worm. Research conducted experiments with various concentration ratio of red fruit (Pandanus sp. juice and distilled water (1, 1:1, 1:2, 1:3, 1:4, 1:5. From this research it found that the results indicate the ratio of concentrations of red fruit (Pandanus sp. juice and distilled water (1:2 can be used as an alternative reagent eosin 2% for their examination of worm eggs. But in the visual field that uses red fruit (Pandanus sp. juice and distilled water (1:2 still looks much dirt as a nuisance and does not give a contrasting background. It can conclude that red fruit (Pandanus sp. juice can use to color the eggs of the worm.

  2. Rhopalophthalmus constrictus sp. nov. and Australomysis reubeni sp. nov. (Crustacea-Mysidacea) from south-west Australian waters

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Two new species of mysids are described, Rhopalophthalmus constrictus sp. nov. is in having a well-produced triangular rostral plate, pleural plates on the anterior five abdominal somites and prominent constriction at the distal end of the telson...

  3. Effect of sp3-hybridized defects on the oscillatory behavior of carbon nanotube oscillators

    International Nuclear Information System (INIS)

    Guo, Taiyu; Ding, Tony Weixi; Pei, Qing-Xiang; Zhang, Yong-Wei


    Using molecular dynamics simulations, we investigate the oscillatory behaviors of carbon nanotube oscillators containing sp 3 -hybridized defects formed by hydrogen chemisorption. It is found that the presence of these defects significantly affects the kinetic and potential energies of the nanotube systems, which in turn affects their oscillation periods and frequencies. We have also studied the oscillatory characteristics of the oscillators containing sp 3 -hybridized Stone-Wales defects. Our results show that it is possible to control the motion of the inner nanotube by introducing sp 3 -hybridized defects on the outer nanotube, which provides a potential way to tune the oscillatory behavior of nanotube oscillators. -- Highlights: → sp 3 -hybridized defects increase energy dissipation. → sp 3 -hybridized defects arranged in a row have stronger effect than that in a ring. → sp 3 -hybridized defects reduces the effect of SW defects.

  4. [Biofilm Formation by the Nonflagellated flhB1 Mutant of Azospirillum brasilense Sp245]. (United States)

    Shelud'ko, A V; Filip'echeva, Yu A; Shumiliva, E M; Khlebtsov, B N; Burov, A M; Petrova, L P; Katsy, E I


    Azospirillum brasilense Sp245 with mixed flagellation are able to form biofilms on various surfaces. A nonflagellated mutant of this strain with inactivated chromosomal copy of the flhB gene (flhB1) was shown to exhibit specific traits at the later stages of biofilm formation on a hydrophilic (glass) surface. Mature biofilms of the flhB1::Omegon-Km mutant Sp245.1063 were considerably thinner than those of the parent strain Sp245. The biofilms of the mutant were more susceptible to the forces of hydrodynamic shear. A. brasilense Sp245 cells in biofilms were not found to possess lateral flagella. Cells with polar flagella were, however, revealed by atomic force microscopy of mature native biofilms of strain Sp245. Preservation of a polar flagellum (probably nonmotile) on the cells of A. brasilense Sp245 may enhance the biofilm stability.

  5. Production of Cold Active Lipase from Bacillus sp.


    Yasemin, Sara; Arabacı, Nihan; Korkmaz Güvenmez, Hatice


    A cold active lipase producing Bacillus sp. strains were isolated from sewage of oil. Bacillus sp. strain SY-7 was determined as the best lipase producing isolate. The highest enzyme production was found at 20°C and pH 8.0 on tributyrin media. Analyses of molecular mass of the partial purified lipase was carried out by SDS-PAGE which revealed a single band as 110.5 kDa. The enzyme activity and stability were determined by spectrophotometric and titrimetric methods. The enzyme was active betwe...


    Capriotti, Augusto


    Capriotti, Augusto (l'Università di Perugia, Perugia, Italy). Hansenula wickerhamii sp. n., a new yeast from Finnish soil. J. Bacteriol. 82:259–360. 1961.—Hansenula wickerhamii sp. n. is described; it was isolated from a Finnish soil, and is named in honor of Lynferd J. Wickerham. Images PMID:13690638

  7. Automated FiO2-SpO2 control system in neonates requiring respiratory support: a comparison of a standard to a narrow SpO2 control range. (United States)

    Wilinska, Maria; Bachman, Thomas; Swietlinski, Janusz; Kostro, Maria; Twardoch-Drozd, Marta


    Managing the oxygen saturation of preterm infants to a target range has been the standard of care for a decade. Changes in target ranges have been shown to significantly impact mortality and morbidity. Selecting and implementing the optimal target range are complicated not only by issues of training, but also the realities of staffing levels and demands. The potential for automatic control is becoming a reality. Results from the evaluation of different systems have been promising and our own experience encouraging. This study was conducted in two tertiary level newborn nurseries, routinely using an automated FiO2-SpO2 control system (Avea-CLiO2, Yorba Linda CA, USA). The aim of this study was to compare the performance of the system as used routinely (set control range of 87-93% SpO2), to a narrower higher range (90-93%). We employed a 12-hour cross-over design with the order of control ranges randomly assigned for each of up to three days. The primary prospectively identified end points were time in the 87-93% SpO2 target range, time at SpO2 extremes and the distribution of the SpO2 exposure. Twenty-one infants completed the study. The infants were born with a median EGA of 27 weeks and studied at a median age of 17 days and weight of 1.08 kg. Their median FiO2 was 0.32; 8 were intubated, and the rest noninvasively supported (7 positive pressure ventilation and 6 CPAP). The control in both arms was excellent, and required less than 2 manual FiO2 adjustments per day. There were no differences in the three primary endpoints. The narrower/higher set control range resulted in tighter control (IQR 3.0 vs. 4.3 p < 0.001), and less time with the SpO2 between 80-86 (6.2% vs. 8.4%, p = 0.006). We found that a shift in the median of the set control range of an automated FiO2-SpO2 control system had a proportional effect on the median and distribution of SpO2 exposure. We found that a dramatic narrowing of the set control range had a disproportionally smaller impact. Our

  8. Test af spørgeskema

    DEFF Research Database (Denmark)

    Hermansen, Jonathan


    Denne bog gennemgår alle surveyarbejdets faser og giver en praktisk indføring i •design af undersøgelsen og udvælgelse af stikprøver, •formulering af spørgeskemaer samt indsamling og kodning af data, •metoder til at analysere resultaterne....

  9. Heitmania gen. nov., a new yeast genus in Microbotryomycetes, and description of three novel species: Heitmania litseae sp. nov., Heitmania castanopsis sp. nov. and Heitmania elacocarpi sp. nov. (United States)

    Liu, Xin-Zhan; Groenewald, Marizeth; Boekhout, Teun; Bai, Feng-Yan


    Nine anamorphic yeast strains isolated from various plant leaves collected in southern China were phylogenetically characterized based on sequences of the internal transcribed spacer (ITS) region, the D1/D2 domains of the large subunit (LSU) rRNA gene, the small subunit (SSU) rRNA gene, the two subunits of the RNA polymerase II gene (RPB1 and RPB2) and the translation elongation factor 1-α (TEF1). Phylogenetic analysis of the combined sequences of the six genes showed that the new strains formed a distinct clade in the class Microbotryomycetes but could not be assigned to any of the existing genera, families or orders of the class. Three separate groups were consistently resolved from the nine new strains based on the combined sequences of the six genes and single gene sequences of ITS, RPB1, RPB2 and TEF1. The results suggest that the nine yeast strains compared represent three novel species in a novel genus. The names Heitmania gen. nov. (MycoBank registration number MB819987), Heitmania litseae sp. nov. (MB820112, type strain CGMCC 2.5697 T =CBS 14756 T ), Heitmania castanopsis sp. nov. (MB819988, CGMCC 2.5698 T =CBS 14750 T ) and Heitmania elacocarpi sp. nov. (MB820113, CGMCC 2.5695 T =CBS 14752 T ) are proposed for the new taxa.

  10. An enzyme-linked immunosorbent assay (ELISA) for quantification of mouse surfactant protein D (SP-D)

    DEFF Research Database (Denmark)

    Hansen, Soren; Schmidt, Vivi; Steffensen, Maria Abildgaard


    characterized and validated for use in sandwich enzyme-linked immunosorbent assay (ELISA). Based on two of these, we established an ELISA that allows for measurements of mouse SP-D in various body fluids. The final ELISA was optimized and calibrated with a standard of purified recombinant mouse SP-D, which......Surfactant protein D (SP-D) is a pattern recognition molecule of the collectin family of C-type lectins. It is found in the airways and at mucosal surfaces. SP-D is part of the innate immune system where it neutralizes and leads to elimination of microorganisms. It regulates the functions of other...... innate immune cells, such as macrophages and neutrophils. It also modulates the adaptive immune response by interacting with antigen-presenting cells and T cells. Monoclonal anti-mouse-SP-D antibodies were raised from SP-D deficient mice using recombinant SP-D as antigen. Ten monoclonal antibodies were...

  11. Ozone Technology for Pathogenic Bacteria of Shrimp (Vibrio sp.) Disinfection (United States)

    Wulansarie, Ria; Dyah Pita Rengga, Wara; Rustamadji


    One of important marine commodities in Indonesia, shrimps are susceptible with Vibrio sp bacteria infection. That infection must be cleared. One of the technologies for disinfecting Vibrio sp. is ozone technology. In this research, Vibrio sp. is a pathogenic bacterium which infects Penaeus vannamei. Ozone technology is applied for threatening Vibrio sp. In this research, ozonation was performed in different pH. Those are neutral, acid (pH=4), and base (pH=9). The sample was water from shrimp embankment from Balai Besar Perikanan Budidaya Air Payau (BBPBAP) located in Jepara. That water was the habitat of Penaeus vannamei shrimp. The brand of ozonator used in this research was “AQUATIC”. The used ozonator in this research had 0,0325 g/hour concentration. The flow rate of sample used in this research was 2 L/minute. The ozonation process was performed in continuous system. A tank, pipe, pump, which was connected with microfilter, flowmeter and ozone generator were the main tools in this research. It used flowmeter and valve to set the flow rate scalable as desired. The first step was the insert of 5 L sample into the receptacle. Then, by using a pump, a sample supplied to the microfilter to be filtered and passed into the flow meter. The flow rate was set to 2 LPM. Furthermore, gas from ozonator passed to the flow for the disinfection of bacteria and then was recycled to the tank and the process run continuously. Samples of the results of ozonation were taken periodically from time 0, 3, 7, 12, 18, 24 to 30 minutes. The samples of the research were analyzed using Total Plate Count (TPC) test in BBPBAP Jepara to determine the number of Vibrio sp. bacteria. The result of this research was the optimal condition for pathogenic bacteria of shrimp (Vibrio sp.) ozonation was in neutral condition.

  12. Copper and Cadmium Toxicity to Marine Phytoplankton, Chaetoceros gracilis and Isochrysis sp.

    Directory of Open Access Journals (Sweden)

    Suratno Suratno


    Full Text Available In Copper (Cu based antifouling (AF paints Cu was largely used as booster biocide after organotin was banned. Cu is micronutrient which is important in photosynthesis process because Cu is an essential metal as component of enzyme and electron transport chain. But in certain dosage, Cu could be toxic to marine organism. Chaetoceros gracilis and Isochrysis sp. are dominant microalgae in aquatic ecosystem. In this study the effect of Cu and Cadmium (Cd on two marine microalgae, C. gracilis and Isochrysis sp. were compared. Toxicity test was based on American Standard for Testing Material (ASTM. IC50-96 h of Cd as reference toxicant was 2,370 mg.L-1 for C. gracilis and 490 mg.L-1 for Isochrysis sp. IC50-96 h of Cu to growth of C. gracilis was 63.75 mg.L-1 and Isochrysis sp. was 31.80 mg.L-1. Both Cd and Cu were inhibited growth of microalgae. Based on IC50-96 h value, it could be concluded that Cu was more toxic than Cd. Toxicity of Cu was 37 times stronger than Cd for C. gracilis and 15 times for Isochrysis sp. It was estimated that at concentration 10 mg.L-1 Cu does not show observable effect (NOEC to C. gracilis and 5 mg.L-1 to Isochrysis sp. The lowest observable effect of Cu (LOEC to C. gracilis was at concentration 17 mg.L-1 and 10 mg.L-1 for Isochrysis sp.

  13. Isolation and characterization of mesotrione-degrading Bacillus sp. from soil

    International Nuclear Information System (INIS)

    Batisson, Isabelle; Crouzet, Olivier; Besse-Hoggan, Pascale; Sancelme, Martine; Mangot, Jean-Francois; Mallet, Clarisse; Bohatier, Jacques


    Dissipation kinetics of mesotrione, a new triketone herbicide, sprayed on soil from Limagne (Puy-de-Dome, France) showed that the soil microflora were able to biotransform it. Bacteria from this soil were cultured in mineral salt solution supplemented with mesotrione as sole source of carbon for the isolation of mesotrione-degrading bacteria. The bacterial community structure of the enrichment cultures was analyzed by temporal temperature gradient gel electrophoresis (TTGE). The TTGE fingerprints revealed that mesotrione had an impact on bacterial community structure only at its highest concentrations and showed mesotrione-sensitive and mesotrione-adapted strains. Two adapted strains, identified as Bacillus sp. and Arthrobacter sp., were isolated by colony hybridization methods. Biodegradation assays showed that only the Bacillus sp. strain was able to completely and rapidly biotransform mesotrione. Among several metabolites formed, 2-amino-4-methylsulfonylbenzoic acid (AMBA) accumulated in the medium. Although sulcotrione has a chemical structure closely resembling that of mesotrione, the isolates were unable to degrade it. - A Bacillus sp. strain isolated from soil was able to completely and rapidly biotransform the triketone herbicide mesotrione

  14. DCHAIN-SP 2001: High energy particle induced radioactivity calculation code

    Energy Technology Data Exchange (ETDEWEB)

    Kai, Tetsuya; Maekawa, Fujio; Kasugai, Yoshimi; Takada, Hiroshi; Ikeda, Yujiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kosako, Kazuaki [Sumitomo Atomic Energy Industries, Ltd., Tokyo (Japan)


    For the purpose of contribution to safety design calculations for induced radioactivities in the JAERI/KEK high-intensity proton accelerator project facilities, the DCHAIN-SP which calculates the high energy particle induced radioactivity has been updated to DCHAIN-SP 2001. The following three items were improved: (1) Fission yield data are included to apply the code to experimental facility design for nuclear transmutation of long-lived radioactive waste where fissionable materials are treated. (2) Activation cross section data below 20 MeV are revised. In particular, attentions are paid to cross section data of materials which have close relation to the facilities, i.e., mercury, lead and bismuth, and to tritium production cross sections which are important in terms of safety of the facilities. (3) User-interface for input/output data is sophisticated to perform calculations more efficiently than that in the previous version. Information needed for use of the code is attached in Appendices; the DCHAIN-SP 2001 manual, the procedures of installation and execution of DCHAIN-SP, and sample problems. (author)

  15. Role of Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 as Bioindicators and Immobilizers of Chromium in a Contaminated Natural Environment


    Millach, Laia; Solé, Antoni; Esteve, Isabel


    The aim of this work was to study the potential of the two phototrophic microorganisms, both isolated from Ebro Delta microbial mats, to be used as bioindicators and immobilizers of chromium. The results obtained indicated that (i) the Minimum Metal Concentration (MMC) significantly affecting Chlorophyll a intensity in Geitlerinema sp. DE2011 and Scenedesmus sp. DE2009 was 0.25??M and 0.75??M, respectively, these values being lower than those established by current legislation, and (ii) Scene...

  16. Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1. (United States)

    Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z


    A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.

  17. Biochemical changes induced by fungicides in nitrogen fixing Nostoc sp. (United States)

    Deviram, G V N S; Pant, Gaurav; Prasuna, R Gyana


    The present study indicates the effect of fungicides (approved by WHO) and their behavior on nitrogen fixer of rice eco system Nostoc sp. Application of plant protecting chemicals at recommended levels braced up the growth of blue green algae thereby enhancing heterocyst formation and nitrogenase activity. Nostoc sp demoed varying degrees of sensitivity to fungicides. Biomass yield, protein, carbohydrate content reduced after 3pg/mL concentration. Heterocyst damage was observed from 4μg/mL, Proline content increased with increase in fungicide concentration, utmost yellowing of the culture started from 4μg/mL. The decreasing order of the toxicity to Nostoc sp with fungicides was Mancozeb> Ediphenphos> Carbendazim> Hexaconazole.

  18. Human surfactant protein D: SP-D contains a C-type lectin carbohydrate recognition domain. (United States)

    Rust, K; Grosso, L; Zhang, V; Chang, D; Persson, A; Longmore, W; Cai, G Z; Crouch, E


    Lung surfactant protein D (SP-D) shows calcium-dependent binding to specific saccharides, and is similar in domain structure to certain members of the calcium-dependent (C-type) lectin family. Using a degenerate oligomeric probe corresponding to a conserved peptide sequence derived from the amino-terminus of the putative carbohydrate binding domain of rat and bovine SP-D, we screened a human lung cDNA library and isolated a 1.4-kb cDNA for the human protein. The relationship of the cDNA to SP-D was established by several techniques including amino-terminal microsequencing of SP-D-derived peptides, and immunoprecipitation of translation products of transcribed mRNA with monospecific antibodies to SP-D. In addition, antibodies to a synthetic peptide derived from a predicted unique epitope within the carbohydrate recognition domain of SP-D specifically reacted with SP-D. DNA sequencing demonstrated a noncollagenous carboxy-terminal domain that is highly homologous with the carboxy-terminal globular domain of previously described C-type lectins. This domain contains all of the so-called "invariant residues," including four conserved cysteine residues, and shows high homology with the mannose-binding subfamily of C-type lectins. Sequencing also demonstrated an amino-terminal collagenous domain that contains an uninterrupted sequence of 59 Gly-X-Y triplets and that also contains the only identified consensus for asparagine-linked oligosaccharides. The studies demonstrate that SP-D is a member of the C-type lectin family, and confirm predicted structural similarities to conglutinin, SP-D, and the serum mannose binding proteins.

  19. Metabolites from marine fungus Aspergillus sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; Rajmanickam, R.; DeSouza, L.

    Chemical examination of a methanolic extract of the marine fungus, Aspergillus sp., isolated from marine grass environment, yielded a steroid, ergosterol peroxide (1), and a mixture of known glyceride esters (2,3) of unsaturated fatty acids...

  20. Micetoma pulmonar por Scedosporium sp, reporte de dos casos

    Directory of Open Access Journals (Sweden)

    José G. Somocurcio


    Full Text Available Se reporta los dos primeros casos de micetoma pulmonar por Scedosporium sp, en el Perú, tratados quirúrgicamente en el Hospital Nacional Hipólito Unanue. Se practicó resección pulmonar debido a micetoma pulmonar de donde se tomó muestras que fueron enviadas a microbiología y anatomía patológica para cultivo y estudio histopatológico. Se identificó el moho Scedosporium sp en dos pacientes con secuelas cavitarias por tuberculosis, quienes presentaron tos y hemoptisis de dos meses y tres años de evolución, respectivamente. Radiológicamente las cavidades estaban ocupadas por una "bola fúngica". La histopatología indicó presencia de abundantes hifas, indistinguibles de las de Aspergillus sp, mientras que la inmunodifusión para Aspergillus fue negativa.

  1. Streptomycetes antagonism against Cladosporium fulvum Cooke and Fusarium oxysporium f.sp. lycopersici Antagonismo de estreptomicetos a Cladosporium fulvum Cooke e Fusarium oxysporium f.sp. lycopersici

    Directory of Open Access Journals (Sweden)

    Ana Cristina Fermino Soares


    Full Text Available This research aimed to evaluate the secondary effects of secondary metabolites produced by streptomycetes on spore germination and mycelial growth of the phytopathogenic fungi Cladosporium fulvum Cooke and Fusarium oxysporium f. sp. lycopersici from tomato plants. Metabolites produced by streptomycete isolates codified as AC-147 and AC-92 caused 94.1% inhibition of C. fulvum while AC-95 isolate caused 33.9% inhibition. AC-92 was the most efficient for F. oxysporum f. sp. lycopersici, causing 94.2% inhibition of spore germination. For mycelial growth, AC-26 and AC-92 were the most efficient in inhibiting C. fulvum growth by 46.6% and F. oxysporum f. sp. lycopersici by 29.9%. These streptomycetes are potential agents for biocontrol development methods of these tomato plant pathogenic fungi.Este trabalho teve como objetivo avaliar o efeito de metabólitos secundários produzidos por estreptomicetos na germinação de esporos e no crescimento micelial dos fungos Cladosporium fulvum Cooke e Fusarium oxysporum sp. f. lycopersici da cultura do tomateiro. Metabólitos produzidos pelos isolados AC-147 e AC-92 causaram 94,1% de inibição da germinação de esporos de C. fluvum, enquanto que o isolado AC-95 causou 33,9% de inibição. O AC-92 foi o mais eficiente para F. oxysporum f. sp. lycopersici, causando 94,2% de inibição na germinação de esporos. Para o crescimento micelial, AC-26 e AC-92 foram os mais eficientes na inibição dos fungos C. fulvum, em 46,6%, e F. oxysporum f. sp. Lycopersici, em 29,9%. Esses estreptomicetos são potenciais agentes para o desenvolvimento de métodos de controle biológico desses fungos fitopatogênicos do tomateiro.

  2. "SP-G", a putative new surfactant protein--tissue localization and 3D structure.

    Directory of Open Access Journals (Sweden)

    Felix Rausch

    Full Text Available Surfactant proteins (SP are well known from human lung. These proteins assist the formation of a monolayer of surface-active phospholipids at the liquid-air interface of the alveolar lining, play a major role in lowering the surface tension of interfaces, and have functions in innate and adaptive immune defense. During recent years it became obvious that SPs are also part of other tissues and fluids such as tear fluid, gingiva, saliva, the nasolacrimal system, and kidney. Recently, a putative new surfactant protein (SFTA2 or SP-G was identified, which has no sequence or structural identity to the already know surfactant proteins. In this work, computational chemistry and molecular-biological methods were combined to localize and characterize SP-G. With the help of a protein structure model, specific antibodies were obtained which allowed the detection of SP-G not only on mRNA but also on protein level. The localization of this protein in different human tissues, sequence based prediction tools for posttranslational modifications and molecular dynamic simulations reveal that SP-G has physicochemical properties similar to the already known surfactant proteins B and C. This includes also the possibility of interactions with lipid systems and with that, a potential surface-regulatory feature of SP-G. In conclusion, the results indicate SP-G as a new surfactant protein which represents an until now unknown surfactant protein class.

  3. The effect of dietary seaweed of Caulerpa sp. and Gracilaria sp. on blood glucose levels and histological pancreas of diabetic rats.

    Directory of Open Access Journals (Sweden)

    Ni Luh Ari Yusasrini


    Full Text Available The aim of this research was to determine the effect of dietary seaweed of Caulerpa sp. and Gracilaria sp. on blood glucose levels and histological pancreas of diabetic rats. A total of 28 male Wistar rats were used in this study. Rats were divided into 4 groups and given different diets i.e. PSN, PSA, PBN and PBS. Bioassay was conducted for 30 days. The analysis conducted on the macronutrient content of the seaweed flour as well as blood glucose levels on day 0, day 1 and day 30 after alloxan injection. At the end of the implementation of  bioassay, animal surgery were performed and pancreas organs were taken for histology observation. The results showed that  Gracilaria sp. and Caulerpa sp. had a crude fiber content respectively 20.48% and 12.47%. Blood glucose levels in all four groups of mice on day 0 ranged from 123.18 mg / dL - 131.96 mg / dL. Feeding PBN and PBS for 30 days lowered blood glucose levels of mice, respectively for 51.63% (from 384.4 mg / dL to 168.52 mg / dL and 35.24% (from 328.05 mg / dL be 212.42 mg / dL. Histological observation showed that feeding PBN and PBS capable of helping the regeneration of pancreatic cells, thereby feeding both types of seaweed showed hypoglycemic effects in comparison with standard feed.

  4. Genome sequencing and annotation of Serratia sp. strain TEL. (United States)

    Lephoto, Tiisetso E; Gray, Vincent M


    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  5. Genome sequencing and annotation of Serratia sp. strain TEL

    Directory of Open Access Journals (Sweden)

    Tiisetso E. Lephoto


    Full Text Available We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410. This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926 collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  6. Genome sequencing and annotation of Serratia sp. strain TEL


    Lephoto, Tiisetso E.; Gray, Vincent M.


    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  7. Xanthobacter sp. C20 contains a novel bioconversion pathway for limonene

    NARCIS (Netherlands)

    Werf, M.J. van der; Keijzer, P.M.; Schaft, P.H. van der


    Xanthobacter sp. C20 was isolated from sediment of the river Rhine using cyclohexane as sole source of carbon and energy. Xanthobacter sp. C20 converted both enantiomers of limonene quantitatively into limonene-8,9-epoxide, a not previously described bioconversion product of limonene. With

  8. Aspergillus waksmanii sp. nov. and Aspergillus marvanovae sp. nov., two closely related species in section Fumigati

    DEFF Research Database (Denmark)

    Hubka, Vit; Peterson, Stephen W.; Frisvad, Jens Christian


    Two new and phylogenetically closely related species in Aspergillus section Fumigati are described and illustrated. Homothallic Aspergillus waksmanii sp. nov. was isolated from New Jersey soil (USA) and is represented by the ex-type isolate NRRL 179T (=CCF 4266T=Thom 4138.HS2T=IBT 31900T......). Aspergillus marvanovae sp. nov. was isolated from water with high boracic acid anions content in Dukovany nuclear power station (Czech Republic). The sexual stage of this species is unknown, but the MAT1-1 locus was successfully amplified suggesting that the species is probably heterothallic and teleomorphic...... but is represented by only the ex-type isolate CCM 8003T (=CCF 4037T=NRRL 62486T=IBT 31279T=IFM 60873T). Both species can be distinguished from all previously described species in section Fumigati based on morphology, maximum growth temperature, sequence data from five unlinked loci and unique secondary metabolites...

  9. Cytosine methylation does not affect binding of transcription factor Sp1

    International Nuclear Information System (INIS)

    Harrington, M.A.; Jones, P.A.; Imagawa, M.; Karin, M.


    DNA methylation may be a component of a multilevel control mechanism that regulates eukaryotic gene expression. The authors used synthetic oligonucleotides to investigate the effect of cytosine methylation on the binding of the transcription factor Sp1 to its target sequence (a G+C-rich sequence known as a GC box). Concatemers of double-stranded 14-mers containing a GC box successfully competed with the human metallothionein IIA promoter for binding to Sp1 in DNase I protection experiments. The presence of 5-methylcytosine in the CpG sequence of the GC box did not influence Sp1 binding. The result was confirmed using double-stranded 20-mers containing 16 base pairs of complementary sequence. Electrophoretic gel retardation analysis of annealed 28-mers containing a GC box incubated with an Sp1-containing HeLa cell nuclear extract demonstrated the formation of DNA-protein complexes; formation of these complexes was not inhibited when an oligomer without a GC box was used as a competitor. Once again, the presence of a 5-methylcytosine residue in the GC box did not influence the binding of the protein to DNA. The results therefore preclude a direct effect of cytosine methylation on Sp1-DNA interactions

  10. Bacterial community composition characterization of a lead-contaminated Microcoleus sp. consortium. (United States)

    Giloteaux, Ludovic; Solé, Antoni; Esteve, Isabel; Duran, Robert


    A Microcoleus sp. consortium, obtained from the Ebro delta microbial mat, was maintained under different conditions including uncontaminated, lead-contaminated, and acidic conditions. Terminal restriction fragment length polymorphism and 16S rRNA gene library analyses were performed in order to determine the effect of lead and culture conditions on the Microcoleus sp. consortium. The bacterial composition inside the consortium revealed low diversity and the presence of specific terminal-restriction fragments under lead conditions. 16S rRNA gene library analyses showed that members of the consortium were affiliated to the Alpha, Beta, and Gammaproteobacteria and Cyanobacteria. Sequences closely related to Achromobacter spp., Alcaligenes faecalis, and Thiobacillus species were exclusively found under lead conditions while sequences related to Geitlerinema sp., a cyanobacterium belonging to the Oscillatoriales, were not found in presence of lead. This result showed a strong lead selection of the bacterial members present in the Microcoleus sp. consortium. Several of the 16S rRNA sequences were affiliated to nitrogen-fixing microorganisms including members of the Rhizobiaceae and the Sphingomonadaceae. Additionally, confocal laser scanning microscopy and scanning and transmission electron microscopy showed that under lead-contaminated condition Microcoleus sp. cells were grouped and the number of electrodense intracytoplasmic inclusions was increased.

  11. [Isolation of actinobacteria with antibiotic associated with soft coral Nephthea sp]. (United States)

    Ma, Liang; Zhang, Wenjun; Zhu, Yiguang; Wu, Zhengchao; Saurav, Kumar; Hang, Hui; Zhang, Changsheng


    The present study aims to isolate and identify actinobacteria associated with the soft coral Nephthea sp., and to isolate natural products from these actinobacteria under the guidance of PCR screening for polyketides synthase (PKS) genes. Eleven selective media were used to isolate actinobacteria associated with the soft coral Nephthea sp. collected from Yongxin Island. The isolated actinobacteria were classified on the basis of phylogenetic tree analysis of their 16S rRNA genes. Degenerated primers targeted on conserved KS (ketoacyl-synthase) domain of type I PKS genes were used to screen for potential isolates. The positive isolates were cultured in three different media to check their producing profiles. One bioactive strain that is rich in metabolites was subjected to larger scale fermentation for isolating bioactive natural products. A total of 20 strains were isolated from Nephthea sp., and were categorized into 3 genera including Streptomyces, Dietzia and Salinospora, among which 18 strains were positive in screening with type I PKS genes. Two bioactive compounds rifamycin S and rifamycin W were isolated and identified from Salinospora arenicola SH04. This is the first report of isolating indigenous marine actinobacteria Salinospora from the soft coral Nephthea sp. It provides an example of isolating bioactive secondary metabolites from cultivable actinobacteria associated with Nephthea sp. by PCR screening.

  12. Occurrence of Euplatypus parallelus, Euplatypus sp. (col.: Euplatypodidae and Xyleborus affinis (col.: Scolytidae in Pinus sp. in Ribas do Rio Pardo, Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Zanuncio José Cola


    Full Text Available Wood borer species of the families Euplatypodidae and Scolytidae were observed attacking trees of Pinus sp. in the Municipality of Ribas do Rio Pardo, state of Mato Grosso do Sul, Brazil, in March 2000. This plantation had been previously burned in an accidental fire in January 2000, causing the trees to become partially or totally unhealthy, rendering them more susceptible to attack of these pests. Galleries of these wood borers were opened with a chisel to observe parameters such as their direction and form of these galleries. Species observed as wood borers of Pinus sp. were Euplatypus parallelus, Euplatypus sp. (Coleoptera: Euplatypodidae and Xyleborus affinis (Coleoptera: Scolytidae.

  13. Dual host specificity of phage SP6 is facilitated by tailspike rotation

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Jiagang [Department of Pathology and Laboratory Medicine, McGovern Medical School at UTHealth, Houston, TX 77030 (United States); Park, Taehyun [Center for Infectious Disease, Department of Molecular Biosciences, Institute for Cell and Molecular Biology, University of Texas at Austin, Austin, TX 78712 (United States); Morado, Dustin R. [Department of Pathology and Laboratory Medicine, McGovern Medical School at UTHealth, Houston, TX 77030 (United States); Hughes, Kelly T. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Molineux, Ian J., E-mail: [Center for Infectious Disease, Department of Molecular Biosciences, Institute for Cell and Molecular Biology, University of Texas at Austin, Austin, TX 78712 (United States); Liu, Jun, E-mail: [Department of Pathology and Laboratory Medicine, McGovern Medical School at UTHealth, Houston, TX 77030 (United States)


    Bacteriophage SP6 exhibits dual-host adsorption specificity. The SP6 tailspikes are recognized as important in host range determination but the mechanisms underlying dual host specificity are unknown. Cryo-electron tomography and sub-tomogram classification were used to analyze the SP6 virion with a particular focus on the interaction of tailspikes with host membranes. The SP6 tail is surrounded by six V-shaped structures that interconnect in forming a hand-over-hand hexameric garland. Each V-shaped structure consists of two trimeric tailspike proteins: gp46 and gp47, connected through the adaptor protein gp37. SP6 infection of Salmonella enterica serovars Typhimurium and Newport results in distinguishable changes in tailspike orientation, providing the first direct demonstration how tailspikes can confer dual host adsorption specificity. SP6 also infects S. Typhimurium strains lacking O antigen; in these infections tailspikes have no apparent specific role and the phage tail must therefore interact with a distinct host receptor to allow infection. - Highlights: •Cryo-electron tomography reveals the structural basis for dual host specificity. •Sub-tomogram classification reveals distinct orientations of the tailspikes during infection of different hosts. •Tailspike-adaptor modules rotate as they bind different O antigens. •In the absence of any O antigen, tailspikes bind weakly and without specificity to LPS. •Interaction of the phage tail with LPS is essential for infection.

  14. Sp100 colocalizes with HPV replication foci and restricts the productive stage of the infectious cycle.

    Directory of Open Access Journals (Sweden)

    Wesley H Stepp


    Full Text Available We have shown previously that Sp100 (a component of the ND10 nuclear body represses transcription, replication and establishment of incoming human papillomavirus (HPV DNA in the early stages of infection. In this follow up study, we show that Sp100 does not substantially regulate viral infection in the maintenance phase, however at late stages of infection Sp100 interacts with amplifying viral genomes to repress viral processes. We find that Sp100 localizes to HPV16 replication foci generated in primary keratinocytes, to HPV31 replication foci that form in differentiated cells, and to HPV16 replication foci in CIN 1 cervical biopsies. To analyze this further, Sp100 was down regulated by siRNA treatment of differentiating HPV31 containing cells and levels of viral transcription and replication were assessed. This revealed that Sp100 represses viral transcription and replication in differentiated cells. Analysis of Sp100 binding to viral chromatin showed that Sp100 bound across the viral genome, and that binding increased at late stages of infection. Therefore, Sp100 represses the HPV life cycle at both early and late stages of infection.

  15. Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov. (United States)

    Yang, Deok-Chun; Im, Wan-Taek; Kim, Myung Kyum; Lee, Sung-Taik


    Gram-negative, non-spore-forming, rod-shaped bacteria, T7-09(T) and TR6-08(T), were isolated from soil from a ginseng field in South Korea and characterized to determine their taxonomic position. 16S rRNA gene sequence analysis showed that the two isolates shared 99.5 % sequence similarity. Strains T7-09(T) and TR6-08(T) were shown to belong to the Proteobacteria and showed the highest levels of sequence similarity to Pseudoxanthomonas broegbernensis DSM 12573(T) (98.1 %), Pseudoxanthomonas mexicana AMX 26B(T) (97.4-97.5 %), Pseudoxanthomonas japonensis 12-3(T) (96.5-96.6 %), Pseudoxanthomonas taiwanensis ATCC BAA-404(T) (95.7 %) and Xanthomonas campestris ATCC 33913(T) (96.3-96.5 %). The sequence similarity values with respect to any species with validly published names in related genera were less than 96.5 %. The detection of a quinone system with Q-8 as the predominant compound and a fatty acid profile with C(15 : 0) iso as the predominant acid supported the assignment of the novel isolates to the order 'Xanthomonadales'. The two isolates could be distinguished from the established species of the genus Pseudoxanthomonas by the presence of quantitative unsaturated fatty acid C(17 : 1) iso omega9c and by their unique biochemical profiles. The results of DNA-DNA hybridization clearly demonstrated that T7-09(T) and TR6-08(T) represent separate species. On the basis of these data, it is proposed that T7-09(T) (=KCTC 12208(T)=IAM 15116(T)) and TR6-08(T) (=KCTC 12207(T)=IAM 15115(T)) be classified as the type strains of two novel Pseudoxanthomonas species, for which the names Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov., respectively, are proposed.

  16. Experimental infection in Notodiaptomus sp. (Crustacea: Calanoida with larvae of Camallanus sp. (Nematoda: Camallanidae Infecção experimental em Notodiaptomus sp. (Crustacea: Calanoida com larvas de Camallanus sp. (Nematoda: Camallanidae

    Directory of Open Access Journals (Sweden)

    M.L. Martins


    Full Text Available This trial registered the experimental infection viability with nematode larvae Camallanus sp. in Notodiaptomus sp., a crustacean, which can be an intermediate host. Adult females of nematode were dissected from the intestines of Xiphophorus maculatus (Osteichthyes: Poeciliidae, at a fish farm in the State of São Paulo. Females were slightly compressed for larvae release, collected with Pasteur pipette and separated on Petri dishes with 9ml filtered water at 28.1ºC, from zooplankton culture. Treatments consisted of Petri dishes with 60 and 105 copepods, in which 120, 150 and 210 larvae of nematode were added in four replications. Twenty-four and 36h after exposition to the larvae, the copepods were fixed in 70% alcohol to record the amount of fixed larvae. Twenty four hours after exposition, 60 copepods group with 120 larvae showed significantly higher prevalence (46.5% when compared to 105 copepods and 120 larvae (33.2%. Thus, these answers suggested that 120 larvae were enough for a successful infectivity. Experimental infection was available and so, it was used as a pattern to life cycle studies of camallanid nematodes and hosts susceptibility tests.A viabilidade da infecção experimental com larvas do nematóide Camallanus sp. em Notodiaptomus sp., crustáceo com potencial para hospedeiro intermediário foi avaliada. Fêmeas adultas do nematóide foram extraídas de Xiphophorus maculatus (Osteichthyes: Poeciliidae, provenientes de piscicultura de peixes ornamentais no estado de São Paulo. As fêmeas foram ligeiramente pressionadas para liberar as larvas, coletadas com pipeta Pasteur e separadas em placas de Petri contendo 9ml de água filtrada a 28,1ºC do próprio cultivo de zooplâncton. Os tratamentos consistiram de placas contendo 60 e 105 copépodes onde se adicionou 120, 150 e 210 larvas de nematóides em quatro repetições. Nos tempos de 24 e 36h após a exposição às larvas, os copépodes foram fixados em álcool 70% para

  17. SP-D as a biomarker for COPD in the Lebanese population

    DEFF Research Database (Denmark)

    Akiki, Zeina; Fakih, Dalia; Jounblat, Rania


    Background: Surfactant protein D (SP-D), a promising systemic biomarker of chronic obstructive pulmonary disease (COPD) was never evaluated in the Lebanese population. Objective: The validity of serum SP-D as a biomarker for COPD, in comparison with C-reactive protein (CRP) and fibrinogen was inv...

  18. Biosorption of americium-241 by Candida sp

    International Nuclear Information System (INIS)

    Luo Shunzhong; Zhang Taiming; Liu Ning; Yang Yuanyou; Jin Jiannan; Liao Jiali


    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high toxicity and long half-life. In this experiment, the biosorption of 241 Am from solution by Candida sp., and the effects of various experimental conditions on the adsorption were investigated. The preliminary results showed that the adsorption of 241 Am by Candida sp. was efficient. 241 Am could be removed by Candida sp. of 0.82 g/L (dry weight) from 241 Am solutions of 5.6-111 MBq/L (44.3-877.2 μg/L)(C 0 ), with maximum adsorption rate (R) of 98% and maximum adsorption capacities (W) of 63.5 MBq/g biomass (dry weight) (501.8 μg/g). The biosorption equilibrium was achieved within 4 hour and the optimum pH was pH = 2. No significant differences on 241 Am adsorption were observed at 10 C-45 C, or in solutions containing Au 3+ or Ag + , even 1500 times or 4500 times above the 241 Am concentration, respectively. The relationship between concentrations and adsorption capacities of 241 Am indicated the biosorption process should be described by a Langmuir adsorption isotherm. (orig.)

  19. Eucalyptus sp. at the Intersection of Environment and Culture in Kenya

    Directory of Open Access Journals (Sweden)

    Brandy M Garrett Kluthe


    Full Text Available Members of the genus Eucalyptus are popular on small farms throughout Kenya, and include species such as Eucalyptus saligna, Eucalpytus globulus, and Eucalyptus grandis. Although they are fast-growing and perform well on marginal land, these trees are associated with negative environmental effects in Africa and elsewhere they have been introduced. In-person surveys were conducted with small farmers in Kenya to determine patterns of Eucalyptus sp. stand use and cultural importance. It was found that despite acknowledged short and long term environmental consequences, Eucalyptus sp. remains popular for medium term economic investment. These findings are consistent with other reports of Eucalyptus sp. woodlots serving as funding sources for education, health emergencies, etc., in parts of the world where bank loans are unavailable. Further, it was found that some farmers are using modified silviculture practices to ameliorate the negative effects of Eucalyptus sp., and others are seeking indigenous alternatives.           

  20. Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09. (United States)

    Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming


    Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.

  1. Profil des examens radiographiques spéciaux conventionnels dans ...

    African Journals Online (AJOL)

    But : Montrer l'apport des examens spéciaux dans la démarche diagnostique Méthodologie : Il s'agit d'une étude rétrospective qui a porté sur les résultats de 249 examens spéciaux colligés dans le service de radiologie du CHU- Tokoin de Lomé du 1er mars 2003 au 1er mars 2004. Résultats : L'âge de nos patients varie ...

  2. Pengaruh PH dan Suhu terhadap Aktivitas Protease Penicillium SP.


    Yusriah, Yusriah; Kuswytasari, Nengah Dwianita


    Tujuan penelitian ini adalah untuk mengetahui pengaruh pH dan suhu terhadap aktivitas protease pada Penicillium sp.3 T3f2. Selanjutnya, isolat Penicillium sp. di kultur dalam media produksi protease untuk menghasilkan protease. Suhu yang digunakan adalah 300 – 500C sedangkan pH-nya 4 – 8. Aktivitas protease ditentukan dan diukur dengan spektrofotometer pada panjang gelombang 275 nm, dengan kasein sebagai substrat. Berdasarkan uji ANOVA yang dilanjutkan dengan uji Duncan dengan taraf kepercaya...


    Directory of Open Access Journals (Sweden)

    Dolly Melissa Obando Castellanos


    Full Text Available Se evaluó el efecto de las épocas climáticas (lluvia y sequía y del estrato de la muestra (Suelo rizosférico, raíces y hojas sobre la población de los géneros Azotobacter, Beijerinckia, Derxia, Azospirillum, Herbaspirillum, Gluconacetobacter y Burkholderia en el Eucalipto (Eucalyptus sp.. Así mismo, se evalúo su capacidad en la producción de compuestos indólicos como promotores del crecimiento vegetal y su actividad de reducción de acetileno como indicador de la fijación biológica de nitrógeno. Los resultados no registraron diferencias estadísticas significativas en el test de Tukey (P ≤ 0.05 en la población con respecto a la época climática. Con respecto al estrato de muestra, los aislamientos tentativos a Herbaspirillum sp. y Azospirillum sp. presentaron diferencias significativas en suelo rizosférico y raíces. Se obtuvieron 44 aislamientos de los cuales se agruparon por caracterización fenotípica como: 14 presuntivos del género Beijerinckia sp., 12 de Azotobacter sp., 8 de Derxia sp., 4 de Herbarpirillum sp., 5 de Azospirillum sp., 1 de Gluconacetobacter sp. y 1 de Burkholderia sp. Por su alto potencial fueron seleccionados y criopreservados los aislamientos C27, C26, C25 y C45, las cuales presentaron los mejores valores de eficiencia in vitro, superando valores de producción de las cepas de referencia utilizadas (A. chroococcum (AC-01 y A. brasilense (SP7.

  4. BIOSORPSI DAN REDUKSI KROM LIMBAH PENYAMAKAN KULIT DENGAN BIOMASSA Fusarium sp DAN Aspergillus niger (Biosorpstion and Reduction of Chromium Bearing Tannery Wastewater Using The Biomass of Fusarium Sp. and Aspergillus niger

    Directory of Open Access Journals (Sweden)

    Suharjono Triatmojo


    Full Text Available ABSTRAK Tujuan penelitian ini ialah untuk membuktikan bahwa biomassa Fusarium sp dapat mereduksi Cr(VI, dan biomassa Aspergillus niger dapat digunakan untuk mengambil ion krom dari larutan. Fusarium.sp ditumbuhkan pada media cair kentang dekftosa cair, ditambah K2Cr2O7 atau sludge limbah penyamakan kulit. Selanjutnya diamati perubahan warnanya, bila terjadi perubahan warna dan oranye ke ungu atau tak berwarna maka telah terjadi reduksi krom valensi VI menjadi krom valensi Ill. Aspergillus niger ditumbuhkan pada media Potato dectrose agar (PDA padat, dipindahkan ke media cair yang bensi bakto pepton, bakto dektrose dan srukronutrien. Produksi biomassa dilakukan pada labu erlenmeyer; setelah 5 hari dipanen dan dibuat bubuk. Bubuk ini digunakan untuk mengambil krom dari larutan. Hasil penelitian menunjukkan bahwa biomassa Fusarium sp dapat digunakan untuk mengambil krom dan larutan yang.mengandung KrCrrO, atau sludge limbah penyamakan kulit. Waktu inkubasi yang lebih lama meningkatkan absorbsi krom oleh biomassa Fascrium sp. Fusarium sp mampu mereduksi Cr(VI menjadi Cr(Iii. Biomassa Aspergillus niger dapat digunakan untuk mengambil krom dari larutan. Hasil terbaik diperoleh pada konsentrasi awal 100 mg/I, pada pH 2,0, berat biomassa 0,1 g, dan waktu kontak 12 jam, yaitu 96,23% untuk Cr(II| dan96,3 % untuk Cr(VI. Fusarium sp. dan A. niger dapat digunakan sebagai bioremediator dalam penanganan limbah penyamakan kulit secara biologi.   ABSTRACT The objectives of this research was to study the biosorption and reduction of chromium bearing tannery wastewater using biomass of Fusarium sp and Aspergillus niger. Fusarium sp was used to investigate bioaccumulation and reduction of chromium in K2 Cr2O7 solution and solution containing sludge of leather tanning waste, and aspergillus niger was used to investigate biosorption of Cr(III and Cr(VI in solution. Fusarium sp was grown on sterilized potato extrose liquid medium, added with K2Cr2O7solution or sludge

  5. Revision of the family Carabodidae (Acari, Oribatida XII. Yoshiobodes camerunensis sp. n. and Rugocepheus costaricensis sp. n.

    Directory of Open Access Journals (Sweden)

    Nestor Fernandez


    Full Text Available Yoshiobodes camerunensis sp. n., collected in Cameroon, is the first species of this genus reported from the Afrotropical region. Diagnostic characters include lamellae terminating in a bridge and not in lamellar tips; cup-shaped bothridia, bothridial ring present; rostral setae cochleariform, smooth; lamellar setae slightly lanceolate, barbate; fifteen pairs of notogastral setae; c3 lanceolate, rounded end, with longitudinal shallow grooves; other notogastral setae curved lanceolate-cochleariform. Rugocepheus costaricensis sp. n. is the third species of the genus to be described, and the first collected outside the African region. Prodorsum presents a Y-shaped structure; elevated interlamellar process, superior flat zone; lamellae lacking lamellar tips; fourteen pairs of notogastral setae; four notogastral furrows, and an unpaired elevated central area devoid of setae. Both species are described and illustrated based on adult specimens, studied by means of optical and SEM microscopy.

  6. Common genetic variants of surfactant protein-D (SP-D are associated with type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Neus Pueyo

    Full Text Available CONTEXT: Surfactant protein-D (SP-D is a primordial component of the innate immune system intrinsically linked to metabolic pathways. We aimed to study the association of single nucleotide polymorphisms (SNPs affecting SP-D with insulin resistance and type 2 diabetes (T2D. RESEARCH DESIGN AND METHODS: We evaluated a common genetic variant located in the SP-D coding region (rs721917, Met(31Thr in a sample of T2D patients and non-diabetic controls (n = 2,711. In a subset of subjects (n = 1,062, this SNP was analyzed in association with circulating SP-D concentrations, insulin resistance, and T2D. This SNP and others were also screened in the publicly available Genome Wide Association (GWA database of the Meta-Analyses of Glucose and Insulin-related traits Consortium (MAGIC. RESULTS: We found the significant association of rs721917 with circulating SP-D, parameters of insulin resistance and T2D. Indeed, G carriers showed decreased circulating SP-D (p = 0.004, decreased fasting glucose (p = 0.0002, glycated hemoglobin (p = 0.0005, and 33% (p = 0.002 lower prevalence of T2D, estimated under a dominant model, especially among women. Interestingly, these differences remained significant after controlling for origin, age, gender, and circulating SP-D. Moreover, this SNP and others within the SP-D genomic region (i.e. rs10887344 were significantly associated with quantitative measures of glucose homeostasis, insulin sensitivity, and T2D, according to GWAS datasets from MAGIC. CONCLUSIONS: SP-D gene polymorphisms are associated with insulin resistance and T2D. These associations are independent of circulating SP-D concentrations.

  7. Ocorrência de Taenia sp. na população atendida no laboratório central do Instituto Adolfo Lutz, São Paulo, SP, Brasil (1960/1989 Occurrence of Taenia sp. in the population attended in the central laboratory of "Instituto Adolfo Lutz", São Paulo, SP, Brazil (1960/1989

    Directory of Open Access Journals (Sweden)

    Rosa Maria Donini Souza Dias


    Full Text Available Foram examinados retrospectivamente os relatórios mensais e anuais da Seção de Enteroparasitoses do Laboratório Central do Instituto Adolfo Lutz, São Paulo, SP, do período de 1960 a 1989, perfazendo uma série histórica de 30 anos, com 1.519.730 exames protoparasitológicos e 355 identificações de proglotes de Taenia. Pelo método da sedimentação espontânea foram diagnosticados 7.663 (0,5% casos de presença de ovos de Taenia sp. nas fezes. Das 355 proglotes enviadas para identificação, 311 (87,60% estavam em condições de serem especificadas, e dessas, 273 (87,80% eram proglotes de Taenia saginata e 38 (12,22% de T. solium.Monthly and yearly reports of the Seção de Enteroparasitoses of the Instituto Adolfo Lutz (São Paulo, SP, Brazil from 1960 to 1989 with 1,519,730 parasitological stool examinations were studied. There were also 355 identifications of Taenia sp. proglottids. Using HOFFMAN, PONS & JANER's method, 7,663 (0.5% cases of taeniasis were diagnosed, and 311 (87.60% of the 355 proglottids were on easy terms to be specified, 273 (87.80% of them were from Taenia saginata.

  8. Effect of tea saponin on ephyrae and polyps of the moon jellyfish Aurelia sp.1.

    Directory of Open Access Journals (Sweden)

    Zhijun Dong

    Full Text Available The moon jellyfish (Aurelia sp.1 is thought to be a nuisance for the sea cucumber aquaculture, which commonly occur in the sea cucumber (Apostichopus japonicus culture ponds of the Yellow Sea, China. To develop an appropriate method to control Aurelia sp.1 blooms, the toxic effects of tea saponin on Aurelia sp.1 ephyrae and polyps were tested in laboratory experiments. Our results revealed that tea saponin caused significant morphological changes, behavioral abnormality and mortality in Aurelia sp.1 ephyrae and polyps in 24 h and 48 h exposure experiments. The 24 h and 48 h median lethal concentrations (LC50 values of tea saponin for Aurelia sp.1 ephyrae were 1.9 and 1.1 mg L-1 respectively, while the LC50 value for Aurelia sp.1 polyps was 0.4 mg L-1 after 24h and 48 h of exposure to tea saponin. Comparison with literature results of tea saponin on A. japonicus indicates that the resistance of A. japonicus to tea saponin is 12-18 times greater than that of Aurelia sp.1 ephyrae. Therefore, the appropriate tea saponin dosage for the control of Aurelia sp.1 should be paid enough attention in order to minimize possible damage for sea cucumber. We suggest that the recommended level of tea saponin to eradicate Aurelia sp.1 ephyrae and polyps in sea cucumber culture ponds be lower than 1.35 mg L-1.

  9. Effect of tea saponin on ephyrae and polyps of the moon jellyfish Aurelia sp.1. (United States)

    Dong, Zhijun; Sun, Tingting; Liang, Likun; Wang, Lei


    The moon jellyfish (Aurelia sp.1) is thought to be a nuisance for the sea cucumber aquaculture, which commonly occur in the sea cucumber (Apostichopus japonicus) culture ponds of the Yellow Sea, China. To develop an appropriate method to control Aurelia sp.1 blooms, the toxic effects of tea saponin on Aurelia sp.1 ephyrae and polyps were tested in laboratory experiments. Our results revealed that tea saponin caused significant morphological changes, behavioral abnormality and mortality in Aurelia sp.1 ephyrae and polyps in 24 h and 48 h exposure experiments. The 24 h and 48 h median lethal concentrations (LC50) values of tea saponin for Aurelia sp.1 ephyrae were 1.9 and 1.1 mg L-1 respectively, while the LC50 value for Aurelia sp.1 polyps was 0.4 mg L-1 after 24h and 48 h of exposure to tea saponin. Comparison with literature results of tea saponin on A. japonicus indicates that the resistance of A. japonicus to tea saponin is 12-18 times greater than that of Aurelia sp.1 ephyrae. Therefore, the appropriate tea saponin dosage for the control of Aurelia sp.1 should be paid enough attention in order to minimize possible damage for sea cucumber. We suggest that the recommended level of tea saponin to eradicate Aurelia sp.1 ephyrae and polyps in sea cucumber culture ponds be lower than 1.35 mg L-1.

  10. Merozoite proteins from Babesia sp. BQ1 (Lintan) as potential antigens for serodiagnosis by ELISA. (United States)

    Guan, G Q; Chauvin, A; Rogniaux, H; Luo, J X; Yin, H; Moreau, E


    Babesia sp. BQ1 (Lintan) is a Babesia isolated from sheep infested with Haemaphysalis qinghaiensis in China, and is closely related to B. motasi based on the 18S rRNA gene sequence. In the present study, an ELISA was developed with merozoite antigens of Babesia sp. BQ1 (Lintan) (BQMA) purified from in vitro culture. When the positive threshold was chosen as 30% of the antibodies rate, evaluated with 198 negative sera, the specificity was 95.5%. Except for Babesia sp. Tianzhu, there was no cross-reaction between BQMA and positive sera from Babesia sp. BQ1 (Ningxian)-, Babesia sp. Hebei-, Babesia sp. Xinjiang-, Theileria luwenshuni-, T. uilenbergi-, or Anaplasma ovis-infected sheep, which are the dominant haemoparasites of small ruminants in China. Specific antibodies against Babesia sp. BQ1 (Lintan) were produced 1 or 2 weeks post-infection and a high level of antibodies persisted for more than 8 months in experimentally infected sheep. This ELISA was tested on 974 sera collected from field-grazing sheep in 3 counties of Gansu province, northwestern China to evaluate the seroprevalence of Babesia sp. BQ1 (Lintan) infection and the average positive rate was 66.84%. The feasibility of increasing the specificity of this BQMA-based ELISA, by using some BQMA antigens for serodiagnosis is discussed.

  11. Lung Surfactant Protein D (SP-D) Response and Regulation During Acute and Chronic Lung Injury

    DEFF Research Database (Denmark)

    Gaunsbaek, Maria Quisgaard; Rasmussen, Karina Juhl; Beers, Michael F.


    in three murine models of lung injury, using a validated ELISA technology for estimation of SP-D levels. METHODS: Mice were exposed to lipopolysaccharide, bleomycin, or Pneumocystis carinii (Pc) and sacrificed at different time points. RESULTS: In lipopolysaccharide-challenged mice, the level of SP...... injury, with a sustained increment during chronic inflammation compared with acute inflammation. A quick upregulation of SP-D in serum in response to acute airway inflammation supports the notion that SP-D translocates from the airways into the vascular system, in favor of being synthesized systemically....... The study also confirms the concept of using increased SP-D serum levels as a biomarker of especially chronic airway inflammation....

  12. Cephaloleia sp. Cerca a Vagelineata Pic*, una Plaga de la Palma Africana

    Directory of Open Access Journals (Sweden)

    Urueta Sandino Eduardo


    Full Text Available Cephalolia sp. y Cephaloleila sp, se han empleado como sinónimos del género Cepaloleia sp. (Lepesme. 1947. Se sabe que los estados de larva y adulto atacan el follaje de la palma africana (Elaeis guineensis Jacq. trayendo muchas veces como consecuencia secamientos en los folíolos o su invasión por hongos. En Colombia el Cephaloleia próximo a vagelineata Pic se presenta en la zona de Urabá y posiblemente en el Departamento de Santander.

  13. Scope and Limitations of Auxiliary-Assisted, Palladium-Catalyzed Arylation and Alkylation of sp2 and sp3 C-H Bonds (United States)

    Nadres, Enrico T.; Santos, Gerson Ivan Franco; Shabashov, Dmitry; Daugulis, Olafs


    The scope of palladium-catalyzed, auxiliary-assisted direct arylation and alkylation of sp2 and sp3 C-H bonds of amine and carboxylic acid derivatives has been investigated. The method employs a palladium acetate catalyst, substrate, aryl, alkyl, benzyl, or allyl halide, and inorganic base in t-amyl alcohol or water solvent at 100-140 °C. Aryl and alkyl iodides as well as benzyl and allyl bromides are competent reagents in this transformation. Picolinic acid auxiliary is used for amine γ-functionalization and 8-aminoquinoline auxiliary is used for carboxylic acid β-functionalization. Some optimization of base, additives, and solvent is required for achieving best results. PMID:24090404

  14. Rhodium(III)-Catalyzed Amidation of Unactivated C(sp(3) )-H Bonds. (United States)

    Wang, He; Tang, Guodong; Li, Xingwei


    Nitrogenation by direct functionalization of C-H bonds represents an important strategy for constructing C-N bonds. Rhodium(III)-catalyzed direct amidation of unactivated C(sp(3) )-H bonds is rare, especially under mild reaction conditions. Herein, a broad scope of C(sp(3) )-H bonds are amidated under rhodium catalysis in high efficiency using 3-substituted 1,4,2-dioxazol-5-ones as the amide source. The protocol broadens the scope of rhodium(III)-catalyzed C(sp(3) )-H activation chemistry, and is applicable to the late-stage functionalization of natural products. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Characterization of a bioflocculant produced by a consortium of Halomonas sp. Okoh and Micrococcus sp. Leo. (United States)

    Okaiyeto, Kunle; Nwodo, Uchechukwu U; Mabinya, Leonard V; Okoh, Anthony I


    The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2-10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment.

  16. Spatial and temporal control of the diazonium modification of sp2 carbon surfaces. (United States)

    Kirkman, Paul M; Güell, Aleix G; Cuharuc, Anatolii S; Unwin, Patrick R


    Interest in the controlled chemical functionalization of sp(2) carbon materials using diazonium compounds has been recently reignited, particularly as a means to generate a band gap in graphene. We demonstrate local diazonium modification of pristine sp(2) carbon surfaces, with high control, at the micrometer scale through the use of scanning electrochemical cell microscopy (SECCM). Electrochemically driven diazonium patterning is investigated at a range of driving forces, coupled with surface analysis using atomic force microscopy (AFM) and Raman spectroscopy. We highlight how the film density, level of sp(2)/sp(3) rehybridization and the extent of multilayer formation can be controlled, paving the way for the use of localized electrochemistry as a route to controlled diazonium modification.

  17. Spøgelsets egne ord

    DEFF Research Database (Denmark)

    Gemzøe, Anker


    refleksioner over den gengangerscene, der åbner Shakespeares Hamlet. Ifølge Derridas ’hantologie’ opererer spøgelser i en eksistentiel tidslighed, der har at gøre med sorg, sprog og forvandling. Genremæssigt, tilføjer Gemzøe, har gengangeren det med at husere i tragedien. Med Derridas ’hantologie’ som en af de...

  18. Pengaruh penambahan enzim dan waktu inkubasi terhadap jumlah protoplas mesofil daun anggrek Dendrobium Sp

    Directory of Open Access Journals (Sweden)

    Edi Setiti Wida Utami


    Full Text Available This research was done in order to study of effect the supplementation of enzyme and incubation time for the protoplast qualtity leaf mesophyll Dendrobium sp. Protoplast can be used for culture protoplast, for somatic cross, biology research, and material for genetic manipulation. This research to make use of material was Dendrobium sp Orchid. Explant that to used was leaf mesophyll Dendrobium sp. For the protoplast isolation to used enzyme combination selulase and maserozym (Onozuka R-10. Yakult JONSHA Co., Ltd., (Japan_ with concentration selulase : maserozym is (0.5; 0.05; 0.75; 0.075; 0; 0.1. leaf mesophyll Dendrobium sp. to get a soak in enzyme solution with incubation time 12-13 hours and 14-1 hours.the result shown that enzyme combination selulase and maserozym can be used for protoplast isolation leaf mesophyll Dendrobium sp Orchid. The best enzyme concertration to fit for isolatin protoplast leaf mesophyll Dendrobium sp to be selulase 0.75% and maserozym 0.075% with incubation time 14-15 hours.

  19. Biohydrogen production by dark fermentation of glycerol using Enterobacter and Citrobacter Sp. (United States)

    Maru, Biniam T; Constanti, Magda; Stchigel, Alberto M; Medina, Francesc; Sueiras, Jesus E


    Glycerol is an attractive substrate for biohydrogen production because, in theory, it can produce 3 mol of hydrogen per mol of glycerol. Moreover, glycerol is produced in substantial amounts as a byproduct of producing biodiesel, the demand for which has increased in recent years. Therefore, hydrogen production from glycerol was studied by dark fermentation using three strains of bacteria: namely, Enterobacter spH1, Enterobacter spH2, and Citrobacter freundii H3 and a mixture thereof (1:1:1). It was found that, when an initial concentration of 20 g/L of glycerol was used, all three strains and their mixture produced substantial amounts of hydrogen ranging from 2400 to 3500 mL/L, being highest for C. freundii H3 (3547 mL/L) and Enterobacter spH1 (3506 mL/L). The main nongaseous fermentation products were ethanol and acetate, albeit in different ratios. For Enterobacter spH1, Enterobacter spH2, C. freundii H3, and the mixture (1:1:1), the ethanol yields (in mol EtOH/mol glycerol consumed) were 0.96, 0.67, 0.31, and 0.66, respectively. Compared to the individual strains, the mixture (1:1:1) did not show a significantly higher hydrogen level, indicating that there was no synergistic effect. Enterobacter spH1 was selected for further investigation because of its higher yield of hydrogen and ethanol. Copyright © 2012 American Institute of Chemical Engineers (AIChE).

  20. Aerococcus sp. with an antimycobacterial effect

    African Journals Online (AJOL)



    Dec 21, 2011 ... In this study, we reported data on a strain that was isolated from different areas of Fez. (Morocco), which ... sp. The antibacterial activity of the genus Aerococcus have .... able to amplify the 16S rRNA gene from eubacteria.

  1. Glycomyces scopariae sp. nov. and Glycomyces mayteni sp. nov., isolated from medicinal plants in China. (United States)

    Qin, Sheng; Chen, Hua-Hong; Klenk, Hans-Peter; Zhao, Guo-Zhen; Li, Jie; Xu, Li-Hua; Li, Wen-Jun


    Two actinomycete strains, designated YIM 56256(T) and YIM 61331(T), were isolated from the roots of Scoparia dulcis and Maytenus austroyunnanensis, two Chinese medicinal plants, and their taxonomic status was established based on a polyphasic investigation. The organisms were found to have chemical and morphological markers typical of members of the genus Glycomyces. 16S rRNA gene sequence analysis showed that they were closely related to each other and to Glycomyces sambucus E71(T). A battery of physiological characteristics and levels of DNA-DNA relatedness indicated that strains YIM 56256(T) and YIM 61331(T) represent two novel species, clearly different from the related known Glycomyces species. On the basis of the data presented, it is evident that each of these strains represents a novel species of the genus Glycomyces, for which the names Glycomyces scopariae sp. nov. (type strain YIM 56256(T) =KCTC 19158(T) =DSM 44968(T)) and Glycomyces mayteni sp. nov. (type strain YIM 61331(T) =KCTC 19527(T) =CCTCC AA 208004(T)) are proposed.

  2. Methylobacterium pseudosasicola sp. nov. and Methylobacterium phyllostachyos sp. nov., isolated from bamboo leaf surfaces. (United States)

    Madhaiyan, Munusamy; Poonguzhali, Selvaraj


    Two strains of Gram-negative, methylotrophic bacteria, isolated because of their abilities to promote plant growth, were subjected to a polyphasic taxonomic study. The isolates were strictly aerobic, motile, pink-pigmented, facultatively methylotrophic, non-spore-forming rods. The chemotaxonomic characteristics of the isolates included the presence of C18 : 1ω7c as the major cellular fatty acid. The DNA G+C contents of strains BL36(T) and BL47(T) were 69.4 and 69.8 mol%, respectively. 16S rRNA gene sequence analysis of strains BL36(T) and BL47(T) placed them under the genus Methylobacterium, with the pairwise sequence similarity between them and the type strains of closely related species ranging from 97.2 to 99.0%. On the basis of their phenotypic and phylogenetic distinctiveness and the results of DNA-DNA hybridization analysis, the isolates represent two novel species within the genus Methylobacterium, for which the names Methylobacterium pseudosasicola sp. nov. (type strain BL36(T) = NBRC 105203(T) = ICMP 17621(T)) and Methylobacterium phyllostachyos sp. nov. (type strain BL47(T) = NBRC 105206(T) = ICMP 17619(T)) are proposed. © 2014 IUMS.

  3. Streptococcus moroccensis sp. nov. and Streptococcus rifensis sp. nov., isolated from raw camel milk. (United States)

    Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter


    Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T)  = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T)  = CCMM B833(T)) are proposed. © 2014 IUMS.

  4. Herbaspirillum canariense sp. nov., Herbaspirillum aurantiacum sp. nov. and Herbaspirillum soli sp. nov., isolated from volcanic mountain soil, and emended description of the genus Herbaspirillum. (United States)

    Carro, Lorena; Rivas, Raúl; León-Barrios, Milagros; González-Tirante, María; Velázquez, Encarna; Valverde, Angel


    Three Gram-negative, motile and slightly curved rod-shaped bacteria, strains SUEMI03(T), SUEMI08(T) and SUEMI10(T), were isolated from an old volcanic mountain soil on Tenerife (Canary Islands). The three strains were related phylogenetically to Herbaspirillum seropedicae. 16S rRNA gene sequence similarity was 99.2-99.6 % among strains SUEMI03(T), SUEMI08(T) and SUEMI10(T), which presented 97.5, 97.8 and 97.7 % identity, respectively, with respect to H. seropedicae DSM 6445(T). The three strains grew optimally in TSB at 28 °C and contained summed features 3 (C(16:1)ω6c and/or C(16:1)ω7c) and 8 (C(18:1)ω6c and/or C(18:1)ω7c) and C(16:0) as major cellular fatty acids. The DNA G+C contents of strains SUEMI03(T), SUEMI08(T) and SUEMI10(T) were 61.6, 60.4 and 61.9 mol%, respectively. Strains SUEMI03(T), SUEMI08(T) and SUEMI10(T) presented less than 60 % interstrain DNA relatedness and less than 30 % relatedness with respect to H. seropedicae DSM 6445(T). In spite of their common geographical origin, the three strains isolated in this study presented several phenotypic differences, presenting phenotypic profiles highly divergent from that of H. seropedicae. Therefore, we propose that the strains isolated in this study represent three novel species of the genus Herbaspirillum, named Herbaspirillum canariense sp. nov. (type strain SUEMI03(T) = LMG 26151(T) = CECT 7838(T)), Herbaspirillum aurantiacum sp. nov. (type strain SUEMI08(T) = LMG 26150(T) = CECT 7839(T)) and Herbaspirillum soli sp. nov. (type strain SUEMI10(T) = LMG 26149(T) = CECT 7840(T)).

  5. Identifikasi Molekuler Fitoplasma yang Berasosiasi dengan Tanaman Kaktus Hias Opuntia sp.

    Directory of Open Access Journals (Sweden)

    Ariny Prasetya


    Full Text Available Cactus species (Opuntia sp. is a popular ornamental succulent plant. Some ornamental cactus species in Indonesia showing proliferation and green mosaic pattern symptoms have been reported to be associated with phytoplasma infection. However, further molecular identification for accurate classification of the causal phytoplasma has not been done.  This study aimed to diagnose phytoplasma associated with Opuntia sp. based on molecular methods involving PCR standard combined with nested-PCR, cloning and DNA sequencing. Standard PCR was carried out using P1/P7 primers followed by nested-PCR using R16F2n/R16R2 or fU5/rU3 primer pairs which amplify the 16S rRNA gene targets of 1.2 kb and 880 bp, respectively. Amplified fragment of nested-PCR using R16F2n/R16R2 primers was chosen to be cloned and sequenced for further identification and classification of phytoplasma.  BLASTn analysis showed that the phytoplasma from Opuntia sp. was closely related to 16SrII group. Phylogenetic analysis and in silico RFLP indicated that phytoplasma strain infecting Opuntia sp. was a member of subgroup 16SrII-C (cactus witches’ broom phytoplasma. This is a newly report of cactus witches’ broom phytoplasma on Opuntia sp. in Indonesia.   

  6. Biodegradation of resorcinol byPseudomonas sp.

    Institute of Scientific and Technical Information of China (English)

    Nader Hajizadeh; Najibeh Shirzad; Ali Farzi; Mojtaba Salouti; Azra Momeni


    ABSTRACT Objective:To investigate the ability ofPseudomonas sp. isolated from East Azarbaijan, Iran in bioremediation of resorcinol. Methods: Resorcinol biodegradation was evaluated using spectrophotometry and confirmed by gas chromatography-mass spectroscopy. Results:This isolate was able to remove up to 37.12% of resorcinol from contaminated water. Reusability experiments had confirmed the biodegradation process which produced seven intermediate compounds. These intermediates were characterized by gas chromatography-mass spectroscopy technique. The products of resorcinol biodegradation were apparently 1, 4-cyclohexadiene, nonadecene, 2-heptadecanone, 1-isopropyl-2-methoxy-4-methylbenzene, hexadecanoic acid, 9-octadecenoic acid, phenol and 5-methyl-2-(1-methylethyl). Conclusions: The findings revealed thatPseudomonas sp. is able to degrade resorcinol. Because of being an indigenous organism, this isolate is more compatible with the climate of the northwest region of Iran and possibly will be used for degradation of other similar aromatic compounds.

  7. Surfactant protein A (SP-A) inhibits agglomeration and macrophage uptake of toxic amine modified nanoparticles. (United States)

    McKenzie, Zofi; Kendall, Michaela; Mackay, Rose-Marie; Whitwell, Harry; Elgy, Christine; Ding, Ping; Mahajan, Sumeet; Morgan, Cliff; Griffiths, Mark; Clark, Howard; Madsen, Jens


    The lung provides the main route for nanomaterial exposure. Surfactant protein A (SP-A) is an important respiratory innate immune molecule with the ability to bind or opsonise pathogens to enhance phagocytic removal from the airways. We hypothesised that SP-A, like surfactant protein D, may interact with inhaled nanoparticulates, and that this interaction will be affected by nanoparticle (NP) surface characteristics. In this study, we characterise the interaction of SP-A with unmodified (U-PS) and amine-modified (A-PS) polystyrene particles of varying size and zeta potential using dynamic light scatter analysis. SP-A associated with both 100 nm U-PS and A-PS in a calcium-independent manner. SP-A induced significant calcium-dependent agglomeration of 100 nm U-PS NPs but resulted in calcium-independent inhibition of A-PS self agglomeration. SP-A enhanced uptake of 100 nm U-PS into macrophage-like RAW264.7 cells in a dose-dependent manner but in contrast inhibited A-PS uptake. Reduced association of A-PS particles in RAW264.7 cells following pre-incubation of SP-A was also observed with coherent anti-Stokes Raman spectroscopy. Consistent with these findings, alveolar macrophages (AMs) from SP-A(-/-) mice were more efficient at uptake of 100 nm A-PS compared with wild type C57Bl/6 macrophages. No difference in uptake was observed with 500 nm U-PS or A-PS particles. Pre-incubation with SP-A resulted in a significant decrease in uptake of 100 nm A-PS in macrophages isolated from both groups of mice. In contrast, increased uptake by AMs of U-PS was observed after pre-incubation with SP-A. Thus we have demonstrated that SP-A promotes uptake of non-toxic U-PS particles but inhibits the clearance of potentially toxic A-PS particles by blocking uptake into macrophages.

  8. Mesocestoides sp. (Eucestoda, Mesocestoididae parasitizing four species of wild felines in Southern Brazil Mesocestoides sp. (Eucestoda, Mesocestoididae parasitando quatro espécies de felinos silvestres no Sul do Brasil

    Directory of Open Access Journals (Sweden)

    Moisés Gallas


    Full Text Available Leopardus colocolo, Leopardus geoffroyi, Leopardus tigrinus and Puma yagouaroundi are wild feline species endangered mainly due to habitat destruction and vehicle run overs. Seventeen felines hit on the roads were collected in Southern Brazil and examined for parasites. Cestodes were identified as Mesocestoides sp. The parasites were found in the small intestine of the hosts with a prevalence of 66.7% (L. colocolo and L. tigrinus, 60% (P. yagouaroundi and 50% (L. geoffroyi. Rodents and lizards were found in the stomach contents and they possibly were intermediate hosts of Mesocestoides sp. This is the first report of Mesocestoides sp. in wild felines in Brazil.As espécies Leopardus colocolo, Leopardus geoffroyi, Leopardus tigrinus e Puma yagouaroundi, são felídeos silvestres ameaçados de extinção, principalmente pela destruição do hábitat e morte em rodovias. Dezessete felídeos foram coletados atropelados no sul do Brasil e, analisados na pesquisa de parasitos. Cestóides encontrados foram identificados como Mesocestoides sp. Os parasitos foram encontrados no intestino delgado dos hospedeiros com prevalência de 66,7% (L. colocolo e L. tigrinus, 60% (P. yagouaroundi e 50% (L. geoffroyi. Roedores e lagartos foram encontrados no conteúdo estomacal, podendo ser os hospedeiros intermediários para Mesocestoides sp. Este é o primeiro registro de Mesocestoides sp. em felídeos silvestres no Brasil.

  9. Limited SP17 expression within tumors diminishes its therapeutic potential

    DEFF Research Database (Denmark)

    Gjerstorff, M F; Ditzel, H J


    In this study, we have investigated the expression of the tumor antigen sperm protein 17 (SP17) in a large panel of human cancers and compared it with the expression of two well-characterized families of tumor antigens, melanoma-associated antigen-A (MAGE-A) and G antigen (GAGE). We found that SP17...

  10. Use of the Single Particle Soot Photometer (SP2) as a pre-filter for ice nucleation measurements: effect of particle mixing state and determination of SP2 conditions to fully vaporize refractory black carbon (United States)

    Schill, Gregory P.; DeMott, Paul J.; Levin, Ezra J. T.; Kreidenweis, Sonia M.


    Ice nucleation is a fundamental atmospheric process that impacts precipitation, cloud lifetimes, and climate. Challenges remain to identify and quantify the compositions and sources of ice-nucleating particles (INPs). Assessment of the role of black carbon (BC) as an INP is particularly important due to its anthropogenic sources and abundance at upper-tropospheric cloud levels. The role of BC as an INP, however, is unclear. This is, in part, driven by a lack of techniques that directly determine the contribution of refractory BC (rBC) to INP concentrations. One previously developed technique to measure this contribution uses the Single Particle Soot Photometer (SP2) as a pre-filter to an online ice-nucleating particle counter. In this technique, rBC particles are selectively heated to their vaporization temperature in the SP2 cavity by a 1064 nm laser. From previous work, however, it is unclear under what SP2 conditions, if any, the original rBC particles were fully vaporized. Furthermore, previous work also left questions about the effect of the SP2 laser on the ice-nucleating properties of several INP proxies and their mixtures with rBC.To answer these questions, we sampled the exhaust of an SP2 with a Scanning Mobility Particle Sizer and a Continuous Flow Diffusion Chamber. Using Aquadag® as an rBC proxy, the effect of several SP2 instrument parameters on the size distribution and physical properties of particles in rBC SP2 exhaust were explored. We found that a high SP2 laser power (930 nW/(220 nm PSL)) is required to fully vaporize a ˜ 0.76 fg rBC particle. We also found that the exhaust particle size distribution is minimally affected by the SP2 sheath-to-sample ratio; the size of the original rBC particle, however, greatly influences the size distribution of the SP2 exhaust. The effect of the SP2 laser on the ice nucleation efficiency of Snomax®, NX-illite, and Suwannee River Fulvic Acid was studied; these particles acted as proxies for biological, illite

  11. Carbon sp chains in graphene nanoholes

    DEFF Research Database (Denmark)

    Castelli, Ivano Eligio; Ferri, Nicola; Onida, Giovanni


    Nowadays sp carbon chains terminated by graphene or graphitic-like carbon are synthesized routinely in several nanotech labs. We propose an ab initio study of such carbon-only materials, by computing their structure and stability, as well as their electronic, vibrational and magnetic properties. ...

  12. Evaluation of toughness degradation by small punch (SP) tests for neutron irradiated structural steels

    International Nuclear Information System (INIS)

    Misawa, Toshihei; Hamaguchi, Yoshikazu; Kimura, Akihiko; Eto, Motokuni; Suzuki, Masahide; Nakajima, Nobuya.


    The small punch (SP) test as one of the useful small specimen testing technique (SSTT) has been developed to evaluate the fracture toughness, ductile-brittle transition temperature (DBTT) and tensile properties for neutron irradiated structural materials. The SP tests using the miniaturized specimens of φ3 mm TEM disk and 10 mm 2 coupon were performed for six kinds of ferritic steels of F-82, F-82H, HT-9, JFMS, 2.25-1Mo and SQV2A. It was shown that the temperature dependence of SP fracture energies with scatter in miniaturized testing can give reliable information on the DBTT by use of the statistical analysis based on the Weibull distribution. A good correlation between the DBTT of the SP tests and that of the standard CVN test has been obtained for the various nuclear ferritic steels. The SP test was performed for cryogenic austenitic steels as a way of evaluating elastic-plastic fracture toughness, J IC , on the basis of a universal empirical relationship between J IC and SP equivalent fracture strain, ε-bar qf . The SP testing using the neutron irradiated specimens of 2.25Cr-1Mo, F-82, F-82H and HT-9 steels was successfully applied and presented the neutron radiation induced changes on the DBTT, fracture toughness and tensile properties. (author)

  13. First record of Babesia sp. in Antarctic penguins. (United States)

    Montero, Estrella; González, Luis Miguel; Chaparro, Alberto; Benzal, Jesús; Bertellotti, Marcelo; Masero, José A; Colominas-Ciuró, Roger; Vidal, Virginia; Barbosa, Andrés


    This is the first reported case of Babesia sp. in Antarctic penguins, specifically a population of Chinstrap penguins (Pygoscelis antarctica) in the Vapour Col penguin rookery in Deception Island, South Shetlands, Antarctica. We collected peripheral blood from 50 adult and 30 chick Chinstrap penguins. Examination of the samples by microscopy showed intraerythrocytic forms morphologically similar to other avian Babesia species in 12 Chinstrap penguin adults and seven chicks. The estimated parasitaemias ranged from 0.25×10(-2)% to 0.75×10(-2)%. Despite the low number of parasites found in blood smears, semi-nested PCR assays yielded a 274 bp fragment in 12 of the 19 positive blood samples found by microscopy. Sequencing revealed that the fragment was 97% similar to Babesia sp. 18S rRNA from Australian Little Penguins (Eudyptula minor) confirming presence of the parasite. Parasite prevalence estimated by microscopy in adults and chicks was higher (24% vs. 23.3%, respectively) than found by semi-nested PCR (16% vs. 13.3% respectively). Although sampled penguins were apparently healthy, the effect of Babesia infection in these penguins is unknown. The identification of Babesia sp. in Antarctic penguins is an important finding. Ixodes uriae, as the only tick species present in the Antarctic Peninsula, is the key to understanding the natural history of this parasite. Future work should address the transmission dynamics and pathogenicity of Babesia sp. in Chinstrap penguin as well as in other penguin species, such as Gentoo penguin (Pygoscelis papua) and Adélie penguin (Pygoscelis adeliae), present within the tick distribution range in the Antarctic Peninsula. Copyright © 2016 Elsevier GmbH. All rights reserved.

  14. Spermatozoal ultrastructure in four genera of Homolidae (crustacea, decapoda): Exemplified by Homologenus sp., Latreillopsis sp., Homolomannia sibogae and Paromolosis boasi (United States)

    Jamieson, B. G. M.; Guinot, D.; Forges, B. Richer De


    The spermatozoa of Homologenus sp., Latreillopsis sp., Homolomannia sibogae and Paromolopsis boasi confirm characteristics of a distinctive homolid spermatozoon previously established for Homola sp., Paromola sp. and Paromola petterdi. Homolid features are (1) moderate anteroposterior depression of the acrosome (ratio of length: width 0.4 0.6) as in lyreidine raninids (0.5), depression being greater in dromiids and dynomenids (both 0.3); (2) the capitate form of the perforatorium, shared with dromiids, dynomenids and lyreidine raninids; (3)the autapomorphic spiked-wheel form of the anterior expansion of the perforatorium; (4) horizontal zonation of the acrosome is possibly a unique synapomorphy of homolids with dromiids and dynomenids, and therefore an autapomorphy of the dromioid-homolid assemblage. In dromiids the posterior zone is proportionately the larger, while in homolids the anterior zone is the larger. The anterior zone is complexly subdivided in dynomenids; (5) the autapomorphic presence of numerous radial arranged extension of the acrosomal operculum into the perforatorium; (6) presence of nuclear arms, a symplesiomorphy of all investigated crabs, but small or questionably sometimes absent in Dromiidae; (7) absence of microtubules from the nuclear arms, as in dromiids, raninids, higher heterotremes and thoracotremes; (8) transient presence of a posterior median process of the nucleus. The process is not seen in dromiids but occurs in anomurans and lower heterotremes; (9) apical perforation of the operculum, also seen, apparently symplesiomorphically, in dromiids, raninids, and lower heterotreme families; (10) absence of an acrosome ray zone, probably homoplasic with absence in raninids; (11) location of most of the cytoplasm, including tortuous membranes and degenerating mitochondria, below the acrosome, also seen in Lyreidus; (12) presence, in at least some species, of centrioles, unknown in dromiids and raninids and variable in occurrence in

  15. Effect of Different Medium on Survival Rate and Growth of Chironomus sp. Larvae

    Directory of Open Access Journals (Sweden)

    . Widanarni


    Full Text Available In the ornamental fish and fish for food culture, feeding by natural feed is very suitable since they are easy to digest and their size is suitable with  to larval mouth.  One of natural foods is blood worm Chironomus sp. larvae that has high protein content (till  65.2% of  protein. Until now, blood worm is obtained from nature and their stock depends on the weather.  That problem  may be overcome by culturing blood worm in appropriate culture medium.  Naturally, Chironomus sp. grows well in the water containing sago waste.  This study was carried out to examine the growth of Chironomus sp. reared in the medium containing mud, solid sago waste, solid tapioca wastes and water with no waste in depth of 0.5 cm. After 35-day rearing, survival rate of Chironomus sp was different among the treatments, while growth in length was similar. The best survival rate, 58.93% was obtained in the media containing solid sago waste.   Keywords: Chironomus, blood worm, sago waste, tapioca waste   ABSTRAK Dalam usaha budidaya ikan hias maupun ikan konsumsi, pemberian pakan alami sangat cocok karena mudah dicerna dan sesuai dengan bukaan mulut larva. Salah satu contoh pakan alami adalah Chironomus sp. (blood worm yang mempunyai kandungan protein mencapai 65,2%. Selama ini cacing darah diperoleh dari alam dan suplainya tergantung pada kondisi musim. Hal ini mungkin dapat diatasi dengan membudidayakan cacing darah dengan  media yang sesuai sebagai tempat hidupnya. Secara alami, Chironomus sp. dapat tumbuh dan berkembang dengan baik pada limbah sagu. Penelitian ini dilakukan untuk mengetahui pertumbuhan Chironomus sp. yang dipelihara pada media berupa lumpur, limbah sagu padat, limbah tapioka padat dan air tanpa limbah dengan ketebalan media 0,5 cm. Setelah 35 hari masa pemeliharaan, diketahui bahwa penggunaan media limbah padat sagu, limbah padat tapioka, lumpur dan air tanpa limbah pada pemeliharaan Chironomus sp. masing-masing menghasilkan tingkat

  16. Haloplanus salinarum sp. nov., an extremely halophilic archaeon isolated from a solar saltern. (United States)

    Hwang, Han-Bit; Kim, Ye-Eun; Koh, Hyeon-Woo; Song, Hye Seon; Roh, Seong Woon; Kim, So-Jeong; Nam, Seung Won; Park, Soo-Je


    An extremely halophilic archaeal strain SP28 T was isolated from the Gomso solar saltern, Republic of Korea. Cells of the new strain SP28 T were pleomorphic and Gram stain negative, and produced red-pigmented colonies. These grew in medium with 2.5-4.5 M NaCl (optimum 3.1 M) and 0.05-0.5 M MgCl2 (optimum 0.1 M), at 25-50 °C (optimum 37 °C) and at a pH of 6.5-8.5 (optimum pH 8.0). Mg 2+ was required for growth. A concentration of at least 2 M NaCl was required to prevent cell lysis. Polar lipids included phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, phosphatidylglycerol sulfate and one glycolipid chromatographically identical to sulfated mannosyl glucosyl diether. 16S rRNA and rpoB' gene sequence analyses showed that strain SP28 T is closely related to Haloplanus ruber R35 T (97.3 and 94.1 %, 16S rRNA and rpoB' gene sequence similarity, respectively), Haloplanus litoreus GX21 T (97.0 and 92.1 %), Haloplanus salinus YGH66 T (96.0 and 91.9 %), Haloplanus vescus RO5-8 T (95.9 and 90.9 %), Haloplanus aerogenes TBN37 T (95.6 and 90.3 %) and Haloplanus natans RE-101 T (95.3 and 89.8 %). The DNA G+C content of the novel strain SP28 T was 66.2 mol%, which is slightly higher than that of Hpn.litoreus GX21 T (65.8 mol%) and Hpn.ruber R35 T (66.0 mol%). DNA-DNA hybridization values betweenHpn.ruber R35 T and strain SP28 T and between Hpn.litoreus GX21 T and strain SP28 T were about 24.8 and 20.7 %, respectively. We conclude that strain SP28 T represents a novel species of the genus Haloplanus and propose the name Haloplanus salinarum sp. nov. The type strain is SP28 T (=JCM 31424 T =KCCM 43210 T ).

  17. Enhancement of sp3 hybridized C in amorphous carbon films by Ar ion bombardment and Si incorporation

    International Nuclear Information System (INIS)

    Jung, Hae-Suk; Park, Hyung-Ho; Mendieta, I.R.; Smith, D.A.


    We report an effective method of increasing the sp 3 hybridization fraction in sputtered amorphous carbon (a-C) film by the combination of Ar ion bombardment and Si incorporation. In the deposition of an a-C film, Ar ion bombardment by controlling the applied bias voltage plays a role in creating high stress in film and causes the local bonding configuration to change to a sp 3 hybridized bond. Simultaneously, the incorporated Si in an a-C network breaks the sp 2 hybridized bonded ring and promotes the formation of a sp 3 hybridized bond. This enhancement of the sp 3 hybridized bonding characteristic is maximized for an a-C film with 23 at. % of Si and 100-150 V of applied bias voltage. In this region, the increase of resistivity, optical band gap, and mechanical hardness of a-C is attributed to the reduction of the sp 2 hybridized bonded ring and increased fraction of the sp 3 hybridized bond. However, at a higher bias voltage above 150 V, the enhancement effect is reduced due to the resputtering and thermally activated reconversion of a sp 3 to a sp 2 hybridized bond

  18. Genomic structure and cloning of two transcript isoforms of human Sp8.

    NARCIS (Netherlands)

    M.A. Milona (Maria-athina); J.E. Gough (Julie); A.J. Edgar (Alasdair)


    textabstractBACKGROUND: The Specificity proteins (Sp) are a family of transcription factors that have three highly conserved zinc-fingers located towards the carboxy-terminal that bind GC-boxes and assist in the initiation of gene transcription. Human Sp1-7 genes have been

  19. Plant-fed versus chemicals-fed rhizobacteria of Lucerne: Plant-only teabags culture media not only increase culturability of rhizobacteria but also recover a previously uncultured Lysobacter sp., Novosphingobium sp. and Pedobacter sp. (United States)

    Hegazi, Nabil A; Sarhan, Mohamed S; Fayez, Mohamed; Patz, Sascha; Murphy, Brian R; Ruppel, Silke


    In an effort to axenically culture the previously uncultivable populations of the rhizobacteria of Lucerne (Medicago sativa L.), we propose plant-only teabags culture media to mimic the nutritional matrix available in the rhizosphere. Here, we show that culture media prepared from Lucerne powder teabags substantially increased the cultivability of Lucerne rhizobacteria compared with a standard nutrient agar, where we found that the cultivable populations significantly increased by up to 60% of the total bacterial numbers as estimated by Quantitative Real-time Polymerase Chain Reaction (qRT-PCR). Cluster analysis of 16S rDNA Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) of cultivable Colony-Forming Units (CFUs) revealed a more distinct composition and separation of bacterial populations recovered on the plant-only teabags culture media than those developed on a standard nutrient agar. Further, the new plant medium gave preference to the micro-symbiont Sinorhizobium meliloti, and succeeded in isolating a number of not-yet-cultured bacteria, most closely matched to Novosphingobium sp., Lysobacter sp. and Pedobacter sp. The present study may encourage other researchers to consider moving from the well-established standard culture media to the challenging new plant-only culture media. Such a move may reveal previously hidden members of rhizobacteria, and help to further explore their potential environmental impacts.

  20. Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone. (United States)

    Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke


    TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

  1. Role of surfactant protein-A (SP-A) in lung injury in response to acute ozone exposure of SP-A deficient mice

    International Nuclear Information System (INIS)

    Haque, Rizwanul; Umstead, Todd M.; Ponnuru, Padmavathi; Guo Xiaoxuan; Hawgood, Samuel; Phelps, David S.; Floros, Joanna


    Millions are exposed to ozone levels above recommended limits, impairing lung function, causing epithelial damage and inflammation, and predisposing some individuals to pneumonia, asthma, and other lung conditions. Surfactant protein-A (SP-A) plays a role in host defense, the regulation of inflammation, and repair of tissue damage. We tested the hypothesis that the lungs of SP-A(-/-) (KO) mice are more susceptible to ozone-induced damage. We compared the effects of ozone on KO and wild type (WT) mice on the C57BL/6 genetic background by exposing them to 2 parts/million of ozone for 3 or 6 h and sacrificing them 0, 4, and 24 h later. Lungs were subject to bronchoalveolar lavage (BAL) or used to measure endpoints of oxidative stress and inflammation. Despite more total protein in BAL of KO mice after a 3 h ozone exposure, WT mice had increased oxidation of protein and had oxidized SP-A dimers. In KO mice there was epithelial damage as assessed by increased LDH activity and there was increased phospholipid content. In WT mice there were more BAL PMNs and elevated macrophage inflammatory protein (MIP)-2 and monocyte chemoattractant protein (MCP)-1. Changes in MIP-2 and MCP-1 were observed in both KO and WT, however mRNA levels differed. In KO mice MIP-2 mRNA levels changed little with ozone, but in WT levels they were significantly increased. In summary, several aspects of the inflammatory response differ between WT and KO mice. These in vivo findings appear to implicate SP-A in regulating inflammation and limiting epithelial damage in response to ozone exposure

  2. SP-100 coated-particle fuel development. Phase I. Final report

    International Nuclear Information System (INIS)


    This document is the final report of Phase I of the SP-100 Coated-Particle Fuel Development Program conducted by GA Technologies Inc. for the US Department of Energy under contract DE-AT03-82SF11690. The general objective of the study conducted between September and December 1982 was to evaluate coated-particle type fuel as an alternate or backup fuel to the UO 2 tile-and-fin arrangement currently incorporated into the reference design of the SP-100 reactor core. This report presents and discusses the following topics in the order listed: the need for an alternative fuel for the SP-100 nuclear reactor; an abbreviated description of the reference and coated-particle fuel module concepts; the bases and results of the study and analysis leading to the preliminary design of a coated particle suitable for the SP-100 space power reactor; incorporation of the fuel particles into compacts and heat-pipe-cooled modules; initial efforts and plans to fabricate coated-particle fuel and fuel compacts; the design and performance of the proposed alternative core relative that of the reference fuel; and a summary of critical issues and conclusions consistent with the level of effort and duration of the study

  3. Isolation and identification of Staphylococcus sp. in powdered infant milk (United States)

    Palilu, Prayolga Toban; Budiarso, Tri Yahya


    Staphylococcus sp. is one of the most dangerous bacteria that could cause food poisoning. It is a pathogenic bacterium which is able to produce enterotoxin in foods. Milk is an ideal growth medium for Staphylococcus sp., that may cause problem if it is to be consumed, especially by infant. It is the objective of this research to detect the presence of Staphylococcus sp. in powdered infant milk. As many as 14 samples obtained from market were used as samples for bacterial isolation. The isolation were done by employing enrichment step on BHI-broth, continued with Baird-Parker Agar which will produce a typical colony. It is then picked and grown on Mannitol Salt Agar, and gram staining, coagulase assay, and fermentation tests. The confirmation step was done by using API-Staph which gives the identification of Staphylococcus hemoliticus, Staphylococcus aureus and Staphylococcus epidermidis, with a percentage of identity ranging from 65.9-97.7%. Two isolates with the highest identification similarity values were then picked for molecular detection. A PCR primer pair targeting gene coding for enterotoxin A was used, and it gives positive result for the two isolates being tested. It is then concluded that the two isolates belong to Staphylococcus sp., and further research need to be done to correctly identify these isolates.

  4. Uji produksi biosurfaktan oleh Pseudomonas sp. pada substrat yang berbeda

    Directory of Open Access Journals (Sweden)

    Fatimah Fatimah


    Full Text Available Biosurfactant, microbial metabolite whose properties like surfactant, was suggested to replace chemically synthesized surfactant for take in hand environtmental pollution by petroleum hydrocarbon. This work was done to examine potency of Pseudomonas sp. isolated from Tanjung Perak Harbor to produce biosurfactant. Also, to know the effect of different substrates (glucose + yeast extract, lubricating oil and hexadecane toward biosurfactant production. Pseudomonas sp. grown in mineral synthetic water and biosurfactant production was measured on stationary phase. Biosurfactant production based on emulsification activity and surface tension reduction of supernatant (using Du Nouy tensiometer. Solar, lubricating oil, and hexadecane were used to examine emulsification activity. Results indicated that Pseudomonas sp. have a potency to produce biosurfactant. Surface tension of supernatant decreased up to 20 dyne/cm, when grown on hexadecane substrate. Hexadecane is the best growing substrate for biosurfactant production than others.

  5. Cu toxicity on growth and chlorophyll-a of Chaetoceros sp. (United States)

    Puspitasari, R.; Suratno; Purbonegoro, T.; Agustin, A. T.


    Phytoplankton is a primary producer in marine aquatic ecosystem. Their sensitivity to metal makes them important to study to predict the environmental impact of pollution. Copper is an essential nutrient for aquatic life as micronutrients on an organism but toxic at high levels. The focus of this study was to assess the toxicity of copper to Chaetoceros sp. on growth and chlorophyll-a content. The result shows that inhibition concentration (IC50) of copper on the microalgae, Chaetoceros sp. was 30.25 μg L-1. Growth of Chaetoceros sp. decreased 16.84% in 16 μg L-1 and 81.97% in 44 μg L-1. Chlorophyll-a content decreased dramatically at 44 μg L-1 compared to control. Increase of the cell size, deformation of cell wall and loss of setae were observed at higher concentration of copper.

  6. Accounting for inertia in modal choices: some new evidence using a RP/SP dataset

    DEFF Research Database (Denmark)

    Cherchi, Elisabetta; Manca, Francesco


    effect is stable along the SP experiments. Inertia has been studied more extensively with panel datasets, but few investigations have used RP/SP datasets. In this paper we extend previous work in several ways. We test and compare several ways of measuring inertia, including measures that have been...... proposed for both short and long RP panel datasets. We also explore new measures of inertia to test for the effect of “learning” (in the sense of acquiring experience or getting more familiar with) along the SP experiment and we disentangle this effect from the pure inertia effect. A mixed logit model...... is used that allows us to account for both systematic and random taste variations in the inertia effect and for correlations among RP and SP observations. Finally we explore the relation between the utility specification (especially in the SP dataset) and the role of inertia in explaining current choices....

  7. EOP Gold Coral (Gerardia sp.) Growth Measurements (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Gold coral (Gerardia sp.) trees that were inspected years earlier on Pisces submersible dives were revisited and their change in size measured. The fishery for...

  8. Domestic wastewater treatment and biofuel production by using microalga Scenedesmus sp. ZTY1. (United States)

    Zhang, Tian-Yuan; Wu, Yin-Hu; Hu, Hong-Ying


    Cultivation of microalgae for biomass production is a promising way to dispose of wastewater and recover nutrients simultaneously. The properties of nutrient removal and biomass production in domestic wastewater of a newly isolated microalga Scenedesmus sp. ZTY1 were investigated in this study. Scenedesmus sp. ZTY1, which was isolated from a wastewater treatment plant in Beijing, grew well in both the primary and secondary effluents of a wastewater treatment plant during the 21-day cultivation, with a maximal algal density of 3.6 × 10(6) and 1.9 × 10(6) cells · mL(-1), respectively. The total phosphorus concentrations in both effluents could be efficiently removed by over 97% after the cultivation. A high removal rate (over 90%) of total nitrogen (TN) was also observed. After cultivation in primary effluent for 21 days, the lipid content of Scenedesmus sp. ZTY1 in dry weight had reached about 32.2%. The lipid and triacylglycerol (TAG) production of Scenedesmus sp. ZTY1 was increased significantly with the extension of cultivation time. The TAG production of Scenedesmus sp. ZTY1 increased from 32 mg L(-1) at 21 d to 148 mg L(-1) at 45 d in primary effluent. All the experiments were carried out in non-sterilized domestic wastewater and Scenedesmus sp. ZTY1 showed good adaptability to the domestic wastewater environment.

  9. Effects of the toxic dinoflagellate Karlodinium sp. (cultured at different N/P ratios on micro and mesozooplankton

    Directory of Open Access Journals (Sweden)

    Dolors Vaqué


    Full Text Available An experimental study was carried out to investigate whether two potential predators such as Oxyrrhis marina (phagotrophic dinoflagellate and Acartia margalefi (Copepoda: Calanoida had different responses when feeding on toxic (Karlodinium sp.-strain CSIC1- or non-toxic (Gymnodinium sp1 dinoflagellates with a similar shape and size. Both prey were cultured at different N/P ratios (balanced N/P = 15, and P-limited N/P > 15 to test whether P-limitation conditions could lead to depressed grazing rates or have other effects on the predators. Both predators ingested the non-toxic Gymnodinium sp1, and low or non-ingestion rates were observed when incubated with Karlodinium sp. The dinoflagellate O. marina did not graze at all on Karlodinium sp. at N/P > 15 and very little at NP = 15, as its net growth rates were always negative when feeding on Karlodinium sp. cultured under P-limitation conditions. A. margalefi had lower ingestion rates when feeding on Karlodinium sp. grown at N/P = 15 than when feeding on Gymnodinium sp1, and did not graze on P-limited Karlodinium sp. Nevertheless, feeding on Karlodinium sp. grown under N/P =15 or N/P > 15 did not have any paralyzing or lethal effect on A. margalefi after 24 h. Finally, a direct effect on the viability of A. margalefi eggs was detected when healthy eggs were incubated for 5 days in the presence of Karlodinium sp. grown under N/P =15 or N/P > 15, producing a decrease in viability of 20% and 60% respectively.

  10. Pore-Width-Dependent Preferential Interaction of sp2 Carbon Atoms in Cyclohexene with Graphitic Slit Pores by GCMC Simulation

    Directory of Open Access Journals (Sweden)

    Natsuko Kojima


    Full Text Available The adsorption of cyclohexene with two sp2 and four sp3 carbon atoms in graphitic slit pores was studied by performing grand canonical Monte Carlo simulation. The molecular arrangement of the cyclohexene on the graphitic carbon wall depends on the pore width. The distribution peak of the sp2 carbon is closer to the pore wall than that of the sp3 carbon except for the pore width of 0.7 nm, even though the Lennard-Jones size of the sp2 carbon is larger than that of the sp3 carbon. Thus, the difference in the interactions of the sp2 and sp3 carbon atoms of cyclohexene with the carbon pore walls is clearly observed in this study. The preferential interaction of sp2 carbon gives rise to a slight tilting of the cyclohexene molecule against the graphitic wall. This is suggestive of a π-π interaction between the sp2 carbon in the cyclohexene molecule and graphitic carbon.

  11. Biochemical basis of mercury remediation and bioaccumulation by Enterobacter sp. EMB21. (United States)

    Sinha, Arvind; Kumar, Sumit; Khare, Sunil Kumar


    The aims of this study were to isolate metal bioaccumulating bacterial strains and to study their applications in removal of environmental problematic heavy metals like mercury. Five bacterial strains belonging to genera Enterobacter, Bacillus, and Pseudomonas were isolated from oil-spilled soil. Among these, one of the strains Enterobacter sp. EMB21 showed mercury bioaccumulation inside the cells simultaneous to its bioremediation. The bioaccumulation of remediated mercury was confirmed by transmission electron microscopy and energy dispersive X-ray. The mercury-resistant loci in the Enterobacter sp. EMB21 cells were plasmid-mediated as confirmed by transformation of mercury-sensitive Escherichia coli DH5α by Enterobacter sp. EMB21 plasmid. Effect of different culture parameters viz-a-viz inoculum size, pH, carbon, and nitrogen source revealed that alkaline pH and presence of dextrose and yeast extract favored better remediation. The results indicated the usefulness of Enterobacter sp. EMB21 for the effective remediation of mercury in bioaccumulated form. The Enterobacter sp. EMB21 seems promising for heavy metal remediation wherein the remediated metal can be trapped inside the cells. The process can further be developed for the synthesis of valuable high-end functional alloy, nanoparticles, or metal conjugates from the metal being remediated.

  12. Effect of probiotic microorganisms isolated from Hypostomus plecostomus in Oreochromis sp juveniles

    Directory of Open Access Journals (Sweden)

    Yuri Vela-Gutiérrez


    Full Text Available Objective. The aim of this study was to assess the behavior of red tilapia juveniles (Oreochromis sp. in presence of the possible probiotic microorganisms isolated from the gastrointestinal tract of panche fish (Hypostomus plecostomus. Materials and methods. During the phase of assessment of probiotics, 120 red tilapia (Oreochromis sp juveniles were selected, with average weight of 1.28±0.22 g and average length of 2.99±0.27 cm. Three experimental treatments were formulated taking into account the nourishment needs of red tilapia (Oreochromis sp.. The statistical method employed was a completely random design. Results. The three strains of Lactobacillus genus (Lactobacillus plantarum, Lactobacillus pentosus, Lactobacillus rhamnosus isolated from the digestive tract of H. plecostomus, yielded diverse results in the biometrical variables considered, as well as in the SGR, PER, AE, AC. Conclusions. The best rapports regarding the gain in length were for the treatment with native probiotics, and it is deduced that they were easily settled in the intestines of the fish (Oreochromis sp.. It is also determined that there are significant differences in the results or gain in length for the Control Concentrate feed (CC against Concentrate feed plus Native Probiotic (CNP for red tilapia (Oreochromis sp. in the juvenile stag for a 30 day time span.

  13. Hubungan Kemelimpahan Chlorella sp Dengan Kualitas Lingkungan Perairan Pada Skala Semi Masal di BBBPBAP Jepara

    Directory of Open Access Journals (Sweden)

    Siska Aprilliyanti


      ABSTRACT Chlorella sp is one of the microalgae are often cultivated for various purposes such as pharmaceuticals, cosmetics, or for alternative biodiesel Chlorella sp an agent of bioremediation good, but can live in a polluted environment can also wear a heavy metal as the metal essential for metabolism. The many benefits that will be taken if it can develop Chlorella sp on a mass scale. With the emergence of Chlorella sp author conducted research using Chlorella sp as its object. The purpose of this study was to determine the relationship between the abundance of Chlorella sp with the quality of the water environment in the district of Jepara.Chlorella sp is cultivated outdoors with a light source coming from direct sunlight, aeration for mixing media using a blower that flowed through the hose and faucet aeration to mix media. Aeration used in this study with the aim of Chlorella sp cells can obtain nutrients evenly in cultivation media for their water circulation in the culture vessel (Amini, 2006. From the analysis of data obtained by the coefficient of determination (R2 = 0.995. This illustrates that there is a very strong relationship between the independent variables namely the five parameters of water quality (nitrates, phosphates, temperature, pH and salinity with the dependent variable abundance of Chlorella sp. Furthermore, multiple linear regression equation as follows: Y = -5323.54 -16.80 -60.78 nitrate phosphate + 111.09 + temperature; 997.26 -191.92 pH salinity. From the regression equation shows that the water quality parameters that have a unidirectional relationship (proportional is temperature and pH. While water quality parameters which have an inverse relationship, namely; nitrate, phosphate and salinity. Chlorella sp abundance relationships with water environmental quality semi massive scale strong, the results of the regression analysis obtained Adjusted R2 value of 0.995, meaning that the percentage contribution of variables influence

  14. Thermococcus guaymasensis sp. nov. and Thermococcus aggregans sp. nov., two novel thermophilic archaea isolated from the Guaymas Basin hydrothermal vent site. (United States)

    Canganella, F; Jones, W J; Gambacorta, A; Antranikian, G


    Thermococcus strains TYST and TYT isolated from the Guaymas Basin hydrothermal vent site and previously described were compared by DNA-DNA hybridization analysis with the closest Thermococcus species in terms of physiology and nutritional aspects. On the basis of the new data and taking into consideration the molecular, physiological and morphological traits published previously, it is proposed that strains TYT and TYST should be classified as new species named Thermococcus aggregans sp. nov. and Thermococcus guaymasensis sp. nov., respectively. The type strain of T. aggregans is strain TYT (= DSM 10597T) and the type strain of T. guaymasensis is strain TYST (= DSM 11113T).

  15. Lama Penyimpanan, Karakterisasi Fisiologi, dan Viabilitas Bakteri Endofit Bacillus sp. dalam Formula Tepung

    Directory of Open Access Journals (Sweden)

    Diana putri


    Full Text Available Endophytic bacteria can be formulated to retain its ability as disease control agents. Three of endophytic bacteria which had the capability to suppress infection of Meloidogyne sp, and to enhance pepper growth were gained from the previous study. This research was aimed to evaluate the influence of storage time on the viability of endophytic bacteria, Bacillus sp. AA2, Bacillus sp. MER and MSJ, and to study its physiological charaterization during storage. The formulation evaluated in this study was : formulation 1 (50 g talc, 1 g pepton, 0.5 g CMC, and brown sugar 1.5 g, formulation 2 (50 g talc, 1 g pepton, 0.5 g CMC, and 1.5 g white sugar, formulation 3 (50 g talc, 1 g pepton, 0.5 g CMC, 1 g yeast extract, and 1.5 gwhite sugar and formulation 4 (50 g talc, 1 g pepton, 0.5 g CMC, 1 g yeast extract, 3 mL molasses, 1 gbentonite, 0.75 g calcium carbonate, and 1 g dextrose. The results of the bacterial characterization showed that Bacillus sp AA2 and Bacillus sp MER belongs to Gram positive, produced lipase and protease enzyme, as well as  IAA hormone. N2 fixation is only existed in Bacillussp. AA2 and MSJ isolate. The highest viability was shown on MSJ isolate with 2.5×106 cfu mL-1. in the fourth formulation, whereas Bacillus sp. AA2 and Bacillus sp. MER viability was 1.9×106 cfu mL-1. and 1.2×106 cfu mL-1. , respectively. 

  16. Pigment Production from Immobilized Monascus sp. Utilizing Polymeric Resin Adsorption


    Evans, Patrick J.; Wang, Henry Y.


    Pigment production by the fungus Monascus sp. was studied to determine why Monascus sp. provides more pigment in solid culture than in submerged culture. Adding a sterilized nonionic polymeric adsorbent resin directly to the growing submerged culture did not enhance the pigment production, thus indicating that pigment extraction is probably not a factor. Monascus cells immobilized in hydrogel were studied and exhibited decreased pigment production as a result of immobilization. This result is...

  17. Reliable and reproducible method for rapid identification of Nocardia species by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. (United States)

    Toyokawa, Masahiro; Kimura, Keigo; Nishi, Isao; Sunada, Atsuko; Ueda, Akiko; Sakata, Tomomi; Asari, Seishi


    Recently, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been challenged for the identification of Nocardia species. However, the standard ethanol-formic acid extraction alone is insufficient in allowing the membrane proteins of Nocardia species to be ionized by the matrix. We therefore aimed to establish our new extraction method for the MALDI-TOF MS-based identification of Nocardia species isolates. Our modified extraction procedure is through dissociation in 0.5% Tween-20 followed by bacterial heat-inactivation, mechanical breaking of the cell wall by acid-washed glass beads and protein extraction with formic acid and acetonitrile. As reference methods for species identification, full-length 16S rRNA gene sequencing and some phenotypical tests were used. In a first step, we made our own Nocardia database by analyzing 13 strains (13 different species including N. elegans, N. otitidiscaviarum, N. asiatica, N. abscessus, N. brasiliensis, N. thailandica, N. farcinica, N. nova, N. mikamii, N. cyriacigeorgica, N. asteroids, Nocardiopsis alba, and Micromonospora sp.) and registered to the MALDI BioTyper database. Then we established our database. The analysis of 12 challenge strains using the our database gave a 100% correct identification, including 8 strains identified to the species level and 4 strains to the genus level (N. elegans, N. nova, N. farcinica, Micromonospora sp.) according to the manufacture's log score specifications. In the estimation of reproducibility of our method intended for 4 strains, both within-run and between-run reproducibility were excellent. These data indicates that our method for rapid identification of Nocardia species is with reliability, reproducibility and cost effective.


    Directory of Open Access Journals (Sweden)

    Nur Prihatiningsih


    Full Text Available Bacterial wilt on tomato caused by Ralstonia solanacearum is a crucial disease, because it can reduce yield until 50%. The aims of this research were: 1 to find out biopesticide formula for Bacillus sp.growth, 2 to test Bacillus sp. against R. solanacearum in vitro, 3 to test potassium fertilizer combined with Bacillus sp. for enhancing tomato resistance to the bacterial wilt disease. The research was conducted in 2 steps i.e to test the persistence of Bacillus sp. in biopesticide formula, and to test the best combination of both potassium and the Bacillus sp. biopesticide. The results showed that Bacillus B298 was the best isolate in its persistence on the biopesticide formula of organic growth medium+CaCO3+CMC 1%+mannitol 1%, and in inhibiting R. solanacearum. The best biopesticide formula for the Bacillus sp. persistence was growth organic media+ CaCO3+CMC 1%+mannitol 1%. Bacillus sp. was able to increase tomato resistance to the bacterial wilt disease from the category of susceptible to be tolerant and becoming resistant.

  19. The Zinc Finger Transcription Factor Sp9 Is Required for the Development of Striatopallidal Projection Neurons

    Directory of Open Access Journals (Sweden)

    Qiangqiang Zhang


    Full Text Available Striatal medium-sized spiny neurons (MSNs, composed of striatonigral and striatopallidal neurons, are derived from the lateral ganglionic eminence (LGE. We find that the transcription factor Sp9 is expressed in LGE progenitors that generate nearly all striatal MSNs and that Sp9 expression is maintained in postmitotic striatopallidal MSNs. Sp9-null mice lose most striatopallidal MSNs because of decreased proliferation of striatopallidal MSN progenitors and increased Bax-dependent apoptosis, whereas the development of striatonigral neurons is largely unaffected. ChIP qPCR provides evidence that Ascl1 directly binds the Sp9 promoter. RNA-seq and in situ hybridization reveal that Sp9 promotes expression of Adora2a, P2ry1, Gpr6, and Grik3 in the LGE and striatum. Thus, Sp9 is crucial for the generation, differentiation, and survival of striatopallidal MSNs.

  20. Curcumin and synthetic analogs induce reactive oxygen species and decreases specificity protein (Sp) transcription factors by targeting microRNAs

    International Nuclear Information System (INIS)

    Gandhy, Shruti U; Kim, KyoungHyun; Larsen, Lesley; Rosengren, Rhonda J; Safe, Stephen


    Curcumin inhibits growth of several cancer cell lines, and studies in this laboratory in bladder and pancreatic cancer cells show that curcumin downregulates specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 and pro-oncogenic Sp-regulated genes. In this study, we investigated the anticancer activity of curcumin and several synthetic cyclohexanone and piperidine analogs in colon cancer cells. The effects of curcumin and synthetic analogs on colon cancer cell proliferation and apoptosis were determined using standardized assays. The changes in Sp proteins and Sp-regulated gene products were analysed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a), miR-20a, miR-17-5p and ZBTB10 and ZBTB4 mRNA expression. The IC 50 (half-maximal) values for growth inhibition (24 hr) of colon cancer cells by curcumin and synthetic cyclohexanone and piperidine analogs of curcumin varied from 10 μM for curcumin to 0.7 μM for the most active synthetic piperidine analog RL197, which was used along with curcumin as model agents in this study. Curcumin and RL197 inhibited RKO and SW480 colon cancer cell growth and induced apoptosis, and this was accompanied by downregulation of specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 and Sp-regulated genes including the epidermal growth factor receptor (EGFR), hepatocyte growth factor receptor (c-MET), survivin, bcl-2, cyclin D1 and NFκB (p65 and p50). Curcumin and RL197 also induced reactive oxygen species (ROS), and cotreatment with the antioxidant glutathione significantly attenuated curcumin- and RL197-induced growth inhibition and downregulation of Sp1, Sp3, Sp4 and Sp-regulated genes. The mechanism of curcumin-/RL197-induced repression of Sp transcription factors was ROS-dependent and due to induction of the Sp repressors ZBTB10 and ZBTB4 and downregulation of microRNAs (miR)-27a, miR-20a and miR-17-5p that regulate these repressors. These results identify a new and highly potent

  1. Curcumin and synthetic analogs induce reactive oxygen species and decreases specificity protein (Sp transcription factors by targeting microRNAs

    Directory of Open Access Journals (Sweden)

    Gandhy Shruti U


    Full Text Available Abstract Background Curcumin inhibits growth of several cancer cell lines, and studies in this laboratory in bladder and pancreatic cancer cells show that curcumin downregulates specificity protein (Sp transcription factors Sp1, Sp3 and Sp4 and pro-oncogenic Sp-regulated genes. In this study, we investigated the anticancer activity of curcumin and several synthetic cyclohexanone and piperidine analogs in colon cancer cells. Methods The effects of curcumin and synthetic analogs on colon cancer cell proliferation and apoptosis were determined using standardized assays. The changes in Sp proteins and Sp-regulated gene products were analysed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a, miR-20a, miR-17-5p and ZBTB10 and ZBTB4 mRNA expression. Results The IC50 (half-maximal values for growth inhibition (24 hr of colon cancer cells by curcumin and synthetic cyclohexanone and piperidine analogs of curcumin varied from 10 μM for curcumin to 0.7 μM for the most active synthetic piperidine analog RL197, which was used along with curcumin as model agents in this study. Curcumin and RL197 inhibited RKO and SW480 colon cancer cell growth and induced apoptosis, and this was accompanied by downregulation of specificity protein (Sp transcription factors Sp1, Sp3 and Sp4 and Sp-regulated genes including the epidermal growth factor receptor (EGFR, hepatocyte growth factor receptor (c-MET, survivin, bcl-2, cyclin D1 and NFκB (p65 and p50. Curcumin and RL197 also induced reactive oxygen species (ROS, and cotreatment with the antioxidant glutathione significantly attenuated curcumin- and RL197-induced growth inhibition and downregulation of Sp1, Sp3, Sp4 and Sp-regulated genes. The mechanism of curcumin-/RL197-induced repression of Sp transcription factors was ROS-dependent and due to induction of the Sp repressors ZBTB10 and ZBTB4 and downregulation of microRNAs (miR-27a, miR-20a and miR-17-5p that regulate these repressors

  2. The role of heterotrophic microorganism Galactomyces sp. Z3 in improving pig slurry bioleaching. (United States)

    Zhou, Jun; Zheng, Guanyu; Zhou, Lixiang; Liu, Fenwu; Zheng, Chaocheng; Cui, Chunhong


    The feasibility of removing heavy metals and eliminating pathogens from pig slurry through bioleaching involving the fungus Galactomyces sp. Z3 and two acidophilic thiobacillus (A. ferrooxidans LX5 and A. thiooxidans TS6) was investigated. It was found that the isolated pig slurry dissolved organic matter (DOM) degrader Z3 was identified as Galactomyces sp. Z3, which could grow well at pH 2.5-7 and degrade pig slurry DOM from 1973 to 942 mg/l within 48 h. During the successive multi-batch bioleaching systems, the co-inoculation of pig slurry degrader Galactomyces sp. Z3 and the two Acidithiobacillus species could improve pig slurry bioleaching efficiency compared to the single system without Galactomyces sp. Z3. The removal efficiency of Zn and Cu exceeded 94% and 85%, respectively. In addition, the elimination efficiencies of pathogens, including both total coliform and faecal coliform counts, exceeded 99% after bioleaching treatment. However, the counts of Galactomyces sp. Z3 decreased with the fall of pH and did not restore to the initial level during successive multi-batch bioleaching systems, and it is necessary to re-inoculate Galactomyces sp. Z3 cells into the bioleaching system to maintain its role in degrading pig slurry DOM. Therefore, a bioleaching technique involving both Galactomyces sp. Z3 and Acidithiobacillus species is an efficient method for removing heavy metals and eliminating pathogens from pig slurry.

  3. An algorithm and a Tool for Wavelength Allocation in OMS-SP Ring Architecture

    DEFF Research Database (Denmark)

    Riaz, Muhammad Tahir; Pedersen, Jens Myrup; Madsen, Ole Brun


    OMS-SP ring is one of the well known architectures in Wavelength Division Multiplexing based optical fiber networks. The architecture supports a restorable full mesh in an optical fiber ring using multiple light wavelengths. The paper presents an algorithm to allocate wavelengths in the OMS-SP ri...... architecture. A tool is also introduced which implements the algorithm and assigns wavelengths. The proposed algorithm uses fewer number of wavelengths than the classical allocation method. The algorithm is described and results are presented.......OMS-SP ring is one of the well known architectures in Wavelength Division Multiplexing based optical fiber networks. The architecture supports a restorable full mesh in an optical fiber ring using multiple light wavelengths. The paper presents an algorithm to allocate wavelengths in the OMS-SP ring...

  4. SP-A-enriched surfactant for treatment of rat lung transplants with SP-A deficiency after storage and reperfusion

    NARCIS (Netherlands)

    Erasmus, ME; Hofstede, GJH; Petersen, AH; Batenburg, JJ; Haagsman, HP; Oetomo, SB; Prop, J


    Background. The function of pulmonary surfactant is affected by lung transplantation, contributing to impaired lung transplant function. A decreased amount of surfactant protein-A (SP-A) after reperfusion is believed to contribute to the impaired surfactant function. Surfactant treatment has been

  5. Changes of plasma SS, SP contents in adult patients with primary hypothyroidism

    International Nuclear Information System (INIS)

    Zheng Xianghong; Song Changyi; Lei Yamei; Ning Ning; Chen Wei; Li Runming


    Objective: To investigate the possible mechanism of imparirment of central nervous system function in hypothyroid patients through determination of changes of plasma neuropeptides after thyroid hormone replacement therapy. Methods: Plasma somatostatin (SS) and substance P(SP) contents were measured with RIA in 45 patients with primary hypothyroidism both before and after thyroid hormone replacement therapy as well as in 38 controls. Results: Before treatment, the plasma contents of SP in the patients were significantly lower than those in the controls (P 0.05). However, the plasma contents of SS in the more advanced hypothyroid patients with FT 3 3 , FT 4 levels, the plasma SS, SP increased significantly (vs before treatment P<0.05, P<0.01). Conclusion: The decrease of plasma contents of SS and SP in patients with hypothyroidism might be related to the development of psycho-neurological symptoms in these patients and thyroid hormone replacement therapy was desirable. (authors)

  6. SP-LL-37, human antimicrobial peptide, enhances disease resistance in transgenic rice. (United States)

    Lee, In Hye; Jung, Yu-Jin; Cho, Yong Gu; Nou, Ill Sup; Huq, Md Amdadul; Nogoy, Franz Marielle; Kang, Kwon-Kyoo


    Human LL-37 is a multifunctional antimicrobial peptide of cathelicidin family. It has been shown in recent studies that it can serve as a host's defense against influenza A virus. We now demonstrate in this study how signal peptide LL-37 (SP-LL-37) can be used in rice resistance against bacterial leaf blight and blast. We synthesized LL-37 peptide and subcloned in a recombinant pPZP vector with pGD1 as promoter. SP-LL-37 was introduced into rice plants by Agrobacterium mediated transformation. Stable expression of SP-LL-37 in transgenic rice plants was confirmed by RT-PCR and ELISA analyses. Subcellular localization of SP-LL-37-GFP fusion protein showed evidently in intercellular space. Our data on testing for resistance to bacterial leaf blight and blast revealed that the transgenic lines are highly resistant compared to its wildtype. Our results suggest that LL-37 can be further explored to improve wide-spectrum resistance to biotic stress in rice.

  7. Deformed model Sp(4) model for studying pairing correlations in atomic nuclei

    CERN Document Server

    Georgieva, A I; Sviratcheva, K


    A fermion representation of the compact symplectic sp(4) algebra introduces a theoretical framework for describing pairing correlations in atomic nuclei. The important non-deformed and deformed subalgebras of sp sub ( sub q sub ) (4) and the corresponding reduction chains are explored for the multiple orbit problem. One realization of the u sub ( sub q sub ) (2) subalgebra is associated with the valence isospin, other reductions describe coupling between identical nucleons or proton-neutron pairs. Microscopic non-deformed and deformed Hamiltonians are expressed in terms of the generators of the sp(4) and sp sub q (4) algebras. In both cases eigenvalues of the isospin breaking Hamiltonian are fit to experimental ground state energies. The theory can be used to investigate the origin of the deformation and predict binding energies of nuclei in proton-rich regions. The q-deformation parameter changes the pairing strength and in so doing introduces a non-linear coupling into the collective degree of freedom

  8. Experimental in vitro transmission of Babesia sp. (EU1) by Ixodes ricinus. (United States)

    Bonnet, Sarah; Brisseau, Nadine; Hermouet, Axelle; Jouglin, Maggy; Chauvin, Alain


    Babesia sp. (EU1), first characterized in 2003, has been implicated in human cases of babesiosis in Italy, Austria and Germany. It has been identified in roe deer and in its suspected tick vector, Ixodes ricinus, in several European countries. The aim of the present study was to validate the competence of I. ricinus as a vector of Babesia sp. (EU1) via experimental infections. For this purpose, a parasite strain isolated from roe deer was cloned in sheep erythrocytes. After experimental infections, parasite DNA was successfully amplified by PCR in both eggs and larvae originating from infected I. ricinus females and in the salivary glands of females exposed to Babesia sp. (EU1) as nymphs. We also demonstrate that infected females were able to transmit parasite DNA during a new blood meal. Together with previous epidemiological studies, these results validate I. ricinus as a competent vector for Babesia sp. (EU1).

  9. A General Catalyst for Site-Selective C(sp(3))-H Bond Amination of Activated Secondary over Tertiary Alkyl C(sp(3))-H Bonds. (United States)

    Scamp, Ryan J; Jirak, James G; Dolan, Nicholas S; Guzei, Ilia A; Schomaker, Jennifer M


    The discovery of transition metal complexes capable of promoting general, catalyst-controlled and selective carbon-hydrogen (C-H) bond amination of activated secondary C-H bonds over tertiary alkyl C(sp(3))-H bonds is challenging, as substrate control often dominates when reactive nitrene intermediates are involved. In this letter, we report the design of a new silver complex, [(Py5Me2)AgOTf]2, that displays general and good-to-excellent selectivity for nitrene insertion into propargylic, benzylic, and allylic C-H bonds over tertiary alkyl C(sp(3))-H bonds.

  10. CULTIVO EXPERIMENTAL DEL CLADOCERO Moina sp ALIMENTADO CON Ankistrodesmus sp y Saccharomyces cereviseae

    Directory of Open Access Journals (Sweden)

    Martha Prieto


    Full Text Available Saccharomyces cereviseae. Materiales y métodos. Fueron realizados cultivos experimentales de la cepade cladóceros Moina sp en el laboratorio de Alimento Vivo de la Universidad de Córdoba, bajo condicionescontroladas de temperatura (22oC, pH (7.6, intensidad lumínica (2000 lux y aireación. Se emplearondos dietas de alimento como tratamiento (Ankistrodesmus y Ankistrodesmus mas Saccharomyces cereviseaeen concentración de 40 x 105 cada uno, para determinar su efecto sobre el desempeño de lapoblación. Diariamente se registró la densidad poblacional y celular. Resultados. Se obtuvieron diferenciassignificativas para el efecto de las dietas sobre el crecimiento poblacional de los cladóceros, los individuosalimentados con Ankistrodesmus sp + Saccharomyces cereviseae alcanzaron una densidad de 12.3a±0.30 org/ml-1 presentando mayor tasa instantánea de crecimiento (K 0.36 ± 0.002, el menor tiempode duplicación (td 1.94 ± 0.012 y el mayor rendimiento (r 1,1 ± 0.07ía-1. Conclusión. Loscladóceros por sus características de crecimiento en cultivo, presentan adaptación favorable a lascondiciones de manejo para la producción de biomasas potencialmente útiles como partícula nutritivacon fines acuícolas.

  11. Inhibition of xyloglucanase from an alkalothermophilic Thermomonospora sp. by a peptidic aspartic protease inhibitor from Penicillium sp. VM24. (United States)

    Menon, Vishnu; Rao, Mala


    A bifunctional inhibitor from Penicillium sp VM24 causing inactivation of xyloglucanase from Thermomonospora sp and an aspartic protease from Aspergillus saitoi was identified. Steady state kinetics studies of xyloglucanase and the inhibitor revealed an irreversible, non-competitive, two-step inhibition mechanism with IC(50) and K(i) values of 780 and 500nM respectively. The interaction of o-phthalaldehyde (OPTA)-labeled xyloglucanase with the inhibitor revealed that the inhibitor binds to the active site of the enzyme. Far- and near-UV spectrophotometric analysis suggests that the conformational changes induced in xyloglucanase by the inhibitor may be due to irreversible denaturation of enzyme. The bifunctional inhibitor may have potential as a biocontrol agent for the protection of plants against phytopathogenic fungi. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. New gnat-midge species chironomus degelenus i sp. n. (diptera chironomidae)

    International Nuclear Information System (INIS)

    Sejsebaev, A.T.; Bakhtin, M.M.; Siirin, M.T.


    For the first time the morphology of larvae, pupae, imago and karyotype of Chironomus degelenus I Sp. n. collected from Water-Body D-3-3 of the Degelen Mountain Massif has been described. The larvae have a species-specific structure and color of the head capsule, ventral-mental blades, and mandibula hamuli. The male gnat is characterized for grid structure in IX tergite. The karyotype of C. degelenus I Sp. n. has the following combination of chromosome arms: AB, CD, EF, and G (thummi complex), which is typical for Chironomus species. It was concluded that the origin of the new species of Chironomus degelenus I Sp. N. is related to the long-term genetic processes of Chironomini adaptation to the elevated radiation background level. (author)

  13. SpEnD: Linked Data SPARQL Endpoints Discovery Using Search Engines (United States)

    Yumusak, Semih; Dogdu, Erdogan; Kodaz, Halife; Kamilaris, Andreas; Vandenbussche, Pierre-Yves

    In this study, a novel metacrawling method is proposed for discovering and monitoring linked data sources on the Web. We implemented the method in a prototype system, named SPARQL Endpoints Discovery (SpEnD). SpEnD starts with a "search keyword" discovery process for finding relevant keywords for the linked data domain and specifically SPARQL endpoints. Then, these search keywords are utilized to find linked data sources via popular search engines (Google, Bing, Yahoo, Yandex). By using this method, most of the currently listed SPARQL endpoints in existing endpoint repositories, as well as a significant number of new SPARQL endpoints, have been discovered. Finally, we have developed a new SPARQL endpoint crawler (SpEC) for crawling and link analysis.

  14. Analysis of the Genome and Chromium Metabolism-Related Genes of Serratia sp. S2. (United States)

    Dong, Lanlan; Zhou, Simin; He, Yuan; Jia, Yan; Bai, Qunhua; Deng, Peng; Gao, Jieying; Li, Yingli; Xiao, Hong


    This study is to investigate the genome sequence of Serratia sp. S2. The genomic DNA of Serratia sp. S2 was extracted and the sequencing library was constructed. The sequencing was carried out by Illumina 2000 and complete genomic sequences were obtained. Gene function annotation and bioinformatics analysis were performed by comparing with the known databases. The genome size of Serratia sp. S2 was 5,604,115 bp and the G+C content was 57.61%. There were 5373 protein coding genes, and 3732, 3614, and 3942 genes were respectively annotated into the GO, KEGG, and COG databases. There were 12 genes related to chromium metabolism in the Serratia sp. S2 genome. The whole genome sequence of Serratia sp. S2 is submitted to the GenBank database with gene accession number of LNRP00000000. Our findings may provide theoretical basis for the subsequent development of new biotechnology to repair environmental chromium pollution.

  15. Endophytic colonization and in planta nitrogen fixation by a diazotrophic Serratia sp. in rice. (United States)

    Sandhiya, G S; Sugitha, T C K; Balachandar, D; Kumar, K


    Nitrogen fixing endophytic Serratia sp. was isolated from rice and characterized. Re-colonization ability of Serratia sp. in the rice seedlings as endophyte was studied under laboratory condition. For detecting the re-colonization potential in the rice seedlings, Serratia sp. was marked with reporter genes (egfp and Kmr) using transposon mutagenesis. The conjugants were screened for re-colonization ability and presence of nif genes using PCR. Further, the influence of flavonoids and growth hormones on the endophytic colonization and in planta nitrogen fixation of Serratia was also investigated. The flavonoids, quercetin (3 microg/ml) and diadzein (2 microg/ml) significantly increased the re-colonization ability of the endophytic Serratia, whereas the growth hormones like IAA and NAA (5 microg/ml) reduced the endophytic colonization ability of Serratia sp. Similarly, the in planta nitrogen fixation by Serratia sp. in rice was significantly increased due to flavonoids. The inoculation of endophytic diazotrophs increased the plant biomass and biochemical constituents.

  16. Usefulness of serum KL-6 and SP-D in the diagnosis of radiation pneumonitis

    International Nuclear Information System (INIS)

    Saika, Yoshinori; Doi, Kenji; Misaki, Toshimasa; Tatsumi, Tomoaki; Komori, Tsuyoshi; Narabayashi, Isamu


    The objective of this study was to investigate the usefulness of serum KL-6 and SP-D in the diagnosis of radiation pneumonitis. We measured serum KL-6 and SP-D in patients undergoing radiation therapy of the chest, primarily for lung cancer, in the Department of Radiology, Osaka Medical College and compared the results with the findings on plain chest X-ray films and thoracic computed tomography conducted at the same time. The sensitivity of serum KL-6 and SP-D for diagnosing radiation pneumonitis were 68.2% and 70.0%, respectively, the specificity were 86.6% and 80.0%, and the accuracy were 82.0% and 77.8%. Examination of the relationship between lesion extent and activity and serum KL-6 showed that serum KL-6 values were higher when the lesion extended beyond the irradiation field than when the lesion was confined to within the irradiation field and that the value tended to be lower for old lesions than for active lesions. In patients with radiation pneumonitis in whom serum KL-6 and SP-D could be measured over time, KL-6 tended to increase after the lesion was discovered by imaging, whereas SP-D increased prior to this in many cases. Examination of the comparison between before radiotherapy and just after radiotherapy in the patients with radiation pneumonitis showed that SP-D had a consistent tendency to increase. Both serum KL-6 and SP-D had a satisfactory degree of sensitivity and specificity for diagnosing radiation pneumonitis. Serum KL-6 correlated with the extent and activity of the lesions. The results suggested that serum SP-D may be helpful for the early detection of radiation pneumonitis. (author)

  17. Identification of a serine proteinase homolog (Sp-SPH) involved in immune defense in the mud crab Scylla paramamosain. (United States)

    Zhang, Qiu-xia; Liu, Hai-peng; Chen, Rong-yuan; Shen, Kai-li; Wang, Ke-jian


    Clip domain serine proteinase homologs are involved in many biological processes including immune response. To identify the immune function of a serine proteinase homolog (Sp-SPH), originally isolated from hemocytes of the mud crab, Scylla paramamosain, the Sp-SPH was expressed recombinantly and purified for further studies. It was found that the Sp-SPH protein could bind to a number of bacteria (including Aeromonas hydrophila, Escherichia coli, Staphylococcus aureus, Vibrio fluvialis, Vibrio harveyi and Vibrio parahemolyticus), bacterial cell wall components such as lipopolysaccharide or peptidoglycan (PGN), and β-1, 3-glucan of fungus. But no direct antibacterial activity of Sp-SPH protein was shown by using minimum inhibitory concentration or minimum bactericidal concentration assays. Nevertheless, the Sp-SPH protein was found to significantly enhance the crab hemocyte adhesion activity (paired t-test, Pparahemolyticus which were both recognized by Sp-SPH protein, if pre-incubated with Sp-SPH protein, respectively. Whereas, the crabs died much faster when challenged with Vibrio alginolyiicus, a pathogenic bacterium not recognized by Sp-SPH protein, compared to those of crabs challenged with A. hydrophila or V. parahemolyticus when pre-coated with Sp-SPH protein. Taken together, these data suggested that Sp-SPH molecule might play an important role in immune defense against bacterial infection in the mud crab S. paramamosain.

  18. Watery rot of pseudo-stem (Dickeya sp. management in banana (Musa sp. under greenhouse conditions

    Directory of Open Access Journals (Sweden)

    Joaquín Guillermo Ramírez


    Full Text Available This crop has serious constraints with diseases, including those caused by bacteria, such as Dickeya sp. This research aimed to evaluate the effect of 4 resistance inductors and 3 doses in Chlorine Dioxide in handling watery rot of pseudo-stem (Dickeya sp. in banana. Resistance inducers and their doses were Potassium Phosphite: 1.5 cm 3 .l -1 ; 3-Aminobutanoic Acid: 1.0 g.l -1 ; Methyl Jasmonate: 0.2 g.l -1 ; S-Methyl-Acibenzolar: 0.3 ml.l -1 , all by foliar application, while Chlorine Dioxide was injected into the pseudo-stem, in doses of 10, 20 and 30 mg.l -1 . The evaluated variables were: development of the disease, total biomass and quantification of the bacterium in the inoculated pseudo-stems. Applications of Chlorine Dioxide achieved a reduction of disease by 65.4, 91.99 and 61.5%, in addition to an inhibition of 100% of the pathogen, using 30 and 50 mg.l -1 doses. Meanwhile, the use of resistance inductors reduced up to 60.6% of the disease, but this effect failed to improve plant growth.

  19. Ichthyobodo salmonis sp. n. (Ichthyobodonidae, Kinetoplastida), an euryhaline ectoparasite infecting Atlantic salmon (Salmo salar L.) (United States)



    SUMMARY Phylogenetic analyses of SSU rDNA sequences have previously revealed the existence of 2 Ichthyobodo species able to infect Atlantic salmon (Salmo salar L.). Ichthyobodo necator sensu stricto (s.s.) is assumed to be a freshwater parasite, while a genetically distinct but undescribed species, Ichthyobodo sp. II sensu Todal et al. (2004) have been detected on Atlantic salmon in both fresh- and seawater. In the present study a morphological description of Ichthyobodo sp. II from the gills of salmon reared in fresh-, brackish- and seawater is presented, using both light- and electron microscopy. Comparative morphometry show that Ichthyobodo sp. II from both freshwater and seawater displays a different cell shape, and is significantly smaller than I. necator s.s. Also, ultrastructural characteristics distinguish these two species, notably differences in the attachment region and the presence of spine-like surface projections in Ichthyobodo sp. II. Based on both unique SSU rDNA sequences and morphological characteristics, we conclude that Ichthyobodo sp. II. represents a novel species for which we propose the name Ichthyobodo salmonis sp. n. PMID:21756424

  20. Thawing of lithium in the SP-100 reactor core configuration

    International Nuclear Information System (INIS)

    Magee, P.M.; Malovrh, J.W.; REineking, W.H.


    The General Electric SP-100 Liquid Metal Reactor is designed to be launched with the lithium coolant in the reactor and primary loops frozen. Initial startup of the system in space, after a satisfactory orbit is achieved, will be accomplished by slowly increasing the power in the reactor core and using the heat generated to melt the lithium, first in the reactor, and then progressively down the primary loops. This technique significantly facilitates ground handling, reduces vibrational loads during vehicle launch and minimized the shuttle bay heat load. The challenge is to thaw the coolant and startup the system within an acceptable time without structural damage. The test results clearly demonstrate that thawing of the lithium in the SP-100 reactor core can be done rapidly without structural damage and, thus, support the selected concept of SP-100 launch with frozen lithium and thaw/startup in space

  1. Hepatitis From Spiroplasma sp. in an Immunocompromised Patient. (United States)

    Mueller, N J; Tini, G M; Weber, A; Gaspert, A; Husmann, L; Bloemberg, G; Boehler, A; Benden, C


    A 70-year-old lung transplant recipient patient was admitted with fever, nausea, abdominal pain, peripheral edema and pronounced weakness. An initial work-up for presumed infection revealed cholestatic hepatitis, leukocytosis and thrombocytopenia, but failed to detect a pathogen. An increased glucose uptake exclusively in the liver was demonstrated by positron emission tomography. Liver biopsy showed basophilic inclusions in the cytoplasm of hepatocytes. Broad- range 16S rRNA gene PCR followed by sequence analysis yielded Spiroplasma sp. in two independent blood samples and the liver biopsy, confirming Spiroplasma sp. as the causative agent. Antibiotic treatment with doxycycline and azithromycin led to complete recovery. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  2. Characterization of a novel anti-lipopolysaccharide factor isoform (SpALF5) in mud crab, Scylla paramamosain. (United States)

    Sun, Wanwei; Wan, Weisong; Zhu, Shuo; Wang, Shasha; Wang, Shuqi; Wen, Xiaobo; Zheng, Huaiping; Zhang, Yueling; Li, Shengkang


    Anti-lipopolysaccharide factors (ALFs), the potential antimicrobial peptides that bind and neutralize lipopolysaccharide (LPS), are common effectors of innate immunity in crustaceans. In this study, a novel isoform of ALFs (SpALF5) was isolated from the hemocytes of mud crab Scylla paramamosain. The full-length 975bp SpALF5 contains a 375bp open reading frame (ORF) encoding 125 amino acids. Although SpALF5 exhibits a low degree of nucleotide homology with other reported ALFs, it contains the conserved amino acid sequence with a signal peptide and a LPS-binding domain including two conservative cysteine residues. The genomic organization of SpALF5 consists of four exons and three introns, with each intron containing one or more tandem repeats. Unlike most of ALFs mainly distributed in crab hemocytes, SpALF5 transcript was predominantly observed in the brain, muscle and skin, while barely detected in the hemocytes in our study. In situ hybridization assay also showed that SpALF5 mRNA was localized in brain, muscle and skin tissues of mud crab. Further, SpALF5 transcript was significantly up-regulated after challenge with LPS, polyinosinic polycytidylic acid (PolyI:C) (with the except of that in brain), Vibrio parahemolyticus or white spot syndrome virus (WSSV). The recombinant SpALF5 protein showed a varying degree of binding activity towards bacteria and fungus. Moreover, in vitro, the recombinant SpALF5 revealed a strong antimicrobial activity against Gram-negative bacteria (V. parahemolyticus, Vibrio alginolyticus, Escherichia coli, Aeromonas hydrophila) and fungus (Sacchromyces cerevisiae), but could only inhibited the growth of some Gram-positive bacteria like Staphylococcus aureus. The results suggest that SpALF5 is a potent immune protector and plays an important role in immune defense against invading pathogens in S. paramamosain. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Reclassification of rhizosphere bacteria including strains causing corky root of lettuce and proposal of Rhizorhapis suberifaciens gen. nov., comb. nov., Sphingobium mellinum sp. nov., Sphingobium xanthum sp. nov. and Rhizorhabdus argentea gen. nov., sp. nov. (United States)

    Francis, Isolde M; Jochimsen, Kenneth N; De Vos, Paul; van Bruggen, Ariena H C


    The genus Rhizorhapis gen. nov. (to replace the illegitimate genus name Rhizomonas) is proposed for strains of Gram-negative bacteria causing corky root of lettuce, a widespread and important lettuce disease worldwide. Only one species of the genus Rhizomonas was described, Rhizomonas suberifaciens, which was subsequently reclassified as Sphingomonas suberifaciens based on 16S rRNA gene sequences and the presence of sphingoglycolipid in the cell envelope. However, the genus Sphingomonas is so diverse that further reclassification was deemed necessary. Twenty new Rhizorhapis gen. nov.- and Sphingomonas-like isolates were obtained from lettuce or sow thistle roots, or from soil using lettuce seedlings as bait. These and previously reported isolates were characterized in a polyphasic study including 16S rRNA gene sequencing, DNA-DNA hybridization, DNA G+C content, whole-cell fatty acid composition, morphology, substrate oxidation, temperature and pH sensitivity, and pathogenicity to lettuce. The isolates causing lettuce corky root belonged to the genera Rhizorhapis gen. nov., Sphingobium, Sphingopyxis and Rhizorhabdus gen. nov. More specifically, we propose to reclassify Rhizomonas suberifaciens as Rhizorhapis suberifaciens gen. nov., comb. nov. (type strain, CA1(T) = LMG 17323(T) = ATCC 49355(T)), and also propose the novel species Sphingobium xanthum sp. nov., Sphingobium mellinum sp. nov. and Rhizorhabdus argentea gen. nov., sp. nov. with the type strains NL9(T) ( = LMG 12560(T) = ATCC 51296(T)), WI4(T) ( = LMG 11032(T) = ATCC 51292(T)) and SP1(T) ( = LMG 12581(T) = ATCC 51289(T)), respectively. Several strains isolated from lettuce roots belonged to the genus Sphingomonas, but none of them were pathogenic.

  4. Recommended practice for small punch (SP) testing of metallic materials (draft)

    International Nuclear Information System (INIS)

    Takahashi, Hideaki; Shoji, Tetsuo; Mao, Xinyuan


    This practice covers the determination of fracture toughness characteristics of metallic materials such as ductile to brittle transition temperature (SPDBTT) and elastic-plastic fracture toughness (J ICSP ) using miniature small punch (SP) specimens. Three kinds of specimens with different shape; 10 by 10 by 0.5 mm, 10 by 10 by 0.25 mm and φ3 by 0.25 mm, are selected as the standard SP specimens. Two types of fixture shall be respectively used for the 10 and φ3 specimens. The relationship between load and deflection during buldge tests shall be recorded from low to high temperatures. Following two parameters in relation to fracture toughness are obtained from analyses of load-deflection curves: (1) The SP energy is calculated from the area surrounded with load-deflection curves, which corresponds to the total energy consumed up to the fracture. (2) The equivalent fracture strain (ε-bar qf ) is calculated from the maximum deflection at fracture (δ*). The SPDBTT can be derived from temperature dependence of SP energy, and the J ICSP can be estimated from the rational correlation curve between ε-bar qf and J IC . (author)

  5. Application of Doehlert experimental design in the optimization of experimental variables for the Pseudozyma sp. (CCMB 306 and Pseudozyma sp. (CCMB 300 cell lysis Aplicação do modelo Doehlert na otimização das variáveis experimentais para a lise de Pseudozyma sp. (CCMB 306 e Pseudozyma sp. (CCMB 300

    Directory of Open Access Journals (Sweden)

    Amanda Reges de Sena


    Full Text Available This study aimed to verify the influence of pH and temperature on the lysis of yeast using experimental design. In this study, the enzymatic extract containing β-1,3-glucanase and chitinase, obtained from the micro-organism Moniliophthora perniciosa, was used. The experiment showed that the best conditions for lysis of Pseudozyma sp. (CCMB 306 and Pseudozyma sp. (CCMB 300 by lytic enzyme were pH 4.9 at 37 ºC and pH 3.9 at 26.7 ºC, respectively. The lytic enzyme may be used for obtaining various biotechnology products from yeast.O presente trabalho visou verificar a influência do pH e temperatura na lise de leveduras utilizando planejamento experimental. No estudo, foi utilizado o extrato enzimático, contendo β-1,3-glucanase e quitinase líticas, obtidas do micro-organismo Moniliophthora perniciosa. O delineamento experimental mostrou que as melhores condições para a lise de Pseudozyma sp. (CCMB 306 e Pseudozyma sp. (CCMB 300, pelas enzimas líticas, foram pH 4,9 a 37 ºC, pH 3,9 a 26,7 ºC, respectivamente. As enzimas líticas podem ser utilizadas para a obtenção de vários produtos biotecnológicos a partir de leveduras.

  6. Burkholderia sp. KCTC 11096BP modulates pepper growth and resistance against Phytophthora capsici

    International Nuclear Information System (INIS)

    Kang, S.M.; Hamayun, M.; Shinwari, Z.K.


    Biological control of crop diseases is desirable for sustainable agriculture as it minimizes chemical inputs in the agricultural system and promotes eco-friendly environment. We analyzed the favorable role of Burkholderia sp. KCTC 11096BP against the pathogen Phytophthora capsici in pepper. We screen thirty rhizobateria for their anti-pathogen activity, and found that Burkholderia sp. KCTC 11096BP exhibits maximum growth inhibition of the pathogen P. capsici. The bacterium inoculation to pepper plants significantly enhanced growth attributes of pepper in infected and control treatments. The total proteins (10.9%), and the amino acids viz. glycine (4.08 ug/g), leucine (3.3 ug/g), and alanine (3.26 ug/g) were preset in considerably higher quantities in Burkholderia sp. applied treatments as compare to control. The systemic acquired resistance (SAR) of the host plant was up-regulated by Burkholderia sp. KCTC, as endogenous salicylic acid (235.5 ng/g) and jasmonic acid (22.8 ng/g) levels were found higher in such treatments. It was concluded that Burkholderia sp. KCTC 11096BP mitigates the adverse effects of P. capsici on pepper crop and can improve crop productivity at the field level. (author)

  7. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp. (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn


    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

  8. New Cyst Nematode, Heterodera sojae n. sp. (Nematoda: Heteroderidae) from Soybean in Korea. (United States)

    Kang, Heonil; Eun, Geun; Ha, Jihye; Kim, Yongchul; Park, Namsook; Kim, Donggeun; Choi, Insoo


    A new soybean cyst nematode Heterodera sojae n. sp. was found from the roots of soybean plants in Korea. Cysts of H. sojae n. sp. appeared more round, shining, and darker than that of H. glycines . Morphologically, H. sojae n. sp. differed from H. glycines by fenestra length (23.5-54.2 µm vs. 30-70 µm), vulval silt length (9.0-24.4 µm vs. 43-60 µm), tail length of J2 (54.3-74.8 µm vs. 40-61 µm), and hyaline part of J2 (32.6-46.3 µm vs. 20-30 µm). It is distinguished from H. elachista by larger cyst (513.4-778.3 µm × 343.4-567.1 µm vs. 350-560 µm × 250-450 µm) and longer stylet length of J2 (23.8-25.3 µm vs. 17-19 µm). Molecular analysis of rRNA large subunit (LSU) D2-D3 segments and ITS gene sequence shows that H. sojae n. sp. is more close to rice cyst nematode H. elachista than H. glycines . Heterodera sojae n. sp. was widely distributed in Korea. It was found from soybean fields of all three provinces sampled.

  9. SP-100 from ground demonstration to flight validation

    International Nuclear Information System (INIS)

    Buden, D.


    The SP-100 program is in the midst of developing and demonstrating the technology of a liquid-metal-cooled fast reactor using thermoelectric thermal-to-electric conversion devices for space power applications in the range of tens to hundreds of kilowatts. The current ground engineering system (GES) design and development phase will demonstrate the readiness of the technology building blocks and the system to proceed to flight system validation. This phase includes the demonstration of a 2.4-MW(thermal) reactor in the nuclear assembly test (NAT) and aerospace subsystem in the integrated assembly test (IAT). The next phase in the SP-100 development, now being planned, is to be a flight demonstration of the readiness of the technology to be incorporated into future military and civilian missions. This planning will answer questions concerning the logical progression of the GES to the flight validation experiment. Important issues in planning the orderly transition include answering the need to plan for a second reactor ground test, the method to be used to test the SP-100 for acceptance for flight, the need for the IAT prior to the flight-test configuration design, the efficient use of facilities for GES and the flight experiment, and whether the NAT should be modified based on flight experiment planning


    Directory of Open Access Journals (Sweden)



    Full Text Available This paper presents the quantitative determination of pigments extract of Thymus sp. from in vitro culture and spontaneous flora. For in vitro culture were used phytohormones (indoleacetic acid-IAA, indole-3-butyric acid-IBA and benzylaminopurine-BAP in order to obtain a high yield in development of Thymus sp. plants. The source of spontaneous flora of Thymus sp. was Bacau (Magura, Romania. The biochemical investigations realised on Thymus sp. using Thin Layer Chromatography and the UV-Vis spectrophotometry showed that the production of assimilating pigments is influenced by growth and lighting conditions of plants.

  11. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan


    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  12. Expression of Heterologous Cellulases in Thermotoga sp. Strain RQ2

    Directory of Open Access Journals (Sweden)

    Hui Xu


    Full Text Available The ability of Thermotoga spp. to degrade cellulose is limited due to a lack of exoglucanases. To address this deficiency, cellulase genes Csac_1076 (celA and Csac_1078 (celB from Caldicellulosiruptor saccharolyticus were cloned into T. sp. strain RQ2 for heterologous overexpression. Coding regions of Csac_1076 and Csac_1078 were fused to the signal peptide of TM1840 (amyA and TM0070 (xynB, resulting in three chimeric enzymes, namely, TM1840-Csac_1078, TM0070-Csac_1078, and TM0070-Csac_1076, which were carried by Thermotoga-E. coli shuttle vectors pHX02, pHX04, and pHX07, respectively. All three recombinant enzymes were successfully expressed in E. coli DH5α and T. sp. strain RQ2, rendering the hosts with increased endo- and/or exoglucanase activities. In E. coli, the recombinant enzymes were mainly bound to the bacterial cells, whereas in T. sp. strain RQ2, about half of the enzyme activities were observed in the culture supernatants. However, the cellulase activities were lost in T. sp. strain RQ2 after three consecutive transfers. Nevertheless, this is the first time heterologous genes bigger than 1 kb (up to 5.3 kb in this study have ever been expressed in Thermotoga, demonstrating the feasibility of using engineered Thermotoga spp. for efficient cellulose utilization.

  13. Tilsynsdiamanten i spændingsfeltet mellem soft law og hard law

    DEFF Research Database (Denmark)

    Rasmussen, Niels Skovmand


    Artiklen behandler de retskildemæssige spørgsmål, som Tilsynsdiamanten udstedt af Finanstilsynet giver anledning til. Dette sker på baggrund af forskellige teorier omkring soft law og hard law.......Artiklen behandler de retskildemæssige spørgsmål, som Tilsynsdiamanten udstedt af Finanstilsynet giver anledning til. Dette sker på baggrund af forskellige teorier omkring soft law og hard law....

  14. Growth and Cultivation of the Unusual Generalized Transducing Bacillus Bacteriophage SP-15 (United States)

    Taylor, Martha J.; Goldberg, Ivan D.


    Additional properties of SP-15, a generalized transducing bacteriophage notable for the ability to transfer an unusually large fragment of deoxyribonucleic acid (DNA) to Bacillus subtilis and B. licheniformis, are presented together with improved methods that enhance its utility. Simple means have been found to provide the rigid control over moisture that is necessary for the assay of plaque-forming units (PFU). Reproducible procedures for propagating transducing phage, which depend upon an appropriate mixing of PFU with uninfected bacteria, have replaced less reliable methods that utilized infected spores. Transduction of B. subtilis W-23 increased linearly when MgSO4 in recipient cell-SP-15 mixtures was increased from 0.005 to 0.03 m. Methods have been developed that protect SP-15 from the damaging effects of CsCl and of osmotic shock subsequent to dilution. Evidence that the PFU and transducing particles of lysates decay at the same slow rate during extended storage suggests that the decay is a result of damage to protein rather than to DNA. One-step growth experiments, in which SP-15 was propagated on B. subtilis W-23-Sr/1 mg, indicated a latent period of 100 min, a rise period of 60 min, and a burst size of 25 to 34 PFU per infected cell. These findings suggest explanations for some of the technical difficulties SP-15 has presented. PMID:4999971

  15. Hepatozoon langii n. sp. and Hepatozoon vacuolatus n. sp. (Apicomplexa: Adele-orina: Hepatozoidae) from the crag lizard (Sauria: Cordylidae) Pseudocordylus langi from the North Eastern Drakensberg escarpment, Eastern Free State, South Africa. (United States)

    Van As, Johann; Davies, Angela J; Smit, Nico J


    Two new haemogregarine species, Hepatozoon langii n. sp. and Hepatozoon vacuolatus n. sp., are described from the pe-ripheral blood of the high altitude crag lizard, Pseudocordylus langi, collected between October 2006 and April 2009 from the North Eastern Drakensberg, Eastern Free State. Hepatozoon langii n. sp. has maturing and mature gamonts that appear encapsulated and have narrow, curved tails. Their cytoplasm stains pinkish-purple with Giemsa, while their nuclei are pur-ple stained with stranded chromatin. Mature gamonts measure 19.1 ± 1.0 (15.4-28.1) μm long by 6.2 ± 1.1 (3.5-7.9) μm wide. Hepatozoon vacuolatus n. sp. gamonts are mostly broader at one pole than the other, have bluish-pink cytoplasm characterised by distinctive rounded and oval vacuoles, and demonstrate pink granules with Giemsa staining. Nuclei stain purple and are mainly coarsely granular. Mature gamonts measure 16.5 ± 1.0 (14.7 - 17.6) μm long by 5.9 ± 1.2 (4.0 - 7.7) μm wide. Both species parasitize erythroblasts, as well as erythrocytes and can dehaemoglobinize the cytoplasm of their host cells. Hepatozoon langii n. sp occurred in the absence of H. vacuolatus n. sp., but the latter haemogregarine always formed mixed infections with the former; no stages intermediate between the two haemogregarine types were observed.

  16. Aquatic Fern (Azolla Sp.) Assisted Synthesis of Gold Nanoparticles (United States)

    Jha, Anal K.; Prasad, K.


    Aquatic pteridophyte (Azolla sp.) was taken to assess its potential to synthesize the metal (Au) nanoparticles. The synthesized particles were characterized using X-ray, UV-visible, scanning and transmission electron microscopy analyses. Nanoparticles almost spherical in shape having the sizes of 5-17nm are found. UV-visible study revealed the surface plasmon resonance at 538nm. Responsible phytochemicals for the transformation were principally phenolics, tannins, anthraquinone glycosides and sugars present abundantly in the plant thereby bestowing it adaptive prodigality. Also, the use of Azolla sp. for the synthesis of gold nanoparticles offers the benefit of eco-friendliness.

  17. Acanthamoeba sp.: un caso de queratitis no relacionada con el uso de lentes de contacto Acanthamoeba sp.: a case report in a non-contact lens wearer

    Directory of Open Access Journals (Sweden)

    Claudia Menghi


    Full Text Available La queratitis por Acanthamoeba sp. generalmente se relaciona con el uso de lentes de contacto y en menor proporción se vincula con el contacto con agua contaminada. Se caracteriza por una disminución de la capacidad visual y la presencia de un fuerte dolor ocular. al examen clínico, puede confundirse con una infección herpética. Si la infección no es diagnosticada y tratada a tiempo en forma adecuada, puede culminar en la perforación de la córnea y, eventualmente, en la pérdida del ojo. en este trabajo se informa uno de los pocos casos registrados de queratitis por Acanthamoeba sp. no relacionada con el uso de lentes de contacto.Acanthamoeba sp. keratitis is generally related to wearing contact lenses, and, to a lesser extent, to contaminated water. it is characterized by reduced visual capacity and the presence of severe ocular pain. Clinically, it can be mistaken for a herpes infection. if it is not diagnosed, and timely and adequately treated, it can result in corneal perforation and, eventually, in vision loss. One of the few registered cases of Acanthamoeba sp. keratitis not related to the use of contact lenses is herein reported.

  18. SP. Pescado

    Directory of Open Access Journals (Sweden)

    Renato Gendre


    Full Text Available Nell'occhiello di un articolo dal titolo Il Peru dei de[Jini rosa e de/la grande pioggia si legge: "da una partenza  in aereo al «pescado»  che ti  sfamera."1 Questa parola spagnola, giustamente chiusa tra caporali, a noi pare molto interes­ sante, perche, nonostante l'apparenza, non ha nulla da spartire sotto i1 profilo se­ mantico con l'it. pescato. lnfatti, tutti i piu importanti dizionari della lingua italiana, di ieri e di oggi, etimologici e non 2, registrano  accanto a pescata,  ii lemma pescato, 3 ma lo spiegano come "quantita di pesce catturato nel corso di una battuta o di una stagione di pesca",4 mentre lo sp. pescado  indica i1 "pesce (solo nel senso di: pesGe pescato da mangiare [...]".s

  19. Characterizing Lithospheric Thickness in Australia using Ps and Sp Scattered Waves (United States)

    Ford, H. A.; Fischer, K. M.; Rychert, C. A.


    The purpose of this study is to constrain the morphology of the lithosphere-asthenosphere boundary throughout Australia using scattered waves. Prior surface wave studies have shown a correlation between lithospheric thickness and the three primary geologic provinces of Australia, with the shallowest lithosphere located beneath the Phanerozoic province to the east, and the thicker lithosphere located beneath the Proterozoic and Archean regions. To determine lithospheric thickness, waveform data from twenty permanent broadband stations spanning mainland Australia and the island of Tasmania were analyzed using Ps and Sp migration techniques. Waveform selection for each station was based on epicentral distance (35° to 80° for Ps and 55° to 80° for Sp), and event depth (no greater than 300 km for Sp). For both Ps and Sp a simultaneous deconvolution was performed on the data for each of the twenty stations, and the resulting receiver function for each station was migrated to depth. Data were binned with epicentral distance to differentiate direct discontinuity phases from crustal reverberations (for Ps) and other teleseismic arrivals (for Sp). Early results in both Ps and Sp show a clear Moho discontinuity at most stations in addition to sharp, strong crustal reverberations seen in many of the Ps images. In the eastern Phanerozoic province, a strong negative phase at 100-105 km is evident in Ps for stations CAN and EIDS. The negative phase lies within a depth range that corresponds to the negative velocity gradient between fast lithosphere and slow asthenosphere imaged by surface waves. We therefore think that it is the lithosphere- asthenosphere boundary. On the island of Tasmania, a negative phase at 70-75 km in Ps images at stations TAU and MOO also appears to be the lithosphere-asthenosphere boundary. In the Proterozoic and Archean regions of the Australian continent, initial results for both Ps and Sp migration indicate clear crustal phases, but significantly

  20. SP-100 multimegawatt scaleup to meet electric propulsion mission requirements

    International Nuclear Information System (INIS)

    Newkirk, D.W.; Salamah, S.A.; Stewart, S.L.; Pluta, P.R.


    The SP-100 space power nuclear reactor nuclear heat source technology, utilizing uranium nitride fuel clad in PWC-11 in a fast reactor with lithium coolant circulated by an electromagnetic pump, is shown in this paper to be directly extrapolatable to thermal power levels that meet NASA nuclear electric propulsion requirements using different power conversion techniques. The SP-100 nuclear technology can be applied for missions with NEP requirements as low as 10's of kWe to 10's of MWe

  1. Identification of a Serine Proteinase Homolog (Sp-SPH) Involved in Immune Defense in the Mud Crab Scylla paramamosain (United States)

    Zhang, Qiu-xia; Liu, Hai-peng; Chen, Rong-yuan; Shen, Kai-li; Wang, Ke-jian


    Clip domain serine proteinase homologs are involved in many biological processes including immune response. To identify the immune function of a serine proteinase homolog (Sp-SPH), originally isolated from hemocytes of the mud crab, Scylla paramamosain, the Sp-SPH was expressed recombinantly and purified for further studies. It was found that the Sp-SPH protein could bind to a number of bacteria (including Aeromonas hydrophila, Escherichia coli, Staphylococcus aureus, Vibrio fluvialis, Vibrio harveyi and Vibrio parahemolyticus), bacterial cell wall components such as lipopolysaccharide or peptidoglycan (PGN), and β-1, 3-glucan of fungus. But no direct antibacterial activity of Sp-SPH protein was shown by using minimum inhibitory concentration or minimum bactericidal concentration assays. Nevertheless, the Sp-SPH protein was found to significantly enhance the crab hemocyte adhesion activity (paired t-test, Pparahemolyticus which were both recognized by Sp-SPH protein, if pre-incubated with Sp-SPH protein, respectively. Whereas, the crabs died much faster when challenged with Vibrio alginolyiicus, a pathogenic bacterium not recognized by Sp-SPH protein, compared to those of crabs challenged with A. hydrophila or V. parahemolyticus when pre-coated with Sp-SPH protein. Taken together, these data suggested that Sp-SPH molecule might play an important role in immune defense against bacterial infection in the mud crab S. paramamosain. PMID:23724001

  2. Sphyrna gilberti sp. nov., a new hammerhead shark (Carcharhiniformes, Sphyrnidae) from the western Atlantic Ocean. (United States)

    Quattro, Joseph M; Driggers, William B; Grady, James M; Ulrich, Glenn F; Roberts, Mark A


    Sphyrna gilberti sp. nov. is described based on 54 specimens collected in the coastal waters of South Carolina, U.S.A. Morphologically, S. gilberti sp. nov. is separable from S. lewini (Griffith & Smith 1834) only in the number of precaudal vertebrae. Due to rarity of specimens and the highly migratory behavior of most sphyrnids, the range of S. gilberti sp. nov. is unknown.

  3. Lipid contents of the sponge Haliclona sp.

    Digital Repository Service at National Institute of Oceanography (India)

    Parameswaran, P.S.; Das, B.; Kamat, S.Y.

    Several fatty acids, sterols, batyl alcohol and its analogs and an N-acylated sphingosine (ceramide) have been isolated from the lipid fraction of the extract of the sponge Haliclona sp. The major sterol is found to be cholesterol (54%), followed...

  4. Cultivation of Microalgae Chlorella sp on Fresh Water and Waste Water of Tofu Industry (United States)

    Widayat; Philia, John; Wibisono, Jessica


    Chlorella sp. is a microalgae that potential for food supplement, pharmaceuticals, animal feed, aqua culture and cosmetics. Chlorella sp. commonly growth in sea water. Indonesia as a producer of tofu generated more liquid waste. Nutrient that contained in the tofu wastewater are very useful for the production of microalgae. Cultivation carried out for 7 days at different percent volume of tofu liquid waste showed that the more volume of tofu liquid waste make them longer process decipherment of polymer compounds in the waste, that's make the growth rate of Chlorella sp. are slowness. Variable of10%V has the fastest growth rate. While, 90% v/v variable has the highest concentration of algae. It shows that Chlorella sp. better to grows in tofu wastewater than seawater.

  5. Identification of a serine proteinase homolog (Sp-SPH involved in immune defense in the mud crab Scylla paramamosain.

    Directory of Open Access Journals (Sweden)

    Qiu-xia Zhang

    Full Text Available Clip domain serine proteinase homologs are involved in many biological processes including immune response. To identify the immune function of a serine proteinase homolog (Sp-SPH, originally isolated from hemocytes of the mud crab, Scylla paramamosain, the Sp-SPH was expressed recombinantly and purified for further studies. It was found that the Sp-SPH protein could bind to a number of bacteria (including Aeromonas hydrophila, Escherichia coli, Staphylococcus aureus, Vibrio fluvialis, Vibrio harveyi and Vibrio parahemolyticus, bacterial cell wall components such as lipopolysaccharide or peptidoglycan (PGN, and β-1, 3-glucan of fungus. But no direct antibacterial activity of Sp-SPH protein was shown by using minimum inhibitory concentration or minimum bactericidal concentration assays. Nevertheless, the Sp-SPH protein was found to significantly enhance the crab hemocyte adhesion activity (paired t-test, P<0.05, and increase phenoloxidase activity if triggered by PGN in vitro (paired t-test, P<0.05. Importantly, the Sp-SPH protein was demonstrated to promote the survival rate of the animals after challenge with A. hydrophila or V. parahemolyticus which were both recognized by Sp-SPH protein, if pre-incubated with Sp-SPH protein, respectively. Whereas, the crabs died much faster when challenged with Vibrio alginolyiicus, a pathogenic bacterium not recognized by Sp-SPH protein, compared to those of crabs challenged with A. hydrophila or V. parahemolyticus when pre-coated with Sp-SPH protein. Taken together, these data suggested that Sp-SPH molecule might play an important role in immune defense against bacterial infection in the mud crab S. paramamosain.

  6. Scale brightness of common goldfish on diet supplemented with seaweed Sargassum sp. and pumpkin Cucurbita moschata

    Directory of Open Access Journals (Sweden)

    Irfina Manda Astari


    Full Text Available ABSTRACT The common goldfish Carassius auratus auratus is an ornamental freshwater fish species with  high market value. The market value of ornamental fish can be determined through some parameters, one of them is brightness of the fish scales. Brightness level may be enhanced by supplementing plant powder containing carotenoid into fish diet. The purpose of this research was to examine the scale brightness level of common goldfish fed diet supplemented with Sargassum sp. and pumpkin powder, and to determine the dose of those powders that allows higher brightness level of scale.  The feed of common goldfish was supplemented with either Sargassum sp. or pumpkin powder at the doses of 10, 20 and 30%, and without supplementation as control. Fishes were reared for 75 days and fed diet at feeding rate of 5% biomass daily. The results of ANOVA test showed that the Sargassum sp. and pumpkin mill addition on food significantly improved of scales brightness of  common goldfish. Increasing supplementation levels of Sargassum sp. and pumpkin powder increased brightness level of scale. The highest improvement in brightness was the fish that fed by 30% concentration of Sargassum sp. flour with the value scale of brightness was 2.67 and the total number of 2,890.67 chromatophore cells. The results suggest that Sargassum sp. powder is better to improve the brightness level of common goldfish scale. Keywords: Carassius auratus auratus, Sargassum sp., Cucurbita moschata, carotenoid, brightness  ABSTRAK Ikan komet Carassius auratus auratus merupakan salah satu spesies ikan hias air tawar yang memiliki nilai jual tinggi. Nilai jual ikan hias dapat ditentukan melalui beberapa parameter, salah satunya yaitu kecerahan sisik ikan. Kecerahan sisik ikan dapat ditingkatkan melalui pemberian pakan yang diperkaya karotenoid. Tujuan penelitian ini adalah menguji tingkat kecerahan warna sisik ikan komet setelah diberi pakan dengan tambahan tepung Sargassum sp. dan

  7. The toxicity of brown algae (Sargassum sp extract to mice (Mus muscullus

    Directory of Open Access Journals (Sweden)

    Rahmat Wariz


    Full Text Available Indonesian is a country with very large and overflow marine biological resources. Utilization of seaweed has been developed and become a source of revenue for Indonesian who live in coastal areas with high potential for seaweed.The demand of seaweed in the world increases as increasing in the use of seaweed for various purposeamong others in the fields of industry, food, textile, paper, paints, cosmetics, medical and pharmaceutical field. Alginate is one of materials that commonly used in the field of dentistry as printed materials to create study models. Materials in the field of dentistry must be biocompatible to the oral cavity tissues. The materials should be stable, safe, comfortable, and certainly doesn’t have a toxicity character to the oral cavity tissues and other tissues in human body. The purpose of this study is to know the toxicity of extract brown algaeSargassum sp given orally to mice.The research perform experimental laboratory research type withexperimental post-tes-only control group design. The reseach samples applyfemales white mice (Mus muscullus. Research samples divided into 5 groups of 5 female mices for each treatment group. Treatment group 1 was given 500mg/kgBW doses of Sargassum sp, group 2 was given 1000mg/KgBW doses of Sargassum sp, group 3 was given 1500mg/KgBW doses of Sargassum sp, group 4 were 2000mg/KgBW doses of Sargassum sp, and a control group was given only dose of Na CMC. The result of this study isdose in humans are converted into 2000mg/KgBW in mice, is a doses that doesn’t cause the death of whole animals. Based of acute toxicity category, the extracts of Sargassum sp that obtained from Punaga Takalar Regency, South Sulawesi includes in the mild toxic.

  8. On Embedding N2R Structures in Optical Fiber OMS-SP Ring

    DEFF Research Database (Denmark)

    Riaz, Muhammad Tahir; Pedersen, Jens Myrup; Nielsen, Rasmus Hjorth


    The objective of this paper is to propose methods for embedding N2R structures in optical fiber OMS-SP rings. The OMS-SP ring supports full mesh structure and restoration on the optical level. The N2R structures have been proven to be superior to other degree 3 network structures. Two main mapping...

  9. Heparinoides naturais isolados de rodofíceas (Halymenia sp. arribadas na costa cearense =Natural heparinoids isolated from Halymenia sp. (Rhodophyceaes delivery on the Ceará coast

    Directory of Open Access Journals (Sweden)

    José Ariévilo Gurgel Rodrigues


    Full Text Available A crescente carência de heparina (HEP motiva a busca por fontes alternativas de novos anticoagulantes naturais. Objetivou-se avaliar a atividade anticoagulante dos polissacarídeos sulfatados (PS isolados de uma rodofícea do gênero Halymenia, nativa do litoral cearense, Brasil. Os PS totais foram obtidos por digestões consecutivas com papaína em tampão acetato de sódio 0,1 M (pH 5,0, contendo cisteína 5 mM e EDTA 5 mM, seguidas por cromatografia de troca iônica em coluna de DEAE-celulose. As frações obtidas foram concentradas por liofilização e submetidas à eletroforese em gel de agarose a 0,5%. Os ensaios anticoagulantes foram realizados pelo tempo de tromboplastina parcial ativada (TTPA, usando-se plasma de coelho e uma curva padrão de HEP (100 UI mg-1. As extrações (53,96% mostraram diferenças marcantes durante o fracionamento e no grau de resolução dos PS. A espécie apresentou PS com atividade anticoagulante superior a HEP. O TTPA das frações modificou-se acentuadamente entre as extrações, expressando-se de maneira dose-dependente e sofrendo um acréscimo de 110,40 (1a extração para 143,10 UI mg-1 (3a extração. Os resultados sugerem que a atividadeanticoagulante dos PS isolados de Halymenia sp. foi promovida pela inibição da via intrínseca e/ou comum da cascata de coagulação. As modificações no TTPA possivelmente serão elucidadas pelos mecanismos de ação envolvidos na coagulação e caracterização estrutural desses compostos. Portanto, a rodofícea Halymenia sp. é uma boa fonte de heparinoides e sugerem-se estudos relacionados ao cultivo da espécie, em proteção aos bancos de algas.The increasing demand for heparin (HEP has led to a search for alternative sources of natural anticoagulants. This study aimed to evaluate the anticoagulant activity of sulfated polysaccharides (SP isolated from a Halymenia rhodophyceae genus native to the coast of Ceará, Brazil. Total SP were obtained by consecutive

  10. Biological effects of space flight on SP{sub 1} traits of fenugreek

    Energy Technology Data Exchange (ETDEWEB)

    Rong, Xu; Jing, Yu; Jiang, Xu; Feng, Zhou; Jun, Chen [The Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Beijing Union Medical College, Beijing (China); Yougang, Liu [Tianjin Univ. of Traditional Chinese Medicine, Tianjin (China); Suqin, Sun [Department of Chemistry, Tsinghua Univ., Beijing (China)


    Fenugreek (Trigonella Foenum-graecum L.) seeds introduced from United Arab Emirates (UAE) were carried to the space by the recoverable satellite 'Shi Jian 8'. After space loading, the seeds were planted to be observed and investigated compared to the control group. The results showed that the germination rate declined after space loading compared to the control group. SP{sub 1} plants grew inhibited first, and then vigorously later at the seedling stage. The branch number, pods and plant weight of SP{sub 1} plants' increased. More important, single pod was changed to dual pod. At the same time, the Fourier transform infrared spectroscopy (FT-IR) was used to analyze and appraise the fenugreek SP{sub 1} seeds. The results indicated that the major components and the structures remained intact, in another word, space mutation had no obvious effect on the quality of SP{sub 1} seeds. Based on the results, some variations mutated by space flight could appear at the present generation. These variations were important to gain high yield. (authors)

  11. Effective production of bioenergy from marine Chlorella sp. by high-pressure homogenization

    Directory of Open Access Journals (Sweden)

    Woon Yong Choi


    Full Text Available This study investigated the use of a high-pressure homogenization process for the production of high shear stress on Chlorella sp. cells in order to effectively degrade their cell walls. The high-pressure homogenization process was conducted by using various pressure conditions in the range of 68.94–275.78 MPa with different numbers of repeated cycles. The optimal high-pressure homogenization pretreatment conditions were found to be two cycles at a pressure of 206.84 MPa, which provided an extraction yield of 20.35% (w/w total cellular lipids. In addition, based on the confocal microscopic images of Chlorella sp. cells stained by using nile red, the walls of Chlorella sp. cells were disrupted more effectively using this process when compared with the disruption achieved by conventional lipid-extraction processes. By using the by-product of Chlorella sp., 47.3% ethanol was obtained from Saccharomyces cerevisiae cultures. These results showed that the high-pressure homogenization process efficiently hydrolysed this marine resource for subsequent bioethanol production by using only water.

  12. Improvement in solvent tolerance by exogenous glycerol in Pseudomonas sp. BCNU 106. (United States)

    Choi, H J; Lim, B R; Park, Y J; Joo, W H


    Solvent hypertolerant Pseudomonas sp. BCNU 106 still has some underlying growth limitation in solvents. Therefore, efficient mass cultivation methods are needed to pursue its applications in biotechnology. Pseudomonas sp. BCNU 106 was cultured in a medium supplemented with 0·05 mol l -1 glycerol and cell survival was monitored during its cultivation in the presence of 1% (v/v) toluene. Exogenously supplemented glycerol provided more protection against damage caused by toluene stress and conferred higher solvent tolerance of Pseudomonas sp. BCNU 106 to toluene compared to control Pseudomonas sp. BCNU 106 without the supplementation of glycerol. This low-cost mass cultivation method can be used to efficiently apply solvent-tolerant bacteria in biotransformation and biodegradation. Protection against toluene and improvement in bacterial cell growth by supplementation of glycerol in the presence of toluene are demonstrated in this study. This result can be used to solve growth-related hindrances of solvent-tolerant bacteria and establish their low-cost mass cultivation, thereby broadening their industrial and environmental applications. © 2017 The Society for Applied Microbiology.

  13. Population Dynamic of Dendronephthya sp.-Associated Bacteria in Natural and Artificial Habitats

    Directory of Open Access Journals (Sweden)



    Full Text Available Dendronephthya sp. is a soft coral that has huge distribution starting from Indopacific, Tonga, Solomon Islands to Great Barrier Reef in Australia. However, this soft corals survive only in short period after cultivation in artificial habitat (aquarium. Recent study showed that the soft coral Dendronephtya sp. has an association or symbiotic relationship with several bacteria, commonly known as coral associated bacteria (CAB. In this study, we compared the population dynamic of Dendronephthya sp.-associated bacteria in natural and artificial habitat, resulting different bacterial community profiles using terminal restriction fragment length polymorphism (T-RFLP analysis of bacterial community DNA. There were 15 main classes of bacterial population identified along with uncultured microorganism, uncultured organism, uncultured bacteria and unidentified organism. Members of Actinobacteria, Arthrobacteria, Chlorobia, Caldilineae, -proteobacteria and Proteobacteria were predicted to give contributions in the survival ability of both Dendronephthya sp. The cultivation of soft corals after 2 weeks in artificial habitat increases bacterial population similarity on 2 different samples by 10%. Bacterial population similarity in artificial habitat would increase along with the longer cultivation time of soft corals.

  14. Population Dynamic of Dendronephthya sp.-Associated Bacteria in Natural and Artificial Habitats

    Directory of Open Access Journals (Sweden)



    Full Text Available Dendronephthya sp. is a soft coral that has huge distribution starting from Indopacific, Tonga, Solomon Islands to Great Barrier Reef in Australia. However, this soft corals survive only in short period after cultivation in artificial habitat (aquarium. Recent study showed that the soft coral Dendronephtya sp. has an association or symbiotic relationship with several bacteria, commonly known as coral associated bacteria (CAB. In this study, we compared the population dynamic of Dendronephthya sp.-associated bacteria in natural and artificial habitat, resulting different bacterial community profiles using terminal restriction fragment length polymorphism (T-RFLP analysis of bacterial community DNA. There were 15 main classes of bacterial population identified along with uncultured microorganism, uncultured organism, uncultured bacteria and unidentified organism. Members of Actinobacteria, Arthrobacteria, Chlorobia, Caldilineae, Δ-proteobacteria and Proteobacteria were predicted to give contributions in the survival ability of both Dendronephthya sp. The cultivation of soft corals after 2 weeks in artificial habitat increases bacterial population similarity on 2 different samples by 10%. Bacterial population similarity in artificial habitat would increase along with the longer cultivation time of soft corals.

  15. Frequency-domain optical tomographic image reconstruction algorithm with the simplified spherical harmonics (SP3) light propagation model. (United States)

    Kim, Hyun Keol; Montejo, Ludguier D; Jia, Jingfei; Hielscher, Andreas H


    We introduce here the finite volume formulation of the frequency-domain simplified spherical harmonics model with n -th order absorption coefficients (FD-SP N ) that approximates the frequency-domain equation of radiative transfer (FD-ERT). We then present the FD-SP N based reconstruction algorithm that recovers absorption and scattering coefficients in biological tissue. The FD-SP N model with 3 rd order absorption coefficient (i.e., FD-SP 3 ) is used as a forward model to solve the inverse problem. The FD-SP 3 is discretized with a node-centered finite volume scheme and solved with a restarted generalized minimum residual (GMRES) algorithm. The absorption and scattering coefficients are retrieved using a limited-memory Broyden-Fletcher-Goldfarb-Shanno (L-BFGS) algorithm. Finally, the forward and inverse algorithms are evaluated using numerical phantoms with optical properties and size that mimic small-volume tissue such as finger joints and small animals. The forward results show that the FD-SP 3 model approximates the FD-ERT (S 12 ) solution within relatively high accuracy; the average error in the phase (<3.7%) and the amplitude (<7.1%) of the partial current at the boundary are reported. From the inverse results we find that the absorption and scattering coefficient maps are more accurately reconstructed with the SP 3 model than those with the SP 1 model. Therefore, this work shows that the FD-SP 3 is an efficient model for optical tomographic imaging of small-volume media with non-diffuse properties both in terms of computational time and accuracy as it requires significantly lower CPU time than the FD-ERT (S 12 ) and also it is more accurate than the FD-SP 1 .

  16. Application of pregnancy specific β1 glycoprotein-radioimmunoassay (SP1-ria) in obstetrics and gynecology

    International Nuclear Information System (INIS)

    Zhang Weiyuan


    Serum SP 1 values of 395 patients were determined by radioimmunoassay. It was found that SP 1 was apparently absent from the blood of normal men and nonpregnant women, increased with gestational stage in pregnant women, and was highest in late pregnancy. In high-risk pregnancy, SP 1 was lower than normal pregnamey group (PC0.01) could also be detected in ectopic pregnancy. In patients with benign and malignant hydatidiform mole, and choriocarcinoma, AP 1 level decreased with malignant degree. The authors suggest that measurement of SP 1 levels is a valuable index for monitoring high-risk pregnancy, diagnosing ectopic pregnancy and following-up trophoblastic cell diseases

  17. 40 CFR 180.1120 - Streptomyces sp. strain K61; exemption from the requirement of a tolerance. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Streptomyces sp. strain K61; exemption... FOOD Exemptions From Tolerances § 180.1120 Streptomyces sp. strain K61; exemption from the requirement of a tolerance. The biological pesticide Streptomyces sp. strain K61 is exempted from the requirement...

  18. Origem botânica de cargas de pólen de colmeias de abelhas africanizadas em Piracicaba, SP Botanic origin of pollen beehives’ loads from Africanized honeybees in Piracicaba, SP, Brazil

    Directory of Open Access Journals (Sweden)

    Anna Frida Hatsue Modro


    Full Text Available Este estudo objetivou identificar a origem botânica das cargas de pólen coletadas por abelhas africanizadas. Em Piracicaba (SP, foram instaladas, durante as quatro estações do ano, cinco colmeias de A. mellifera com um coletor de pólen frontal em cada uma. A preparação palinológica foi pelo uso de acetólise, sendo identificados e contados aproximadamente 900 grãos de pólen por amostra. A partir da composição polínica, calculou-se a riqueza, os índices de diversidade e equitabilidade. Ao longo do ano, foram encontrados 81 tipos polínicos, pertencentes a 32 famílias botânicas sendo Fabaceae, Asteraceae e Malvaceae, as famílias com maior frequência de tipos polínicos (≥5 tipos polínicos, e Myrtaceae, a família com dois tipos polínicos (Eucalyptus sp. e Myrcia sp. entre os nove mais frequentes nas amostras (>10%. A maior riqueza de tipos polínicos foi no verão e a maior diversidade e equitabilidade, na primavera. Fabaceae, Asteraceae, Malvaceae e Myrtaceae são as famílias botânicas mais importantes como fontes poliníferas em Piracicaba - SP.This study aimed to identify the botanic origin of pollen loads collected by Africanized honeybees. In Piracicaba (SP, during four seasons of the year, five honeybee colonies were installed with a frontal pollen collector in each one. The palinological preparation was done by the use of acetolysis and identified and counted approximately 900 pollen grains per sample. From the pollinic composition, the richness, diversity indexes and equitability were calculated. Throughout the year, 81 pollinic types were found, belonging to 32 botanic families, being Fabaceae, Asteraceae and Malvaceae the ones with the biggest frequency of pollinic types (≥5 pollinic types and, Myrtaceae, the family with two pollinic types (Eucalyptus sp. and Myrcia sp., among the nine most common types in the samples (> 10%. The biggest richness of pollinic types was during summer, and the biggest diversity and

  19. Plant growth promoting potential of pseudomonas sp. SP0113 isolated from potable water from a closed water well

    Directory of Open Access Journals (Sweden)

    Przemieniecki Wojciech Sebastian


    Full Text Available The Pseudomonas sp. SP0113 strain from a partially closed aquatic environment was identified as a plant growth promoting bacterium (PGPB. Laboratory tests revealed that PS0113 has multiple plant growth promoting traits, including mineral phosphate solubilizing ability, ammonifying ability that increases nitrogen availability for plants via the root system, and phosphatase activity that plays an important role in organic phosphorus mineralization. Tricalcium phosphate (Ca3(PO42 solubilizing ability was described as average (2-3 mm after 7 days of incubation and as high (>3 mm after 14 days of incubation. The analyzed bacterium was an antagonist of major crop pathogenic fungi. A high degree of pathogen growth inhibition was reported with regard to Rhizoctonia solani (38%, whereas the tested strain's ability to inhibit the growth of fungi of the genera Fusarium and Microdochium nivalis was somewhat lower at 20-29%. The bacterium proliferated in Roundup 360 SL solutions with concentrations of 0.1, 1 and 10 mg•ml-1.

  20. Ecologia da polinização da amoreira-preta (Rubus sp (Rosaceae em Timbó-SC, Brasil Pollination ecology of blackberry (Rubus sp. (Rosaceae in Timbo (SC, Brazil

    Directory of Open Access Journals (Sweden)

    Leônidas João de Mello Junior


    Full Text Available O presente trabalho verificou experimentalmente a ecologia da polinização da amoreira-preta (Rubus sp.. Objetivou-se confirmar a síndrome de polinização de Rubus sp., por meio de análise de seu sistema reprodutivo, quantificação da produção diária de néctar, levantamento da entomofauna que visita as flores da amoreira na área de estudo e análise do seu comportamento polinizador. Os experimentos foram realizados em uma área de cultivo de amoreira-preta, no mês de dezembro de 2005, município de Timbó (SC. Constatou-se que a maior taxa de frutificação (48,3 % ± 3,2 ocorreu via polinização livre, onde os insetos não foram excluídos. Foi verificada a ocorrência de autopolinização, porém com taxa inferior de frutificação (12,2% ± 4,9. A anemofilia não foi constatada na espécie. A avaliação da produção de néctar em Rubus sp