WorldWideScience

Sample records for nkx2-3 promoter region

  1. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  2. Homeobox NKX2-3 promotes marginal-zone lymphomagenesis by activating B-cell receptor signalling and shaping lymphocyte dynamics

    Science.gov (United States)

    Robles, Eloy F.; Mena-Varas, Maria; Barrio, Laura; Merino-Cortes, Sara V.; Balogh, Péter; Du, Ming-Qing; Akasaka, Takashi; Parker, Anton; Roa, Sergio; Panizo, Carlos; Martin-Guerrero, Idoia; Siebert, Reiner; Segura, Victor; Agirre, Xabier; Macri-Pellizeri, Laura; Aldaz, Beatriz; Vilas-Zornoza, Amaia; Zhang, Shaowei; Moody, Sarah; Calasanz, Maria Jose; Tousseyn, Thomas; Broccardo, Cyril; Brousset, Pierre; Campos-Sanchez, Elena; Cobaleda, Cesar; Sanchez-Garcia, Isidro; Fernandez-Luna, Jose Luis; Garcia-Muñoz, Ricardo; Pena, Esther; Bellosillo, Beatriz; Salar, Antonio; Baptista, Maria Joao; Hernandez-Rivas, Jesús Maria; Gonzalez, Marcos; Terol, Maria Jose; Climent, Joan; Ferrandez, Antonio; Sagaert, Xavier; Melnick, Ari M.; Prosper, Felipe; Oscier, David G.; Carrasco, Yolanda R.; Dyer, Martin J. S.; Martinez-Climent, Jose A.

    2016-01-01

    NKX2 homeobox family proteins have a role in cancer development. Here we show that NKX2-3 is overexpressed in tumour cells from a subset of patients with marginal-zone lymphomas, but not with other B-cell malignancies. While Nkx2-3-deficient mice exhibit the absence of marginal-zone B cells, transgenic mice with expression of NKX2-3 in B cells show marginal-zone expansion that leads to the development of tumours, faithfully recapitulating the principal clinical and biological features of human marginal-zone lymphomas. NKX2-3 induces B-cell receptor signalling by phosphorylating Lyn/Syk kinases, which in turn activate multiple integrins (LFA-1, VLA-4), adhesion molecules (ICAM-1, MadCAM-1) and the chemokine receptor CXCR4. These molecules enhance migration, polarization and homing of B cells to splenic and extranodal tissues, eventually driving malignant transformation through triggering NF-κB and PI3K-AKT pathways. This study implicates oncogenic NKX2-3 in lymphomagenesis, and provides a valid experimental mouse model for studying the biology and therapy of human marginal-zone B-cell lymphomas. PMID:27297662

  3. Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

    Directory of Open Access Journals (Sweden)

    Dan Wu

    Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

  4. Indian hedgehog signaling triggers Nkx3.2 protein degradation during chondrocyte maturation

    Science.gov (United States)

    Choi, Seung-Won; Jeong, Da-Un; Kim, Jeong-Ah; Lee, Boyoung; Joeng, Kyu Sang; Long, Fanxin; Kim, Dae-Won

    2015-01-01

    The Indian hedgehog (Ihh) pathway plays an essential role in facilitating chondrocyte hypertrophy and bone formation during skeletal development. Nkx3.2 is initially induced in chondrocyte precursor cells, maintained in early-stage chondrocytes, and down-regulated in terminal-stage chondrocytes. Consistent with these expression patterns, Nkx3.2 has been shown to enhance chondrocyte differentiation and cell survival, while inhibiting chondrocyte hypertrophy and apoptosis. Thus, in this work, we investigate whether Nkx3.2, an early stage chondrogenic factor, can be regulated by Ihh, a key regulator for chondrocyte hypertrophy. Here, we show that Ihh signaling can induce proteasomal degradation of Nkx3.2. In addition, we found that Ihh can suppress levels of Lrp (Wnt co-receptor) and Sfrp (Wnt antagonist) expression, which, in turn, may selectively enhance Lrp-independent non-canonical Wnt pathways in chondrocyte. In agreement with these findings, Ihh-induced Nkx3.2 degradation requires Wnt5a, which is capable of triggering Nkx3.2 degradation. Finally, we found that Nkx3.2 protein levels in chondrocytes are remarkably elevated in mice defective in Ihh signaling by deletion of either Ihh or Smoothened. Thus, these results suggest that Ihh/Wnt5a signaling may play a role in negative regulation of Nkx3.2 for appropriate progression of chondrocyte hypertrophy during chondrogenesis. PMID:22507129

  5. Smad4 mediated BMP2 signal is essential for the regulation of GATA4 and Nkx2.5 by affecting the histone H3 acetylation in H9c2 cells

    International Nuclear Information System (INIS)

    Si, Lina; Shi, Jin; Gao, Wenqun; Zheng, Min; Liu, Lingjuan; Zhu, Jing; Tian, Jie

    2014-01-01

    Highlights: • BMP2 can upregulated cardiac related gene GATA4, Nkx2.5, MEF2c and Tbx5. • Inhibition of Smad4 decreased BMP2-induced hyperacetylation of histone H3. • Inhibition of Smad4 diminished BMP2-induced overexpression of GATA4 and Nkx2.5. • Inhibition of Smad4 decreased hyperacetylated H3 in the promoter of GATA4 and Nkx2.5. • Smad4 is essential for BMP2 induced hyperacetylated histone H3. - Abstract: BMP2 signaling pathway plays critical roles during heart development, Smad4 encodes the only common Smad protein in mammals, which is a pivotal nuclear mediator. Our previous studies showed that BMP2 enhanced the expression of cardiac transcription factors in part by increasing histone H3 acetylation. In the present study, we tested the hypothesis that Smad4 mediated BMP2 signaling pathway is essential for the expression of cardiac core transcription factors by affecting the histone H3 acetylation. We successfully constructed a lentivirus-mediated short hairpin RNA interference vector targeting Smad4 (Lv-Smad4) in rat H9c2 embryonic cardiac myocytes (H9c2 cells) and demonstrated that it suppressed the expression of the Smad4 gene. Cultured H9c2 cells were transfected with recombinant adenoviruses expressing human BMP2 (AdBMP2) with or without Lv-Smad4. Quantitative real-time RT-PCR analysis showed that knocking down of Smad4 substantially inhibited both AdBMP2-induced and basal expression levels of cardiac transcription factors GATA4 and Nkx2.5, but not MEF2c and Tbx5. Similarly, chromatin immunoprecipitation (ChIP) analysis showed that knocking down of Smad4 inhibited both AdBMP2-induced and basal histone H3 acetylation levels in the promoter regions of GATA4 and Nkx2.5, but not of Tbx5 and MEF2c. In addition, Lv-Smad4 selectively suppressed AdBMP2-induced expression of HAT p300, but not of HAT GCN5 in H9c2 cells. The data indicated that inhibition of Smad4 diminished both AdBMP2 induced and basal histone acetylation levels in the promoter regions of

  6. Smad4 mediated BMP2 signal is essential for the regulation of GATA4 and Nkx2.5 by affecting the histone H3 acetylation in H9c2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Si, Lina; Shi, Jin; Gao, Wenqun [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Cooperation Center for Child Development and Disorders, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Zheng, Min [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Liu, Lingjuan; Zhu, Jing [Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Cooperation Center for Child Development and Disorders, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Tian, Jie, E-mail: jietian@cqmu.edu.cn [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China)

    2014-07-18

    Highlights: • BMP2 can upregulated cardiac related gene GATA4, Nkx2.5, MEF2c and Tbx5. • Inhibition of Smad4 decreased BMP2-induced hyperacetylation of histone H3. • Inhibition of Smad4 diminished BMP2-induced overexpression of GATA4 and Nkx2.5. • Inhibition of Smad4 decreased hyperacetylated H3 in the promoter of GATA4 and Nkx2.5. • Smad4 is essential for BMP2 induced hyperacetylated histone H3. - Abstract: BMP2 signaling pathway plays critical roles during heart development, Smad4 encodes the only common Smad protein in mammals, which is a pivotal nuclear mediator. Our previous studies showed that BMP2 enhanced the expression of cardiac transcription factors in part by increasing histone H3 acetylation. In the present study, we tested the hypothesis that Smad4 mediated BMP2 signaling pathway is essential for the expression of cardiac core transcription factors by affecting the histone H3 acetylation. We successfully constructed a lentivirus-mediated short hairpin RNA interference vector targeting Smad4 (Lv-Smad4) in rat H9c2 embryonic cardiac myocytes (H9c2 cells) and demonstrated that it suppressed the expression of the Smad4 gene. Cultured H9c2 cells were transfected with recombinant adenoviruses expressing human BMP2 (AdBMP2) with or without Lv-Smad4. Quantitative real-time RT-PCR analysis showed that knocking down of Smad4 substantially inhibited both AdBMP2-induced and basal expression levels of cardiac transcription factors GATA4 and Nkx2.5, but not MEF2c and Tbx5. Similarly, chromatin immunoprecipitation (ChIP) analysis showed that knocking down of Smad4 inhibited both AdBMP2-induced and basal histone H3 acetylation levels in the promoter regions of GATA4 and Nkx2.5, but not of Tbx5 and MEF2c. In addition, Lv-Smad4 selectively suppressed AdBMP2-induced expression of HAT p300, but not of HAT GCN5 in H9c2 cells. The data indicated that inhibition of Smad4 diminished both AdBMP2 induced and basal histone acetylation levels in the promoter regions of

  7. Aberrant activity of NKL homeobox gene NKX3-2 in a T-ALL subset

    Science.gov (United States)

    Meyer, Corinna; Kaufmann, Maren; Zaborski, Margarete; MacLeod, Roderick A. F.; Drexler, Hans G.

    2018-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) is a hematopoietic malignancy originating from T-cell progenitors in which differentiation is blocked at early stages. Physiological expression of specific NKL homeobox genes obeys a hematopoietic NKL-code implicated in the process of lymphopoiesis while in differentiated T-cells these genes are silenced. We propose that this developmental expression pattern underlies the observation that NKL homeobox genes are the most ubiquitous group of transcription factors deregulated in T-ALL, including TLX1, TLX3, NKX2-5 and NKX3-1. Here, we describe a novel member of the NKL homeobox gene subclass, NKX3-2 (BAPX1), which is aberrantly activated in 18% of pediatric T-ALL patients analyzed while being normally expressed in developing spleen. Identification of NKX3-2 expression in T-ALL cell line CCRF-CEM qualified these cells to model its deregulation and function in a leukemic context. Genomic and chromosomal analyses demonstrated normal configuration of the NKX3-2 locus at chromosome 4p15, thus excluding cytogenetic dysregulation. Comparative expression profiling analysis of NKX3-2 patient data revealed deregulated activity of BMP- and MAPK-signalling. These candidate pathways were experimentally confirmed to mediate aberrant NKX3-2 expression. We also show that homeobox gene SIX6, plus MIR17HG and GATA3 are downstream targets of NKX3-2 and plausibly contribute to the pathogenesis of this malignancy by suppressing T-cell differentiation. Finally, NKL homeobox gene NKX2-5 was activated by NKX3-2 in CCRF-CEM and by FOXG1 in PEER, representing mutually inhibitory activators of this translocated oncogene. Together, our findings reveal a novel oncogenic NKL homeobox gene subclass member which is aberrantly expressed in a large subset of T-ALL patients and participates in a deregulated gene network likely to arise in developing spleen. PMID:29746601

  8. HOXB5 cooperates with NKX2-1 in the transcription of human RET.

    Directory of Open Access Journals (Sweden)

    Jiang Zhu

    Full Text Available The enteric nervous system (ENS regulates peristaltic movement of the gut, and abnormal ENS causes Hirschsprung's disease (HSCR in newborns. HSCR is a congenital complex genetic disorder characterised by a lack of enteric ganglia along a variable length of the intestine. The receptor tyrosine kinase gene (RET is the major HSCR gene and its expression is crucial for ENS development. We have previously reported that (i HOXB5 transcription factor mediates RET expression, and (ii mouse with defective HOXB5 activity develop HSCR phenotype. In this study, we (i elucidate the underlying mechanisms that HOXB5 mediate RET expression, and (ii examine the interactions between HOXB5 and other transcription factors implicated in RET expression. We show that human HOXB5 binds to the promoter region 5' upstream of the binding site of NKX2-1 and regulates RET expression. HOXB5 and NKX2-1 form a protein complex and mediate RET expression in a synergistic manner. HSCR associated SNPs at the NKX2-1 binding site (-5G>A rs10900296; -1A>C rs10900297, which reduce NKX2-1 binding, abolish the synergistic trans-activation of RET by HOXB5 and NKX2-1. In contrast to the synergistic activation of RET with NKX2-1, HOXB5 cooperates in an additive manner with SOX10, PAX3 and PHOX2B in trans-activation of RET promoter. Taken together, our data suggests that HOXB5 in coordination with other transcription factors mediates RET expression. Therefore, defects in cis- or trans-regulation of RET by HOXB5 could lead to reduction of RET expression and contribute to the manifestation of the HSCR phenotype.

  9. Cartilage-Specific and Cre-Dependent Nkx3.2 Overexpression In Vivo Causes Skeletal Dwarfism by Delaying Cartilage Hypertrophy.

    Science.gov (United States)

    Jeong, Da-Un; Choi, Je-Yong; Kim, Dae-Won

    2017-01-01

    Nkx3.2, the vertebrate homologue of Drosophila bagpipe, has been implicated as playing a role in chondrogenic differentiation. In brief, Nkx3.2 is initially expressed in chondrocyte precursor cells and later during cartilage maturation, its expression is diminished in hypertrophic chondrocytes. In addition to Nkx3.2 expression analyses, previous studies using ex vivo chick embryo cultures and in vitro cell cultures have suggested that Nkx3.2 can suppress chondrocyte hypertrophy. However, it has never been demonstrated that Nkx3.2 functions in regulating chondrocyte hypertrophy during cartilage development in vivo. Here, we show that cartilage-specific and Cre-dependent Nkx3.2 overexpression in mice results in significant postnatal dwarfism in endochondral skeletons, while intramembranous bones remain unaltered. Further, we observed significant delays in cartilage hypertrophy in conditional transgenic ciTg-Nkx3.2 mice. Together, these findings confirm that Nkx3.2 is capable of controlling hypertrophic maturation of cartilage in vivo, and this regulation plays a significant role in endochondral ossification and longitudinal bone growth. J. Cell. Physiol. 232: 78-90, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Ontogenetic distribution of the transcription factor Nkx2.2 in the developing forebrain of Xenopus laevis

    Directory of Open Access Journals (Sweden)

    Laura eDominguez

    2011-03-01

    Full Text Available The expression of the Nkx2.2 gene is involved in the organization of the alar-basal boundary in the forebrain of vertebrates. Its expression in different diencephalic and telencephalic regions, helped to define distinct progenitor domains in mouse and chick. Here we investigated the pattern of Nkx2.2 protein distribution throughout the development of the forebrain of the anuran amphibian, Xenopus laevis. We used immunohistochemical and in situ hybridization techniques for its detection in combination with other essential territorial markers in the forebrain. No expression was observed in the telencephalon. In the alar hypothalamus, Nkx2.2 positive cells were scattered in the suprachiasmatic territory, but also in the supraoptoparaventricular area, as defined by the expression of the transcription factor Otp and the lack of xDll4. In the basal hypothalamus Nkx2.2 expressing cells were localized in the tuberal region, with the exception of the arcuate nucleus, rich in Otp expressing cells. In the diencephalon it was expressed in all three prosomeres (P1-P3 and not in the zona limitans intrathalamica. The presence of Nkx2.2 expressing cells in P3 was restricted to the alar portion, as well as in prosomere P2, whereas in P1 the Nkx2.2 expressing cells were located in the basal plate and identified the alar/basal boundary. These results showed that Nkx2.2 and Sonic hedgehog are expressed in parallel adjacent stripes along the anterior-posterior axis. The results of this study showed a conserved distribution pattern of Nkx2.2 among vertebrates, crucial to recognize subdivisions that are otherwise indistinct, and supported the relevance of this transcription factor in the organization of the forebrain, particularly in the delineation of the alar/basal boundary of the forebrain.

  11. Nkx2.5 enhances the efficacy of mesenchymal stem cells transplantation in treatment heart failure in rats.

    Science.gov (United States)

    Deng, Bo; Wang, Jin Xin; Hu, Xing Xing; Duan, Peng; Wang, Lin; Li, Yang; Zhu, Qing Lei

    2017-08-01

    The aim of this study is to determine whether Nkx2.5 transfection of transplanted bone marrow mesenchymal stem cells (MSCs) improves the efficacy of treatment of adriamycin-induced heart failure in a rat model. Nkx2.5 was transfected in MSCs by lentiviral vector transduction. The expressions of Nkx2.5 and cardiac specific genes in MSCs and Nkx2.5 transfected mesenchymal stem cells (MSCs-Nkx2.5) were analyzed with quantitative real-time PCR and Western blot in vitro. Heart failure models of rats were induced by adriamycin and were then randomly divided into 3 groups: injected saline, MSCs or MSCs-Nkx2.5 via the femoral vein respectively. Four weeks after injection, the cardiac function, expressions of cardiac specific gene, fibrosis formation and collagen volume fraction in the myocardium as well as the expressions of GATA4 and MEF2 in rats were analyzed with echocardiography, immunohistochemistry, Masson staining, quantitative real-time PCR and Western blot, respectively. Nkx2.5 enhanced cardiac specific gene expressions including α-MHC, TNI, CKMB, connexin-43 in MSCs-Nkx2.5 in vitro. Both MSCs and MSCs-Nkx2.5 improved cardiac function, promoted the differentiation of transplanted MSCs into cardiomyocyte-like cells, decreased fibrosis formation and collagen volume fraction in the myocardium, as well as increased the expressions of GATA4 and MEF2 in adriamycin-induced rat heart failure models. Moreover, the effect was much more remarkable in MSCs-Nkx2.5 than in MSCs group. This study has found that Nkx2.5 enhances the efficacy of MSCs transplantation in treatment adriamycin-induced heart failure in rats. Nkx2.5 transfected to transplanted MSCs provides a potential effective approach to heart failure. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Nkx2.1-derived astrocytes and neurons together with Slit2 are indispensable for anterior commissure formation

    KAUST Repository

    Minocha, Shilpi

    2015-04-23

    Guidepost cells present at and surrounding the midline provide guidance cues that orient the growing axons through commissures. Here we show that the transcription factor Nkx2.1 known to control the specification of GABAergic interneurons also regulates the differentiation of astroglia and polydendrocytes within the mouse anterior commissure (AC). Nkx2.1-positive glia were found to originate from three germinal regions of the ventral telencephalon. Nkx2.1-derived glia were observed in and around the AC region by E14.5. Thereafter, a selective cell ablation strategy showed a synergistic role of Nkx2.1-derived cells, both GABAergic interneurons and astroglia, towards the proper formation of the AC. Finally, our results reveal that the Nkx2.1-regulated cells mediate AC axon guidance through the expression of the repellent cue, Slit2. These results bring forth interesting insights about the spatial and temporal origin of midline telencephalic glia, and highlight the importance of neurons and astroglia towards the formation of midline commissures.

  13. Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

    Science.gov (United States)

    Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

    2016-01-01

    Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

  14. Nuclear import of Nkx2-2 is mediated by multiple pathways

    International Nuclear Information System (INIS)

    Lin, Wenbo; Xu, PengPeng; Guo, YingYing; Jia, Qingjie; Tao, Tao

    2017-01-01

    Nkx2-2 homeoprotein is essential for the development of the central nervous system and pancreas. Although the nuclear localization signals of Nkx2-2 have been identified, the responsible transport receptor is still unknown. Here, we demonstrate that imp α1 not only interacts with Nkx2-2 but also transports it into the nucleus in vitro by acting together with imp β1. However, the nuclear import of Nkx2-2 in cells was not inhibited in response to knockdown expression of endogenous imp β1 or over-expression of Bimax2. Furthermore, imp β1 and imp 13, but not imp 4, directly interact with Nkx2-2 and are capable of transporting Nkx2-2 in an in vitro import assay. By GST pull-down assay, we demonstrate that mutation of NLS1 or NLS2 has no effect on interaction with imp α1 or imp 13, but significantly reduced binding to imp β1. Thus, the nuclear import of Nkx2-2 is mediated not only by the classical import pathway but also directly by imp β1 or imp 13.

  15. Nkx2.1-derived astrocytes and neurons together with Slit2 are indispensable for anterior commissure formation

    KAUST Repository

    Minocha, Shilpi; Valloton, Delphine; Ypsilanti, Athena R.; Fiumelli, Hubert; Allen, Elizabeth A.; Yanagawa, Yuchio; Marin, Oscar; Ché dotal, Alain; Hornung, Jean-Pierre; Lebrand, Cé cile

    2015-01-01

    the AC region by E14.5. Thereafter, a selective cell ablation strategy showed a synergistic role of Nkx2.1-derived cells, both GABAergic interneurons and astroglia, towards the proper formation of the AC. Finally, our results reveal that the Nkx2

  16. Ectopic Expression of Homeobox Gene NKX2-1 in Diffuse Large B-Cell Lymphoma Is Mediated by Aberrant Chromatin Modifications

    Science.gov (United States)

    Nagel, Stefan; Ehrentraut, Stefan; Tomasch, Jürgen; Quentmeier, Hilmar; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G.; MacLeod, Roderick A. F.

    2013-01-01

    Homeobox genes encode transcription factors ubiquitously involved in basic developmental processes, deregulation of which promotes cell transformation in multiple cancers including hematopoietic malignancies. In particular, NKL-family homeobox genes TLX1, TLX3 and NKX2-5 are ectopically activated by chromosomal rearrangements in T-cell neoplasias. Here, using transcriptional microarray profiling and RQ-PCR we identified ectopic expression of NKL-family member NKX2-1, in a diffuse large B-cell lymphoma (DLBCL) cell line SU-DHL-5. Moreover, in silico analysis demonstrated NKX2-1 overexpression in 5% of examined DLBCL patient samples. NKX2-1 is physiologically expressed in lung and thyroid tissues where it regulates differentiation. Chromosomal and genomic analyses excluded rearrangements at the NKX2-1 locus in SU-DHL-5, implying alternative activation. Comparative expression profiling implicated several candidate genes in NKX2-1 regulation, variously encoding transcription factors, chromatin modifiers and signaling components. Accordingly, siRNA-mediated knockdown and overexpression studies confirmed involvement of transcription factor HEY1, histone methyltransferase MLL and ubiquitinated histone H2B in NKX2-1 deregulation. Chromosomal aberrations targeting MLL at 11q23 and the histone gene cluster HIST1 at 6p22 which we observed in SU-DHL-5 may, therefore, represent fundamental mutations mediating an aberrant chromatin structure at NKX2-1. Taken together, we identified ectopic expression of NKX2-1 in DLBCL cells, representing the central player in an oncogenic regulative network compromising B-cell differentiation. Thus, our data extend the paradigm of NKL homeobox gene deregulation in lymphoid malignancies. PMID:23637834

  17. Transcriptional activation of prostate specific homeobox gene NKX3-1 in subsets of T-cell lymphoblastic leukemia (T-ALL.

    Directory of Open Access Journals (Sweden)

    Stefan Nagel

    Full Text Available Homeobox genes encode transcription factors impacting key developmental processes including embryogenesis, organogenesis, and cell differentiation. Reflecting their tight transcriptional control, homeobox genes are often embedded in large non-coding, cis-regulatory regions, containing tissue specific elements. In T-cell acute lymphoblastic leukemia (T-ALL homeobox genes are frequently deregulated by chromosomal aberrations, notably translocations adding T-cell specific activatory elements. NKX3-1 is a prostate specific homeobox gene activated in T-ALL patients expressing oncogenic TAL1 or displaying immature T-cell characteristics. After investigating regulation of NKX3-1 in primary cells and cell lines, we report its ectopic expression in T-ALL cells independent of chromosomal rearrangements. Using siRNAs and expression profiling, we exploited NKX3-1 positive T-ALL cell lines as tools to investigate aberrant activatory mechanisms. Our data confirmed NKX3-1 activation by TAL1/GATA3/LMO and identified LYL1 as an alternative activator in immature T-ALL cells devoid of GATA3. Moreover, we showed that NKX3-1 is directly activated by early T-cell homeodomain factor MSX2. These activators were regulated by MLL and/or by IL7-, BMP4- and IGF2-signalling. Finally, we demonstrated homeobox gene SIX6 as a direct leukemic target of NKX3-1 in T-ALL. In conclusion, we identified three major mechanisms of NKX3-1 regulation in T-ALL cell lines which are represented by activators TAL1, LYL1 and MSX2, corresponding to particular T-ALL subtypes described in patients. These results may contribute to the understanding of leukemic transcriptional networks underlying disturbed T-cell differentiation in T-ALL.

  18. The transcription factors Nkx2.2 and Nkx2.9 play a novel role in floor plate development and commissural axon guidance

    DEFF Research Database (Denmark)

    Holz, Andreas; Kollmus, Heike; Ryge, Jesper

    2010-01-01

    -mutant mice exhibit abnormal locomotion, including a permanent or intermittent hopping gait. Drug-induced locomotor-like activity in spinal cords of mutant neonates is also affected, demonstrating increased variability of left-right and flexor-extensor coordination. Our data argue that the Nkx2.2 and Nkx2...

  19. EWS/FLI mediates transcriptional repression via NKX2.2 during oncogenic transformation in Ewing's sarcoma.

    Directory of Open Access Journals (Sweden)

    Leah A Owen

    2008-04-01

    Full Text Available EWS/FLI is a master regulator of Ewing's sarcoma formation. Gene expression studies in A673 Ewing's sarcoma cells have demonstrated that EWS/FLI downregulates more genes than it upregulates, suggesting that EWS/FLI, and/or its targets, function as transcriptional repressors. One critical EWS/FLI target, NKX2.2, is a transcription factor that contains both transcriptional activation and transcriptional repression domains, raising the possibility that it mediates portions of the EWS/FLI transcriptional signature. We now report that microarray analysis demonstrated that the transcriptional profile of NKX2.2 consists solely of downregulated genes, and overlaps with the EWS/FLI downregulated signature, suggesting that NKX2.2 mediates oncogenic transformation via transcriptional repression. Structure-function analysis revealed that the DNA binding and repressor domains in NKX2.2 are required for oncogenesis in Ewing's sarcoma cells, while the transcriptional activation domain is completely dispensable. Furthermore, blockade of TLE or HDAC function, two protein families thought to mediate the repressive function of NKX2.2, inhibited the transformed phenotype and reversed the NKX2.2 transcriptional profile in Ewing's sarcoma cells. Whole genome localization studies (ChIP-chip revealed that a significant portion of the NKX2.2-repressed gene expression signature was directly mediated by NKX2.2 binding. These data demonstrate that the transcriptional repressive function of NKX2.2 is necessary, and sufficient, for the oncogenic phenotype of Ewing's sarcoma, and suggest a therapeutic approach to this disease.

  20. NKX3.1 Genotype and IGF-1 Interact in Prostate Cancer Risk

    Science.gov (United States)

    2010-05-01

    hi stopathology-confirmed di agnosis of adenocarcinoma of the prostate (International Classification of Diseases, 9th revision, rubric 185...ymorphic l ocus NKX3.1 C154T i s a ttenuated i n IGFBP-3 activation and growth suppression in vitro. NKX3.1 C154T is a genetic determinant that is a...Australia + 6 Centre for Molecular, Environmental, Genetic , and Analytic Epidemiology, The University of Melbourne, Australia 4Children’s

  1. Mutations in the NKX2-5 gene in patients with stroke and patent foramen ovale.

    Science.gov (United States)

    Belvís, Robert; Tizzano, Eduardo F; Martí-Fàbregas, Joan; Leta, Rubén G; Baena, Manel; Carreras, Francesc; Pons-Lladó, Guillem; Baiget, Montserrat; Martí-Vilalta, Josep Lluis

    2009-09-01

    Patent foramen ovale (PFO) has been related to stroke but its existence has not been explained to date. NKX2-5 is the most implicated gene in fetal atrial septation. We studied NKX2-5 with respect to the presence or absence of PFO in stroke patients. A prospective analysis of NKX2-5 regarding age, gender, PFO, right-to-left shunt (RLS) size and atrial septal aneurysm (ASA) was performed in consecutive stroke patients and in 50 controls. The entire coding region and intron-exon boundaries of NKX2-5 gene were analyzed by PCR and sequencing of DNA from peripheral lymphocytes. One hundred patients participated in the study (mean age 56.5+/-12.4 years, 58% males) and PFO was diagnosed in 34% of them by transesophageal echocardiography. RLS was small (12%), moderate (2%) and large (20%). ASA was present in four patients. DNA revealed a novel c.2357G>A change in one PFO patient with cryptogenic stroke. Furthermore, c.182C>T, a mutation previously described in patients with cardiac defects, was detected in two non-PFO women with cryptogenic stroke. None of these changes were detected in our controls. The c.172A>G polymorphism was found in 21% of controls. It appeared more frequently in ASA patients (p=0.084), in cryptogenic PFO stroke patients (p=0.097) and in patients with known causes of stroke (p=0.037). The c.2850C>A polymorphism was also detected in our series with no differences in PFO, RLS size or ASA. Despite the fact that the NKX2-5 could account for the persistence of PFO, mutations of this gene in peripheral blood DNA were barely detected in our study.

  2. NKX2.2, PDX-1 and CDX-2 as potential biomarkers to differentiate well-differentiated neuroendocrine tumors.

    Science.gov (United States)

    Yang, Michelle X; Coates, Ryan F; Ambaye, Abiy; Cortright, Valerie; Mitchell, Jeannette M; Buskey, Alexa M; Zubarik, Richard; Liu, James G; Ades, Steven; Barry, Maura M

    2018-01-01

    Well-differentiated neuroendocrine tumors (NET) most frequently arise from the gastrointestinal tract (GI), pancreas, and lung. Patients often present as metastasis with an unknown primary, and the clinical management and outcome depend on multiple factors, including the accurate diagnosis with the tumor primary site. Determining the site of the NET with unknown primary remains challenging. Many biomarkers have been investigated in primary NETs and metastatic NETs, with heterogeneous sensitivity and specificity observed. We used high-throughput tissue microarray (TMA) and immunohistochemistry (IHC) with antibodies against a panel of transcriptional factors including NKX2.2, PDX-1, PTF1A, and CDX-2 on archived formalin-fixed paraffin-embedded NETs, and investigated the protein expression pattern of these transcription factors in 109 primary GI ( N  = 81), pancreatic ( N  = 17), and lung ( N  = 11) NETs. Differential expression pattern of these markers was observed. In the GI and pancreatic NETs ( N  = 98), NKX2.2, PDX-1, and CDX-2 were immunoreactive in 82 (84%), 14 (14%), and 52 (52%) cases, respectively. PDX-1 was expressed mainly in the small intestinal and appendiceal NETs, occasionally in the pancreatic NETs, and not in the colorectal NETs. All three biomarkers including NKX2.2, PDX-1, and CDX-2 were completely negative in lung NETs. PTF1A was expressed in all normal and neuroendocrine tumor cells. Our findings suggest that NKX2.2 was a sensitive and specific biomarker for the GI and pancreatic neuroendocrine tumors. We proposed that a panel of immunostains including NKX2.2, PDX-1, and CDX-2 may show diagnostic utility for the most common NETs.

  3. 3D Structure Determination of a Human Prostate-Specific Homeoprotein, NKX3.1: The Mechanism of Autoregulation Through its Terminal Domains

    National Research Council Canada - National Science Library

    Tomita, York

    2004-01-01

    NKX3.l, a member of the NK class of homeodomain (HD) proteins, is expressed primarily in the adult prostate and has growth suppression and differentiating effects in prostate epithelial cells. NKX3...

  4. Heterogeneous Pulmonary Phenotypes Associated With Mutations in the Thyroid Transcription Factor Gene NKX2-1

    Science.gov (United States)

    Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.

    2013-01-01

    Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038

  5. Genome-wide association mapping in dogs enables identification of the homeobox gene, NKX2-8, as a genetic component of neural tube defects in humans.

    Directory of Open Access Journals (Sweden)

    Noa Safra

    Full Text Available Neural tube defects (NTDs is a general term for central nervous system malformations secondary to a failure of closure or development of the neural tube. The resulting pathologies may involve the brain, spinal cord and/or vertebral column, in addition to associated structures such as soft tissue or skin. The condition is reported among the more common birth defects in humans, leading to significant infant morbidity and mortality. The etiology remains poorly understood but genetic, nutritional, environmental factors, or a combination of these, are known to play a role in the development of NTDs. The variable conditions associated with NTDs occur naturally in dogs, and have been previously reported in the Weimaraner breed. Taking advantage of the strong linkage-disequilibrium within dog breeds we performed genome-wide association analysis and mapped a genomic region for spinal dysraphism, a presumed NTD, using 4 affected and 96 unaffected Weimaraners. The associated region on canine chromosome 8 (pgenome  =3.0 × 10(-5, after 100,000 permutations, encodes 18 genes, including NKX2-8, a homeobox gene which is expressed in the developing neural tube. Sequencing NKX2-8 in affected Weimaraners revealed a G to AA frameshift mutation within exon 2 of the gene, resulting in a premature stop codon that is predicted to produce a truncated protein. The exons of NKX2-8 were sequenced in human patients with spina bifida and rare variants (rs61755040 and rs10135525 were found to be significantly over-represented (p=0.036. This is the first documentation of a potential role for NKX2-8 in the etiology of NTDs, made possible by investigating the molecular basis of naturally occurring mutations in dogs.

  6. Mutational Analysis of GATA4 and NKX2.5 Genes in Dilated ...

    African Journals Online (AJOL)

    All rights reserved. Available ... Results: Evaluation of the age and sex of the patients indicated that DCM was more prevalent among ... NKX 2.5 are essential for cardiac development, and .... severe left ventricular dysfunction and a lower.

  7. An EG-VEGF-dependent decrease in homeobox gene NKX3.1 contributes to cytotrophoblast dysfunction: a possible mechanism in human fetal growth restriction.

    Science.gov (United States)

    Murthi, P; Brouillet, S; Pratt, A; Borg, Aj; Kalionis, B; Goffin, F; Tsatsaris, V; Munaut, C; Feige, Jj; Benharouga, M; Fournier, T; Alfaidy, N

    2015-07-21

    Idiopathic fetal growth restriction (FGR) is frequently associated with placental insufficiency. Previous reports have provided evidence that EG-VEGF (endocrine gland derived-vascular endothelial growth factor), a placental secreted protein, is expressed during the first trimester of pregnancy, controls both trophoblast proliferation and invasion, and its increased expression is associated with human FGR. In this study, we hypothesise that EG-VEGF-dependent change in placental homeobox gene expressions contribute to trophoblast dysfunction in idiopathic FGR. The changes in EG-VEGF-dependent homeobox gene expressions were determined using a Homeobox gene cDNA array on placental explants of 8-12 weeks' gestation after stimulation with EG-VEGF in vitro for 24 hours. The Homeobox gene array identified a >5-fold increase in HOXA9, HOXC8, HOXC10, HOXD1, HOXD8, HOXD9 and HOXD11, while NKX 3.1 showed a >2 fold-decrease in mRNA expression compared to untreated controls. Homeobox gene NKX3.1 was selected as a candidate because it is a downstream target of EG-VEGF and its expression and functional role are largely unknown in control and idiopathic FGR-affected placentae. Real-time PCR and immunoblotting showed a significant decrease in NKX3.1 mRNA and protein levels, respectively, in placentae from FGR compared to control pregnancies. Gene inactivation in vitro using short-interference RNA specific for NKX3.1 demonstrated an increase in BeWo cell differentiation and a decrease in HTR8-SVneo proliferation. We conclude that the decreased expression of homeobox gene NKX3.1 down-stream of EG-VEGF may contribute to the trophoblast dysfunction associated with idiopathic FGR pregnancies.

  8. Nkx2-5 Mutations in Patients With Nonsyndromic Congenital Heart Disease

    Directory of Open Access Journals (Sweden)

    Fariborz Soheili

    2016-01-01

    Full Text Available Background Congenital heart diseases (CHD are the most common of all birth defects, affecting nearly 0.9% of all live births. Nkx2-5 mutations were reported to cause CHD but data in Kurdish populations of Iran are limited. Objectives In this experimental study, we performed high resolution melt (HRM mutation scanning of Nkx2-5 exons of non-syndrome patients. Patients and Methods Thirty nine patients with atrial septal defect and 57 patients with ventricular septal defect, 4 patients possessing both defects as case groups and 50 healthy controls. Then we grouped samples according to HRM graph and sequenced several samples from each group. Results HRM analysis showed 2 deviated curves for exon 1 and one group for exon 2A and exon 2B. Then, 2 samples of exon 1 that showed different HRM curves, 3 samples of another group from this exon and 5 samples of exon 2A, 2B and healthy controls were randomly sequenced. The results of sequencing confirmed the HRM analysis, and one polymorphism (A65G was identified in 2 atrial septal defects with deviated curves. Conclusions The environmental and effective factors on the heart development within embryonic evolution as well as the possibility of the existence of the mutation in coding genes of the other cardiac transcription factors such as GATA4 and TBX5 can be the reasons for the lack of the pathogenic mutation in this study. It is suggested in further related studies to investigate normal and abnormal cardiac tissue samples of these studied patients and coding genes of the other cardiac transcription factors.

  9. Enrichment of human embryonic stem cell-derived NKX6.1-expressing pancreatic progenitor cells accelerates the maturation of insulin-secreting cells in vivo.

    Science.gov (United States)

    Rezania, Alireza; Bruin, Jennifer E; Xu, Jean; Narayan, Kavitha; Fox, Jessica K; O'Neil, John J; Kieffer, Timothy J

    2013-11-01

    Human embryonic stem cells (hESCs) are considered a potential alternative to cadaveric islets as a source of transplantable cells for treating patients with diabetes. We previously described a differentiation protocol to generate pancreatic progenitor cells from hESCs, composed of mainly pancreatic endoderm (PDX1/NKX6.1-positive), endocrine precursors (NKX2.2/synaptophysin-positive, hormone/NKX6.1-negative), and polyhormonal cells (insulin/glucagon-positive, NKX6.1-negative). However, the relative contributions of NKX6.1-negative versus NKX6.1-positive cell fractions to the maturation of functional β-cells remained unclear. To address this question, we generated two distinct pancreatic progenitor cell populations using modified differentiation protocols. Prior to transplant, both populations contained a high proportion of PDX1-expressing cells (~85%-90%) but were distinguished by their relatively high (~80%) or low (~25%) expression of NKX6.1. NKX6.1-high and NKX6.1-low progenitor populations were transplanted subcutaneously within macroencapsulation devices into diabetic mice. Mice transplanted with NKX6.1-low cells remained hyperglycemic throughout the 5-month post-transplant period whereas diabetes was reversed in NKX6.1-high recipients within 3 months. Fasting human C-peptide levels were similar between groups throughout the study, but only NKX6.1-high grafts displayed robust meal-, glucose- and arginine-responsive insulin secretion as early as 3 months post-transplant. NKX6.1-low recipients displayed elevated fasting glucagon levels. Theracyte devices from both groups contained almost exclusively pancreatic endocrine tissue, but NKX6.1-high grafts contained a greater proportion of insulin-positive and somatostatin-positive cells, whereas NKX6.1-low grafts contained mainly glucagon-expressing cells. Insulin-positive cells in NKX6.1-high, but not NKX6.1-low grafts expressed nuclear MAFA. Collectively, this study demonstrates that a pancreatic endoderm

  10. Reprogramming of enteroendocrine K cells to pancreatic β-cells through the combined expression of Nkx6.1 and Neurogenin3, and reaggregation in suspension culture

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Esder; Ryu, Gyeong Ryul; Moon, Sung-Dae; Ko, Seung-Hyun; Ahn, Yu-Bae; Song, Ki-Ho, E-mail: kihos@catholic.ac.kr

    2014-01-17

    Highlights: •K cells were selected from STC-1 cells, a heterogeneous enteroendocrine cell line. •K cells did not express Nkx6.1 and Neurogenin3. •Combined expression of Nkx6.1 and Neurogenin3 reprogrammed K cells to β-cells. •Reprogramming of K cells to β-cells was not complete. -- Abstract: Recent studies have demonstrated that adult cells such as pancreatic exocrine cells can be converted to pancreatic β-cells in a process called cell reprogramming. Enteroendocrine cells and β-cells share similar pathways of differentiation during embryonic development. Notably, enteroendocrine K cells express many of the key proteins found in β-cells. Thus, K cells could be reprogrammed to β-cells under certain conditions. However, there is no clear evidence on whether these cells convert to β-cells. K cells were selected from STC-1 cells, an enteroendocrine cell line expressing multiple hormones. K cells were found to express many genes of transcription factors crucial for islet development and differentiation except for Nkx6.1 and Neurogenin3. A K cell clone stably expressing Nkx6.1 (Nkx6.1{sup +}-K cells) was established. Induction of Neurogenin3 expression in Nkx6.1{sup +}-K cells, by either treatment with a γ-secretase inhibitor or infection with a recombinant adenovirus expressing Neurogenin3, led to a significant increase in Insulin1 mRNA expression. After infection with the adenovirus expressing Neurogenin3 and reaggregation in suspension culture, about 50% of Nkx6.1{sup +}-K cells expressed insulin as determined by immunostaining. The intracellular insulin content was increased markedly. Electron microscopy revealed the presence of insulin granules. However, glucose-stimulated insulin secretion was defective, and there was no glucose lowering effect after transplantation of these cells in diabetic mice. In conclusion, we demonstrated that K cells could be reprogrammed partially to β-cells through the combined expression of Nkx6.1 and Neurogenin3, and

  11. Reprogramming of enteroendocrine K cells to pancreatic β-cells through the combined expression of Nkx6.1 and Neurogenin3, and reaggregation in suspension culture

    International Nuclear Information System (INIS)

    Lee, Esder; Ryu, Gyeong Ryul; Moon, Sung-Dae; Ko, Seung-Hyun; Ahn, Yu-Bae; Song, Ki-Ho

    2014-01-01

    Highlights: •K cells were selected from STC-1 cells, a heterogeneous enteroendocrine cell line. •K cells did not express Nkx6.1 and Neurogenin3. •Combined expression of Nkx6.1 and Neurogenin3 reprogrammed K cells to β-cells. •Reprogramming of K cells to β-cells was not complete. -- Abstract: Recent studies have demonstrated that adult cells such as pancreatic exocrine cells can be converted to pancreatic β-cells in a process called cell reprogramming. Enteroendocrine cells and β-cells share similar pathways of differentiation during embryonic development. Notably, enteroendocrine K cells express many of the key proteins found in β-cells. Thus, K cells could be reprogrammed to β-cells under certain conditions. However, there is no clear evidence on whether these cells convert to β-cells. K cells were selected from STC-1 cells, an enteroendocrine cell line expressing multiple hormones. K cells were found to express many genes of transcription factors crucial for islet development and differentiation except for Nkx6.1 and Neurogenin3. A K cell clone stably expressing Nkx6.1 (Nkx6.1 + -K cells) was established. Induction of Neurogenin3 expression in Nkx6.1 + -K cells, by either treatment with a γ-secretase inhibitor or infection with a recombinant adenovirus expressing Neurogenin3, led to a significant increase in Insulin1 mRNA expression. After infection with the adenovirus expressing Neurogenin3 and reaggregation in suspension culture, about 50% of Nkx6.1 + -K cells expressed insulin as determined by immunostaining. The intracellular insulin content was increased markedly. Electron microscopy revealed the presence of insulin granules. However, glucose-stimulated insulin secretion was defective, and there was no glucose lowering effect after transplantation of these cells in diabetic mice. In conclusion, we demonstrated that K cells could be reprogrammed partially to β-cells through the combined expression of Nkx6.1 and Neurogenin3, and reaggregation

  12. Regulation of sonic hedgehog-GLI1 downstream target genes PTCH1, Cyclin D2, Plakoglobin, PAX6 and NKX2.2 and their epigenetic status in medulloblastoma and astrocytoma

    International Nuclear Information System (INIS)

    Shahi, Mehdi H; Afzal, Mohammad; Sinha, Subrata; Eberhart, Charles G; Rey, Juan A; Fan, Xing; Castresana, Javier S

    2010-01-01

    The Sonic hedgehog (Shh) signaling pathway is critical for cell growth and differentiation. Impairment of this pathway can result in both birth defects and cancer. Despite its importance in cancer development, the Shh pathway has not been thoroughly investigated in tumorigenesis of brain tumors. In this study, we sought to understand the regulatory roles of GLI1, the immediate downstream activator of the Shh signaling pathway on its downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6 in medulloblastoma and astrocytic tumors. We silenced GLI1 expression in medulloblastoma and astrocytic cell lines by transfection of siRNA against GLI1. Subsequently, we performed RT-PCR and quantitative real time RT-PCR (qRT-PCR) to assay the expression of downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6. We also attempted to correlate the pattern of expression of GLI1 and its regulated genes in 14 cell lines and 41 primary medulloblastoma and astrocytoma tumor samples. We also assessed the methylation status of the Cyclin D2 and PTCH1 promoters in these 14 cell lines and 58 primary tumor samples. Silencing expression of GLI1 resulted up-regulation of all target genes in the medulloblastoma cell line, while only PTCH1 was up-regulated in astrocytoma. We also observed methylation of the cyclin D2 promoter in a significant number of astrocytoma cell lines (63%) and primary astrocytoma tumor samples (32%), but not at all in any medulloblastoma samples. PTCH1 promoter methylation was less frequently observed than Cyclin D2 promoter methylation in astrocytomas, and not at all in medulloblastomas. Our results demonstrate different regulatory mechanisms of Shh-GLI1 signaling. These differences vary according to the downstream target gene affected, the origin of the tissue, as well as epigenetic regulation of some of these genes

  13. Regulation of sonic hedgehog-GLI1 downstream target genes PTCH1, Cyclin D2, Plakoglobin, PAX6 and NKX2.2 and their epigenetic status in medulloblastoma and astrocytoma

    Directory of Open Access Journals (Sweden)

    Eberhart Charles G

    2010-11-01

    Full Text Available Abstract Background The Sonic hedgehog (Shh signaling pathway is critical for cell growth and differentiation. Impairment of this pathway can result in both birth defects and cancer. Despite its importance in cancer development, the Shh pathway has not been thoroughly investigated in tumorigenesis of brain tumors. In this study, we sought to understand the regulatory roles of GLI1, the immediate downstream activator of the Shh signaling pathway on its downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6 in medulloblastoma and astrocytic tumors. Methods We silenced GLI1 expression in medulloblastoma and astrocytic cell lines by transfection of siRNA against GLI1. Subsequently, we performed RT-PCR and quantitative real time RT-PCR (qRT-PCR to assay the expression of downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6. We also attempted to correlate the pattern of expression of GLI1 and its regulated genes in 14 cell lines and 41 primary medulloblastoma and astrocytoma tumor samples. We also assessed the methylation status of the Cyclin D2 and PTCH1 promoters in these 14 cell lines and 58 primary tumor samples. Results Silencing expression of GLI1 resulted up-regulation of all target genes in the medulloblastoma cell line, while only PTCH1 was up-regulated in astrocytoma. We also observed methylation of the cyclin D2 promoter in a significant number of astrocytoma cell lines (63% and primary astrocytoma tumor samples (32%, but not at all in any medulloblastoma samples. PTCH1 promoter methylation was less frequently observed than Cyclin D2 promoter methylation in astrocytomas, and not at all in medulloblastomas. Conclusions Our results demonstrate different regulatory mechanisms of Shh-GLI1 signaling. These differences vary according to the downstream target gene affected, the origin of the tissue, as well as epigenetic regulation of some of these genes.

  14. Essential and Unexpected Role of YY1 to Promote Mesodermal Cardiac Differentiation

    Science.gov (United States)

    Gregoire, Serge; Karra, Ravi; Passer, Derek; Deutsch, Marcus-Andre; Krane, Markus; Feistritzer, Rebecca; Sturzu, Anthony; Domian, Ibrahim; Saga, Yumiko; Wu, Sean M.

    2013-01-01

    Rational Cardiogenesis is regulated by a complex interplay between transcription factors. However, little is known about how these interactions regulate the transition from mesodermal precursors to cardiac progenitor cells (CPCs). Objective To identify novel regulators of mesodermal cardiac lineage commitment. Methods and Results We performed a bioinformatic-based transcription factor binding site analysis on upstream promoter regions of genes that are enriched in embryonic stem cell (ESC)-derived CPCs. From 32 candidate transcription factors screened, we found that YY1, a repressor of sarcomeric gene expression, is present in CPCs in vivo. Interestingly, we uncovered the ability of YY1 to transcriptionally activate Nkx2.5, a key marker of early cardiogenic commitment. YY1 regulates Nkx2.5 expression via a 2.1 kb cardiac-specific enhancer as demonstrated by in vitro luciferase-based assays and in vivo chromatin immunoprecipitation (ChIP) and genome-wide sequencing analysis. Furthermore, the ability of YY1 to activate Nkx2.5 expression depends on its cooperative interaction with Gata4 at a nearby chromatin. Cardiac mesoderm-specific loss-of-function of YY1 resulted in early embryonic lethality. This was corroborated in vitro by ESC-based assays where we show that the overexpression of YY1 enhanced the cardiogenic differentiation of ESCs into CPCs. Conclusion These results demonstrate an essential and unexpected role for YY1 to promote cardiogenesis as a transcriptional activator of Nkx2.5 and other CPC-enriched genes. PMID:23307821

  15. Activation of the Nkx2.5–Calr–p53 signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish

    Directory of Open Access Journals (Sweden)

    Yanyi Sun

    2017-10-01

    Full Text Available Hyperglycemia is an independent risk factor for diabetic cardiomyopathy in humans; however, the underlying mechanisms have not been thoroughly elucidated. Zebrafish (Danio rerio was used in this study as a novel vertebrate model to explore the signaling pathways of human adult cardiomyopathy. Hyperglycemia was induced by alternately immersing adult zebrafish in a glucose solution or water. The hyperglycemic fish gradually exhibited some hallmarks of cardiomyopathy such as myocardial hypertrophy and apoptosis, myofibril loss, fetal gene reactivation, and severe arrhythmia. Echocardiography of the glucose-treated fish demonstrated diastolic dysfunction at an early stage and systolic dysfunction at a later stage, consistent with what is observed in diabetic patients. Enlarged hearts with decreased myocardial density, accompanied by decompensated cardiac function, indicated that apoptosis was critical in the pathological process. Significant upregulation of the expression of Nkx2.5 and its downstream targets calreticulin (Calr and p53 was noted in the glucose-treated fish. High-glucose stimulation in vitro evoked marked apoptosis of primary cardiomyocytes, which was rescued by the p53 inhibitor pifithrin-μ. In vitro experiments were performed using compound treatment and genetically via cell infection. Genetically, knockout of Nkx2.5 induced decreased expression of Nkx2.5, Calr and p53. Upregulation of Calr resulted in increased p53 expression, whereas the level of Nkx2.5 remained unchanged. An adult zebrafish model of hyperglycemia-induced cardiomyopathy was successfully established. Hyperglycemia-induced myocardial apoptosis was mediated, at least in part, by activation of the Nkx2.5–Calr–p53 pathway in vivo, resulting in cardiac dysfunction and hyperglycemia-induced cardiomyopathy.

  16. Upregulation of NKX2.2, a target of EWSR1/FLI1 fusion transcript, in primary renal Ewing sarcoma

    Directory of Open Access Journals (Sweden)

    Yoshinari Yamamoto

    2015-01-01

    Full Text Available Renal Ewing sarcoma (ES is a rare malignant tumor characterized by fusion of the EWSR1 gene with a member of the ETS family of oncogenes, arising at a specific chromosomal translocation. Diagnosis of ES can be problematic, especially from cytological or small bioptical specimens because the differential diagnoses comprising a diverse group of small round blue cell tumors (SRBCTs. We report a case of primary renal ES in a young male, which had a t(11;22 (q24;q12 chromosome translocation encoding a type2 EWSR1/FLI1 fusion transcript. The tumor cells showed diffuse cytoplasmic immunoreactivity for CD99 and diffuse nuclear immunoreactivity for NKX2.2, an important oncogenic transcriptional target of EWSR1/FLI1, not only in the histological, but also in the cytological specimens. From the results of this case, we speculate that NKX2.2, in combination with CD99, may be a useful immunocytochemical marker to distinguish renal ES from other SRBCTs of kidney.

  17. Patterns of hypothalamic regionalization in amphibians and reptiles: common traits revealed by a genoarchitectonic approach

    Directory of Open Access Journals (Sweden)

    Laura eDominguez

    2015-02-01

    Full Text Available Most studies in mammals and birds have demonstrated common patterns of hypothalamic development highlighted by the combination of developmental regulatory genes (genoarchitecture, supporting the notion of the hypothalamus as a component of the secondary prosencephalon, topologically rostral to the diencephalon. In our comparative analysis we have summarized the data on the expression patterns of different transcription factors and neuroactive substances, used as anatomical markers, in the developing hypothalamus of the amphibian Xenopus laevis and the juvenile turtle Pseudemys scripta. This analysis served to highlight the organization of the hypothalamus in the anamniote/amniotic transition. We have identified supraoptoparaventricular and the suprachiasmatic regions in the alar part of the hypothalamus, and tuberal and mammillary regions in the basal hypothalamus. Shared features in the two species are: 1 The supraoptoparaventricular region is defined by the expression of Otp and the lack of Nkx2.1/Isl1. It is subdivided into rostral, rich in Otp and Nkx2.2, and caudal, only Otp-positive, portions. 2 The suprachiasmatic area contains catecholaminergic cell groups and lacks Otp, and can be further divided into rostral (rich in Nkx2.1 and Nkx2.2 and a caudal (rich in Isl1 and devoid of Nkx2.1 portions. 3 Expression of Nkx2.1 and Isl1 define the tuberal hypothalamus and only the rostral portion expresses Otp. 4 Its caudal boundary is evident by the lack of Isl1 in the adjacent mammillary region, which expresses Nkx2.1 and Otp. Differences in the anamnio-amniote transition were noted since in the turtle, like in other amniotes, the boundary between the alar hypothalamus and the telencephalic preoptic area shows distinct Nkx2.2 and Otp expressions but not in the amphibian (anamniote, and the alar supraoptoparaventricular region is defined by the expression of Otp/Pax6, whereas in Xenopus only Otp is expressed.

  18. Transplantation of bone marrow derived cells promotes pancreatic islet repair in diabetic mice

    International Nuclear Information System (INIS)

    Gao Xiaodong; Song Lujun; Shen Kuntang; Wang Hongshan; Niu Weixin; Qin Xinyu

    2008-01-01

    The transplantation of bone marrow (BM) derived cells to initiate pancreatic regeneration is an attractive but as-yet unrealized strategy. Presently, BM derived cells from green fluorescent protein transgenic mice were transplanted into diabetic mice. Repair of diabetic islets was evidenced by reduction of hyperglycemia, increase in number of islets, and altered pancreatic histology. Cells in the pancreata of recipient mice co-expressed BrdU and insulin. Double staining revealed β cells were in the process of proliferation. BrdU + insulin - PDX-1 + cells, Ngn3 + cells and insulin + glucagon + cells, which showed stem cells, were also found during β-cell regeneration. The majority of transplanted cells were mobilized to the islet and ductal regions. In recipient pancreas, transplanted cells simultaneously expressed CD34 but did not express insulin, PDX-1, Ngn3, Nkx2.2, Nkx6.1, Pax4, Pax6, and CD45. It is concluded that BM derived cells especially CD34 + cells can promote repair of pancreatic islets. Moreover, both proliferation of β cells and differentiation of pancreatic stem cells contribute to the regeneration of β cells

  19. Regulation of LH/FSH expression by secretoglobin 3A2 in the mouse pituitary gland.

    Science.gov (United States)

    Miyano, Yuki; Tahara, Shigeyuki; Sakata, Ichiro; Sakai, Takafumi; Abe, Hiroyuki; Kimura, Shioko; Kurotani, Reiko

    2014-04-01

    Secretoglobin (SCGB) 3A2 was originally identified as a downstream target for the homeodomain transcription factor NKX2-1 in the lung. NKX2-1 plays a role in the genesis and expression of genes in the thyroid, lung and ventral forebrain; Nkx2-1-null mice have no thyroid and pituitary and severely hypoplastic lungs and hypothalamus. To demonstrate whether SCGB3A2 plays any role in pituitary hormone production, NKX2-1 and SCGB3A2 expression in the mouse pituitary gland was examined by immunohistochemical analysis and RT-PCR. NKX2-1 was localized in the posterior pituitary lobe, whereas SCGB3A2 was observed in both anterior and posterior lobes as shown by immunohistochemistry and RT-PCR. Expression of CCAAT-enhancer binding proteins (C/EBPs), which regulate mouse Scgb3a2 transcription, was also examined by RT-PCR. C/EBPβ, γ, δ and ζ were expressed in the adult mouse pituitary gland. SCGB3A2 was expressed in the anterior and posterior lobes from postnatal days 1 and 5, respectively and the areas where SCGB3A2 expression was found coincided with the area where FSH-secreting cells were found. Double-staining for SCGB3A2 and pituitary hormones revealed that SCGB3A2 was mainly localized in gonadotrophs in 49 % of FSH-secreting cells and 47 % of LH-secreting cells. In addition, SCGB3A2 dramatically inhibited LH and FSH mRNA expression in rat pituitary primary cell cultures. These results suggest that SCGB3A2 regulates FSH/LH production in the anterior pituitary lobe and that transcription factors other than NKX2-1 may regulate SCGB3A2 expression.

  20. TNFα-mediated loss of β-catenin/E-cadherin association and subsequent increase in cell migration is partially restored by NKX3.1 expression in prostate cells.

    Directory of Open Access Journals (Sweden)

    Bilge Debelec-Butuner

    Full Text Available Inflammation-induced carcinogenesis is associated with increased proliferation and migration/invasion of various types of tumor cells. In this study, altered β-catenin signaling upon TNFα exposure, and relation to loss of function of the tumor suppressor NKX3.1 was examined in prostate cancer cells. We used an in vitro prostate inflammation model to demonstrate altered sub-cellular localization of β-catenin following increased phosphorylation of Akt(S473 and GSK3β(S9. Consistently, we observed that subsequent increase in β-catenin transactivation enhanced c-myc, cyclin D1 and MMP2 expressions. Consequently, it was also observed that the β-catenin-E-cadherin association at the plasma membrane was disrupted during acute cytokine exposure. Additionally, it was demonstrated that disrupting cell-cell interactions led to increased migration of LNCaP cells in real-time migration assay. Nevertheless, ectopic expression of NKX3.1, which is degraded upon proinflammatory cytokine exposure in inflammation, was found to induce the degradation of β-catenin by inhibiting Akt(S473 phosphorylation, therefore, partially rescued the disrupted β-catenin-E-cadherin interaction as well as the cell migration in LNCaP cells upon cytokine exposure. As, the disrupted localization of β-catenin at the cell membrane as well as increased Akt(S308 priming phosphorylation was observed in human prostate tissues with prostatic inflammatory atrophy (PIA, high-grade prostatic intraepithelial neoplasia (H-PIN and carcinoma lesions correlated with loss of NKX3.1 expression. Thus, the data indicate that the β-catenin signaling; consequently sub-cellular localization is deregulated in inflammation, associates with prostatic atrophy and PIN pathology.

  1. Progenitor potential of nkx6.1-expressing cells throughout zebrafish life and during beta cell regeneration.

    Science.gov (United States)

    Ghaye, Aurélie P; Bergemann, David; Tarifeño-Saldivia, Estefania; Flasse, Lydie C; Von Berg, Virginie; Peers, Bernard; Voz, Marianne L; Manfroid, Isabelle

    2015-09-02

    In contrast to mammals, the zebrafish has the remarkable capacity to regenerate its pancreatic beta cells very efficiently. Understanding the mechanisms of regeneration in the zebrafish and the differences with mammals will be fundamental to discovering molecules able to stimulate the regeneration process in mammals. To identify the pancreatic cells able to give rise to new beta cells in the zebrafish, we generated new transgenic lines allowing the tracing of multipotent pancreatic progenitors and endocrine precursors. Using novel bacterial artificial chromosome transgenic nkx6.1 and ascl1b reporter lines, we established that nkx6.1-positive cells give rise to all the pancreatic cell types and ascl1b-positive cells give rise to all the endocrine cell types in the zebrafish embryo. These two genes are initially co-expressed in the pancreatic primordium and their domains segregate, not as a result of mutual repression, but through the opposite effects of Notch signaling, maintaining nkx6.1 expression while repressing ascl1b in progenitors. In the adult zebrafish, nkx6.1 expression persists exclusively in the ductal tree at the tip of which its expression coincides with Notch active signaling in centroacinar/terminal end duct cells. Tracing these cells reveals that they are able to differentiate into other ductal cells and into insulin-expressing cells in normal (non-diabetic) animals. This capacity of ductal cells to generate endocrine cells is supported by the detection of ascl1b in the nkx6.1:GFP ductal cell transcriptome. This transcriptome also reveals, besides actors of the Notch and Wnt pathways, several novel markers such as id2a. Finally, we show that beta cell ablation in the adult zebrafish triggers proliferation of ductal cells and their differentiation into insulin-expressing cells. We have shown that, in the zebrafish embryo, nkx6.1+ cells are bona fide multipotent pancreatic progenitors, while ascl1b+ cells represent committed endocrine precursors. In

  2. Reactivation of the Nkx2.5 cardiac enhancer after myocardial infarction does not presage myogenesis.

    Science.gov (United States)

    Deutsch, Marcus-André; Doppler, Stefanie A; Li, Xinghai; Lahm, Harald; Santamaria, Gianluca; Cuda, Giovanni; Eichhorn, Stefan; Ratschiller, Thomas; Dzilic, Elda; Dreßen, Martina; Eckart, Annekathrin; Stark, Konstantin; Massberg, Steffen; Bartels, Anna; Rischpler, Christoph; Gilsbach, Ralf; Hein, Lutz; Fleischmann, Bernd K; Wu, Sean M; Lange, Rüdiger; Krane, Markus

    2018-03-20

    The contribution of resident stem or progenitor cells to cardiomyocyte renewal after injury in adult mammalian hearts remains a matter of considerable debate. We evaluated a cell population in the adult mouse heart induced by myocardial infarction (MI) and characterized by an activated Nkx2.5 enhancer element that is specific for multipotent cardiac progenitor cells during embryonic development. We hypothesized that these MI induced cells (MICs) harbor cardiomyogenic properties similar to their embryonic counterparts. MICs reside in the heart and mainly localize to the infarction area and border zone. Interestingly, gene expression profiling of purified MICs one week after infarction revealed increased expression of stem cell markers and embryonic cardiac transcription factors in these cells as compared to the non-mycoyte cell fraction of adult hearts. A subsequent global transcriptome comparison with embryonic cardiac progenitor cells and fibroblasts and in vitro culture of MICs unveiled that (myo-) fibroblastic features predominated and that cardiac transcription factors were only expressed at background levels. Adult injury induced reactivation of a cardiac-specific Nkx2.5 enhancer element known to specifically mark myocardial progenitor cells during embryonic development does not reflect hypothesized embryonic cardiomyogenic properties. Our data suggest a decreasing plasticity of cardiac progenitor (-like) cell populations with increasing age. A re-expression of embryonic, stem or progenitor cell features in the adult heart must be interpreted very carefully with respect to the definition of cardiac resident progenitor cells. Albeit, the abundance of scar formation after cardiac injury suggests a potential to target predestinated activated profibrotic cells to push them towards cardiomyogenic differentiation to improve regeneration.

  3. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  4. Expression Analysis of Gata4, Tbx5 and Nkx2.5 Genes Involved in Congenital Heart Disease

    Directory of Open Access Journals (Sweden)

    Mahta Mazaheri-Naeeini

    2016-04-01

    Full Text Available Background Congenital heart disease (CHD is the most widespread congenital disease in newborn babies and is one of the main causes of death worldwide. The causal agent of heart congenital diseases is unknown but genetic factors have an important role in prevalence of disease. Objectives The main objective of this research is comparison of the gene expression level of three Gata4, Tbx5 and Nkx2.5 genes in three groups of children between 6 months and 13 year old with congenital heart disease. Patients and Methods In this case-control study, 30 samples from each cyanotic and acyanotic patients and 30 samples from healthy children as control were used. RNA extraction was done using commercial kit and gene expression analysis was performed by qRT-PCR approach in three replication using Gata4, Tbx5 and Nkx2.5 genes. Data analysis was done by REST software. Results The results of RNA extraction and cDNA synthesis of all sample showed high quantity and quality of genetic materials. Expression level of tested genes was reduced in two patients group. In cyanotic group reduction was more than acyanotic samples. All tested gene were reduced in both group. Tbx5 gene was suppressed more than other genes. Conclusions Based on our results we could conclude that a gene family play an important role in cardiogenesis process and heart formation. These genes are closely related together. So a genetic consultation for such diseases on parents of these patients to determine the probable genetic mutations is recommended.

  5. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  6. NKX6.1 induced pluripotent stem cell reporter lines for isolation and analysis of functionally relevant neuronal and pancreas populations

    Directory of Open Access Journals (Sweden)

    Shailesh Kumar Gupta

    2018-05-01

    Full Text Available Recent studies have reported significant advances in the differentiation of human pluripotent stem cells to clinically relevant cell types such as the insulin producing beta-like cells and motor neurons. However, many of the current differentiation protocols lead to heterogeneous cell cultures containing cell types other than the targeted cell fate. Genetically modified human pluripotent stem cells reporting the expression of specific genes are of great value for differentiation protocol optimization and for the purification of relevant cell populations from heterogeneous cell cultures. Here we present the generation of human induced pluripotent stem cell (iPSC lines with a GFP reporter inserted in the endogenous NKX6.1 locus. Characterization of the reporter lines demonstrated faithful GFP labelling of NKX6.1 expression during pancreas and motor neuron differentiation. Cell sorting and gene expression profiling by RNA sequencing revealed that NKX6.1-positive cells from pancreatic differentiations closely resemble human beta cells. Furthermore, functional characterization of the isolated cells demonstrated that glucose-stimulated insulin secretion is mainly confined to the NKX6.1-positive cells. We expect that the NKX6.1-GFP iPSC lines and the results presented here will contribute to the further refinement of differentiation protocols and characterization of hPSC-derived beta cells and motor neurons for disease modelling and cell replacement therapies. Keywords: Human induced pluripotent stem cells, NKX6.1, Reporter cell line, Directed differentiation, hiPSC-derived beta cells

  7. Single-cell-derived mesenchymal stem cells overexpressing Csx/Nkx2.5 and GATA4 undergo the stochastic cardiomyogenic fate and behave like transient amplifying cells

    International Nuclear Information System (INIS)

    Yamada, Yoji; Sakurada, Kazuhiro; Takeda, Yukiji; Gojo, Satoshi; Umezawa, Akihiro

    2007-01-01

    Bone marrow-derived stromal cells can give rise to cardiomyocytes as well as adipocytes, osteocytes, and chondrocytes in vitro. The existence of mesenchymal stem cells has been proposed, but it remains unclear if a single-cell-derived stem cell stochastically commits toward a cardiac lineage. By single-cell marking, we performed a follow-up study of individual cells during the differentiation of 9-15c mesenchymal stromal cells derived from bone marrow cells. Three types of cells, i.e., cardiac myoblasts, cardiac progenitors and multipotent stem cells were differentiated from a single cell, implying that cardiomyocytes are generated stochastically from a single-cell-derived stem cell. We also demonstrated that overexpression of Csx/Nkx2.5 and GATA4, precardiac mesodermal transcription factors, enhanced cardiomyogenic differentiation of 9-15c cells, and the frequency of cardiomyogenic differentiation was increased by co-culturing with fetal cardiomyocytes. Single-cell-derived mesenchymal stem cells overexpressing Csx/Nkx2.5 and GATA4 behaved like cardiac transient amplifying cells, and still retained their plasticity in vivo

  8. Isolation of mineralizing Nestin+ Nkx6.1+ vascular muscular cells from the adult human spinal cord

    Directory of Open Access Journals (Sweden)

    Guillon Hélène

    2011-10-01

    Full Text Available Abstract Background The adult central nervous system (CNS contains different populations of immature cells that could possibly be used to repair brain and spinal cord lesions. The diversity and the properties of these cells in the human adult CNS remain to be fully explored. We previously isolated Nestin+ Sox2+ neural multipotential cells from the adult human spinal cord using the neurosphere method (i.e. non adherent conditions and defined medium. Results Here we report the isolation and long term propagation of another population of Nestin+ cells from this tissue using adherent culture conditions and serum. QPCR and immunofluorescence indicated that these cells had mesenchymal features as evidenced by the expression of Snai2 and Twist1 and lack of expression of neural markers such as Sox2, Olig2 or GFAP. Indeed, these cells expressed markers typical of smooth muscle vascular cells such as Calponin, Caldesmone and Acta2 (Smooth muscle actin. These cells could not differentiate into chondrocytes, adipocytes, neuronal and glial cells, however they readily mineralized when placed in osteogenic conditions. Further characterization allowed us to identify the Nkx6.1 transcription factor as a marker for these cells. Nkx6.1 was expressed in vivo by CNS vascular muscular cells located in the parenchyma and the meninges. Conclusion Smooth muscle cells expressing Nestin and Nkx6.1 is the main cell population derived from culturing human spinal cord cells in adherent conditions with serum. Mineralization of these cells in vitro could represent a valuable model for studying calcifications of CNS vessels which are observed in pathological situations or as part of the normal aging. In addition, long term propagation of these cells will allow the study of their interaction with other CNS cells and their implication in scar formation during spinal cord injury.

  9. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  10. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

    Science.gov (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

    2017-02-01

    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  11. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  12. The Cdk4-E2f1 pathway regulates early pancreas development by targeting Pdx1+ progenitors and Ngn3+ endocrine precursors

    Science.gov (United States)

    Kim, So Yoon; Rane, Sushil G.

    2011-01-01

    Cell division and cell differentiation are intricately regulated processes vital to organ development. Cyclin-dependent kinases (Cdks) are master regulators of the cell cycle that orchestrate the cell division and differentiation programs. Cdk1 is essential to drive cell division and is required for the first embryonic divisions, whereas Cdks 2, 4 and 6 are dispensable for organogenesis but vital for tissue-specific cell development. Here, we illustrate an important role for Cdk4 in regulating early pancreas development. Pancreatic development involves extensive morphogenesis, proliferation and differentiation of the epithelium to give rise to the distinct cell lineages of the adult pancreas. The cell cycle molecules that specify lineage commitment within the early pancreas are unknown. We show that Cdk4 and its downstream transcription factor E2f1 regulate mouse pancreas development prior to and during the secondary transition. Cdk4 deficiency reduces embryonic pancreas size owing to impaired mesenchyme development and fewer Pdx1+ pancreatic progenitor cells. Expression of activated Cdk4R24C kinase leads to increased Nkx2.2+ and Nkx6.1+ cells and a rise in the number and proliferation of Ngn3+ endocrine precursors, resulting in expansion of the β cell lineage. We show that E2f1 binds and activates the Ngn3 promoter to modulate Ngn3 expression levels in the embryonic pancreas in a Cdk4-dependent manner. These results suggest that Cdk4 promotes β cell development by directing E2f1-mediated activation of Ngn3 and increasing the pool of endocrine precursors, and identify Cdk4 as an important regulator of early pancreas development that modulates the proliferation potential of pancreatic progenitors and endocrine precursors. PMID:21490060

  13. Epigenetic mechanisms of peptidergic regulation of gene expression during aging of human cells.

    Science.gov (United States)

    Ashapkin, V V; Linkova, N S; Khavinson, V Kh; Vanyushin, B F

    2015-03-01

    Expression levels of genes encoding specific transcription factors and other functionally important proteins vary upon aging of pancreatic and bronchial epithelium cell cultures. The peptides KEDW and AEDL tissue-specifically affect gene expression in pancreatic and bronchial cell cultures, respectively. It is established in this work that the DNA methylation patterns of the PDX1, PAX6, NGN3, NKX2-1, and SCGB1A1 gene promoter regions change upon aging in pancreatic and bronchial cell cultures in correlation with variations in their expression levels. Thus, stable changes in gene expression upon aging of cell cultures could be caused by changes in their promoter methylation patterns. The methylation patterns of the PAX4 gene in pancreatic cells as well as those of the FOXA1, SCGB3A2, and SFTPA1 genes in bronchial cells do not change upon aging and are unaffected by peptides, whereas their expression levels change in both cases. The promoter region of the FOXA2 gene in pancreatic cells contains a small number of methylated CpG sites, their methylation levels being affected by cell culture aging and KEDW, though without any correlation with gene expression levels. The promoter region of the FOXA2 gene is completely unmethylated in bronchial cells irrespective of cell culture age and AEDL action. Changes in promoter methylation might be the cause of age- and peptide-induced variations in expression levels of the PDX1, PAX6, and NGN3 genes in pancreatic cells and NKX2-1 and SCGB1A1 genes in bronchial cells. Expression levels of the PAX4 and FOXA2 genes in pancreatic cells and FOXA1, FOXA2, SCGB3A2, and SFTPA1 genes in bronchial cells seem to be controlled by some other mechanisms.

  14. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  15. Analysis of Transcription Factors Key for Mouse Pancreatic Development Establishes NKX2-2 and MNX1 Mutations as Causes of Neonatal Diabetes in Man

    Science.gov (United States)

    Flanagan, Sarah E.; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M.; Edge, Julie A.; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A.L.; Edghill, Emma L.; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T.

    2014-01-01

    Summary Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. PMID:24411943

  16. Efficient Generation of NKX6-1+ Pancreatic Progenitors from Multiple Human Pluripotent Stem Cell Lines

    Directory of Open Access Journals (Sweden)

    M. Cristina Nostro

    2015-04-01

    Full Text Available Human pluripotent stem cells (hPSCs represent a renewable source of pancreatic beta cells for both basic research and therapeutic applications. Given this outstanding potential, significant efforts have been made to identify the signaling pathways that regulate pancreatic development in hPSC differentiation cultures. In this study, we demonstrate that the combination of epidermal growth factor (EGF and nicotinamide signaling induces the generation of NKX6-1+ progenitors from all hPSC lines tested. Furthermore, we show that the size of the NKX6-1+ population is regulated by the duration of treatment with retinoic acid, fibroblast growth factor 10 (FGF10, and inhibitors of bone morphogenetic protein (BMP and hedgehog signaling pathways. When transplanted into NOD scid gamma (NSG recipients, these progenitors differentiate to give rise to exocrine and endocrine cells, including monohormonal insulin+ cells. Together, these findings provide an efficient and reproducible strategy for generating highly enriched populations of hPSC-derived beta cell progenitors for studies aimed at further characterizing their developmental potential in vivo and deciphering the pathways that regulate their maturation in vitro.

  17. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  18. Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jae Sook Sung

    2012-09-01

    Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

  19. Sensitivity of MLL-rearranged AML cells to all-trans retinoic acid is associated with the level of H3K4me2 in the RARα promoter region

    International Nuclear Information System (INIS)

    Sakamoto, K; Imamura, T; Yano, M; Yoshida, H; Fujiki, A; Hirashima, Y; Hosoi, H

    2014-01-01

    All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML

  20. An Estrogen-Responsive Module in the Ventromedial Hypothalamus Selectively Drives Sex-Specific Activity in Females

    Directory of Open Access Journals (Sweden)

    Stephanie M. Correa

    2015-01-01

    Full Text Available Estrogen-receptor alpha (ERα neurons in the ventrolateral region of the ventromedial hypothalamus (VMHVL control an array of sex-specific responses to maximize reproductive success. In females, these VMHVL neurons are believed to coordinate metabolism and reproduction. However, it remains unknown whether specific neuronal populations control distinct components of this physiological repertoire. Here, we identify a subset of ERα VMHVL neurons that promotes hormone-dependent female locomotion. Activating Nkx2-1-expressing VMHVL neurons via pharmacogenetics elicits a female-specific burst of spontaneous movement, which requires ERα and Tac1 signaling. Disrupting the development of Nkx2-1+ VMHVL neurons results in female-specific obesity, inactivity, and loss of VMHVL neurons coexpressing ERα and Tac1. Unexpectedly, two responses controlled by ERα+ neurons, fertility and brown adipose tissue thermogenesis, are unaffected. We conclude that a dedicated subset of VMHVL neurons marked by ERα, NKX2-1, and Tac1 regulates estrogen-dependent fluctuations in physical activity and constitutes one of several neuroendocrine modules that drive sex-specific responses.

  1. Changes of MODY signal pathway genes in the endoplasmic reticulum stress in INS-1-3 cells.

    Directory of Open Access Journals (Sweden)

    Yanan Dong

    Full Text Available Metabolic disturbances induce endoplasmic reticulum stress (ERS in pancreatic beta cells. This study aims to investigate whether a common pathway exists in the ERS induced by various chemicals, including high levels of glucose and palmitate in INS-1-3 cells.ERS in INS-1-3 cells was induced by exposure cells to thapsigargin (TG, tunicamycin (TM or palmitic acid (PA +high glucose (HG. Digital gene expression (DGE profiling technique was used to detect differentially expressed genes. The profile of gene expression was detected by gene oncology (GO function and pathway enrichment analysis. Nkx6.1 over-expression was established in INS-1-3 cell lines by lentivirus infection to revert the inhibition of Nkx6.1 expression found in the situation of ERS. Real time reverse transcription polymerase chain reaction (RT-PCR was used to verify the expression changes of key genes. Cell viability was measured by 3-(4, 5-dimethylthiazol-2-yl-2, 5-diphenyltetrazolium bromide (MTT assay. The apoptosis was determined by flow cytometry. INS-1-3 cell function was measured by glucose stimulated insulin secretion test(GSIS.As compared to control, DGE demonstrated that there were 135, 57 and 74 differentially expressed genes in TM, TG and HG+PA groups, respectively. Those differentially expressed genes were enriched to ERS, antigen processing and presentation, protein export pathways, and interestingly, the maturity onset diabetes of the young (MODY pathway. Nkx6.1 is one of common down-regulated gene in MODY signaling pathway among TM, TG and HG+PA groups. Over-expression of Nkx6.1 ameliorated glucolipotoxicity induced apoptosis rate by 45.4%, and increased proliferation by 40.9%. At the same time, GSIS increased by 1.82 folds.MODY pathway genes expression was changed in the state of ERS. Over-expression of Nkx6.1 protected the INS-1-3 cells from glucolipotoxicity.

  2. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    Science.gov (United States)

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  3. Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...

    Indian Academy of Sciences (India)

    First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...

  4. Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column

    Science.gov (United States)

    Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri

    2017-05-01

    Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.

  5. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  6. Molecular cloning and functional characterization of two forms of Pax8 in the rainbow trout, Oncorhynchus mykiss

    Science.gov (United States)

    Katagiri, Nobuto; Uemae, Youji; Sakamoto, Joe; Hidaka, Yoshie; Susa, Takao; Kato, Yukio; Kimura, Shioko; Suzuki, Masakazu

    2014-01-01

    We have identified two distinct Pax8 (a and b) mRNAs from the thyroid gland of the rainbow trout (Oncorhynchus mykiss), which seemed to be generated by alternative splicing. Both Pax8a and Pax8b proteins were predicted to possess the paired domain, octapeptide, and partial homeodomain, while Pax8b lacked the carboxy-terminal portion due to an insertion in the coding region of the mRNA. RT-PCR analysis showed each of Pax8a and Pax8b mRNAs to be abundantly expressed in the thyroid and kidney. In situ hybridization histochemistry further detected the expression of Pax8 mRNA in the epithelial cells of the thyroid follicles of the adult trout and in the thyroid primordial cells of the embryo. The functional properties of Pax8a and Pax8b were investigated by dual luciferase assay. The transcriptional regulation by the rat thyroid peroxidase (TPO) promoter was found to be increased by Pax8a, but not by Pax8b. Pax8a further showed synergistic transcriptional activity with rat Nkx2-1 for the human TPO upstream region including the enhancer and promoter. On the other hand, Pax8b decreased the synergistic activity of Pax8a and Nkx2-1. Electrophoretic mobility shift assay additionally indicated that not only Pax8a but also Pax8b can bind to the TPO promoter and enhancer, implying that the inhibitory effect of Pax8b might result from the lack of the functional carboxy-terminal portion. Collectively, the results suggest that for the trout thyroid gland, Pax8a may directly increase TPO gene expression in cooperation with Nkx2-1 while Pax8b may work as a non-activating competitor for the TPO transcription. PMID:24380675

  7. BAG3 promotes proliferation of ovarian cancer cells via post-transcriptional regulation of Skp2 expression.

    Science.gov (United States)

    Yan, Jing; Liu, Chuan; Jiang, Jing-Yi; Liu, Hans; Li, Chao; Li, Xin-Yu; Yuan, Ye; Zong, Zhi-Hong; Wang, Hua-Qin

    2017-10-01

    Bcl-2 associated athanogene 3 (BAG3) contains a modular structure, through which BAG3 interacts with a wide range of proteins, thereby affording its capacity to regulate multifaceted biological processes. BAG3 is often highly expressed and functions as a pro-survival factor in many cancers. However, the oncogenic potential of BAG3 remains not fully understood. The cell cycle regulator, S-phase kinase associated protein 2 (Skp2) is increased in various cancers and plays an important role in tumorigenesis. The current study demonstrated that BAG3 promoted proliferation of ovarian cancer cells via upregulation of Skp2. BAG3 stabilized Skp2 mRNA via its 3'-untranslated region (UTR). The current study demonstrated that BAG3 interacted with Skp2 mRNA. In addition, miR-21-5p suppressed Skp2 expression, which was compromised by forced BAG3 expression. These results indicated that at least some oncogenic functions of BAG3 were mediated through posttranscriptional regulation of Skp2 via antagonizing suppressive action of miR-21-5p in ovarian cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Conservation of gene linkage in dispersed vertebrate NK homeobox clusters.

    Science.gov (United States)

    Wotton, Karl R; Weierud, Frida K; Juárez-Morales, José L; Alvares, Lúcia E; Dietrich, Susanne; Lewis, Katharine E

    2009-10-01

    Nk homeobox genes are important regulators of many different developmental processes including muscle, heart, central nervous system and sensory organ development. They are thought to have arisen as part of the ANTP megacluster, which also gave rise to Hox and ParaHox genes, and at least some NK genes remain tightly linked in all animals examined so far. The protostome-deuterostome ancestor probably contained a cluster of nine Nk genes: (Msx)-(Nk4/tinman)-(Nk3/bagpipe)-(Lbx/ladybird)-(Tlx/c15)-(Nk7)-(Nk6/hgtx)-(Nk1/slouch)-(Nk5/Hmx). Of these genes, only NKX2.6-NKX3.1, LBX1-TLX1 and LBX2-TLX2 remain tightly linked in humans. However, it is currently unclear whether this is unique to the human genome as we do not know which of these Nk genes are clustered in other vertebrates. This makes it difficult to assess whether the remaining linkages are due to selective pressures or because chance rearrangements have "missed" certain genes. In this paper, we identify all of the paralogs of these ancestrally clustered NK genes in several distinct vertebrates. We demonstrate that tight linkages of Lbx1-Tlx1, Lbx2-Tlx2 and Nkx3.1-Nkx2.6 have been widely maintained in both the ray-finned and lobe-finned fish lineages. Moreover, the recently duplicated Hmx2-Hmx3 genes are also tightly linked. Finally, we show that Lbx1-Tlx1 and Hmx2-Hmx3 are flanked by highly conserved noncoding elements, suggesting that shared regulatory regions may have resulted in evolutionary pressure to maintain these linkages. Consistent with this, these pairs of genes have overlapping expression domains. In contrast, Lbx2-Tlx2 and Nkx3.1-Nkx2.6, which do not seem to be coexpressed, are also not associated with conserved noncoding sequences, suggesting that an alternative mechanism may be responsible for the continued clustering of these genes.

  9. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  10. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  11. Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

    Directory of Open Access Journals (Sweden)

    Dongkyoon Kim

    2017-12-01

    Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

  12. [Health-Promoting Schools Regional Initiative of the Americas].

    Science.gov (United States)

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  13. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Directory of Open Access Journals (Sweden)

    Carlos Guerrero-Bosagna

    2010-09-01

    Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  14. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Science.gov (United States)

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

    2010-09-30

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  15. Influence of vibronic contribution on light harvesting efficiency of NKX-2587 derivatives with oligothiophene as π-conjugated linker

    Science.gov (United States)

    Yang, Pan; Zhang, Yang; Li, Ming; Shen, Wei; He, Rongxing

    2018-01-01

    Based on the NKX-2587 molecule we designed ten sensitizers with 1-10 thiophene moieties to investigate how the number of thiophene unit in the spacer influences the absorption spectra of sensitizer in dye sensitized solar cells (DSSCs). The parameters of short-circuit current density (Jsc), open circuit voltage (Voc), the light harvesting efficiency (LHE), injection driving force (Δ Ginject), and transferred electron number (nc), were calculated and discussed in detail. Results indicated that the increasing of thiophene units makes for the enhancement of oscillator strengths (f), although the red shift of vertical electronic absorption spectra is small. For the designed sensitizers with 1-5 thiophene units, their ΔGinject and nc raise gradually with the increasing of thiophene number. However, for those sensitizers with 6-10 thiophene units, the ΔGinject and nc decrease continuously with the increasing of thiophene units. In order to study how the oligothiophene as π-conjugated linker affects light harvesting efficiency of DSSCs, the vibrationally resolved electronic spectra of five metal-free NKX-2587 derivatives with 1-5 thiophene units were simulated within the Franck-Condon approximation including the Herzberg-Teller and Duschinsky effects. The present theoretical results provided helpful guidance for understanding the sources of spectral intensities of dye molecules, and a valuable method for rational design of new molecules to improve the energy conversion efficiency (η) of DSSCs.

  16. Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

    International Nuclear Information System (INIS)

    Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

    2015-01-01

    Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

  17. Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures

    DEFF Research Database (Denmark)

    Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita

    2016-01-01

    characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...

  18. Polymorphism in the PER3 promoter associates with diurnal preference and delayed sleep phase disorder.

    Science.gov (United States)

    Archer, Simon N; Carpen, Jayshan D; Gibson, Mark; Lim, Gim Hui; Johnston, Jonathan D; Skene, Debra J; von Schantz, Malcolm

    2010-05-01

    To screen the PER3 promoter for polymorphisms and investigate the phenotypic associations of these polymorphisms with diurnal preference, delayed sleep phase disorder/syndrome (DSPD/DSPS), and their effects on reporter gene expression. Interspecific comparison was used to define the approximate extent of the PER3 promoter as the region between the transcriptional start site and nucleotide position -874. This region was screened in DNA pools using PCR and direct sequencing, which was also used to screen DNA from individual participants. The different promoter alleles were cloned into a luciferase expression vector and a deletion library created. Promoter activation was measured by chemiluminescence. N/A. DNA samples were obtained from volunteers with defined diurnal preference (3 x 80, selected from a pool of 1,590), and DSPD patients (n=23). N/A. We verified three single nucleotide polymorphisms (G -320T, C -319A, G -294A), and found a novel variable number tandem repeat (VNTR) polymorphism (-318 1/2 VNTR). The -320T and -319A alleles occurred more frequently in DSPD compared to morning (P = 0.042 for each) or evening types (P = 0.006 and 0.033). The allele combination TA2G was more prevalent in DSPD compared to morning (P 0.033) or evening types (P = 0.002). Luciferase expression driven by the TA2G combination was greater than for the more common GC2A (P < 0.05) and the rarer TA1G (P < 0.001) combinations. Deletion reporter constructs identified two enhancer regions (-703 to -605, and -283 to -80). Polymorphisms in the PER3 promoter could affect its expression, leading to potential differences in the observed functions of PER3.

  19. Characteristics of NaNO3-Promoted CdO as a Midtemperature CO2 Absorbent.

    Science.gov (United States)

    Kim, Kang-Yeong; Kwak, Jin-Su; An, Young-In; Oh, Kyung-Ryul; Kwon, Young-Uk

    2017-06-28

    In this study, we explored the reaction system CdO(s) + CO 2 (g) ⇄ CdCO 3 (s) as a model system for CO 2 capture agent in the intermediate temperature range of 300-400 °C. While pure CdO does not react with CO 2 at all up to 500 °C, CdO mixed with an appropriate amount of NaNO 3 (optimal molar ratio NaNO 3 /CdO = 0.14) greatly enhances the conversion of CdO into CdCO 3 up to ∼80% (5.68 mmol/g). These NaNO 3 -promoted CdO absorbents can undergo many cycles of absorption and desorption by temperature swing between 300 and 370 °C under a 100% CO 2 condition. Details of how NaNO 3 promotes the CO 2 absorption of CdO have been delineated through various techniques using thermogravimetry, coupled with X-ray diffraction and electron microscopy. On the basis of the observed data, we propose a mechanism of CO 2 absorption and desorption of NaNO 3 -promoted CdO. The absorption proceeds through a sequence of events of CO 2 adsorption on the CdO surface covered by NaNO 3 , dissolution of so-formed CdCO 3 , and precipitation of CdCO 3 particles in the NaNO 3 medium. The desorption occurs through the decomposition of CdCO 3 in the dissolved state in the NaNO 3 medium where CdO nanoparticles are formed dispersed in the NaNO 3 medium. The CdO nanoparticles are aggregated into micrometer-large particles with smooth surfaces and regular shapes.

  20. Estradiol represses Insulin-like 3 expression and promoter activity in MA-10 Leydig cells

    International Nuclear Information System (INIS)

    Lague, Eric; Tremblay, Jacques J.

    2009-01-01

    There are increasing evidence in the literature reporting the detrimental effects of endocrine disruptors on the development and function of the male reproductive system. One example is cryptorchidism, or undescended testis, caused by exposure to excessive estrogens. Estrogens, acting through the estrogen receptor α (ERα), have been shown to repress expression of the gene encoding insulin-like 3 (INSL3), a small peptide produced by testicular Leydig cells that is essential for normal testis descent. The molecular mechanism of estrogen/ER action on Insl3 expression, however, remains poorly understood. Here we report estradiol (E 2 ) represses Insl3 mRNA levels in MA-10 cells, a Leydig cell line model. We also found that E 2 represses the activity of the human and mouse Insl3 promoter in these cells. The E 2 -responsive region of the human INSL3 promoter was located to the proximal INSL3 promoter. This region does not contain a consensus estrogen response element indicating an indirect mechanism of action. In agreement with this, we found that E 2 -responsiveness was lost when two previously characterized binding sites for the nuclear receptors NUR77 and SF1 were mutated. Finally we show that the E 2 repressive effect could be overcome by cotreatment with testosterone, a positive regulator of Insl3 transcription. Collectively our data provide important new insights into the molecular mechanism of estrogen action in Insl3 transcription in Leydig cells

  1. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  2. BAG3 directly stabilizes Hexokinase 2 mRNA and promotes aerobic glycolysis in pancreatic cancer cells.

    Science.gov (United States)

    An, Ming-Xin; Li, Si; Yao, Han-Bing; Li, Chao; Wang, Jia-Mei; Sun, Jia; Li, Xin-Yu; Meng, Xiao-Na; Wang, Hua-Qin

    2017-12-04

    Aerobic glycolysis, a phenomenon known historically as the Warburg effect, is one of the hallmarks of cancer cells. In this study, we characterized the role of BAG3 in aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) and its molecular mechanisms. Our data show that aberrant expression of BAG3 significantly contributes to the reprogramming of glucose metabolism in PDAC cells. Mechanistically, BAG3 increased Hexokinase 2 (HK2) expression, the first key enzyme involved in glycolysis, at the posttranscriptional level. BAG3 interacted with HK2 mRNA, and the degree of BAG3 expression altered recruitment of the RNA-binding proteins Roquin and IMP3 to the HK2 mRNA. BAG3 knockdown destabilized HK2 mRNA via promotion of Roquin recruitment, whereas BAG3 overexpression stabilized HK2 mRNA via promotion of IMP3 recruitment. Collectively, our results show that BAG3 promotes reprogramming of glucose metabolism via interaction with HK2 mRNA in PDAC cells, suggesting that BAG3 may be a potential target in the aerobic glycolysis pathway for developing novel anticancer agents. © 2017 An et al.

  3. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  4. 36 CFR 261.73 - Regulations applicable to Region 3, Southwestern Region, as defined in § 200.2. [Reserved

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Regulations applicable to Region 3, Southwestern Region, as defined in § 200.2. [Reserved] 261.73 Section 261.73 Parks, Forests... § 261.73 Regulations applicable to Region 3, Southwestern Region, as defined in § 200.2. [Reserved] ...

  5. Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3

    Energy Technology Data Exchange (ETDEWEB)

    Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.

    2017-08-01

    The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.

  6. Investigation of phase relationships in subsolidus region of Ln2O3-MoO3-B2O3 systems

    International Nuclear Information System (INIS)

    Lysanova, C.V.; Dzhurinskij, B.F.; Komova, M.G.; Tananaev, I.V.

    1983-01-01

    Phase formation in subsolidus region of Ln 2 O 3 -MoO 3 B 2 O 3 systems (Ln-La, Nd) is studied. Three compounds with mixed oxyanions-boratomolybdates of LnMoBO 6 composition (Ln-La, Ce, Pr, Nd), Ln 2 MoB 2 O 9 (Ln-La, Ce, Pr, Nd, Sm, EU, Gde Tb) Ln 6 Mo 3 B 4 0 24 (Ln-Pr, Nd) are revealed and described

  7. 2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter

    Directory of Open Access Journals (Sweden)

    Zhentao Yang

    2017-05-01

    Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.

  8. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  9. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  10. Communication: Equivalence between symmetric and antisymmetric stretching modes of NH3 in promoting H + NH3 → H2 + NH2 reaction

    Science.gov (United States)

    Song, Hongwei; Yang, Minghui; Guo, Hua

    2016-10-01

    Vibrational excitations of reactants sometimes promote reactions more effectively than the same amount of translational energy. Such mode specificity provides insights into the transition-state modulation of reactivity and might be used to control chemical reactions. We report here a state-of-the-art full-dimensional quantum dynamical study of the hydrogen abstraction reaction H + NH3 → H2 + NH2 on an accurate ab initio based global potential energy surface. This reaction serves as an ideal candidate to study the relative efficacies of symmetric and degenerate antisymmetric stretching modes. Strong mode specificity, particularly for the NH3 stretching modes, is demonstrated. It is further shown that nearly identical efficacies of the symmetric and antisymmetric stretching modes of NH3 in promoting the reaction can be understood in terms of local-mode stretching vibrations of the reactant molecule.

  11. Coxsackievirus B3 2A protease promotes encephalomyocarditis virus replication.

    Science.gov (United States)

    Song, Qin-Qin; Lu, Ming-Zhi; Song, Juan; Chi, Miao-Miao; Sheng, Lin-Jun; Yu, Jie; Luo, Xiao-Nuan; Zhang, Lu; Yao, Hai-Lan; Han, Jun

    2015-10-02

    To determine whether 2A protease of the enterovirus genus with type I internal ribosome entry site (IRES) effect on the viral replication of type II IRES, coxsackievirus B3(CVB3)-encoded protease 2A and encephalomyocarditis virus (EMCV) IRES (Type II)-dependent or cap-dependent report gene were transiently co-expressed in eukaryotic cells. We found that CVB3 2A protease not only inhibited translation of cap-dependent reporter genes through the cleavage of eIF4GI, but also conferred high EMCV IRES-dependent translation ability and promoted EMCV replication. Moreover, deletions of short motif (aa13-18 RVVNRH, aa65-70 KNKHYP, or aa88-93 PRRYQSH) resembling the nuclear localization signals (NLS) or COOH-terminal acidic amino acid motif (aa133-147 DIRDLLWLEDDAMEQ) of CVB3 2A protease decreased both its EMCV IRES-dependent translation efficiency and destroy its cleavage on eukaryotic initiation factor 4G (eIF4G) I. Our results may provide better understanding into more effective interventions and treatments for co-infection of viral diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Loss of Sh3gl2/Endophilin A1 Is a Common Event in Urothelial Carcinoma that Promotes Malignant Behavior

    Directory of Open Access Journals (Sweden)

    Shyama Majumdar

    2013-07-01

    Full Text Available Urothelial carcinoma (UC causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying urothelial cancer development and tumor progression are still largely unknown. Using informatics analysis, we identified Sh3gl2 (endophilin A1 as a bladder urothelium-enriched transcript. The gene encoding Sh3gl2 is located on chromosome 9p, a region frequently altered in UC. Sh3gl2 is known to regulate endocytosis of receptor tyrosine kinases implicated in oncogenesis, such as the epidermal growth factor receptor (EGFR and c-Met. However, its role in UC pathogenesis is unknown. Informatics analysis of expression profiles as well as immunohistochemical staining of tissue microarrays revealed Sh3gl2 expression to be decreased in UC specimens compared to nontumor tissues. Loss of Sh3gl2 was associated with increasing tumor grade and with muscle invasion, which is a reliable predictor of metastatic disease and cancer-derived mortality. Sh3gl2 expression was undetectable in 19 of 20 human UC cell lines but preserved in the low-grade cell line RT4. Stable silencing of Sh3gl2 in RT4 cells by RNA interference 1 enhanced proliferation and colony formation in vitro, 2 inhibited EGF-induced EGFR internalization and increased EGFR activation, 3 stimulated phosphorylation of Src family kinases and STAT3, and 4 promoted growth of RT4 xenografts in subrenal capsule tissue recombination experiments. Conversely, forced re-expression of Sh3gl2 in T24 cells and silenced RT4 clones attenuated oncogenic behaviors, including growth and migration. Together, these findings identify loss of Sh3gl2 as a frequent event in UC development that promotes disease progression.

  13. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  14. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Sun JX

    2014-05-01

    Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

  15. Photoactivation of GLUT4 translocation promotes glucose uptake via PI3-K/Akt2 signaling in 3T3-L1 adipocytes

    Directory of Open Access Journals (Sweden)

    Lei Huang

    2014-05-01

    Full Text Available Insulin resistance is a hallmark of the metabolic syndrome and type 2 diabetes. Dysfunction of PI-3K/Akt signaling was involved in insulin resistance. Glucose transporter 4 (GLUT4 is a key factor for glucose uptake in muscle and adipose tissues, which is closely regulated by PI-3K/Akt signaling in response to insulin treatment. Low-power laser irradiation (LPLI has been shown to regulate various physiological processes and induce the synthesis or release of multiple molecules such as growth factors, which (especially red and near infrared light is mainly through the activation of mitochondrial respiratory chain and the initiation of intracellular signaling pathways. Nevertheless, it is unclear whether LPLI could promote glucose uptake through activation of PI-3K/Akt/GLUT4 signaling in 3T3L-1 adipocytes. In this study, we investigated how LPLI promoted glucose uptake through activation of PI-3K/Akt/GLUT4 signaling pathway. Here, we showed that GLUT4 was localized to the Golgi apparatus and translocated from cytoplasm to cytomembrane upon LPLI treatment in 3T3L-1 adipocytes, which enhanced glucose uptake. Moreover, we found that glucose uptake was mediated by the PI3-K/Akt2 signaling, but not Akt1 upon LPLI treatment with Akt isoforms gene silence and PI3-K/Akt inhibitors. Collectively, our results indicate that PI3-K/Akt2/GLUT4 signaling act as the key regulators for improvement of glucose uptake under LPLI treatment in 3T3L-1 adipocytes. More importantly, our findings suggest that activation of PI3-K/Akt2/GLUT4 signaling by LPLI may provide guidance in practical applications for promotion of glucose uptake in insulin-resistant adipose tissue.

  16. Multicomponent Biginelli's synthesis of 3,4-dihydropyrimidin-2(1H-ones promoted by SnCl2.2H2O

    Directory of Open Access Journals (Sweden)

    Russowsky Dennis

    2004-01-01

    Full Text Available The ability of SnCl2.2H2O as catalyst to promote the Biginelli three-component condensation reaction from a diversity of aromatic aldehydes, ethyl acetoacetate and urea or thiourea is described. The reaction was carried out in acetonitrile or ethanol as solvents in neutral media and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3.6H2O, NiCl2.6H2O and CoCl2.6H2O which were used with HCl as co-catalyst. The synthesis of 3,4-dihydropyrimidinones was achieved in good to excelent yields.

  17. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  18. Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

    DEFF Research Database (Denmark)

    Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher

    2014-01-01

    The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...

  19. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

    1994-01-01

    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  20. Stat3 induces oncogenic Skp2 expression in human cervical carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hanhui [Shanghai Medical College of Fudan University, Shanghai 200032 (China); Zhao, Wenrong [Department of Gynecology, Obstetrics and Gynecology Hospital of Fudan University, Shanghai 200011 (China); Yang, Dan, E-mail: yangdandr@gmail.com [Department of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University, Shanghai 200040 (China)

    2012-02-03

    Highlights: Black-Right-Pointing-Pointer Upregulation of Skp2 by IL-6 or Stat3 activation. Black-Right-Pointing-Pointer Stat3 activates Skp2 expression through bound to its promoter region. Black-Right-Pointing-Pointer Stat3 activates Skp2 expression through recruitment of P300. Black-Right-Pointing-Pointer Stat3 activation decreases the P27 stability. -- Abstract: Dysregulated Skp2 function promotes cell proliferation, which is consistent with observations of Skp2 over-expression in many types of human cancers, including cervical carcinoma (CC). However, the molecular mechanisms underlying elevated Skp2 expression have not been fully explored. Interleukin-6 (IL-6) induced Stat3 activation is viewed as crucial for multiple tumor growth and metastasis. Here, we demonstrate that Skp2 is a direct transcriptional target of Stat3 in the human cervical carcinoma cells. Our data show that IL-6 administration or transfection of a constitutively activated Stat3 in HeLa cells activates Skp2 mRNA transcription. Using luciferase reporter and ChIP assays, we show that Stat3 binds to the promoter region of Skp2 and promotes its activity through recruiting P300. As a result of the increase of Skp2 expression, endogenous p27 protein levels are markedly decreased. Thus, our results suggest a previously unknown Stat3-Skp2 molecular network controlling cervical carcinoma development.

  1. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Møller, A M; Jensen, N M; Pildal, J

    2001-01-01

    This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...

  2. The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

    Science.gov (United States)

    Fu, Chunli; Xing, Yingqi; Song, Xiaonan

    2011-04-01

    To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

  3. CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.

    Science.gov (United States)

    Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan

    2017-07-05

    DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20

  4. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  5. Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

    Directory of Open Access Journals (Sweden)

    Wang Xiaoqin

    2005-10-01

    Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

  6. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J

    2007-05-01

    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  7. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  8. Oct3/4 directly regulates expression of E2F3a in mouse embryonic stem cells

    International Nuclear Information System (INIS)

    Kanai, Dai; Ueda, Atsushi; Akagi, Tadayuki; Yokota, Takashi; Koide, Hiroshi

    2015-01-01

    Embryonic stem (ES) cells, derived from the inner cell mass of blastocysts, have a characteristic cell cycle with truncated G1 and G2 phases. Recent findings that suppression of Oct3/4 expression results in a reduced proliferation rate of ES cells suggest the involvement of Oct3/4 in the regulation of ES cell growth, although the underlying molecular mechanism remains unclear. In the present study, we identified E2F3a as a direct target gene of Oct3/4 in ES cells. Oct3/4 directly bound to the promoter region of the E2F3a gene and positively regulated expression of E2F3a in mouse ES cells. Suppression of E2F3a activity by E2F6 overexpression led to the reduced proliferation in ES cells, which was relieved by co-expression of E2F3a. Furthermore, cell growth retardation caused by loss of Oct3/4 was rescued by E2F3a expression. These results suggest that Oct3/4 upregulates E2F3a expression to promote ES cell growth. - Highlights: • Oct3/4 positively regulates E2F3a expression in ES cells. • Oct3/4 binds to the promoter region of the E2F3a gene. • Overexpression of E2F6, an inhibitor of E2F3a, reduces ES cell growth. • E2F3a recovers growth retardation of ES cells caused by Oct3/4 reduction

  9. Oct3/4 directly regulates expression of E2F3a in mouse embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Kanai, Dai; Ueda, Atsushi; Akagi, Tadayuki; Yokota, Takashi; Koide, Hiroshi, E-mail: hkoide@med.kanazawa-u.ac.jp

    2015-04-10

    Embryonic stem (ES) cells, derived from the inner cell mass of blastocysts, have a characteristic cell cycle with truncated G1 and G2 phases. Recent findings that suppression of Oct3/4 expression results in a reduced proliferation rate of ES cells suggest the involvement of Oct3/4 in the regulation of ES cell growth, although the underlying molecular mechanism remains unclear. In the present study, we identified E2F3a as a direct target gene of Oct3/4 in ES cells. Oct3/4 directly bound to the promoter region of the E2F3a gene and positively regulated expression of E2F3a in mouse ES cells. Suppression of E2F3a activity by E2F6 overexpression led to the reduced proliferation in ES cells, which was relieved by co-expression of E2F3a. Furthermore, cell growth retardation caused by loss of Oct3/4 was rescued by E2F3a expression. These results suggest that Oct3/4 upregulates E2F3a expression to promote ES cell growth. - Highlights: • Oct3/4 positively regulates E2F3a expression in ES cells. • Oct3/4 binds to the promoter region of the E2F3a gene. • Overexpression of E2F6, an inhibitor of E2F3a, reduces ES cell growth. • E2F3a recovers growth retardation of ES cells caused by Oct3/4 reduction.

  10. Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane

    Science.gov (United States)

    Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen

    2017-09-01

    A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).

  11. Tropomyosin Promotes Lamellipodial Persistence by Collaborating with Arp2/3 at the Leading Edge.

    Science.gov (United States)

    Brayford, Simon; Bryce, Nicole S; Schevzov, Galina; Haynes, Elizabeth M; Bear, James E; Hardeman, Edna C; Gunning, Peter W

    2016-05-23

    At the leading edge of migrating cells, protrusion of the lamellipodium is driven by Arp2/3-mediated polymerization of actin filaments [1]. This dense, branched actin network is promoted and stabilized by cortactin [2, 3]. In order to drive filament turnover, Arp2/3 networks are remodeled by proteins such as GMF, which blocks the actin-Arp2/3 interaction [4, 5], and coronin 1B, which acts by directing SSH1L to the lamellipodium where it activates the actin-severing protein cofilin [6, 7]. It has been shown in vitro that cofilin-mediated severing of Arp2/3 actin networks results in the generation of new pointed ends to which the actin-stabilizing protein tropomyosin (Tpm) can bind [8]. The presence of Tpm in lamellipodia, however, is disputed in the literature [9-19]. Here, we report that the Tpm isoforms 1.8/9 are enriched in the lamellipodium of fibroblasts as detected with a novel isoform-specific monoclonal antibody. RNAi-mediated silencing of Tpm1.8/9 led to an increase of Arp2/3 accumulation at the cell periphery and a decrease in the persistence of lamellipodia and cell motility, a phenotype consistent with cortactin- and coronin 1B-deficient cells [2, 7]. In the absence of coronin 1B or cofilin, Tpm1.8/9 protein levels are reduced while, conversely, inhibition of Arp2/3 with CK666 leads to an increase in Tpm1.8/9 protein. These findings establish a novel regulatory mechanism within the lamellipodium whereby Tpm collaborates with Arp2/3 to promote lamellipodial-based cell migration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Selective photocatalytic reduction of CO{sub 2} by H{sub 2}O/H{sub 2} to CH{sub 4} and CH{sub 3}OH over Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} nanocatalyst

    Energy Technology Data Exchange (ETDEWEB)

    Tahir, Muhammad, E-mail: mtahir@cheme.utm.my [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia); Department of Chemical Engineering, COMSATS Institute of Information Technology, Lahore, Punjab (Pakistan); Tahir, Beenish; Saidina Amin, Nor Aishah; Alias, Hajar [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia)

    2016-12-15

    Highlights: • Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} nanocatalysts tested for CO{sub 2} photoreduction with H{sub 2}O/H{sub 2}. • Production of CH{sub 4} and CH{sub 3}OH depends on reductants type and metal-loading to TiO{sub 2}. • CH{sub 4} production over Cu-In/TiO{sub 2} was 1.5 fold more than In/TiO{sub 2} and 5 times the TiO{sub 2}. • The Cu-promoted CH{sub 3}OH production while In gave more CH{sub 4} with water vapors. • The H{sub 2} reductant gave negative effect for CH{sub 4} but enhanced CH{sub 3}OH production. - Abstract: Photocatalytic CO{sub 2} reduction by H{sub 2}O and/or H{sub 2} reductant to selective fuels over Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} photocatalyst has been investigated. The samples, prepared via a simple and direct sol-gel method, were characterized by XRD, SEM, TEM, XPS, N{sub 2} adsorption-desorption, UV–vis diffuse reflectance, Raman and PL spectroscopy. Cu and In loaded into TiO{sub 2}, oxidized as Cu{sup 2+} and In{sup 3+}, promoted efficient separation of photo-generated electron/hole pairs (e{sup −}/h{sup +}). The results indicate that the reduction rate of CO{sub 2} by H{sub 2}O to CH{sub 4} approached to 181 μmol g{sup −1} h{sup −1} using 0.5% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst, a 1.53 fold higher than the production rate over the 3% In{sub 2}O{sub 3}/TiO{sub 2} and 5 times the amount produced over the pure TiO{sub 2}. In addition, Cu was found to promote efficient production of CH{sub 3}OH and yield rate reached to 68 μmol g{sup −1} h{sup −1} over 1% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst. This improvement was attributed to charge transfer property and suppressed recombination rate by Cu-metal. More importantly, H{sub 2} reductant was less favorable for CH{sub 4} production, yet a significant amount of CH{sub 4} and CH{sub 3}OH were obtained using a mixture of H{sub 2}O/H{sub 2} reductant. Therefore, Cu-loaded In{sub 2}O{sub 3}/TiO{sub 2} catalyst has shown to be capable for

  13. Epigenetic modification of histone 3 lysine 27: mediator subunit MED25 is required for the dissociation of polycomb repressive complex 2 from the promoter of cytochrome P450 2C9.

    Science.gov (United States)

    Englert, Neal A; Luo, George; Goldstein, Joyce A; Surapureddi, Sailesh

    2015-01-23

    The Mediator complex is vital for the transcriptional regulation of eukaryotic genes. Mediator binds to nuclear receptors at target response elements and recruits chromatin-modifying enzymes and RNA polymerase II. Here, we examine the involvement of Mediator subunit MED25 in the epigenetic regulation of human cytochrome P450 2C9 (CYP2C9). MED25 is recruited to the CYP2C9 promoter through association with liver-enriched HNF4α, and we show that MED25 influences the H3K27 status of the HNF4α binding region. This region was enriched for the activating marker H3K27ac and histone acetyltransferase CREBBP after MED25 overexpression but was trimethylated when MED25 expression was silenced. The epigenetic regulator Polycomb repressive complex (PRC2), which represses expression by methylating H3K27, plays an important role in target gene regulation. Silencing MED25 correlated with increased association of PRC2 not only with the promoter region chromatin but with HNF4α itself. We confirmed the involvement of MED25 for fully functional preinitiation complex recruitment and transcriptional output in vitro. Formaldehyde-assisted isolation of regulatory elements (FAIRE) revealed chromatin conformation changes that were reliant on MED25, indicating that MED25 induced a permissive chromatin state that reflected increases in CYP2C9 mRNA. For the first time, we showed evidence that a functionally relevant human gene is transcriptionally regulated by HNF4α via MED25 and PRC2. CYP2C9 is important for the metabolism of many exogenous chemicals including pharmaceutical drugs as well as endogenous substrates. Thus, MED25 is important for regulating the epigenetic landscape resulting in transcriptional activation of a highly inducible gene, CYP2C9. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. MECP2 promoter methylation and X chromosome inactivation in autism.

    Science.gov (United States)

    Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

    2008-06-01

    Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.

  15. Identification and annotation of promoter regions in microbial

    Indian Academy of Sciences (India)

    2007-06-15

    Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

  16. Development and characterization of nickel catalysts supported in CeO2-ZrO2-Al2O3, CeO2-La2O3-Al2O3 e ZrO2-La2O3-Al2O3 matrixes evaluated for methane reforming reactions

    International Nuclear Information System (INIS)

    Abreu, Amanda Jordão de

    2012-01-01

    Nowadays, the methane reforming is large interest industrial for the take advantage of these gas in production the hydrogen and synthesis gas (syngas). Among in the reactions of methane stand of the reactions steam reforming and carbon dioxide reforming of methane. The main catalysts uses in the methane reforming is Ni/Al 2 O 3 . However, the supported-nickel catalyst is susceptible to the deactivation or the destruction by coke deposition. The carbon dissolves in the nickel crystallite and its diffuses through the nickel, leading for formation of the carbon whiskers, which results in fragmentation of the catalyst. Modification of such catalysts, like incorporation of suitable promoters, is desirable to achieve reduction of the methane hydrogenolysis and/or promotion of the carbon gasification. Catalysts 5%Ni/Al 2 O 3 supported on solid solutions formed by ZrO 2 -CeO 2 , La 2 O 3 and CeO 2 -ZrO 2 -La 2 O 3 were prepared, characterized and evaluated in reactions steam and carbon dioxide reforming and partial oxidation of methane with objective the value effect loading solution solid in support. The supports were prepared by co-precipitation method and catalysts were prepared by impregnation method and calcined at 500 deg C. The supports and catalysts were characterized by Nitrogen Adsorption, method -rays diffraction (XRD), X-rays dispersive spectroscopy (XDS), spectroscopy in the region of the ultraviolet and the visible (UV-vis NIR) to and temperature programmed reduction (TPR), Raman Spectroscopy, X-ray absorption spectroscopy and Thermogravimetric Analysis. After all the catalytic reactions check which the addition of solid solution is beneficial for Ni/Al 2 O 3 catalysts and the best catalysts are Ni/CeO 2 -La 2 O 3 -Al 2 O 3 . (author)

  17. A role for the transcription factor NK2 homeobox 1 in schizophrenia: Convergent evidence from animal and human studies

    Directory of Open Access Journals (Sweden)

    Eva Albertsen Malt

    2016-03-01

    Full Text Available Schizophrenia is a highly heritable disorder with diverse mental and somatic symptoms. The molecular mechanisms leading from genes to disease pathology in schizophrenia remain largely unknown. Genome-wide association studies have shown that common single-nucleotide polymorphisms associated with specific diseases are enriched in the recognition sequences of transcription factors that regulate physiological processes relevant to the disease. We have used a bottom-up approach and tracked a developmental trajectory from embryology to physiological processes and behavior and recognized that the transcription factor NK2 homeobox 1 (NKX2-1 possesses properties of particular interest for schizophrenia. NKX2-1 is selectively expressed from prenatal development to adulthood in the brain, thyroid gland, parathyroid gland, lungs, skin, and enteric ganglia, and has key functions at the interface of the brain, the endocrine-, and the immune system. In the developing brain, NKX2-1-expressing progenitor cells differentiate into distinct subclasses of forebrain GABAergic and cholinergic neurons, astrocytes, and oligodendrocytes. The transcription factor is highly expressed in mature limbic circuits related to context-dependent goal-directed patterns of behavior, social interaction and reproduction, fear responses, responses to light, and other homeostatic processes. It is essential for development and mature function of the thyroid gland and the respiratory system, and is involved in calcium metabolism and immune responses. NKX2-1 interacts with a number of genes identified as susceptibility genes for schizophrenia. We suggest that NKX2-1 may lie at the core of several dose dependent pathways that are dysregulated in schizophrenia. We correlate the symptoms seen in schizophrenia with the temporal and spatial activities of NKX2-1 in order to highlight promising future research areas.

  18. Ultrasound-promoted organocatalytic enamine–azide [3 + 2] cycloaddition reactions for the synthesis of ((arylselanylphenyl-1H-1,2,3-triazol-4-ylketones

    Directory of Open Access Journals (Sweden)

    Gabriel P. Costa

    2017-04-01

    Full Text Available The use of sonochemistry is described in the organocatalytic enamine–azide [3 + 2] cycloaddition between 1,3-diketones and aryl azidophenyl selenides. These sonochemically promoted reactions were found to be amenable to a range of 1,3-diketones or aryl azidophenyl selenides, providing an efficient access to new ((arylselanylphenyl-1H-1,2,3-triazol-4-ylketones in good to excellent yields and short reaction times. In addition, this protocol was extended to β-keto esters, β-keto amides and α-cyano ketones. Selanyltriazoyl carboxylates, carboxamides and carbonitriles were synthesized in high yields at short times of reaction under very mild reaction conditions.

  19. Opioid gene expression changes and post-translational histone modifications at promoter regions in the rat nucleus accumbens after acute and repeated 3,4-methylenedioxy-methamphetamine (MDMA) exposure.

    Science.gov (United States)

    Caputi, Francesca Felicia; Palmisano, Martina; Carboni, Lucia; Candeletti, Sanzio; Romualdi, Patrizia

    2016-12-01

    The recreational drug of abuse 3,4-methylenedioxymethamphetamine (MDMA) has been shown to produce neurotoxic damage and long-lasting changes in several brain areas. In addition to the involvement of serotoninergic and dopaminergic systems, little information exists about the contribution of nociceptin/orphaninFQ (N/OFQ)-NOP and dynorphin (DYN)-KOP systems in neuronal adaptations evoked by MDMA. Here we investigated the behavioral and molecular effects induced by acute (8mg/kg) or repeated (8mg/kg twice daily for seven days) MDMA exposure. MDMA exposure affected body weight gain and induced hyperlocomotion; this latter effect progressively decreased after repeated administration. Gene expression analysis indicated a down-regulation of the N/OFQ system and an up-regulation of the DYN system in the nucleus accumbens (NAc), highlighting an opposite systems regulation in response to MDMA exposure. Since histone modifications have been strongly associated to the addiction-related maladaptive changes, we examined two permissive (acH3K9 and me3H3K4) and two repressive transcription marks (me3H3K27 and me2H3K9) at the pertinent opioid gene promoter regions. Chromatin immunoprecipitation assays revealed that acute MDMA increased me3H3K4 at the pN/OFQ, pDYN and NOP promoters. Following acute and repeated treatment a significant decrease of acH3K9 at the pN/OFQ promoter was observed, which correlated with gene expression results. Acute treatment caused an acH3K9 increase and a me2H3K9 decrease at the pDYN promoter which matched its mRNA up-regulation. Our data indicate that the activation of the DYNergic stress system together with the inactivation of the N/OFQergic anti-stress system contribute to the neuroadaptive actions of MDMA and offer novel epigenetic information associated with MDMA abuse. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  1. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  2. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    International Nuclear Information System (INIS)

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  3. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  4. Genetic basis for childhood interstitial lung disease among Japanese infants and children.

    Science.gov (United States)

    Hayasaka, Itaru; Cho, Kazutoshi; Akimoto, Takuma; Ikeda, Masahiko; Uzuki, Yutaka; Yamada, Masafumi; Nakata, Koh; Furuta, Itsuko; Ariga, Tadashi; Minakami, Hisanori

    2018-02-01

    BackgroundGenetic variants responsible for childhood interstitial lung disease (chILD) have not been studied extensively in Japanese patients.MethodsThe study population consisted of 62 Japanese chILD patients. Twenty-one and four patients had pulmonary hypertension resistant to treatment (PH) and hypothyroidism, respectively. Analyses of genetic variants were performed in all 62 patients for SFTPC and ABCA3, in all 21 PH patients for FOXF1, and in a limited number of patients for NKX2.1.ResultsCausative genetic variants for chILD were identified in 11 (18%) patients: SFTPC variants in six, NKX2.1 variants in three, and FOXF1 variants in two patients. No patients had ABCA3 variants. All three and two patients with NKX2.1 variants had hypothyroidism and developmental delay, respectively. We found six novel variants in this study.ConclusionMutations in SFTPC, NKX2.1, and FOXF1 were identified among Japanese infants and children with chILD, whereas ABCA3 mutations were rare.

  5. Improvement of H2S Sensing Properties of SnO2-Based Thick Film Gas Sensors Promoted with MoO3 and NiO

    Directory of Open Access Journals (Sweden)

    In Sung Son

    2013-03-01

    Full Text Available The effects of the SnO2 pore size and metal oxide promoters on the sensing properties of SnO2-based thick film gas sensors were investigated to improve the detection of very low H2S concentrations (<1 ppm. SnO2 sensors and SnO2-based thick-film gas sensors promoted with NiO, ZnO, MoO3, CuO or Fe2O3 were prepared, and their sensing properties were examined in a flow system. The SnO2 materials were prepared by calcining SnO2 at 600, 800, 1,000 and 1,200 °C to give materials identified as SnO2(600, SnO2(800, SnO2(1000, and SnO2(1200, respectively. The Sn(12Mo5Ni3 sensor, which was prepared by physically mixing 5 wt% MoO3 (Mo5, 3 wt% NiO (Ni3 and SnO2(1200 with a large pore size of 312 nm, exhibited a high sensor response of approximately 75% for the detection of 1 ppm H2S at 350 °C with excellent recovery properties. Unlike the SnO2 sensors, its response was maintained during multiple cycles without deactivation. This was attributed to the promoter effect of MoO3. In particular, the Sn(12Mo5Ni3 sensor developed in this study showed twice the response of the Sn(6Mo5Ni3 sensor, which was prepared by SnO2(600 with the smaller pore size than SnO2(1200. The excellent sensor response and recovery properties of Sn(12Mo5Ni3 are believed to be due to the combined promoter effects of MoO3 and NiO and the diffusion effect of H2S as a result of the large pore size of SnO2.

  6. A PKC-dependent recruitment of MMP-2 controls semaphorin-3A growth-promoting effect in cortical dendrites.

    Directory of Open Access Journals (Sweden)

    Bertrand Gonthier

    Full Text Available There is increasing evidence for a crucial role of proteases and metalloproteinases during axon growth and guidance. In this context, we recently described a functional link between the chemoattractive Sema3C and Matrix metalloproteinase 3 (MMP3. Here, we provide data demonstrating the involvement of MMP-2 to trigger the growth-promoting effect of Sema3A in cortical dendrites. The in situ analysis of MMP-2 expression and activity is consistent with a functional growth assay demonstrating in vitro that the pharmacological inhibition of MMP-2 reduces the growth of cortical dendrites in response to Sema3A. Hence, our results suggest that the selective recruitment and activation of MMP-2 in response to Sema3A requires a PKC alpha dependent mechanism. Altogether, we provide a second set of data supporting MMPs as effectors of the growth-promoting effects of semaphorins, and we identify the potential signalling pathway involved.

  7. SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig.

    Science.gov (United States)

    Ryan, Marion T; Hamill, Ruth M; O'Halloran, Aisling M; Davey, Grace C; McBryan, Jean; Mullen, Anne M; McGee, Chris; Gispert, Marina; Southwood, Olwen I; Sweeney, Torres

    2012-07-25

    The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK), a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs) in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP) and intramuscular fat (IMF) in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G) characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98), Duroc (n = 99) and Pietrain (n = 98) purebreds. Four major haplotypes including promoter SNP's g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL) and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT), pH at 45 min in LTL (pH(45)LT) and pH at 45 min in the M. semimembranosus muscle (pH(45)SM). HAP3 was associated with driploss%, pHULT pH(45)LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2, HAP3 and HAP4) in the Duroc breed. The

  8. SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig

    Directory of Open Access Journals (Sweden)

    Ryan Marion T

    2012-07-01

    Full Text Available Abstract Background The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK, a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. Results PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP and intramuscular fat (IMF in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98, Duroc (n = 99 and Pietrain (n = 98 purebreds. Four major haplotypes including promoter SNP’s g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT, pH at 45 min in LTL (pH45LT and pH at 45 min in the M. semimembranosus muscle (pH45SM. HAP3 was associated with driploss%, pHULT pH45LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2

  9. Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

    International Nuclear Information System (INIS)

    Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

    2004-01-01

    The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder

  10. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  11. Indolo[3,2-b]carbazole inhibits gap junctional intercellular communication in rat primary hepatocytes and acts as a potential tumor promoter

    DEFF Research Database (Denmark)

    Herrmann, Susan; Seidelin, Michel; Bisgaard, Hanne Cathrine

    2002-01-01

    Indole-3-carbinol (I3C) is a naturally occurring substance that shows anti-carcinogenic properties in animal models. Besides its clear anti-carcinogenic effects, some studies indicate that I3C may sometimes act as a tumor promoter. Indolo[3,2-b]carbazole (ICZ), which is formed in the acidic...... environment of the stomach after intake of I3C, has a similar structure to, and shares biological effects with, the well-known tumor promoter 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). Therefore, we hypothesized that ICZ could be responsible for the potential tumor-promoting activity of I3C. The aim...

  12. Exploring the potential of the glycerol-3-phosphate dehydrogenase 2 (GPD2) promoter for recombinant gene expression in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna

    2015-01-01

    A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...

  13. NK-like homeodomain proteins activate NOTCH3-signaling in leukemic T-cells

    International Nuclear Information System (INIS)

    Nagel, Stefan; Scherr, Michaela; MacLeod, Roderick AF; Venturini, Letizia; Przybylski, Grzegorz K; Grabarczyk, Piotr; Meyer, Corinna; Kaufmann, Maren; Battmer, Karin; Schmidt, Christian A; Drexler, Hans G

    2009-01-01

    Homeodomain proteins control fundamental cellular processes in development and in cancer if deregulated. Three members of the NK-like subfamily of homeobox genes (NKLs), TLX1, TLX3 and NKX2-5, are implicated in T-cell acute lymphoblastic leukemia (T-ALL). They are activated by particular chromosomal aberrations. However, their precise function in leukemogenesis is still unclear. Here we screened further NKLs in 24 T-ALL cell lines and identified the common expression of MSX2. The subsequent aim of this study was to analyze the role of MSX2 in T-cell differentiation which may be disturbed by oncogenic NKLs. Specific gene activity was examined by quantitative real-time PCR, and globally by expression profiling. Proteins were analyzed by western blot, immuno-cytology and immuno-precipitation. For overexpression studies cell lines were transduced by lentiviruses. Quantification of MSX2 mRNA in primary hematopoietic cells demonstrated higher levels in CD34+ stem cells as compared to peripheral blood cells and mature CD3+ T-cells. Furthermore, analysis of MSX2 expression levels in T-cell lines after treatment with core thymic factors confirmed their involvement in regulation. These results indicated that MSX2 represents an hematopoietic NKL family member which is downregulated during T-cell development and may functionally substituted by oncogenic NKLs. For functional analysis JURKAT cells were lentivirally transduced, overexpressing either MSX2 or oncogenic TLX1 and NKX2-5, respectively. These cells displayed transcriptional activation of NOTCH3-signaling, including NOTCH3 and HEY1 as analyzed by gene expression profiling and quantitative RT-PCR, and consistently attenuated sensitivity to gamma-secretase inhibitor as analyzed by MTT-assays. Furthermore, in addition to MSX2, both TLX1 and NKX2-5 proteins interacted with NOTCH-pathway repressors, SPEN/MINT/SHARP and TLE1/GRG1, representing a potential mechanism for (de)regulation. Finally, elevated expression of NOTCH3

  14. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva

    2016-01-01

    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  15. The miR-599 promotes non-small cell lung cancer cell invasion via SATB2

    International Nuclear Information System (INIS)

    Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran

    2017-01-01

    MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.

  16. The Role of S P2, SP3 AND SP4 in The Transcriptional Regulation of The Promoter of Nuclear Encoded Mitochondrial Genes

    International Nuclear Information System (INIS)

    Zaid, A.; Salem, Gh.

    2012-01-01

    The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.

  17. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus.

    Science.gov (United States)

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

    2017-04-01

    Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Zinc deficiency promotes cystitis-related bladder pain by enhancing function and expression of Cav3.2 in mice.

    Science.gov (United States)

    Ozaki, Tomoka; Matsuoka, Junki; Tsubota, Maho; Tomita, Shiori; Sekiguchi, Fumiko; Minami, Takeshi; Kawabata, Atsufumi

    2018-01-15

    Ca v 3.2 T-type Ca 2+ channel activity is suppressed by zinc that binds to the extracellular histidine-191 of Ca v 3.2, and enhanced by H 2 S that interacts with zinc. Ca v 3.2 in nociceptors is upregulated in an activity-dependent manner. The enhanced Ca v 3.2 activity by H 2 S formed by the upregulated cystathionine-γ-lyase (CSE) is involved in the cyclophosphamide (CPA)-induced cystitis-related bladder pain in mice. We thus asked if zinc deficiency affects the cystitis-related bladder pain in mice by altering Ca v 3.2 function and/or expression. Dietary zinc deficiency for 2 weeks greatly decreased zinc concentrations in the plasma but not bladder tissue, and enhanced the bladder pain/referred hyperalgesia (BP/RH) following CPA at 200mg/kg, a subeffective dose, but not 400mg/kg, a maximal dose, an effect abolished by pharmacological blockade or gene silencing of Ca v 3.2. Acute zinc deficiency caused by systemic N,N,N',N'-tetrakis-(2-pyridylmethyl)-ethylendiamine (TPEN), a zinc chelator, mimicked the dietary zinc deficiency-induced Ca v 3.2-dependent promotion of BP/RH following CPA at 200mg/kg. CPA at 400mg/kg alone or TPEN plus CPA at 200mg/kg caused Ca v 3.2 overexpression accompanied by upregulation of Egr-1 and USP5, known to promote transcriptional expression and reduce proteasomal degradation of Ca v 3.2, respectively, in the dorsal root ganglia (DRG). The CSE inhibitor, β-cyano-l-alanine, prevented the BP/RH and upregulation of Ca v 3.2, Egr-1 and USP5 in DRG following TPEN plus CPA at 200mg/kg. Together, zinc deficiency promotes bladder pain accompanying CPA-induced cystitis by enhancing function and expression of Ca v 3.2 in nociceptors, suggesting a novel therapeutic avenue for treatment of bladder pain, such as zinc supplementation. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Dual reporter transgene driven by 2.3Col1a1 promoter is active in differentiated osteoblasts

    Science.gov (United States)

    Marijanovic, Inga; Jiang, Xi; Kronenberg, Mark S.; Stover, Mary Louise; Erceg, Ivana; Lichtler, Alexander C.; Rowe, David W.

    2003-01-01

    AIM: As quantitative and spatial analyses of promoter reporter constructs are not easily performed in intact bone, we designed a reporter gene specific to bone, which could be analyzed both visually and quantitatively by using chloramphenicol acetyltransferase (CAT) and a cyan version of green fluorescent protein (GFPcyan), driven by a 2.3-kb fragment of the rat collagen promoter (Col2.3). METHODS: The construct Col2.3CATiresGFPcyan was used for generating transgenic mice. Quantitative measurement of promoter activity was performed by CAT analysis of different tissues derived from transgenic animals; localization was performed by visualized GFP in frozen bone sections. To assess transgene expression during in vitro differentiation, marrow stromal cell and neonatal calvarial osteoblast cultures were analyzed for CAT and GFP activity. RESULTS: In mice, CAT activity was detected in the calvaria, long bone, teeth, and tendon, whereas histology showed that GFP expression was limited to osteoblasts and osteocytes. In cell culture, increased activity of CAT correlated with increased differentiation, and GFP activity was restricted to mineralized nodules. CONCLUSION: The concept of a dual reporter allows a simultaneous visual and quantitative analysis of transgene activity in bone.

  20. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-06-15

    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  1. Genome wide binding (ChIP-Seq of murine Bapx1 and Sox9 proteins in vivo and in vitro

    Directory of Open Access Journals (Sweden)

    Sumantra Chatterjee

    2016-12-01

    Full Text Available This work pertains to GEO submission GSE36672, in vivo and in vitro genome wide binding (ChIP-Seq of Bapx1/Nkx3.2 and Sox9 proteins. We have previously shown that data from a genome wide binding assay combined with transcriptional profiling is an insightful means to divulge the mechanisms directing cell type specification and the generation of tissues and subsequent organs [1]. Our earlier work identified the role of the DNA-binding homeodomain containing protein Bapx1/Nkx3.2 in midgestation murine embryos. Microarray analysis of EGFP-tagged cells (both wildtype and null was integrated using ChIP-Seq analysis of Bapx1/Nkx3.2 and Sox9 DNA-binding proteins in living tissue.

  2. Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.

    Science.gov (United States)

    Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T

    2017-08-01

    X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Fine genetic structure of the 2D3-2F5 region of the X-chromosome of Drosophila melanogaster

    International Nuclear Information System (INIS)

    Gvozdev, V.A.; Gostimsky, S.A.; Gerasimova, T.I.; Dubrovskaya, E.S.; Braslavskaya, O.Yu.

    1975-01-01

    97 lethal and semilethal mutations were induced by ethyl methanesulfonate, nitrosomethyl urea and γ-irradiation in the 2D3-F5 region of the X-chromosome of D. melanogaster. Approximately 1 per cent of the tested X-chromosomes carried a lethal in the 2D3-2F5 region. The mutation frequencies per band of DNA content in this region and the whole X-chromosome are equal. Complementation analysis revealed at least 10 functionally independent essential loci in this region including about 10 bands. The data presented in this study support the one band - one gene hypothesis. The Pgd locus coding for 6-phosphogluconate dehydrogenase (6PGD) is mapped in the 2D3 (or 2D4) band. Isolation of 11 lethal or semilethal point mutations with null or reduced 6PGD acticity shows that the Pgd locus is a vital one. (orig.) [de

  4. The FAK–Arp2/3 interaction promotes leading edge advance and haptosensing by coupling nascent adhesions to lamellipodia actin

    Science.gov (United States)

    Swaminathan, Vinay; Fischer, R. S.; Waterman, Clare M.

    2016-01-01

    Cell migration is initiated in response to biochemical or physical cues in the environment that promote actin-mediated lamellipodial protrusion followed by the formation of nascent integrin adhesions (NAs) within the protrusion to drive leading edge advance. Although FAK is known to be required for cell migration through effects on focal adhesions, its role in NA formation and lamellipodial dynamics is unclear. Live-cell microscopy of FAK−/− cells with expression of phosphorylation deficient or a FERM-domain mutant deficient in Arp2/3 binding revealed a requirement for FAK in promoting the dense formation, transient stabilization, and timely turnover of NA within lamellipodia to couple actin-driven protrusion to adhesion and advance of the leading edge. Phosphorylation on Y397 of FAK promotes dense NA formation but is dispensable for transient NA stabilization and leading edge advance. In contrast, transient NA stabilization and advance of the cell edge requires FAK–Arp2/3 interaction, which promotes Arp2/3 localization to NA and reduces FAK activity. Haptosensing of extracellular matrix (ECM) concentration during migration requires the interaction between FAK and Arp2/3, whereas FAK phosphorylation modulates mechanosensing of ECM stiffness during spreading. Taken together, our results show that mechanistically separable functions of FAK in NA are required for cells to distinguish distinct properties of their environment during migration. PMID:26842895

  5. SH2-B promotes insulin receptor substrate 1 (IRS1)- and IRS2-mediated activation of the phosphatidylinositol 3-kinase pathway in response to leptin.

    Science.gov (United States)

    Duan, Chaojun; Li, Minghua; Rui, Liangyou

    2004-10-15

    Leptin regulates energy homeostasis primarily by binding and activating its long form receptor (LRb). Deficiency of either leptin or LRb causes morbid obesity. Leptin stimulates LRb-associated JAK2, thus initiating multiple pathways including the Stat3 and phosphatidylinositol (PI) 3-kinase pathways that mediate leptin biological actions. Here we report that SH2-B, a JAK2-interacting protein, promotes activation of the PI 3-kinase pathway by recruiting insulin receptor substrate 1 (IRS1) and IRS2 in response to leptin. SH2-B directly bound, via its PH and SH2 domain, to both IRS1 and IRS2 both in vitro and in intact cells and mediated formation of a JAK2/SH2-B/IRS1 or IRS2 tertiary complex. Consequently, SH2-B dramatically enhanced leptin-stimulated tyrosine phosphorylation of IRS1 and IRS2 in HEK293 cells stably expressing LRb, thus promoting association of IRS1 and IRS2 with the p85 regulatory subunit of PI 3-kinase and phosphorylation and activation of Akt. SH2-B mutants with lower affinity for IRS1 and IRS2 exhibited reduced ability to promote association of JAK2 with IRS1, tyrosine phosphorylation of IRS1, and association of IRS1 with p85 in response to leptin. Moreover, deletion of the SH2-B gene impaired leptin-stimulated tyrosine phosphorylation of endogenous IRS1 in mouse embryonic fibroblasts (MEF), which was reversed by reintroduction of SH2-B. Similarly, SH2-B promoted growth hormone-stimulated tyrosine phosphorylation of IRS1 in both HEK293 and MEF cells. Our data suggest that SH2-B is a novel mediator of the PI 3-kinase pathway in response to leptin or other hormones and cytokines that activate JAK2.

  6. The Adsorption Geometry and Electronic Structure of Organic Dye Molecule on TiO2(101 Surface from First Principles Calculations

    Directory of Open Access Journals (Sweden)

    Niu Mang

    2017-01-01

    Full Text Available Using density functional theory (DFT, we have investigated the structural and electronic properties of dye-sensitized solar cells (DSSCs comprised of I-doped anatase TiO2(101 surface sensitized with NKX-2554 dye. The calculation results indicate that the cyanoacrylic acid anchoring group in NKX-2554 has a strong binding to the TiO2(101 surface. The dissociative and bidentate bridging type was found to be the most favorable adsorption configuration. On the other hand, the incorporations of I dopant can reduce the band gap of TiO2 photoanode and improve the of NKX-2554 dye, which can improve the visible-light absorption of anatase TiO2 and can also facilitate the electron injection from the dye molecule to the TiO2 substrate. As a result, the I doping can significantly enhance the incident photon-to-current conversion efficiency (IPCE of DSSCs.

  7. Effect of Ni/Al2O3-SiO2 and Ni/Al2O3-SiO2 with K2O Promoter Catalysts on H2, CO and CH4 Concentration by CO2 Gasification of Rosa Multiflora Biomass

    Directory of Open Access Journals (Sweden)

    Tursunov Obid

    2017-11-01

    Full Text Available The thermal behaviour of the Rosa mutiflora biomass by thermogravimetric analysis was studied at heating rate 3 K min−1 from ambient temperature to 950 °C. TGA tests were performed in high purity carbon dioxide (99 998% with a flow rate 200 ml/min and 100 mg of sample, milled and sieved to a particle size below 250 µm. Moreover, yields of gasification products such as hydrogen (H2, carbon monoxide (CO and methane (CH4 were determined based on the thermovolumetric measurements of catalytic (Ni/Al2O3-SiO2 and Ni/Al2O3-SiO2 with K2O promoter catalysts and non-catalytic gasification of the Rosa multiflora biomass. Additionally, carbon conversion degrees are presented. Calculations were made of the kinetic parameters of carbon monoxide and hydrogen formation reaction in the catalytic and non-catalytic CO2 gasification processes. A high temperature of 950 °C along with Ni/Al2O3-SiO2and Ni/Al2O3-SiO2 with K2O promoter catalysts resulted in a higher conversion of Rosa multiflora biomass into gaseous yield production with greatly increasing of H2 and CO contents. Consequently, H2 and CO are the key factors to produce renewable energy and bio-gases (synthesis gas. The parameters obtained during the experimental examinations enable a tentative assessment of plant biomasses for the process of large-scale gasification in industrial sectors.

  8. Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

    Science.gov (United States)

    Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson

    2014-01-01

    The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940

  9. Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

    OpenAIRE

    Vitor Braga

    2004-01-01

    The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

  10. Does energy and CO_2 emissions performance of China benefit from regional integration?

    International Nuclear Information System (INIS)

    Li, Jianglong; Lin, Boqiang

    2017-01-01

    Low energy and carbon efficiency and widespread market segmentation are two stylized facts of China's regional economies. This paper evaluates energy and CO_2 emissions performance using a newly developed non-radial directional distance function, and China's regional integration is investigated using a price approach. The study points to evidence that: (1) most provinces do not perform efficiently in terms of energy use and CO_2 emissions with performance gaps among regions becoming larger, indicating regional segmentation; (2) magnitude of regional integration has increased dramatically, while China's eastern provinces are less integrated in domestic side due to their convenience to international openness; (3) regional integration has significant and robust positive effects on energy and CO_2 emissions performance with over 70% of effects coming from artificial barriers, rather than geographical distance; (4) international openness is also beneficial for promoting energy and CO_2 emissions performance, but cannot substitute for regional integration because of China's specialization in energy-intensive manufacturing in the global economy. Based on the empirical findings, we suggest that central government should continue to encourage regional integration given that local governments have incentives to fragment because it is a way of promoting energy and CO_2 emissions performance and stimulating economy at the same time. - Highlights: • NDDF method is applied to evaluate China's regional energy and carbon performance. • Difficulties in identifying NDDF using parametric approach are discussed. • Panel data of China's regional integration using the price approach is constructed. • Local protectionism is particularly identified by filtering effects of geography. • World trade cannot substitute domestic integration for improving energy efficiency.

  11. Wnt inhibition promotes vascular specification of embryonic cardiac progenitors.

    Science.gov (United States)

    Reichman, David E; Park, Laura; Man, Limor; Redmond, David; Chao, Kenny; Harvey, Richard P; Taketo, Makoto M; Rosenwaks, Zev; James, Daylon

    2018-01-08

    Several studies have demonstrated a multiphasic role for Wnt signaling during embryonic cardiogenesis and developed protocols that enrich for cardiac derivatives during in vitro differentiation of human pluripotent stem cells (hPSCs). However, few studies have investigated the role of Wnt signaling in the specification of cardiac progenitor cells (CPCs) toward downstream fates. Using transgenic mice and hPSCs, we tracked endothelial cells (ECs) that originated from CPCs expressing NKX2.5. Analysis of EC-fated CPCs at discrete phenotypic milestones during hPSC differentiation identified reduced Wnt activity as a hallmark of EC specification, and the enforced activation or inhibition of Wnt reduced or increased, respectively, the degree of vascular commitment within the CPC population during both hPSC differentiation and mouse embryogenesis. Wnt5a, which has been shown to exert an inhibitory influence on Wnt signaling during cardiac development, was dynamically expressed during vascular commitment of hPSC-derived CPCs, and ectopic Wnt5a promoted vascular specification of hPSC-derived and mouse embryonic CPCs. © 2018. Published by The Company of Biologists Ltd.

  12. Wide band antireflective coatings Al2O3 / HfO2 / MgF2 for UV region

    Science.gov (United States)

    Winkowski, P.; Marszałek, Konstanty W.

    2013-07-01

    Deposition technology of the three layers antireflective coatings consists of hafnium compound are presented in this paper. Oxide films were deposited by means of e-gun evaporation in vacuum of 5x10-5 mbar in presence of oxygen and fluoride films by thermal evaporation. Substrate temperature was 250°C. Coatings were deposited onto optical lenses made from quartz glass (Corning HPFS). Thickness and deposition rate were controlled by thickness measuring system Inficon XTC/2. Simulations leading to optimization of thickness and experimental results of optical measurements carried during and after deposition process were presented. Physical thickness measurements were made during deposition process and were equal to 43 nm/74 nm/51 nm for Al2O3 / HfO2 / MgF2 respectively. Optimization was carried out for ultraviolet region from 230nm to the beginning of visible region 400 nm. In this region the average reflectance of the antireflective coating was less than 0.5% in the whole range of application.

  13. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.

    1987-01-01

    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  14. Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.

    Science.gov (United States)

    Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru

    2012-07-01

    Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.

  15. Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Hsu Anna

    2011-10-01

    Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.

  16. Gas6 Promotes Inflammatory (CCR2hiCX3CR1lo) Monocyte Recruitment in Venous Thrombosis.

    Science.gov (United States)

    Laurance, Sandrine; Bertin, François-René; Ebrahimian, Talin; Kassim, Yusra; Rys, Ryan N; Lehoux, Stéphanie; Lemarié, Catherine A; Blostein, Mark D

    2017-07-01

    Coagulation and inflammation are inter-related. Gas6 (growth arrest-specific 6) promotes venous thrombosis and participates to inflammation through endothelial-innate immune cell interactions. Innate immune cells can provide the initiating stimulus for venous thrombus development. We hypothesize that Gas6 promotes monocyte recruitment during venous thrombosis. Deep venous thrombosis was induced in wild-type and Gas6-deficient (-/-) mice using 5% FeCl 3 and flow reduction in the inferior vena cava. Total monocyte depletion was achieved by injection of clodronate before deep venous thrombosis. Inflammatory monocytes were depleted using an anti-C-C chemokine receptor type 2 (CCR2) antibody. Similarly, injection of an anti-chemokine ligand 2 (CCL2) antibody induced CCL2 depletion. Flow cytometry and immunofluorescence were used to characterize the monocytes recruited to the thrombus. In vivo, absence of Gas6 was associated with a reduction of monocyte recruitment in both deep venous thrombosis models. Global monocyte depletion by clodronate leads to smaller thrombi in wild-type mice. Compared with wild type, the thrombi from Gas6 -/- mice contain less inflammatory (CCR2 hi CX 3 CR1 lo ) monocytes, consistent with a Gas6-dependent recruitment of this monocyte subset. Correspondingly, selective depletion of CCR2 hi CX 3 CR1 lo monocytes reduced the formation of venous thrombi in wild-type mice demonstrating a predominant role of the inflammatory monocytes in thrombosis. In vitro, the expression of both CCR2 and CCL2 were Gas6 dependent in monocytes and endothelial cells, respectively, impacting monocyte migration. Moreover, Gas6-dependent CCL2 expression and monocyte migration were mediated via JNK (c-Jun N-terminal kinase). This study demonstrates that Gas6 specifically promotes the recruitment of inflammatory CCR2 hi CX 3 CR1 lo monocytes through the regulation of both CCR2 and CCL2 during deep venous thrombosis. © 2017 American Heart Association, Inc.

  17. mPGES-1-derived prostaglandin E2 stimulates Stat3 to promote podocyte apoptosis.

    Science.gov (United States)

    Yu, Jing; Wu, Yimei; Wang, Lu; Zhang, Wen; Xu, Man; Song, Jiayu; Fu, Yu; Cui, Yiyun; Gong, Wei; Li, Shuzhen; Xia, Weiwei; Huang, Songming; Zhang, Aihua; Jia, Zhanjun

    2017-11-01

    We previously reported that microsomal prostaglandin E synthase-1 (mPGES-1) contributed to adriamycin (Adr)-induced podocyte apoptosis. However, the molecular mechanism remains unclear. Here we studied the role of mPGES-1/PGE2 cascade in activating Stat3 signaling and the contribution of Stat3 in PGE2- and Adr-induced podocyte apoptosis. In murine podocytes, PGE2 dose- and time-dependently increased the phosphorylation of Stat3 in line with the enhanced cell apoptosis and reduced podocyte protein podocin. In agreement with the increased Stat3 phosphorylation, Stat3-derived cytokines including IL-6, IL-17, MCP-1, and ICAM-1 were significantly upregulated following PGE2 treatment. By application of a specific Stat3 inhibitor S3I-201, PGE2-induced podocyte apoptosis was largely abolished in parallel with a blockade of podocin reduction. Next, we observed that Adr treatment also enhanced p-Stat3 and activated mPGES-1/PGE2 cascade. Blockade of Stat3 by S3I-201 significantly ameliorated Adr-induced cell apoptosis and podocin reduction. More interestingly, silencing mPGES-1 in podocytes by mPGES-1 siRNA blocked Adr-induced increments of Stat-3 phosphorylation, PGE2 production, and Stat3-derived inflammatory cytokines. Taken together, this study suggested that mPGES-1-derived PGE2 could activate Stat3 signaling to promote podocyte apoptosis. Targeting mPGES-1/PGE2/Stat3 signaling might be a potential strategy for the treatment of podocytopathy.

  18. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  19. Development and characterization of nickel catalysts supported in CeO{sub 2}-ZrO{sub 2}-Al{sub 2}O{sub 3}, CeO{sub 2}-La{sub 2}O{sub 3}-Al{sub 2}O{sub 3} e ZrO{sub 2}-La{sub 2}O{sub 3}-Al{sub 2}O{sub 3} matrixes evaluated for methane reforming reactions; Desenvolvimento e caracterização de catalisadores de níquel suportados em matrizes CeO{sub 2}-ZrO{sub 2}-Al{sub 2}O{sub 3}, CeO{sub 2}-La{sub 2}O{sub 3}-Al{sub 2}O{sub 3} e ZrO{sub 2}-La{sub 2}O{sub 3}-Al{sub 2}O{sub 3} avaliados para as reações de reforma do metano

    Energy Technology Data Exchange (ETDEWEB)

    Abreu, Amanda Jordão de

    2012-07-01

    Nowadays, the methane reforming is large interest industrial for the take advantage of these gas in production the hydrogen and synthesis gas (syngas). Among in the reactions of methane stand of the reactions steam reforming and carbon dioxide reforming of methane. The main catalysts uses in the methane reforming is Ni/Al{sub 2}O{sub 3}. However, the supported-nickel catalyst is susceptible to the deactivation or the destruction by coke deposition. The carbon dissolves in the nickel crystallite and its diffuses through the nickel, leading for formation of the carbon whiskers, which results in fragmentation of the catalyst. Modification of such catalysts, like incorporation of suitable promoters, is desirable to achieve reduction of the methane hydrogenolysis and/or promotion of the carbon gasification. Catalysts 5%Ni/Al{sub 2}O{sub 3} supported on solid solutions formed by ZrO{sub 2}-CeO{sub 2}, La{sub 2}O{sub 3} and CeO{sub 2}-ZrO{sub 2}-La{sub 2}O{sub 3} were prepared, characterized and evaluated in reactions steam and carbon dioxide reforming and partial oxidation of methane with objective the value effect loading solution solid in support. The supports were prepared by co-precipitation method and catalysts were prepared by impregnation method and calcined at 500 deg C. The supports and catalysts were characterized by Nitrogen Adsorption, method -rays diffraction (XRD), X-rays dispersive spectroscopy (XDS), spectroscopy in the region of the ultraviolet and the visible (UV-vis NIR) to and temperature programmed reduction (TPR), Raman Spectroscopy, X-ray absorption spectroscopy and Thermogravimetric Analysis. After all the catalytic reactions check which the addition of solid solution is beneficial for Ni/Al{sub 2}O{sub 3} catalysts and the best catalysts are Ni/CeO{sub 2}-La{sub 2}O{sub 3}-Al{sub 2}O{sub 3}. (author)

  20. Msx1 and Msx2 are functional interacting partners of T-box factors in the regulation of Connexin43.

    Science.gov (United States)

    Boogerd, Kees-Jan; Wong, L Y Elaine; Christoffels, Vincent M; Klarenbeek, Meinke; Ruijter, Jan M; Moorman, Antoon F M; Barnett, Phil

    2008-06-01

    T-box factors Tbx2 and Tbx3 play key roles in the development of the cardiac conduction system, atrioventricular canal, and outflow tract of the heart. They regulate the gap-junction-encoding gene Connexin43 (Cx43) and other genes critical for heart development and function. Discovering protein partners of Tbx2 and Tbx3 will shed light on the mechanisms by which these factors regulate these gene programs. Employing an yeast 2-hybrid screen and subsequent in vitro pull-down experiments we demonstrate that muscle segment homeobox genes Msx1 and Msx2 are able to bind the cardiac T-box proteins Tbx2, Tbx3, and Tbx5. This interaction, as that of the related Nkx2.5 protein, is supported by the T-box and homeodomain alone. Overlapping spatiotemporal expression patterns of Msx1 and Msx2 together with the T-box genes during cardiac development in mouse and chicken underscore the biological significance of this interaction. We demonstrate that Msx proteins together with Tbx2 and Tbx3 suppress Cx43 promoter activity and down regulate Cx43 gene activity in a rat heart-derived cell line. Using chromatin immunoprecipitation analysis we demonstrate that Msx1 can bind the Cx43 promoter at a conserved binding site located in close proximity to a previously defined T-box binding site, and that the activity of Msx proteins on this promoter appears dependent in the presence of Tbx3. Msx1 and Msx2 can function in concert with the T-box proteins to suppress Cx43 and other working myocardial genes.

  1. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  2. Perspectives on Promoting Regional Renewable Energy Research and Development

    International Nuclear Information System (INIS)

    Dresselhaus, M.

    2008-01-01

    Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

  3. [Brd3 promotes IL-6 production via enhancing acetylase CBP recruitment and histone 3 acetylation within IL6 promoter].

    Science.gov (United States)

    Ren, Wenhui; Sun, Donghao; Wang, Chunmei; Li, Nan

    2016-10-01

    Objective To investigate the role of bromodomain containing 3 (Brd3) in LPS-triggered interleukin-6 (IL-6) production in macrophages and the underlying mechanism. Methods CRISPR-Cas9 technology was used to screen an RAW264.7 cell line with Brd3 knockout (Brd3 -/- ). The Brd3 -/- cells were used as an experimental group, and the parential cells expressing wide-type Brd3 as a control group. The IL-6 level in cell culture supernatant was detected by ELISA after 100 ng/mL LPS challenging. Effect of Brd3 knockout on the expression and activation of signal pathways involved in IL-6 expression, including the NF-κB and mitogen-activated protein kinase (MAPK) pathways were examined by Western blot analysis. Chromatin immunoprecipitation (ChIP) assay was used to evaluate the recruitment of acetylase CREB-binding protein (CBP) to IL6 gene promoter and the acetylation level of histone 3 within IL6 gene promoter. Results LPS treatment significantly downregulated Brd3 expression in mouse peritoneal macrophages. LPS-induced production of IL-6 was significantly inhibited in Brd3 -/- macrophages. The expressions and activation of signal molecules within NF-κB and MAPK pathways were barely affected. Brd3 knockout significantly decreased the recruitment of acetylase CBP to IL6 gene promoter, and the acetylation level of histone3 within IL6 gene promoter was also repressed. Conclusion Brd3 promotes LPS-triggered IL-6 production via promoting the recruitment of CBP to IL6 promoter and enhancing the acetylation level of histone 3 within IL6 promoter.

  4. Surfactant-promoted reactions of Cl2 and Br2 with Br- in glycerol.

    Science.gov (United States)

    Faust, Jennifer A; Dempsey, Logan P; Nathanson, Gilbert M

    2013-10-17

    Gas-liquid scattering experiments are used to explore reactions of gaseous Cl2 and Br2 with a 0.03 M solution of the surfactant tetrahexylammonium bromide (THABr) dissolved in glycerol. At thermal collision energies, 79 ± 2% of incident Cl2 molecules react with Br(-) to form Cl2Br(-) in the interfacial region. This reaction probability is three times greater than the reactivity of Cl2 with 3 M NaBr-glycerol, even though the interfacial Br(-) concentrations are similar in each solution. We attribute the high 79% uptake to the presence of surface THA(+) ions that stabilize the Cl2Br(-) intermediate as it is formed in the charged, hydrophobic pocket created by the hexyl chains. Cl2Br(-) generates the single exchange product BrCl in a 1% yield close to the surface, while the remaining 99% desorbs as the double exchange product Br2 over >0.1 s after diffusing deeply into the bulk. When NaCl is added to the surfactant solution in a 20:1 Cl(-)/Br(-) ratio, the Cl2 reaction probability drops from 79% to 46 ± 1%, indicating that Cl(-) in the interfacial region only partially blocks reaction with Br(-). In parallel, we observe that gaseous Br2 molecules dissolve in 0.03 M THABr for 10(4) times longer than in 3 M NaBr. We attribute this change to formation of stabilizing interfacial and bulk-phase THA(+)Br3(-) ion pairs, in analogy with the capture of Cl2 and formation of THA(+)Cl2Br(-) pairs. The THA(+) ion appears to be a powerful interfacial catalyst for promoting reaction of Cl2 and Br2 with Br(-) and for ferrying the resultant ions into solution.

  5. Regulation of Neurospora Catalase-3 by global heterochromatin formation and its proximal heterochromatin region.

    Science.gov (United States)

    Wang, Yajun; Dong, Qing; Ding, Zhaolan; Gai, Kexin; Han, Xiaoyun; Kaleri, Farah Naz; He, Qun; Wang, Ying

    2016-10-01

    Catalase-3 (CAT-3) constitutes the main catalase activity in growing hyphae of Neurospora crassa, and its activity increases during exponential growth or is induced under different stress conditions. Although extensive progress has been made to identify catalase regulators, the regulation mechanism of CAT-3 at the chromatin level still remains unclear. Here, we aim at investigating the molecular regulation mechanisms of cat-3 at the chromatin level. We found that CAT-3 protein levels increased in mutants defective in proper global heterochromatin formation. Bioinformatics analysis identified a 5-kb AT-rich sequence adjacent to the cat-3 promoter as a heterochromatin region because of its enrichment of H3K9me3 and HP1. Expression of CAT-3 was induced by H 2 O 2 treatment in wild-type and such change occurred along with the accumulation of histone H3 acetylation at 5-kb heterochromatin boundaries and cat-3 locus, but without alteration of its H3K9me3 repressive modification. Moreover, disruption of 5-kb heterochromatin region results in elevated cat-3 expression, and higher levels of cat-3 expression were promoted by the combination with global heterochromatin defective mutants. Interestingly, the molecular weight and activity bands of CAT-3 protein are different in heterochromatin defective mutants compared with those in wild-type, suggesting that its N-terminal processing and modification may be altered. Our study indicates that the local chromatin structure creates a heterochromatin repressive environment to repress nearby gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. SIRPA, VCAM1 and CD34 identify discrete lineages during early human cardiovascular development

    Directory of Open Access Journals (Sweden)

    Rhys J.P. Skelton

    2014-07-01

    Full Text Available The study of human cardiogenesis would benefit from a detailed cell lineage fate map akin to that established for the haematopoietic lineages. Here we sought to define cell lineage relationships based on the expression of NKX2-5 and the cell surface markers VCAM1, SIRPA and CD34 during human cardiovascular development. Expression of NKX2-5GFP was used to identify cardiac progenitors and cardiomyocytes generated during the differentiation of NKX2-5GFP/w human embryonic stem cells (hESCs. Cardiovascular cell lineages sub-fractionated on the basis of SIRPA, VCAM1 and CD34 expression were assayed for differentiation potential and gene expression. The NKX2-5posCD34pos population gave rise to endothelial cells that rapidly lost NKX2-5 expression in culture. Conversely, NKX2-5 expression was maintained in myocardial committed cells, which progressed from being NKX2-5posSIRPApos to NKX2-5posSIRPAposVCAM1pos. Up-regulation of VCAM1 was accompanied by the expression of myofilament markers and reduced clonal capacity, implying a restriction of cell fate potential. Combinatorial expression of NKX2-5, SIRPA, VCAM1 and CD34 can be used to define discrete stages of cardiovascular cell lineage differentiation. These markers identify specific stages of cardiomyocyte and endothelial lineage commitment and, thus provide a scaffold for establishing a fate map of early human cardiogenesis.

  7. Study on aggregation and electric properties in the micro-region of functionalized dithieno[2, 3-b: 3′, 2′-d]thiophene (DTT) oligomers

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Xiaohong; Huang, Xiaowei; Zhang, Jiajia; Lu, Zhijuan; Wang, Hua; Du, Zuliang, E-mail: zld@henu.edu.cn [Key Laboratory for Special Functional Materials of Ministry of Education, Henan University, Kaifeng, 475004 (China)

    2016-07-15

    Three kinds of 2,5,-diphenyl-dithienol[2, 3-b: 3′, 2′-d]thiophene (DP-DTT), 2,5,-distyryl-dithienol[2, 3-b: 3′, 2′-d]thiophene (DEP-DTT) and 2,5,-thienyl-dithienol[2, 3-b: 3′, 2′-d]thiophene (DET-DTT) micro-region structure and electronic properties were studied. Thin films of these functionalized DTT oligomers were prepared in a one-step drop-casting deposition onto highly oriented pyrolytic graphite substrates. The surface structure of these films was characterized by atomic force microscopy (AFM). Conducting probe atomic force microscope (C-AFM) and Kelvin probe force microscope (KFM) were both used to characterize the electronic transport behavior and surface potential distribution. The substituents of DTT oligomers can greatly affect their aggregation and the hopping conductance mechanism was used to explain the Au-DTTs-HOPG junctions. KFM investigation revealed that these oligomers with different substituents have different highest occupied molecular orbital energy levels. The corresponding theoretical analysis reveals similar result to KFM characterization. The I-V results indicated that the aggregates of molecules were the dominating factor to their micro-region electrical transport.

  8. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  9. Is methylation analysis of SFRP2, TFPI2, NDRG4, and BMP3 promoters suitable for colorectal cancer screening in the Korean population?

    Directory of Open Access Journals (Sweden)

    Soo-Kyung Park

    2017-10-01

    Full Text Available Background/Aims: Colorectal cancer (CRC screening using stool DNA was recently found to yield good detection rates. A multi-target stool DNA test (Cologuard®, Exact Sciences, including methylated genes has been recently approved by the U.S. Food and Drug Administration. The aim of this study was to validate these aberrantly methylated genes as stool-based DNA markers for detecting CRC and colorectal advanced adenoma (AA in the Korean population.Methods: A single-center study was conducted in 36 patients with AA; 35 patients with CRC; and 40 endoscopically diagnosed healthy controls using CRC screening colonoscopy. The methylation status of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was investigated blindly using bisulfate-modified stool DNA obtained from 111 participants. Methylation status was investigated by methylation-specific polymerase chain reaction.Results: Methylated SFRP2, TFPI2, NDRG4, and BMP3 promoters were detected in 60.0%, 31.4%, 68.8%, and 40.0% of CRC samples and in 27.8%, 27.8%, 27.8%, and 33.3% of AA samples, respectively. The sensitivities obtained using 4 markers to detect CRC and AA were 94.3% and 72.2%, respectively. The specificity was 55.0%.Conclusions: Our results demonstrate that the SFRP2, TFPI2, NDRG4, and BMP3 promoter methylation analysis of stool sample DNA showed high sensitivity but low specificity for detecting CRC and AA. Because of the low specificity, 4 methylated markers might not be sufficient for CRC screening in the Korean population. Further large-scale studies are required to validate the methylation of these markers in the Asian population and to find new markers for the Asian population.

  10. Growing Significance of EU Institutions in Promotion of Inter-regional policies

    Directory of Open Access Journals (Sweden)

    Ella V. Ermakova

    2014-01-01

    Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

  11. Promoters active in interphase are bookmarked during mitosis by ubiquitination

    Science.gov (United States)

    Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.

    2012-01-01

    We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662

  12. Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

    Science.gov (United States)

    Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

    2014-12-01

    Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  13. Antireflective bilayer coatings based on Al2O3 film for UV region

    Directory of Open Access Journals (Sweden)

    Marszałek Konstanty

    2015-03-01

    Full Text Available Bilayer antireflective coatings consisting of aluminium oxide Al2O3/MgF2 and Al2O3/SiO2 are presented in this paper. Oxide films were deposited by means of e-gun evaporation in vacuum of 5 × 10-3 Pa in the presence of oxygen, and magnesium fluoride was prepared by thermal evaporation on heated optical lenses made from quartz glass (Corning HPFS. Substrate temperature was maintained at 250 _C during the deposition. Thickness and deposition rate were controlled with a thickness measuring system Inficon XTC/2. The experimental results of the optical measurements carried out during and after the deposition process have been presented. Physical thickness measurements were made during the deposition process and resulted in 44 nm/52 nm for Al2O3/MgF2 and 44 nm/50 nm for Al2O3/SiO2 system. Optimization was carried out for ultraviolet region with minimum of reflectance at 300 nm. The influence of post deposition annealing on the crystal structure was determined by X-ray measurements. In the range from ultraviolet to the beginning of visible region, the reflectance of both systems decreased and reached minimum at 290 nm. The value of reflectance at this point, for the coating Al2O3/MgF2 was equal to R290nm = 0.6 % and for Al2O3/SiO2R290nm = 1.1 %. Despite the difference between these values both are sufficient for applications in the UV optical systems for medicine and UV laser technology.

  14. GSTT2 promoter polymorphisms and colorectal cancer risk

    Directory of Open Access Journals (Sweden)

    Ahn Sun-A

    2007-01-01

    Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.

  15. Tissue-Specific Contributions of Paternally Expressed Gene 3 in Lactation and Maternal Care of Mus musculus.

    Directory of Open Access Journals (Sweden)

    Wesley D Frey

    Full Text Available Paternally Expressed Gene 3 (Peg3 is an imprinted gene that controls milk letdown and maternal-caring behaviors. In this study, a conditional knockout allele has been developed in Mus musculus to further characterize these known functions of Peg3 in a tissue-specific manner. The mutant line was first crossed with a germline Cre. The progeny of this cross displayed growth retardation phenotypes. This is consistent with those seen in the previous mutant lines of Peg3, confirming the usefulness of the new mutant allele. The mutant line was subsequently crossed individually with MMTV- and Nkx2.1-Cre lines to test Peg3's roles in the mammary gland and hypothalamus, respectively. According to the results, the milk letdown process was impaired in the nursing females with the Peg3 mutation in the mammary gland, but not in the hypothalamus. This suggests that Peg3's roles in the milk letdown process are more critical in the mammary gland than in the hypothalamus. In contrast, one of the maternal-caring behaviors, nest-building, was interrupted in the females with the mutation in both MMTV- and Nkx2.1-driven lines. Overall, this is the first study to introduce a conditional knockout allele of Peg3 and to further dissect its contribution to mammalian reproduction in a tissue-specific manner.

  16. BF3·Et2O promoted conjugate addition of ethanethiol to electron-deficient alkynes

    Institute of Scientific and Technical Information of China (English)

    Qing Fa Zhou; Xue Ping Chu; Shen Zhao; Tao Lu; Wei Fang Tang

    2012-01-01

    An effective method for the synthesis of vinyl thioethers through the conjugate addition of ethanethiol to electron-deficient alkynes promoted by BF3·Et2O has been developed.Electron-deficient internal alkynes react with ethanethiol in this system to yield mainly Z-isomer of vinyl thioether adducts,while electron-deficient terminal alkynes afford mainly E-isomer of vinyl thioether adducts.

  17. Promotion effect of Pt on a SnO2-WO3 material for NOx sensing

    Science.gov (United States)

    Wang, Chen-Yang; Hong, Zih-Siou; Wu, Ren-Jang

    2015-05-01

    Metal-oxide nanocomposites were prepared over screen-printed gold electrodes to be used as room-temperature NOx (nitric-oxide (NO) and nitrogen dioxide (NO2)) sensors. Various weight ratios of SnO2-WO3 and Pt loadings were used for NO sensing. The sensing materials were characterized using X-ray diffraction (XRD), transmission electron microscopy (TEM) and BET surface analysis. The NO-sensing results indicated that SnO2-WO3 (1:2) was more effective than other materials were. The sensor response (S=resistance of N2/resistance of NO=RN2/RNO) for detecting 1000 ppm of NO at room temperature was 2.6. The response time (T90) and recovery time (TR90) was 40 s and 86 s, respectively. By further loading with 0.5% Pt, the sensor response increased to 3.3. The response and recovery times of 0.5% Pt/SnO2-WO3 (1:2) were 40 s and 206 s, respectively. The linearity of the sensor response for a NO concentration range of 10-1000 ppm was 0.9729. A mechanism involving Pt promotion of the SnO2-WO3 heterojunction was proposed for NO adsorption, surface reaction, and adsorbed NO2 desorption.

  18. Remarkable promoting effect of rhodium on the catalytic performance of Ag/Al2O3 for the selective reduction of NO with decane

    International Nuclear Information System (INIS)

    Sato, Kazuhito; Yoshinari, Tomohiro; Kintaichi, Yoshiaki; Haneda, Masaaki; Hamada, Hideaki

    2003-01-01

    The addition of small amounts of rhodium enhanced the activity of Ag/Al 2 O 3 catalyst for the selective reduction of NO with decane at low temperatures. The Rh-promoted Ag/Al 2 O 3 showed its high performance even in the presence of low concentrations of SO 2 . Based on the catalytic activity for elementary reactions, it was suggested that the role of added rhodium is to enhance the reaction between NO x and decane-derived species, leading to NO reduction. Catalyst characterization by UV-Vis spectroscopy indicated that the major silver species on Rh-promoted Ag/Al 2 O 3 is Ag nn δ+ clusters, which would be responsible for the high activity. FT-IR measurements revealed that the formation rate of isocyanate species, which is a major reaction intermediate, is higher on Rh-promoted Ag/Al 2 O 3

  19. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  20. Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

    2013-10-11

    Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

  1. The mechanism of Naringin-enhanced remyelination after spinal cord injury

    Directory of Open Access Journals (Sweden)

    Wei Rong

    2017-01-01

    Full Text Available Our previous study revealed that intragastric administration of naringin improved remyelination in rats with spinal cord injury and promoted the recovery of neurological function of the injured spinal cord. This study sought to reveal the mechanisms by which naringin improves oligodendrocyte precursor cell differentiation and maturation, and promotes remyelination. Spinal cord injury was induced in rats by the weight-drop method. Naringin was intragastrically administered daily (20, 40 mg/kg for 4 weeks after spinal cord injury induction. Behavioral assessment, histopathological staining, immunofluorescence spectroscopy, ultrastructural analysis and biochemical assays were employed. Naringin treatment remarkably mitigated demyelination in the white matter, increased the quality of myelinated nerve fibers and myelin sheath thickness, promoted oligodendrocyte precursor cell differentiation by upregulating the expression of NKx2.2 and 23′-cyclic nucleotide 3′-phosphodiesterase, and inhibited β-catenin expression and glycogen synthase kinase-3β (GSK-3β phosphorylation. These findings indicate that naringin treatment regulates oligodendrocyte precursor cell differentiation and promotes remyelination after spinal cord injury through the β-catenin/GSK-3β signaling pathway.

  2. Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.

    Directory of Open Access Journals (Sweden)

    Yoichiro Shinohara

    Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.

  3. The ShcA SH2 domain engages a 14-3-3/PI3'K signaling complex and promotes breast cancer cell survival.

    Science.gov (United States)

    Ursini-Siegel, J; Hardy, W R; Zheng, Y; Ling, C; Zuo, D; Zhang, C; Podmore, L; Pawson, T; Muller, W J

    2012-11-29

    The ShcA adapter protein transmits activating signals downstream of receptor and cytoplasmic tyrosine kinases through the establishment of phosphotyrosine-dependent complexes. In this regard, ShcA possesses both a phosphotyrosine-binding domain (PTB) and Src homology 2 domain (SH2), which bind phosphotyrosine residues in a sequence-specific manner. Although the majority of receptor tyrosine kinases expressed in breast cancer cells bind the PTB domain, very little is known regarding the biological importance of SH2-driven ShcA signaling during mammary tumorigenesis. To address this, we employed transgenic mice expressing a mutant ShcA allele harboring a non-functional SH2 domain (ShcR397K) under the transcriptional control of the endogenous ShcA promoter. Using transplantation approaches, we demonstrate that SH2-dependent ShcA signaling within the mammary epithelial compartment is essential for breast tumor outgrowth, survival and the development of lung metastases. We further show that the ShcA SH2 domain activates the AKT pathway, potentially through a novel SH2-mediated complex between ShcA, 14-3-3ζ and the p85 regulatory subunit of phosphatidylinositol 3 (PI3') kinase. This study is the first to demonstrate that the SH2 domain of ShcA is critical for tumor survival during mammary tumorigenesis.

  4. BF3·Et2O-promoted cleavage of the Csp-Csp2 bond of 2-propynolphenols/anilines: route to C2-alkenylated benzoxazoles and benzimidazoles.

    Science.gov (United States)

    Song, Xian-Rong; Qiu, Yi-Feng; Song, Bo; Hao, Xin-Hua; Han, Ya-Ping; Gao, Pin; Liu, Xue-Yuan; Liang, Yong-Min

    2015-02-20

    A novel BF3·Et2O-promoted tandem reaction of easily prepared 2-propynolphenols/anilines and trimethylsilyl azide is developed to give C2-alkenylated benzoxazoles and benzimidazoles in moderate to good yields. Most reactions could be accomplished in 30 min at room temperature. This tandem process involves a Csp-Csp2 bond cleavage and a C-N bond formation. Moreover, both tertiary and secondary propargylic alcohols with diverse functional groups were tolerated under the mild conditions.

  5. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  6. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  7. Stat3 is involved in control of MASP2 gene expression

    International Nuclear Information System (INIS)

    Unterberger, Claudia; Hanson, Steven; Klingenhoff, Andreas; Oesterle, Daniela; Frankenberger, Marion; Endo, Yuichi; Matsushita, Misao; Fujita, Teizo; Schwaeble, Wilhelm; Weiss, Elisabeth H.; Ziegler-Heitbrock, Loems; Stover, Cordula

    2007-01-01

    Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 to be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity

  8. Functional Characterization of TaSnRK2.8 Promoter in Response to Abiotic Stresses by Deletion Analysis in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Hongying Zhang

    2017-07-01

    Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.

  9. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  10. The MDM-2 Antagonist Nutlin-3 Promotes the Maturation of Acute Myeloid Leukemic Blasts

    Directory of Open Access Journals (Sweden)

    Paola Secchiero

    2007-10-01

    Full Text Available The small-molecule inhibitor of murine double minute (MDM-2, Nutlin-3, induced variable apoptosis in primary acute myeloid leukemia (AML blasts, promoted myeloid maturation of surviving cells, as demonstrated by analysis of CD11 b, CD14 surface antigens, by morphologic examination. Although the best-characterized activity of Nutlin-3 is activation of the p53 pathway, Nutlin-3 induced maturation also in one AML sample characterized by p53 deletion, as well as in the p53-/- human myeloblastic HL-60 cell line. At the molecular level, the maturational activity of Nutlin-3 in HL-60 cells was accompanied by the induction of E2F1 transcription factor, it was significantly counteracted by specific gene knockdown with small interfering RNA for E2F1. Moreover, Nutlin-3, as well as tumor necrosis factor (TNF α, potentiated the maturational activity of recombinant TNF-related apoptosis-inducing lig, (TRAIL in HL-60 cells. However, although TNF-α significantly counteracted the proapoptotic activity of TRAIL, Nutlin-3 did not interfere with the proapoptotic activity of TRAIL. Taken together, these data disclose a novel, potentially relevant therapeutic role for Nutlin-3 in the treatment of both p53 wild-type, p53-/- AML, possibly in association with recombinant TRAIL.

  11. Differential requirements for Gli2 and Gli3 in the regional specification of the mouse hypothalamus

    Directory of Open Access Journals (Sweden)

    Roberta eHaddad-Tóvolli

    2015-03-01

    Full Text Available Secreted protein Sonic hedgehog (Shh ventralizes the neural tube by modulating the crucial balance between activating and repressing functions (GliA, GliR of transcription factors Gli2 and Gli3. This balance—the Shh-Gli code—is species- and context-dependent and has been elucidated for the mouse spinal cord. The hypothalamus, a forebrain region regulating vital functions like homeostasis and hormone secretion, shows dynamic and intricate Shh expression as well as complex regional differentiation. Here we asked if particular combinations of Gli2 and Gli3 and of GliA and GliR functions contribute to the variety of hypothalamic regions, i.e. we wanted to clarify the hypothalamic version of the Shh-Gli code. Based on mouse mutant analysis, we show that: 1 hypothalamic regional heterogeneity is based in part on differentially stringent requirements for Gli2 or Gli3; 2 another source of diversity are differential requirements for Shh of neural vs non-neural origin; 3 Gli2 is indispensable for the specification of a medial progenitor domain generating several essential hypothalamic nuclei plus the pituitary and median eminence; 4 the suppression of Gli3R by neural and non-neural Shh is essential for hypothalamic specification. Finally, we have mapped our results on a recent model which considers the hypothalamus as a transverse region with alar and basal portions. Our data confirm the model and are explained by it.

  12. Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

    DEFF Research Database (Denmark)

    Gyan, B A; Goka, B; Cvetkovic, J T

    2004-01-01

    Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

  13. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.

    2011-01-01

    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  14. Influence of elemental diffusion on low temperature formation of MgH2 in TiMn1.3T0.2-Mg (T = 3d-transition elements)

    International Nuclear Information System (INIS)

    Yamamoto, K.; Tanioka, S.; Tsushio, Y.; Shimizu, T.; Morishita, T.; Orimo, S.; Fujii, H.

    1996-01-01

    In order to examine the influence of the elemental diffusion from the host compound into the Mg region on low temperature formation of MgH 2 , we have investigated the hydriding properties and the microstructures of the composite materials TiMn 1.3 T 0.2 -Mg (T = V, Cr, Mn, Fe, Co, Ni and Cu). MgH 2 is formed at 353 K in all composite materials. Of all the substitutions, the amount of MgH 2 is the largest in the case of the Cu substitution, which originates from the existence of the Mg-Mg 2 Cu eutectic formed by Cu diffusion from the host compound TiMn 1.3 Cu 0.2 into the Mg region during the liquid phase sintering. In addition, the hydrogen capacity of TiMn 1.3 Cu 0.2 -Mg (that is TiMn 1.3 Cu 0.1 -(Mg+Mg 2 Cu) after the sintering) easily saturates in comparison with TiMn 1.5 -(Mg+Mg 2 Cu) without Cu diffusion. It is concluded that Cu diffusion promotes the mobility of hydrogen atoms at the complex interface between the host compound and the Mg region. (orig.)

  15. Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny.

    Directory of Open Access Journals (Sweden)

    Dorcas J Orengo

    Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.

  16. The role of salicylic acid, L-ascorbic acid and oxalic acid in promoting the oxidation of alkenes with H(2)O(2) catalysed by [Mn(IV) (2)(O)(3)(tmtacn)(2)](2+)

    NARCIS (Netherlands)

    de Boer, Johannes W.; Alsters, Paul L.; Meetsma, Auke; Hage, Ronald; Browne, Wesley R.; Feringa, Ben L.

    2008-01-01

    The role played by the additives salicylic acid, L-ascorbic acid and oxalic acid in promoting the catalytic activity of [Mn(IV) (2)(O)(3)(tmtacn)(2)](PF(6))(2) {1(PF(6))(2), where tmtacn = N, N ', N ''-trimethyl-1,4,7-triazacyclononane} in the epoxidation and cis-dihydroxylation of alkenes with

  17. EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications.

    Science.gov (United States)

    Li, Zhenghao; Takenobu, Hisanori; Setyawati, Amallia Nuggetsiana; Akita, Nobuhiro; Haruta, Masayuki; Satoh, Shunpei; Shinno, Yoshitaka; Chikaraishi, Koji; Mukae, Kyosuke; Akter, Jesmin; Sugino, Ryuichi P; Nakazawa, Atsuko; Nakagawara, Akira; Aburatani, Hiroyuki; Ohira, Miki; Kamijo, Takehiko

    2018-05-01

    The polycomb repressor complex 2 molecule EZH2 is now known to play a role in essential cellular processes, namely, cell fate decisions, cell cycle regulation, senescence, cell differentiation, and cancer development/progression. EZH2 inhibitors have recently been developed; however, their effectiveness and underlying molecular mechanisms in many malignancies have not yet been elucidated in detail. Although the functional role of EZH2 in tumorigenesis in neuroblastoma (NB) has been investigated, mutations of EZH2 have not been reported. A Kaplan-Meier analysis on the event free survival and overall survival of NB patients indicated that the high expression of EZH2 correlated with an unfavorable prognosis. In order to elucidate the functional roles of EZH2 in NB tumorigenesis and its aggressiveness, we knocked down EZH2 in NB cell lines using lentivirus systems. The knockdown of EZH2 significantly induced NB cell differentiation, e.g., neurite extension, and the neuronal differentiation markers, NF68 and GAP43. EZH2 inhibitors also induced NB cell differentiation. We performed a comprehensive transcriptome analysis using Human Gene Expression Microarrays and found that NTRK1 (TrkA) is one of the EZH2-related suppression targets. The depletion of NTRK1 canceled EZH2 knockdown-induced NB cell differentiation. Our integrative methylome, transcriptome, and chromatin immunoprecipitation assays using NB cell lines and clinical samples clarified that the NTRK1 P1 and P2 promoter regions were regulated differently by DNA methylation and EZH2-related histone modifications. The NTRK1 transcript variants 1/2, which were regulated by EZH2-related H3K27me3 modifications at the P1 promoter region, were strongly expressed in favorable, but not unfavorable NB. The depletion and inhibition of EZH2 successfully induced NTRK1 transcripts and functional proteins. Collectively, these results indicate that EZH2 plays important roles in preventing the differentiation of NB cells and also

  18. Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

    Science.gov (United States)

    Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

    2016-01-01

    Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

  19. Sp1/Sp3 and DNA-methylation contribute to basal transcriptional activation of human podoplanin in MG63 versus Saos-2 osteoblastic cells

    Directory of Open Access Journals (Sweden)

    Puri Christina

    2007-03-01

    Full Text Available Abstract Background Podoplanin is a membrane mucin that, among a series of tissues, is expressed on late osteoblasts and osteocytes. Since recent findings have focussed on podoplanin's potential role as a tumour progression factor, we aimed at identifying regulatory elements conferring PDPN promoter activity. Here, we characterized the molecular mechanism controlling basal PDPN transcription in human osteoblast-like MG63 versus Saos-2 cells. Results We cloned and sequenced 2056 nucleotides from the 5'-flanking region of the PDPN gene and a computational search revealed that the TATA and CAAT box-lacking promoter possesses features of a growth-related gene, such as a GC-rich 5' region and the presence of multiple putative Sp1, AP-4 and NF-1 sites. Reporter gene assays demonstrated a functional promoter in MG63 cells exhibiting 30-fold more activity than in Saos-2 cells. In vitro DNase I footprinting revealed eight protected regions flanked by DNaseI hypersensitive sites within the region bp -728 to -39 present in MG63, but not in Saos-2 cells. Among these regions, mutation and supershift electrophoretic mobility shift assays (EMSA identified four Sp1/Sp3 binding sites and two binding sites for yet unknown transcription factors. Deletion studies demonstrated the functional importance of two Sp1/Sp3 sites for PDPN promoter activity. Overexpression of Sp1 and Sp3 independently increased the stimulatory effect of the promoter and podoplanin mRNA levels in MG63 and Saos-2 cells. In SL2 cells, Sp3 functioned as a repressor, while Sp1 and Sp3 acted positively synergistic. Weak PDPN promoter activity of Saos-2 cells correlated with low Sp1/Sp3 nuclear levels, which was confirmed by Sp1/Sp3 chromatin immunoprecipitations in vivo. Moreover, methylation-sensitive Southern blot analyses and bisulfite sequencing detected strong methylation of CpG sites upstream of bp -464 in MG63 cells, but hypomethylation of these sites in Saos-2 cells. Concomitantly

  20. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  1. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  2. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  3. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    International Nuclear Information System (INIS)

    Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun

    2015-01-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  4. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Jing; Chen, Xi; Liu, Yanan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Xie, Qunhui [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Zhao, Bin, E-mail: binzhao@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Tang, Naijun, E-mail: tangnaijun@tijmu.edu.cn [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China)

    2015-12-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  5. Promotion effect of H2 on ethanol oxidation and NOx reduction with ethanol over Ag/Al2O3 catalyst.

    Science.gov (United States)

    Yu, Yunbo; Li, Yi; Zhang, Xiuli; Deng, Hua; He, Hong; Li, Yuyang

    2015-01-06

    The catalytic partial oxidation of ethanol and selective catalytic reduction of NOx with ethanol (ethanol-SCR) over Ag/Al2O3 were studied using synchrotron vacuum ultraviolet (VUV) photoionization mass spectrometry (PIMS). The intermediates were identified by PIMS and their photoionization efficiency (PIE) spectra. The results indicate that H2 promotes the partial oxidation of ethanol to acetaldehyde over Ag/Al2O3, while the simultaneously occurring processes of dehydration and dehydrogenation were inhibited. H2 addition favors the formation of ammonia during ethanol-SCR over Ag/Al2O3, the occurrence of which creates an effective pathway for NOx reduction by direct reaction with NH3. Simultaneously, the enhancement of the formation of ammonia benefits its reaction with surface enolic species, resulting in producing -NCO species again, leading to enhancement of ethanol-SCR over Ag/Al2O3 by H2. Using VUV-PIMS, the reactive vinyloxy radical was observed in the gas phase during the NOx reduction by ethanol for the first time, particularly in the presence of H2. Identification of such a reaction occurring in the gas phase may be crucial for understanding the reaction pathway of HC-SCR over Ag/Al2O3.

  6. Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

    Directory of Open Access Journals (Sweden)

    Susanne Helm

    Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

  7. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  8. FGF-2 Transcriptionally Down-Regulates the Expression of BNIP3L via PI3K/Akt/FoxO3a Signaling and Inhibits Necrosis and Mitochondrial Dysfunction Induced by High Concentrations of Hydrogen Peroxide in H9c2 Cells

    Directory of Open Access Journals (Sweden)

    Qian Chen

    2016-12-01

    Full Text Available Background/Aims: Cardiovascular disease is a growing major global public health problem. Necrosis is one of the main forms of cardiomyocyte death in heart disease. Oxidative stress is regarded as one of the key regulators of cardiac necrosis, which eventually leads to cardiovascular disease. Many pharmacological and in vitro studies have suggested that FGF-2 can act directly on cardiomyocytes to maintain the integrity and function of the myocardium and prevent damage during oxidative stress. However, the mechanisms by which FGF-2 rescues the myocardium from oxidative stress damage in cardiovascular disease remain unclear. The present study explored the protective effects of FGF-2 in the H2O2-induced necrosis of H9C2 cardiomyocytes as well as the possible signaling pathways involved. Methods: Necrosis of H9c2 cardiomyocytes was induced by H2O2 and assessed using a Cell Counting Kit-8 (CCK8 assay and flow cytometry analysis. The cells were pretreated with the PI3K/Akt inhibitor Wortmannin to investigate the possible involvement of the PI3K/Akt pathway in the protection by FGF-2. The levels of Akt, p-Akt, FoxO3a, p-FoxO3a, and BNIP3L were detected by Western blot. Chromatin immuno-precipitation (ChIP analysis was used to test whether FoxO3a binds directly to the BNIP3L promoter region. A luciferase assay was used to study the effects of FoxO3a on BNIP3L gene promoter activity. Mitochondrial ΔΨM was quantified using tetramethylrhodamine methyl ester perchlorate (TMRM. The mitochondrial oxygen consumption rate (OCR was assessed with a Seahorse XF24 Analyzer. Results: Treatment with H2O2 decreased the phosphorylation of Akt and FoxO3a, and it induced the nuclear localization of FoxO3a and the necrosis of H9c2 cells. These effects of H2O2 were abrogated by pretreatment with FGF-2. Furthermore, the protective effects of FGF-2 were abolished by the PI3K/Akt inhibitor Wortmannin. ChIP analyses indicated that FoxO3a binds directly to the BNIP3L promoter

  9. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Møller, A M; Jensen, N M; Pildal, J

    2001-01-01

    This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...

  10. Ionic liquid promoted one pot approach for the synthesis of pyrido[1,2-c][1,3,5]thiadiazin-4-ones and thiazolo[3,2-c][1,3,5]thiadiazin-4-ones in water

    Directory of Open Access Journals (Sweden)

    I.R. Siddiqui

    2018-02-01

    Full Text Available A novel three component one pot methodology for rapid access to pyrido[1,2-c][1,3,5]thiadiazin-4-ones and thiazolo[3,2-c][1,3,5]thiadiazin-4-ones has been developed. A task specific ionic liquid [bmIm]SCN has been used as thiocyanating reagent. The reaction provides high yields of the product and proceeds at ambient reaction conditions in water. The use of water as the reaction medium and easy recyclability of the ionic liquid used as a reagent as well as promoter of the reaction endows the reaction with green aspects.

  11. Data on foreign regions where uranium resources are developed, 2 and 3

    International Nuclear Information System (INIS)

    1982-07-01

    This book was published in July, 1976, before, and the revised edition was published at the beginning of 1982 as Part 1, Asia and Africa. This is Part 2, in which the regions of North America, Central and South America are reported, and Part 3 concerning Australian regions. The state of resource exploration and development, the policy of uranium mining, Japanese policy to advance in, the geological features and deposits, and the promising regions in Canada, USA, various countries in Central America and South America and Australia are described. Canada is one of the promising regions in the world regarding uranium deposits, and the exploration activity is brisk. In USA, the joint exploration with US persons having the mining right is the main method, and the companies must be established to develop mines. In Australia, P.N.C. Exploration P/L continues the exploration. (Kako, I.)

  12. Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

    2005-01-01

    Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

  13. Decreased expression of lysyl hydroxylase 2 (LH2) in skin fibroblasts from three Ehlers-Danlos patients does not result from mutations in either the coding or proximal promoter region of the LH2 gene.

    Science.gov (United States)

    Walker, L C; Teebi, A S; Marini, J C; De Paepe, A; Malfait, F; Atsawasuwan, P; Yamauchi, M; Yeowell, H N

    2004-12-01

    The Ehlers-Danlos syndromes (EDS) are a heterogeneous group of inherited connective tissue disorders characterized by tissue fragility, hyperelasticity of the skin and joint hypermobility. This phenotype, accompanied by kyphoscoliosis and/or ocular fragility, is present in patients with the autosomal recessive type VI form of EDS. These patients have significantly decreased levels of lysyl hydroxylase (LH) activity, due to mutations in the LH1 gene. LH hydroxylates specific lysine residues in the collagen molecule that are precursors for the formation of cross-links which provide collagen with its tensile strength. No disorder has been directly linked to decreased expression of LH2 and LH3, two other isoforms of LH. This study describes 3 patients with mixed phenotypes of EDS, who have significantly decreased mRNAs for LH2, but normal levels of LH1 and LH3 mRNAs, in their skin fibroblasts. In contrast to the effect of LH1 deficiency in EDS VI patients, the decreased expression of LH2 does not affect LH activity, bifunctional collagen cross-links (measured after reduction as dihydroxylysinonorleucine (DHLNL) and hydroxylysinonorleucine (HLNL)), or helical lysine hydroxylation in these cell lines. Sequence analysis of full length LH2 cDNAs and 1kb of the promoter region of LH2 does not show mutations that could explain the decreased expression of LH2. These results suggest that the deficiency of LH2 in these fibroblasts may be caused by changes in other factors required for the expression of LH2.

  14. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa

    2015-03-01

    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  15. Inhibition of proliferation and differentiation and promotion of apoptosis by cyclin L2 in mouse embryonic carcinoma P19 cells

    International Nuclear Information System (INIS)

    Zhuo, Lili; Gong, Jie; Yang, Rong; Sheng, Yanhui; Zhou, Lei; Kong, Xiangqing; Cao, Kejiang

    2009-01-01

    Cyclin L2 (CCNL2) is a novel member of the cyclin gene family. In a previous study, we demonstrated that CCNL2 expression was upregulated in ventricular septum tissues from patients with ventricular septal defect compared to healthy controls. In the present study, we established a stable CCNL2-overexpressing P19 cell line that can differentiate to myocardial cells when treated with 1% dimethyl sulfoxide (DMSO). Our data showed that stable CCNL2-overexpressing P19 cells were less differentiated after treatment with 1% DMSO and that expression of myocardial cell differentiation-related genes (such as cardiac actin, GATA4, Mef2C, Nkx2.5, and BNP) were reduced compared to vector-only transfected P19. Moreover, P19 cells overexpressing the CCNL2 gene had a reduced growth rate and a remarkably decreased S phase. We also found that these cells underwent apoptosis, as detected by two different apoptosis assays. The anti-apoptotic Bcl-2 protein was also downregulated in these cells. In addition, real-time PCR analysis revealed that expression of Wnt and β-catenin was suppressed and GSK3β was induced in the CCNL2-overexpressing P19 cells. These data suggest that overexpression of CCNL2 inhibited proliferation and differentiation of mouse embryonic carcinoma P19 cells and induced them to undergo apoptosis, possibly through the Wnt signal transduction pathway.

  16. Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

    DEFF Research Database (Denmark)

    Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

    1988-01-01

    Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

  17. Development of posterior hypothalamic neurons enlightens a switch in the prosencephalic basic plan.

    Directory of Open Access Journals (Sweden)

    Sophie Croizier

    Full Text Available In rats and mice, ascending and descending axons from neurons producing melanin-concentrating hormone (MCH reach the cerebral cortex and spinal cord. However, these ascending and descending projections originate from distinct sub-populations expressing or not "Cocaine-and-Amphetamine-Regulated-Transcript" (CART peptide. Using a BrdU approach, MCH cell bodies are among the very first generated in the hypothalamus, within a longitudinal cell cord made of earliest delaminating neuroblasts in the diencephalon and extending from the chiasmatic region to the ventral midbrain. This region also specifically expresses the regulatory genes Sonic hedgehog (Shh and Nkx2.2. First MCH axons run through the tractus postopticus (tpoc which gathers pioneer axons from the cell cord and courses parallel to the Shh/Nkx2.2 expression domain. Subsequently generated MCH neurons and ascending MCH axons differentiate while neurogenesis and mantle layer differentiation are generalized in the prosencephalon, including telencephalon. Ascending MCH axons follow dopaminergic axons of the mesotelencephalic tract, both being an initial component of the medial forebrain bundle (mfb. Netrin1 and Slit2 proteins that are involved in the establishment of the tpoc and mfb, respectively attract or repulse MCH axons.We conclude that first generated MCH neurons develop in a diencephalic segment of a longitudinal Shh/Nkx2.2 domain. This region can be seen as a prosencephalic segment of a medial neurogenic column extending from the chiasmatic region through the ventral neural tube. However, as the telencephalon expends, it exerts a trophic action and the mfb expands, inducing a switch in the longitudinal axial organization of the prosencephalon.

  18. Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

    Science.gov (United States)

    Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra

    2013-01-01

    Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this

  19. Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

    Directory of Open Access Journals (Sweden)

    Kazi Md Kamrul Huda

    Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible

  20. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus

    2009-11-01

    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  1. Ultrasonic irradiation-promoted one-pot synthesis of CH3NH3PbBr3 quantum dots without using flammable CH3NH2 precursor

    Science.gov (United States)

    Jiang, Han; Wang, Chunlei; Lv, Changgui; Xu, Shuhong; Zhu, Li; Zhang, Ruohu; Cui, Yiping

    2017-02-01

    At present, the CH3NH3PbBr3 quantum dots (QDs) reported in the literature usually contain two synthesis steps: the initial preparation of CH3NH3Br via the reaction of flammable CH3NH2 and HBr, together with the subsequent formation of CH3NH3PbBr3 QDs. To avoid the use of dangerous CH3NH2, this work develops a novel one-pot method for synthesizing CH3NH3PbBr3 QDs using safe and commercially available reactants (CH3NH3Cl, KBr and PbCl2). It is found that ultrasonic treatment plays a key role during the synthesis of CH3NH3PbBr3 QDs. Without ultrasonic irradiation, it is not possible to synthesize CH3NH3PbBr3 QDs under heating or vigorous stirring. Aliquots of samples taken at different ultrasonic irradiation time intervals show a time-dependent redshift in the emission wavelength. This suggests the formation of CH3NH3PbCl3 QDs first, followed by the formation of CH3NH3PbBr3 QDs through ultrasonically promoted halide exchange. Moreover, mixed CH3NH3PbCl x Br3-x QDs with a tunable emission wavelength can also be prepared through this one-pot method by controlling the ultrasonic irradiation time. In comparison to the previous two-step method, the current one-pot method is simpler, less time-consuming and does not use flammable CH3NH2. The as-prepared CH3NH3PbBr3 QDs show a comparable photoluminescence (PL) quantum yield (QY) to that of the literature. What is more, the ultrasonic time-controlled emission wavelength of CH3NH3PbCl x Br3-x QDs also provides an alternative way of tuning QD emission to the traditional way of controlling the halide ratios.

  2. Increased expression of bHLH transcription factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis

    International Nuclear Information System (INIS)

    Patel, Divya; Chaudhary, Jaideep

    2012-01-01

    Highlights: ► E2A, considered as a tumor suppressor is highly expressed in prostate cancer. ► Silencing of E2A attenuates cell proliferation and promotes apoptosis. ► E2A regulates c-myc, Id1, Id3 and CDKN1A expression. ► Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. ► Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.

  3. High dielectric permittivity in the microwave region of SrBi2Nb2O9 (SBN) added La2O3, PbO and Bi2O3, obtained by mechanical alloying

    Science.gov (United States)

    Rocha, M. J. S.; Silva, P. M. O.; Theophilo, K. R. B.; Sancho, E. O.; Paula, P. V. L.; Silva, M. A. S.; Honorato, S. B.; Sombra, A. S. B.

    2012-08-01

    This paper presents the microwave dielectric properties and a structural study of SrBi2Nb2O9 (SBN) added La2O3, PbO or Bi2O3 obtained by a solid state procedure. High-energy mechanical milling was used to reduce the particle size, which allows for a better shaping of the green body and an increased reactivity. The mechanical milling activation process produced a reduced sintering temperature in the material, decreasing the loss of the volatile elements and controlling the growth of the grain that is produced when a high temperature is required to obtain dense ceramics. The incorporation of La3+, or Pb2+, or Bi3+ of different amounts (0, 3, 5, 10 and 15 wt%) was used to improve the densification without changing the crystal structure, since with a low doping content these ions can occupy the A site of the perovskite blocks; they can also occupy the Bi3+ sites in Bi2O3 layers. A single orthorhombic phase was formed after calcination at 800 °C for 2 h. X-ray diffraction, Fourier transformation, infrared and Raman spectroscopy have been carried out in order to investigate the effects of doping on SBN. The dielectric permittivity (ɛ‧r) and loss in the microwave region (2-4 GHz) of SBN ceramics with additions of Bi2O3, La2O3 and PbO were studied. Higher values of permittivity (ɛr‧ = 154.6) have been obtained for the SBN added La (15 wt%) a lower loss (tg δ = 0.01531) was also achieved in the SBN added La (15 wt%) sample with PVA and TEOS, respectively. The samples that showed the highest dielectric permittivities were all lanthanum doped, all with values of permittivity above 90. A comparative study associated with different types of binders was completed (with glycerin, PVA and TEOS). This procedure allowed us to obtain phases at lower temperatures than usually appear in the literature. The microwave dielectric properties (permittivity and loss) in the region 2-4 GHz, were studied for all samples. The structural and microwave dielectric properties of SBN show a

  4. Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor

    Energy Technology Data Exchange (ETDEWEB)

    Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)

    2007-11-30

    Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.

  5. Radiation susceptibility of the mouse smalleye mutants, Del(2)Sey3Hpax6 and Del(2)Sey4Hpax6, which delete the chromosome 2 middle regions

    International Nuclear Information System (INIS)

    Nitta, Y.; Hoshi, M.; Yoshida, K.; Yamate, J.; Peters, J.; Cattanach, B.M.

    2003-01-01

    Full text: LOH at the chromosome 2 middle regions is common in the radiation-induced mouse acute myeloid leukemia (AML). To identify the suppressor or the modifier gene of AML at this region, the mouse deletion mutants, Del(2)Sey3H pax6 and Del(2)Sey3H pax6 could be the good models, as they deleted the chromosome 2 middle regions hemizygously. The allele of the partially deleted chromosome 2 was paternally generated and maintained hemizygously. The exact deleted regions of the two mutants were mapped by the PCR-based detection of polymorphism of the STS markers. The length of the deletions was 3.01Mb and 10.11MB for Del(2)Sey3H pax6 and Del(2)Sey3H pax6 , respectively. For the induction of tumors, a radiation, 3.0Gy of Co-60 and a chemical carcinogen, N-methyl-N-nitrosourea were applied to the mutants. Their tumorigenicity was compared with those of control as well as normal sibs by the Kaplan-Meier analysis. Both mutants were found to predispose to small intestinal tumors. Intestinal tumors developed spontaneously with the incidence of 30%. The radiation and the chemical accelerated the malignancy and increased the incidence of the intestinal tumors. Radiation shortened the latency of AML development in the Del(2)Sey3H pax6 mutant but not in the Del(2)Sey3H pax6 . Spontaneous AML has not been observed, nor any increase in the incidence of induced AMLs. The commonly deleted region of the two mutants, the 3.01Mb region, must be critical for the development of tumors and the high susceptibility to radiation. The role of Pax6 gene should be considered in the intestinal tumorigenesis, as the Pax6 gene plays an important role in the pancreas development during the embryogenesis. The Wt1, a tumor suppressor gene, which is deleted hemizygously in these mutants as well. The screening of homozygous deletion has been started using the induced as well as spontaneously developed tumors

  6. Association of an APOC3 promoter variant with type 2 diabetes risk and need for insulin treatment in lean persons

    NARCIS (Netherlands)

    M. van Hoek (Mandy); T.W. van Herpt (Thijs); A. Dehghan (Abbas); A. Hofman (Albert); A. Lieverse (Aloysius); C.M. van Duijn (Cornelia); J.C.M. Witteman (Jacqueline); E.J.G. Sijbrands (Eric)

    2011-01-01

    textabstractAims/hypothesis: An APOC3 promoter haplotype has been previously associated with type 1 diabetes. In this population-based study, we investigated whether APOC3 polymorphisms increase type 2 diabetes risk and need for insulin treatment in lean participants. Methods: In the Rotterdam

  7. Ginsenoside 25-OCH3-PPD promotes activity of LXRs to ameliorate P2X7R-mediated NLRP3 inflammasome in the development of hepatic fibrosis.

    Science.gov (United States)

    Han, Xin; Song, Jian; Lian, Li-Hua; Yao, You-Li; Shao, Dan-Yang; Fan, Ying; Hou, Li-Shuang; Wang, Ge; Zheng, Shuang; Wu, Yan-Ling; Nan, Ji-Xing

    2018-06-22

    Ginseng is widely used in energy drinks, dietary supplements and herbal medicines, and its pharmacological actions are related with energy metabolism. As an important modulating energy metabolism pathway, liver X receptors (LXRs) can promote the resolving of hepatic fibrosis and inflammation. The present study aims to evaluate the regulation of 25-OCH3-PPD, a ginsenoside isolated from Panax ginseng, against hepatic fibrosis and inflammation in thioacetamide (TAA)-stimulated mice by activating LXRs pathway. 25-OCH3-PPD decreases serum ALT/AST levels and improves the histological pathology of liver in TAA-induced mice; attenuates transcripts of pro-fibrogenic markers associated with hepatic stellate cell activation; attenuates the levels of pro-Inflammatory cytokines and blocks apoptosis happened in liver; inhibits NLRP3 inflammasome by affecting P2X7R activation; regulates PI3K/Akt and LKB1/AMPK-SIRT1. 25-OCH3-PPD also facilitates LX25Rs and FXR activities decreased by TAA stimulation. 25-OCH3-PPD also decreases α-SMA via regulation of LXRs and P2X7R-NLRP3 in vitro. Our data suggest the possibility that 25-OCH3-PPD promotes activity of LXRs to ameliorate P2X7R-mediated NLRP3 inflammasome in the development of hepatic fibrosis.

  8. Promoting Effect of CeO2 Addition on Activity and Catalytic Stability in Steam Reforming of Methane over Ni/Al2O3

    International Nuclear Information System (INIS)

    Rakib, A.; Gennequin, C.; Ringot, S.; Aboukais, A.; Abi-Aad, E.; Dhainaut, T.

    2011-01-01

    Hydrogen production by steam reforming of methane was studied over Ni catalysts supported on CeO 2 , Al 2 O 3 and CeO 2 -Al 2 O 3 . These catalysts were prepared using the impregnation method and characterized by XRD. The effect of CeO2 promoter on the catalytic performance of Ni/Al 2 O 3 catalyst for methane steam reforming reaction was investigated. In fact, CeO 2 had a positive effect on the catalytic activity in this reaction. Experimental results demonstrated that Ni/CeO 2 -Al 2 O 3 catalyst showed excellent catalytic activity and high reaction performance. In addition, the effects of reaction temperature and metal content on the conversion of CH 4 and H 2 /CO ratio were also investigated. Results indicated that CH4 conversion increased significantly with the increase of the reaction temperature and metal content. (author)

  9. Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress

    Directory of Open Access Journals (Sweden)

    Ou Shulin

    2017-01-01

    Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.

  10. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.

    2001-01-01

    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  11. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  12. Enhancement of CO(3-2)/CO(1-0) ratios and star formation efficiencies in supergiant H II regions

    Energy Technology Data Exchange (ETDEWEB)

    Miura, Rie E.; Espada, Daniel; Komugi, Shinya; Nakanishi, Kouichiro; Sawada, Tsuyoshi; Fujii, Kosuke; Kawabe, Ryohei [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Kohno, Kotaro [Institute of Astronomy, School of Science, The University of Tokyo, Osawa, Mitaka, Tokyo 181-0015 (Japan); Tosaki, Tomoka [Joetsu University of Education, Yamayashiki-machi, Joetsu, Niigata 943-8512 (Japan); Hirota, Akihiko; Minamidani, Tetsuhiro [Nobeyama Radio Observatory, Minamimaki, Minamisaku, Nagano 384-1805 (Japan); Okumura, Sachiko K. [Department of Mathematical and Physical Sciences, Faculty of Science, Japan Woman' s University, Mejirodai 2-8-1, Bunkyo, Tokyo 112-8681 (Japan); Kuno, Nario [Department of Astronomical Science, The Graduate University for Advanced Studies (Sokendai), 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Muraoka, Kazuyuki; Onodera, Sachiko [Osaka Prefecture University, Gakuen 1-1, Sakai, Osaka 599-8531 (Japan); Kaneko, Hiroyuki, E-mail: rie.miura@nao.ac.jp [Department of Physics, Meisei University, Hino, Tokyo 191-8506 (Japan)

    2014-06-20

    We present evidence that super giant H II regions (GHRs) and other disk regions of the nearby spiral galaxy, M33, occupy distinct locations in the correlation between molecular gas, Σ{sub H{sub 2}}, and the star formation rate surface density, Σ{sub SFR}. This result is based on wide-field and high-sensitivity CO(3-2) observations at 100 pc resolution. Star formation efficiencies (SFEs), defined as Σ{sub SFR}/Σ{sub H{sub 2}}, in GHRs are found to be ∼1 dex higher than in other disk regions. The CO(3-2)/CO(1-0) integrated intensity ratio, R {sub 3-2/1-0}, is also higher than the average over the disk. Such high SFEs and R {sub 3-2/1-0} can reach the values found in starburst galaxies, which suggests that GHRs may be the elements building up a larger-scale starburst region. Three possible contributions to high SFEs in GHRs are investigated: (1) the I {sub CO}-N(H{sub 2}) conversion factor, (2) the dense gas fraction traced by R {sub 3-2/1-0}, and (3) the initial mass function (IMF). We conclude that these starburst-like properties in GHRs can be interpreted by a combination of both a top-heavy IMF and a high dense gas fraction, but not by changes in the I {sub CO}-N(H{sub 2}) conversion factor.

  13. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

  14. In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.

    Science.gov (United States)

    Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica

    2013-12-01

    The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

  15. Fucoidan promotes early step of cardiac differentiation from human embryonic stem cells and long-term maintenance of beating areas.

    Science.gov (United States)

    Hamidi, Sofiane; Letourneur, Didier; Aid-Launais, Rachida; Di Stefano, Antonio; Vainchenker, William; Norol, Françoise; Le Visage, Catherine

    2014-04-01

    Somatic stem cells require specific niches and three-dimensional scaffolds provide ways to mimic this microenvironment. Here, we studied a scaffold based on Fucoidan, a sulfated polysaccharide known to influence morphogen gradients during embryonic development, to support human embryonic stem cells (hESCs) differentiation toward the cardiac lineage. A macroporous (pore 200 μm) Fucoidan scaffold was selected to support hESCs attachment and proliferation. Using a protocol based on the cardiogenic morphogen bone morphogenic protein 2 (BMP2) and transforming growth factor (TGFβ) followed by tumor necrosis factor (TNFα), an effector of cardiopoietic priming, we examined the cardiac differentiation in the scaffold compared to culture dishes and embryoid bodies (EBs). At day 8, Fucoidan scaffolds supported a significantly higher expression of the 3 genes encoding for transcription factors marking the early step of embryonic cardiac differentiation NKX2.5 (prelease TGFβ and TNFα was confirmed by Luminex technology. We also found that Fucoidan scaffolds supported the late stage of embryonic cardiac differentiation marked by a significantly higher atrial natriuretic factor (ANF) expression (pstress in the soft hydrogel impaired sarcomere formation, as confirmed by molecular analysis of the cardiac muscle myosin MYH6 and immunohistological staining of sarcomeric α-actinin. Nevertheless, Fucoidan scaffolds contributed to the development of thin filaments connecting beating areas through promotion of smooth muscle cells, thus enabling maintenance of beating areas for up to 6 months. In conclusion, Fucoidan scaffolds appear as a very promising biomaterial to control cardiac differentiation from hESCs that could be further combined with mechanical stress to promote sarcomere formation at terminal stages of differentiation.

  16. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  17. 9 CFR 3.81 - Environment enhancement to promote psychological well-being.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Environment enhancement to promote..., Treatment, and Transportation of Nonhuman Primates 2 Facilities and Operating Standards § 3.81 Environment..., document, and follow an appropriate plan for environment enhancement adequate to promote the psychological...

  18. Promoter polymorphisms of ST3GAL4 and ST6GAL1 genes and associations with risk of premalignant and malignant lesions of the cervix.

    Science.gov (United States)

    Rivera-Juarez, Maria de Los Angeles; Rosas-Murrieta, Nora Hilda; Mendieta-Carmona, Victoriano; Hernandez-Pacheco, Raquel Esneidy; Zamora-Ginez, Irma; Rodea-Avila, Carlos; Apresa-Garcia, Teresa; Garay-Villar, Onix; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis Felipe; Diaz-Orea, Maria Alicia; Milflores-Flores, Lorena; Reyes-Salinas, Juan Salvador; Ceja-Utrera, Francisco Javier; Vazquez-Zamora, Victor Javier; Vargas-Maldonado, Tomas; Reyes-Carmona, Sandra; Sosa-Jurado, Francisca; Santos-Lopez, Gerardo; Reyes-Leyva, Julio; Vallejo-Ruiz, Veronica

    2014-01-01

    Sialyltransferase gene expression is altered in several cancers, including examples in the cervix. Transcriptional regulation of the responsible genes depends on different promoters. We aimed to determine the association of single-nucleotide polymorphisms in the B3 promoter of the ST3GAL4 gene and the P1 promoter of the ST6GAL1 gene with cervical premalignant lesions or cervical cancer. A blood sample and/or cervical scrapes were obtained from 104 women with normal cytology, 154 with premalignant lesions and 100 with cervical cancer. We also included 119 blood samples of random donors. The polymorphisms were identified by sequencing from PCR products. For the B3 promoter, a fragment of 506 bp (from nucleotide -408 to +98) was analyzed, and for the P1 promoter a 490 bp (-326 to +164) fragment. The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions (OR=2.89; 95%CI 1.72-4.85) and cervical cancer (OR=2.23; 95%CI 1.27-3.91). We detected only one allele of each polymorphism in the ST6GAL1 P1 promoter. We did not detect any genetic variability in the P1 promoter region in our study population. Our results suggest that the rs10893506 polymorphism -22C/T may increase susceptibility to premalignant and malignant lesions of the cervix.

  19. Occurrence of greenhouse gases (CO2, N2O and CH4) in groundwater of the Walloon Region (Belgium).

    Science.gov (United States)

    Jurado, Anna; Borges, Alberto V.; Pujades, Estanislao; Hakoun, Vivien; Knöller, Kay; Brouyère, Serge

    2017-04-01

    Greenhouse gases (GHGs) are an environmental problem because their concentrations in the atmosphere have continuously risen since the industrial revolution. They can be indirectly transferred to the atmosphere through groundwater discharge into surface water bodies such as rivers. However, their occurrence is poorly evaluated in groundwater. The aim of this work is to identify the hydrogeological contexts (e.g., chalk and limestone aquifers) and the most conductive conditions for the generation of GHGs in groundwater at a regional scale. To this end, carbon dioxide (CO2), methane (CH4) and nitrous oxide (N2O) concentrations, major and minor elements and environmental isotopes were monitored in several groundwater bodies of the Walloon Region (Belgium) from September 2014 to June 2016. The concentrations of GHGs in groundwater ranged from 1769 to 100519 ppm for the partial pressure of CO2 and from 0 to 1064 nmol/L and 1 to 37062 nmol/L for CH4 and N2O respectively. Overall, groundwater was supersaturated in GHGs with respect to atmospheric equilibrium, suggesting that groundwater contribute to the atmospheric GHGs budget. Prior inspection of the data suggested that N2O in groundwater can be produced by denitrification and nitrification. The most suitable conditions for the accumulation of N2O are promoted by intermediate dissolved oxygen concentrations (2.5-3 mg L-1) and the availability of nitrate (NO3-). These observations will be compared with the isotopes of NO3-. CH4 was less detected and at lower concentration than N2O, suggesting that groundwater redox conditions are not reducing enough to promoted the production of CH4. The results will be presented and discussed in detail in the presentation.

  20. Sp1 and Sp3 Are the Transcription Activators of Human ek1 Promoter in TSA-Treated Human Colon Carcinoma Cells.

    Science.gov (United States)

    Kuan, Chee Sian; See Too, Wei Cun; Few, Ling Ling

    2016-01-01

    Ethanolamine kinase (EK) catalyzes the phosphorylation of ethanolamine, the first step in the CDP-ethanolamine pathway for the biosynthesis of phosphatidylethanolamine (PE). Human EK exists as EK1, EK2α and EK2β isoforms, encoded by two separate genes, named ek1 and ek2. EK activity is stimulated by carcinogens and oncogenes, suggesting the involvement of EK in carcinogenesis. Currently, little is known about EK transcriptional regulation by endogenous or exogenous signals, and the ek gene promoter has never been studied. In this report, we mapped the important regulatory regions in the human ek1 promoter. 5' deletion analysis and site-directed mutagenesis identified a Sp site at position (-40/-31) that was essential for the basal transcription of this gene. Treatment of HCT116 cells with trichostatin A (TSA), a histone deacetylase inhibitor, significantly upregulated the ek1 promoter activity through the Sp(-40/-31) site and increased the endogenous expression of ek1. Chromatin immunoprecipitation assay revealed that TSA increased the binding of Sp1, Sp3 and RNA polymerase II to the ek1 promoter in HCT116 cells. The effect of TSA on ek1 promoter activity was cell-line specific as TSA treatment did not affect ek1 promoter activity in HepG2 cells. In conclusion, we showed that Sp1 and Sp3 are not only essential for the basal transcription of the ek1 gene, their accessibility to the target site on the ek1 promoter is regulated by histone protein modification in a cell line dependent manner.

  1. Core Promoter Structure in the Oomycete Phytophthora infestans

    Science.gov (United States)

    McLeod, Adele; Smart, Christine D.; Fry, William E.

    2004-01-01

    We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

  2. T2 relaxation time in patellar cartilage - global and regional reproducibility at 1.5 Tesla and 3 Tesla

    International Nuclear Information System (INIS)

    Glaser, C.; Horng, A.; Mendlik, T.; Weckbach, S.; Hoffmann, R.T.; Wagner, S.; Raya, J.G.; Reiser, M.; Horger, W.

    2007-01-01

    Purpose: Evaluation of the global and regional reproducibility of T2 relaxation time in patellar cartilage at 1.5 T and 3 T. Materials and Methods: 6 left patellae of 6 healthy volunteers (aged 25-30, 3 female, 3 male) were examined using a fat-saturated multiecho sequence and a T1-w 3D-FLASH sequence with water excitation at 1.5 Tesla and 3 Tesla. Three consecutive data sets were acquired within one MRI session with the examined knee being repositioned in the coil and scanner between each data set. The segmented cartilage (FLASH sequence) was overlaid on the multiecho data and T2 values were calculated for the total cartilage, 3 horizontal layers consisting of a superficial, intermedial and deep layer, 3 facets consisting of a medial, median (ridge) and lateral facet (global T2 values) and 27 ROIs/MRI slices (regional T2 value). The reproducibility (precision error) was calculated as the root mean square average of the individual standard deviations [ms] and coefficients of variation (COV) [%]. Results: The mean global reproducibility error for T2 was 3.53% (±0.38%) at 1.5 Tesla and 3.25% (±0.61%) at 3 Tesla. The mean regional reproducibility error for T2 was 8.62% (±2.61%) at 1.5 Tesla and 9.66% (±3.37%) at 3 Tesla. There was no significant difference with respect to absolute reproducibility errors between 1.5 Tesla and 3 Tesla at a constant spatial resolution. However, different reproducibility errors were found between the cartilage layers. One third of the data variability could be attributed to the influence of the different cartilage layers, and another 10% to the influence of the separate MRI slices. Conclusion: Our data provides an estimation of the global and regional reproducibility errors of T2 in healthy cartilage. In the analysis of small subregions, an increase in the regional reproducibility error must be accepted. The data may serve as a basis for sample size calculations of study populations and may contribute to the decision regarding the

  3. Selective Hydrogenolysis of Glycerol and Crude Glycerol (a By-Product or Waste Stream from the Biodiesel Industry to 1,2-Propanediol over B2O3 Promoted Cu/Al2O3 Catalysts

    Directory of Open Access Journals (Sweden)

    Malaya R. Nanda

    2017-06-01

    Full Text Available The performance of boron oxide (B2O3-promoted Cu/Al2O3 catalyst in the selective hydrogenolysis of glycerol and crude glycerol (a by-product or waste stream from the biodiesel industry to produce 1,2-propanediol (1,2-PDO was investigated. The catalysts were characterized using N2-adsorption-desorption isotherm, Inductively coupled plasma atomic emission spectroscopy (ICP-AES, X-ray diffraction (XRD, ammonia temperature programmed desorption (NH3-TPD, thermogravimetric analysis (TGA, temperature programmed reduction (TPR, and transmission electron microscopy (TEM. Incorporation of B2O3 to Cu/Al2O3 was found to enhance the catalytic activity. At the optimum condition (250 °C, 6 MPa H2 pressure, 0.1 h−1 WHSV (weight hourly space velocity, and 5Cu-B/Al2O3 catalyst, 10 wt% aqueous solution of glycerol was converted into 1,2-PDO at 98 ± 2% glycerol conversion and 98 ± 2% selectivity. The effects of temperature, pressure, boron addition amount, and liquid hourly space velocity were studied. Different grades of glycerol (pharmaceutical, technical, or crude glycerol were used in the process to investigate the stability and resistance to deactivation of the selected 5Cu-B/Al2O3 catalyst.

  4. C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

    Science.gov (United States)

    Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

    2009-08-07

    The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

  5. Oxide (CeO{sub 2}, NiO, Co{sub 3}O{sub 4} and Mn{sub 3}O{sub 4})-promoted Pd/C electrocatalysts for alcohol electrooxidation in alkaline media

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Changwei; Tian, Zhiqun; Jiang, San Ping [School of Mechanical and Aerospace Engineering, Nanyang Technological University (Singapore); Shen, Peikang [School of Physics and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)

    2008-01-01

    This study investigated Pt/C, Pd/C and oxide (CeO{sub 2}, NiO, Co{sub 3}O{sub 4} and Mn{sub 3}O{sub 4})-promoted Pd/C for electrooxidation reactions of methanol, ethanol, ethylene glycol and glycerol in alkaline media. The results show that Pd/C electrocatalysts alone have low activity and very poor stability for the alcohol electrooxidation. However, addition of oxides like CeO{sub 2}, NiO, Co{sub 3}O{sub 4} and Mn{sub 3}O{sub 4} significantly promotes catalytic activity and stability of the Pd/C electrocatalysts for the alcohol electrooxidation. The Pd-Co{sub 3}O{sub 4} (2:1, w:w)/C shows the highest activity for the electrooxidation of methanol, EG and glycerol while the most active catalyst for the ethanol electrooxidation is Pd-NiO (6:1, w:w)/C. On the other hand, Pd-Mn{sub 3}O{sub 4}/C shows significantly better performance stability than other oxide-promoted Pd/C for the alcohol electrooxidation. The poor stability of the Pd-Co{sub 3}O{sub 4}/C electrocatalysts is most likely related to the limited solubility of cobalt oxides in alkaline solutions. (author)

  6. SH3 domain-mediated recruitment of host cell amphiphysins by alphavirus nsP3 promotes viral RNA replication.

    Directory of Open Access Journals (Sweden)

    Maarit Neuvonen

    2011-11-01

    Full Text Available Among the four non-structural proteins of alphaviruses the function of nsP3 is the least well understood. NsP3 is a component of the viral replication complex, and composed of a conserved aminoterminal macro domain implicated in viral RNA synthesis, and a poorly conserved carboxyterminal region. Despite the lack of overall homology we noted a carboxyterminal proline-rich sequence motif shared by many alphaviral nsP3 proteins, and found it to serve as a preferred target site for the Src-homology 3 (SH3 domains of amphiphysin-1 and -2. Nsp3 proteins of Semliki Forest (SFV, Sindbis (SINV, and Chikungunya viruses all showed avid and SH3-dependent binding to amphiphysins. Upon alphavirus infection the intracellular distribution of amphiphysin was dramatically altered and colocalized with nsP3. Mutations in nsP3 disrupting the amphiphysin SH3 binding motif as well as RNAi-mediated silencing of amphiphysin-2 expression resulted in impaired viral RNA replication in HeLa cells infected with SINV or SFV. Infection of Balb/c mice with SFV carrying an SH3 binding-defective nsP3 was associated with significantly decreased mortality. These data establish SH3 domain-mediated binding of nsP3 with amphiphysin as an important host cell interaction promoting alphavirus replication.

  7. Promoting Vehicle to Grid (V2G) in the Nordic Region

    DEFF Research Database (Denmark)

    Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo

    2018-01-01

    Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...

  8. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  9. Nitric oxide synthase-3 promotes embryonic development of atrioventricular valves.

    Directory of Open Access Journals (Sweden)

    Yin Liu

    Full Text Available Nitric oxide synthase-3 (NOS3 has recently been shown to promote endothelial-to-mesenchymal transition (EndMT in the developing atrioventricular (AV canal. The present study was aimed to investigate the role of NOS3 in embryonic development of AV valves. We hypothesized that NOS3 promotes embryonic development of AV valves via EndMT. To test this hypothesis, morphological and functional analysis of AV valves were performed in wild-type (WT and NOS3(-/- mice at postnatal day 0. Our data show that the overall size and length of mitral and tricuspid valves were decreased in NOS3(-/- compared with WT mice. Echocardiographic assessment showed significant regurgitation of mitral and tricuspid valves during systole in NOS3(-/- mice. These phenotypes were all rescued by cardiac specific NOS3 overexpression. To assess EndMT, immunostaining of Snail1 was performed in the embryonic heart. Both total mesenchymal and Snail1(+ cells in the AV cushion were decreased in NOS3(-/- compared with WT mice at E10.5 and E12.5, which was completely restored by cardiac specific NOS3 overexpression. In cultured embryonic hearts, NOS3 promoted transforming growth factor (TGFβ, bone morphogenetic protein (BMP2 and Snail1expression through cGMP. Furthermore, mesenchymal cell formation and migration from cultured AV cushion explants were decreased in the NOS3(-/- compared with WT mice. We conclude that NOS3 promotes AV valve formation during embryonic heart development and deficiency in NOS3 results in AV valve insufficiency.

  10. Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population.

    Science.gov (United States)

    Li, Changgui; Chu, Nan; Wang, Binbin; Wang, Jing; Luan, Jian; Han, Lin; Meng, Dongmei; Wang, Yunlong; Suo, Peisu; Cheng, Longfei; Ma, Xu; Miao, Zhimin; Liu, Shiguo

    2012-01-01

    Glucose transporter 9 (GLUT9) is a high-capacity/low-affinity urate transporter. To date, several recent genome-wide association studies (GWAS) and follow-up studies have identified genetic variants of SLC2A9 associated with urate concentrations and susceptibility to gout. We therefore investigated associations between gout and polymorphisms and haplotypes in the presumptive promoter region of GLUT9 in Chinese males. The approximately 2000 bp presumptive promoter region upstream of the start site of exon 1 of GLUT9 was sequenced and subjected to genetic analysis. A genotype-phenotype correlation was performed and polymorphisms-induced changes in transcription factor binding sites were predicted. Of 21 SNPs identified in GLUT9, five had not been previously reported. Two of the SNPs (rs13124007 and rs6850166) were associated with susceptibility to gout (p = 0.009 and p = 0.042, respectively). The C allele of rs13124007 appeared to be the risk allele for predisposition to gout (p = 0.006, OR 1.709 [95% CI 1.162-2.514]). For rs6850166, an increased risk of gout was associated with the A allele (p = 0.029, OR 1.645 [95% CI 1.050-2.577]). After Bonferroni correction, there was statistically difference in rs13124007 allele frequencies between gout cases and controls (P = 0.042). Haplotype analyses showed that haplotype GG was a protective haplotype (p = 0.0053) and haplotype CA was associated with increased risk of gout (p = 0.0326). Genotype-phenotype analysis among gout patients revealed an association of rs13124007 with serum triglycerides levels (P = 0.001). The C to G substitution in polymorphism rs13124007 resulted in a loss of a binding site for transcription factor interferon regulatory factor 1 (IRF-1). Polymorphisms rs13124007 and rs6850166 are associated with susceptibility to gout in Chinese males.

  11. Fiber optic lasers with emission to the region 2-3 μm of IR medium

    International Nuclear Information System (INIS)

    Anzuelo Sanchez, G.; Osuna Galan, I.; Camas Anzueto, J.; Martinez Rios, A.; Selvas Aguilar, R.

    2009-01-01

    We present recent advances in laser emission in the 2-2-5 μm mid-IR, using a chalcogenide fiber with low loss and a high Raman gain in the region 2-10 μm. We present a review of fiber lasers operating in 2-3 μm of the mid IR. (Author)

  12. The validity and reliability of the type 2 diabetes and health promotion scale Turkish version: a methodological study.

    Science.gov (United States)

    Yildiz, Esra; Kavuran, Esin

    2018-03-01

    A healthy promotion is important for maintaining health and preventing complications in patients with type 2 diabetes. The aim of the present study was to examine the psychometrics of a recently developed tool that can be used to screen for a health-promoting lifestyle in patients with type 2 diabetes. Data were collected from outpatients attending diabetes clinics. The Type 2 Diabetes and Health Promotion Scale (T2DHPS) and a demographic questionnaire were administered to 295 participants. Forward-backward translation of the original English version was used to develop a Turkish version. Internal consistency of the scale was assessed by Cronbach's alpha. An explanatory factor analysis and confirmatory factor analysis used validity of the Type 2 Diabetes and Health Promotion Scale - Turkish version. Kaiser-Meyer-Olkin (KMO) and Bartlett's sphericity tests showed that the sample met the criteria required for factor analysis. The reliability coefficient for the total scale was 0.84, and alpha coefficients for the subscales ranged from 0.57 to 0.92. A six-factor solution was obtained that explained 59.3% of the total variance. The ratio of chi-square statistics to degrees of freedom (χ 2 /df) 3.30 (χ 2 = 1157.48/SD = 350); error of root mean square approximation (RMSEA) 0.061; GFI value of 0.91 and comparative fit index (CFI) value was obtained as 0.91. Turkish version of The T2DHPS is a valid and reliable tool that can be used to assess patients' health-promoting lifestyle behaviours. Validity and reliability studies in different cultures and regions are recommended. © 2017 Nordic College of Caring Science.

  13. The promotion of regional integration of electricity markets: Lessons for developing countries

    International Nuclear Information System (INIS)

    Oseni, Musiliu O.; Pollitt, Michael G.

    2016-01-01

    This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

  14. Inferring dynamic gene regulatory networks in cardiac differentiation through the integration of multi-dimensional data.

    Science.gov (United States)

    Gong, Wuming; Koyano-Nakagawa, Naoko; Li, Tongbin; Garry, Daniel J

    2015-03-07

    Decoding the temporal control of gene expression patterns is key to the understanding of the complex mechanisms that govern developmental decisions during heart development. High-throughput methods have been employed to systematically study the dynamic and coordinated nature of cardiac differentiation at the global level with multiple dimensions. Therefore, there is a pressing need to develop a systems approach to integrate these data from individual studies and infer the dynamic regulatory networks in an unbiased fashion. We developed a two-step strategy to integrate data from (1) temporal RNA-seq, (2) temporal histone modification ChIP-seq, (3) transcription factor (TF) ChIP-seq and (4) gene perturbation experiments to reconstruct the dynamic network during heart development. First, we trained a logistic regression model to predict the probability (LR score) of any base being bound by 543 TFs with known positional weight matrices. Second, four dimensions of data were combined using a time-varying dynamic Bayesian network model to infer the dynamic networks at four developmental stages in the mouse [mouse embryonic stem cells (ESCs), mesoderm (MES), cardiac progenitors (CP) and cardiomyocytes (CM)]. Our method not only infers the time-varying networks between different stages of heart development, but it also identifies the TF binding sites associated with promoter or enhancers of downstream genes. The LR scores of experimentally verified ESCs and heart enhancers were significantly higher than random regions (p network inference model identified a region with an elevated LR score approximately -9400 bp upstream of the transcriptional start site of Nkx2-5, which overlapped with a previously reported enhancer region (-9435 to -8922 bp). TFs such as Tead1, Gata4, Msx2, and Tgif1 were predicted to bind to this region and participate in the regulation of Nkx2-5 gene expression. Our model also predicted the key regulatory networks for the ESC-MES, MES-CP and CP

  15. CO Reduction to CH3OSiMe3: Electrophile-Promoted Hydride Migration at a Single Fe Site.

    Science.gov (United States)

    Deegan, Meaghan M; Peters, Jonas C

    2017-02-22

    One of the major challenges associated with developing molecular Fischer-Tropsch catalysts is the design of systems that promote the formation of C-H bonds from H 2 and CO while also facilitating the release of the resulting CO-derived organic products. To this end, we describe the synthesis of reduced iron-hydride/carbonyl complexes that enable an electrophile-promoted hydride migration process, resulting in the reduction of coordinated CO to a siloxymethyl (L n Fe-CH 2 OSiMe 3 ) group. Intramolecular hydride-to-CO migrations are extremely rare, and to our knowledge the system described herein is the first example where such a process can be accessed from a thermally stable M(CO)(H) complex. Further addition of H 2 to L n Fe-CH 2 OSiMe 3 releases CH 3 OSiMe 3 , demonstrating net four-electron reduction of CO to CH 3 OSiMe 3 at a single Fe site.

  16. The promotion on cell growth of androgen-dependent prostate cancer by antimony via mimicking androgen activity.

    Science.gov (United States)

    Zhang, Changwen; Li, Penghao; Wen, Yingwu; Feng, Guowei; Liu, Yu; Zhang, Yangyi; Xu, Yong; Zhang, Zhihong

    2018-05-15

    Antimony is a widely used heavier pnictogens in industry, and its toxicity has been a matter of concern. Although previous studies have suggested that antimony may have the function as either a tumor suppressor or an oncogene in several cancers, the molecular basis underlying antimony-mediated transformation is still unclear. In the current study, we attempt to elucidate the potential role of antimony in the development of prostate cancer. Our results showed that the concentration of antimony was much higher in serum of prostate cancer patients, and was closely associated with poor outcome of patients who underwent radical prostatectomy. Additionally, low dose of antimony could promote proliferation and invasion of androgen-dependent prostate cancer cell line LNCaP cells in vitro and in vivo. The mechanistic studies demonstrated that exposure to antimony triggered the phosphorylation of androgen receptor (AR), which transcriptionally regulates the expression of androgen-related targets, including PSA and NKX3.1. Overall, our results unearthed that antimony could promote tumor growth by mimicking androgen activity in androgen-dependent prostate cancer cells. Therefore, these findings expanded our understanding on the molecular mechanism of antimony in tumorigenesis and tumor progression of prostate cancer, and it appears to be an inspiring strategy to restrain prostate cancer by inhibiting antimony-induced androgen-like effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Molecular cloning and characterization of porcine Na⁺/K⁺-ATPase isoforms α1, α2, α3 and the ATP1A3 promoter.

    Directory of Open Access Journals (Sweden)

    Carina Henriksen

    Full Text Available Na⁺/K⁺-ATPase maintains electrochemical gradients of Na⁺ and K⁺ essential for a variety of cellular functions including neuronal activity. The α-subunit of the Na⁺/K⁺-ATPase exists in four different isoforms (α1-α4 encoded by different genes. With a view to future use of pig as an animal model in studies of human diseases caused by Na⁺/K⁺-ATPase mutations, we have determined the porcine coding sequences of the α1-α3 genes, ATP1A1, ATP1A2, and ATP1A3, their chromosomal localization, and expression patterns. Our ATP1A1 sequence accords with the sequences from several species at five positions where the amino acid residue of the previously published porcine ATP1A1 sequence differs. These corrections include replacement of glutamine 841 with arginine. Analysis of the functional consequences of substitution of the arginine revealed its importance for Na⁺ binding, which can be explained by interaction of the arginine with the C-terminus, stabilizing one of the Na⁺ sites. Quantitative real-time PCR expression analyses of porcine ATP1A1, ATP1A2, and ATP1A3 mRNA showed that all three transcripts are expressed in the embryonic brain as early as 60 days of gestation. Expression of α3 is confined to neuronal tissue. Generally, the expression patterns of ATP1A1, ATP1A2, and ATP1A3 transcripts were found similar to their human counterparts, except for lack of α3 expression in porcine heart. These expression patterns were confirmed at the protein level. We also report the sequence of the porcine ATP1A3 promoter, which was found to be closely homologous to its human counterpart. The function and specificity of the porcine ATP1A3 promoter was analyzed in transgenic zebrafish, demonstrating that it is active and drives expression in embryonic brain and spinal cord. The results of the present study provide a sound basis for employing the ATP1A3 promoter in attempts to generate transgenic porcine models of neurological diseases caused by

  18. Ginsenoside 20(S)-Rg3 Inhibits the Warburg Effect Via Modulating DNMT3A/ MiR-532-3p/HK2 Pathway in Ovarian Cancer Cells.

    Science.gov (United States)

    Zhou, Yuanyuan; Zheng, Xia; Lu, Jiaojiao; Chen, Wei; Li, Xu; Zhao, Le

    2018-01-01

    The Warburg effect is one of the main energy metabolism features supporting cancer cell growth. 20(S)-Rg3 exerts anti-tumor effect on ovarian cancer partly by inhibiting the Warburg effect. microRNAs are important regulators of the Warburg effect. However, the microRNA regulatory network mediating the anti-Warburg effect of 20(S)-Rg3 was largely unknown. microRNA deep sequencing was performed to identify the 20(S)-Rg3-influenced microRNAs in SKOV3 ovarian cancer cells. miR-532-3p was overexpressed by mimic532-3p transfection in SKOV3 and A2780 cells or inhibited by inhibitor532-3p transfection in 20(S)-Rg3-treated cells to examine the changes in HK2 and PKM2 expression, glucose consumption, lactate production and cell growth. Dual-luciferase reporter assay was conducted to verify the direct binding of miR-532-3p to HK2. The methylation status in the promoter region of pre-miR-532-3p gene was examined by methylation-specific PCR. Expression changes of key molecules controlling DNA methylation including DNMT1, DNMT3A, DNMT3B, and TET1-3 were examined in 20(S)-Rg3-treated cells. DNMT3A was overexpressed in 20(S)-Rg3-treated cells to examine its influence on miR-532-3p level, HK2 and PKM2 expression, glucose consumption and lactate production. Deep sequencing results showed that 11 microRNAs were increased and 9 microRNAs were decreased by 20(S)-Rg3 in SKOV3 cells, which were verified by qPCR. More than 2-fold increase of miR-532-3p was found in 20(S)-Rg3-treated SKOV3 cells. Forced expression of miR-532-3p reduced HK2 and PKM2 expression, glucose consumption and lactate production in SKOV3 and A2780 ovarian cancer cells. Inhibition of miR-532-3p antagonized the suppressive effect of 20(S)-Rg3 on HK2 and PKM2 expression, glucose consumption and lactate production in ovarian cancer cells. Dual-luciferase reporter assay showed that miR-532-3p directly suppressed HK2 rather than PKM2. miR-532-3p level was controlled by the methylation in the promoter region of its host

  19. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  20. Neurotrophin-3 Induces BMP-2 and VEGF Activities and Promotes the Bony Repair of Injured Growth Plate Cartilage and Bone in Rats.

    Science.gov (United States)

    Su, Yu-Wen; Chung, Rosa; Ruan, Chun-Sheng; Chim, Shek Man; Kuek, Vincent; Dwivedi, Prem P; Hassanshahi, Mohammadhossein; Chen, Ke-Ming; Xie, Yangli; Chen, Lin; Foster, Bruce K; Rosen, Vicki; Zhou, Xin-Fu; Xu, Jiake; Xian, Cory J

    2016-06-01

    Injured growth plate is often repaired by bony tissue causing bone growth defects, for which the mechanisms remain unclear. Because neurotrophins have been implicated in bone fracture repair, here we investigated their potential roles in growth plate bony repair in rats. After a drill-hole injury was made in the tibial growth plate and bone, increased injury site mRNA expression was observed for neurotrophins NGF, BDNF, NT-3, and NT-4 and their Trk receptors. NT-3 and its receptor TrkC showed the highest induction. NT-3 was localized to repairing cells, whereas TrkC was observed in stromal cells, osteoblasts, and blood vessel cells at the injury site. Moreover, systemic NT-3 immunoneutralization reduced bone volume at injury sites and also reduced vascularization at the injured growth plate, whereas recombinant NT-3 treatment promoted bony repair with elevated levels of mRNA for osteogenic markers and bone morphogenetic protein (BMP-2) and increased vascularization and mRNA for vascular endothelial growth factor (VEGF) and endothelial cell marker CD31 at the injured growth plate. When examined in vitro, NT-3 promoted osteogenesis in rat bone marrow stromal cells, induced Erk1/2 and Akt phosphorylation, and enhanced expression of BMPs (particularly BMP-2) and VEGF in the mineralizing cells. It also induced CD31 and VEGF mRNA in rat primary endothelial cell culture. BMP activity appears critical for NT-3 osteogenic effect in vitro because it can be almost completely abrogated by co-addition of the BMP inhibitor noggin. Consistent with its angiogenic effect in vivo, NT-3 promoted angiogenesis in metatarsal bone explants, an effect abolished by co-treatment with anti-VEGF. This study suggests that NT-3 may be an osteogenic and angiogenic factor upstream of BMP-2 and VEGF in bony repair, and further studies are required to investigate whether NT-3 may be a potential target for preventing growth plate faulty bony repair or for promoting bone fracture healing. © 2016

  1. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  2. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  3. In vitro epigenetic reprogramming of human cardiac mesenchymal stromal cells into functionally competent cardiovascular precursors.

    Directory of Open Access Journals (Sweden)

    Matteo Vecellio

    Full Text Available Adult human cardiac mesenchymal-like stromal cells (CStC represent a relatively accessible cell type useful for therapy. In this light, their conversion into cardiovascular precursors represents a potential successful strategy for cardiac repair. The aim of the present work was to reprogram CStC into functionally competent cardiovascular precursors using epigenetically active small molecules. CStC were exposed to low serum (5% FBS in the presence of 5 µM all-trans Retinoic Acid (ATRA, 5 µM Phenyl Butyrate (PB, and 200 µM diethylenetriamine/nitric oxide (DETA/NO, to create a novel epigenetically active cocktail (EpiC. Upon treatment the expression of markers typical of cardiac resident stem cells such as c-Kit and MDR-1 were up-regulated, together with the expression of a number of cardiovascular-associated genes including KDR, GATA6, Nkx2.5, GATA4, HCN4, NaV1.5, and α-MHC. In addition, profiling analysis revealed that a significant number of microRNA involved in cardiomyocyte biology and cell differentiation/proliferation, including miR 133a, 210 and 34a, were up-regulated. Remarkably, almost 45% of EpiC-treated cells exhibited a TTX-sensitive sodium current and, to a lower extent in a few cells, also the pacemaker I(f current. Mechanistically, the exposure to EpiC treatment introduced global histone modifications, characterized by increased levels of H3K4Me3 and H4K16Ac, as well as reduced H4K20Me3 and H3s10P, a pattern compatible with reduced proliferation and chromatin relaxation. Consistently, ChIP experiments performed with H3K4me3 or H3s10P histone modifications revealed the presence of a specific EpiC-dependent pattern in c-Kit, MDR-1, and Nkx2.5 promoter regions, possibly contributing to their modified expression. Taken together, these data indicate that CStC may be epigenetically reprogrammed to acquire molecular and biological properties associated with competent cardiovascular precursors.

  4. The Role of Fe2O3 Species in Depressing the Formation of N2O in the Selective Reduction of NO by NH3 over V2O5/TiO2-Based Catalysts

    Directory of Open Access Journals (Sweden)

    Moon Hyeon Kim

    2018-03-01

    Full Text Available Promotion of 2.73% Fe2O3 in an in-house-made V2O5-WO3/TiO2 (VWT and a commercial V2O5-WO3/TiO2 (c-VWT has been investigated as a cost effective approach to the suppression of N2O formation in the selective catalytic reduction of NO by NH3 (NH3-SCR. The promoted VWT and c-VWT catalysts all gave a significantly decreased N2O production at temperatures >400 °C compared to the unpromoted samples. However, such a promotion led to the loss in high temperature NO conversion, mainly due to the oxidation of NH3 to N-containing gases, particularly NO. Characterization of the unpromoted and promoted catalysts using X-ray diffraction (XRD, NH3 adsorption-desorption, and Raman spectroscopy techniques could explain the reason why the promotion showed much lower N2O formation levels at high temperatures. The addition of Fe2O3 to c-VWT resulted in redispersion of the V2O5 species, although this was not visible for 2.73% Fe2O3/VWT. The iron oxides exist as a highly-dispersed noncrystalline α-Fe2O3 in the promoted catalysts. These Raman spectra had a new Raman signal that could be tentatively assigned to Fe2O3-induced tetrahedrally coordinated polymeric vanadates and/or surface V-O-Fe species with significant electronic interactions between the both metal oxides. Calculations of the monolayer coverage of each metal oxide and the surface total coverage are reasonably consistent with Raman measurements. The proposed vanadia-based surface polymeric entities may play a key role for the substantial reduction of N2O formed at high temperatures by NH3 species adsorbed strongly on the promoted catalysts. This reaction is a main pathway to greatly suppress the extent of N2O formation in NH3-SCR reaction over the promoted catalysts.

  5. Bag3 promotes resistance to apoptosis through Bcl-2 family members in non-small cell lung cancer.

    Science.gov (United States)

    Zhang, Yong; Wang, Jian-Hua; Lu, Qiang; Wang, Yun-Jie

    2012-01-01

    In non-small cell lung cancer (NSCLC) certain molecular characteristics, which are related to molecular alterations have been investigated. These are responsible for both the initiation and maintenance of the malignancy in lung cancer. The aim of this study was to evaluate the influence of Bag3 (Bcl-2 associated athanogene 3) in the regulation of apoptosis on NSCLC. Bag3 and Hsp70 expression were examined by immunohistochemistry to confirm their potential roles in the prevalence of NSCLC. We also established human normal bronchial epithelial cells and HOP-62 cell line as the model to analyze cell apoptosis and the expression of Hsp70, Bcl-XL and Bcl-2, which were affected by Bag3. In this study, we found that Bag3 and Hsp70 are highly expressed in few tissues and cell lines of NSCLC. Bag3 inhibits apoptosis in human normal bronchial epithelial cell lines and sustain the survival of NSCLC cells. Bag3, Hsp70, Bcl-XL and Bcl-2 are up-regulated in NSCLC cell lines. At the same time, the silencing of Bag3 results in diminishing protein levels of Bcl-XL and Bcl-2. The results of immunoprecipitation identified that Bag3 could interact with Hsp70, Bcl-XL and Bcl-2 NSCLC cells directly or indirectly. We conclude that NSCLC cells were protected from apoptosis through increasing Bag3 expression and consequently promoted the expression of Bcl-XL and Bcl-2.

  6. Designing a HER2/neu promoter to drive α1,3galactosyltransferase expression for targeted anti-αGal antibody-mediated tumor cell killing

    International Nuclear Information System (INIS)

    Lanteri, Marion; Ollier, Laurence; Giordanengo, Valérie; Lefebvre, Jean-Claude

    2005-01-01

    Our goal was to specifically render tumor cells susceptible to natural cytolytic anti-αGal antibodies by using a murine α1,3galactosyltransferase (mαGalT) transgene driven by a designed form of HER2/neu promoter (pNeu), the transcription of which is frequently observed to be above basal in breast tumors. Indeed, the αGalT activity that promotes Galα1,3Galβ1,4GlcNAc-R (αGal) epitope expression has been mutationally disrupted during the course of evolution, starting from Old World primates, and this has led to the counter-production of large amounts of cytotoxic anti-αGal antibodies in recent primates, including man. Expression of the endogenous c-erbB-2 gene was investigated in various cell lines by northern blotting. A mαGalT cDNA was constructed into pcDNA3 vector downstream of the original CMV promoter (pCMV/mαGalT) and various forms of pNeu were prepared by PCR amplification and inserted in the pCMV/mαGalT construct upstream of the mαGalT cDNA, in the place of the CMV promoter. These constructs were transferred into HEK-293 control and breast tumor cell lines. Stably transfected cells were analyzed by northern blotting for their expression of αGalT and c-erbB-2, and by flow cytometry for their binding with fluorescein isothiocyanate-conjugated Griffonia simplicifolia/isolectin B4. We show that expression of the mαGalT was up- or down-modulated according to the level of endogenous pNeu activity and the particular form of constructed pNeu. Among several constructs, two particular forms of the promoter, pNeu250 containing the CCAAT box and the PEA3 motif adjacent to the TATAA box, and pNeu664, which has three additional PEA3 motifs upstream of the CCAAT box, were found to promote differential αGalT expression. Our results strengthen current concepts about the crucial role played by the proximal PEA3 motif of pNeu, and may represent a novel therapeutic approach for the development of targeted transgene expression

  7. Multi-tasking role of the mechanosensing protein Ankrd2 in the signaling network of striated muscle.

    Directory of Open Access Journals (Sweden)

    Anna Belgrano

    Full Text Available Ankrd2 (also known as Arpp together with Ankrd1/CARP and DARP are members of the MARP mechanosensing proteins that form a complex with titin (N2A/calpain 3 protease/myopalladin. In muscle, Ankrd2 is located in the I-band of the sarcomere and moves to the nucleus of adjacent myofibers on muscle injury. In myoblasts it is predominantly in the nucleus and on differentiation shifts from the nucleus to the cytoplasm. In agreement with its role as a sensor it interacts both with sarcomeric proteins and transcription factors.Expression profiling of endogenous Ankrd2 silenced in human myotubes was undertaken to elucidate its role as an intermediary in cell signaling pathways. Silencing Ankrd2 expression altered the expression of genes involved in both intercellular communication (cytokine-cytokine receptor interaction, endocytosis, focal adhesion, tight junction, gap junction and regulation of the actin cytoskeleton and intracellular communication (calcium, insulin, MAPK, p53, TGF-β and Wnt signaling. The significance of Ankrd2 in cell signaling was strengthened by the fact that we were able to show for the first time that Nkx2.5 and p53 are upstream effectors of the Ankrd2 gene and that Ankrd1/CARP, another MARP member, can modulate the transcriptional ability of MyoD on the Ankrd2 promoter. Another novel finding was the interaction between Ankrd2 and proteins with PDZ and SH3 domains, further supporting its role in signaling. It is noteworthy that we demonstrated that transcription factors PAX6, LHX2, NFIL3 and MECP2, were able to bind both the Ankrd2 protein and its promoter indicating the presence of a regulatory feedback loop mechanism.In conclusion we demonstrate that Ankrd2 is a potent regulator in muscle cells affecting a multitude of pathways and processes.

  8. Rac1 promotes chondrogenesis by regulating STAT3 signaling pathway.

    Science.gov (United States)

    Kim, Hyoin; Sonn, Jong Kyung

    2016-09-01

    The small GTPase protein Rac1 is involved in a wide range of biological processes including cell differentiation. Previously, Rac1 was shown to promote chondrogenesis in micromass cultures of limb mesenchyme. However, the pathways mediating Rac1's role in chondrogenesis are not fully understood. This study aimed to explore the molecular mechanisms by which Rac1 regulates chondrogenic differentiation. Phosphorylation of signal transducer and activator of transcription 3 (STAT3) was increased as chondrogenesis proceeded in micromass cultures of chick wing bud mesenchyme. Inhibition of Rac1 with NSC23766, janus kinase 2 (JAK2) with AG490, or STAT3 with stattic inhibited chondrogenesis and reduced phosphorylation of STAT3. Conversely, overexpression of constitutively active Rac1 (Rac L61) increased phosphorylation of STAT3. Rac L61 expression resulted in increased expression of interleukin 6 (IL-6), and treatment with IL-6 increased phosphorylation of STAT3. NSC23766, AG490, and stattic prohibited cell aggregation, whereas expression of Rac L61 increased cell aggregation, which was reduced by stattic treatment. Our studies indicate that Rac1 induces STAT3 activation through expression and action of IL-6. Overexpression of Rac L61 increased expression of bone morphogenic protein 4 (BMP4). BMP4 promoted chondrogenesis, which was inhibited by K02288, an activin receptor-like kinase-2 inhibitor, and increased phosphorylation of p38 MAP kinase. Overexpression of Rac L61 also increased phosphorylation of p38 MAPK, which was reduced by K02288. These results suggest that Rac1 activates STAT3 by expression of IL-6, which in turn increases expression and activity of BMP4, leading to the promotion of chondrogenesis. © 2016 International Federation for Cell Biology.

  9. The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries

    Directory of Open Access Journals (Sweden)

    Nove E. Variant Anna

    2015-04-01

    Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.

  10. The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries

    Directory of Open Access Journals (Sweden)

    Nove E. Variant Anna

    2018-01-01

    Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.

  11. Electrochemical promotion of sulfur dioxide catalytic oxidation

    DEFF Research Database (Denmark)

    Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm

    2000-01-01

    investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...

  12. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box.

    Science.gov (United States)

    Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L

    2000-10-01

    The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

  13. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

    Science.gov (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

    2014-04-01

    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  14. An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

    Science.gov (United States)

    Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

    2013-01-01

    On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

  15. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  16. Identiifcation and validation of root-speciifc promoters in rice

    Institute of Scientific and Technical Information of China (English)

    HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying

    2015-01-01

    Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).

  17. 15-Deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2) mediates repression of TNF-α by decreasing levels of acetylated histone H3 and H4 at its promoter

    International Nuclear Information System (INIS)

    Engdahl, Ryan; Monroy, M. Alexandra; Daly, John M.

    2007-01-01

    Prostaglandin metabolite 15-Deoxy-Δ 12,14 -prostaglandin J2 (15d-PGJ2) is known to inhibit a number of pro-inflammatory cytokines as well as being a ligand for nuclear receptor PPARγ. We investigated the ability of 15d-PGJ2 to inhibit TNF-α gene expression through mechanisms that involve histone modification. Pretreatment with 15d-PGJ2 (10 μM) inhibited LPS-stimulated TNF-α mRNA in THP-1 monocytes or PMA-differentiated cells to nearly basal levels. A specific PPARγ ligand, GW1929, failed to inhibit LPS-induced TNF-α mRNA expression nor did a PPARγ antagonist, GW9662, alter the repression of TNF-α mRNA in LPS-stimulated cells pretreated with 15d-PGJ2 suggesting a PPARγ-independent inhibition of TNF-α mRNA in THP-1 cells. Transfection studies with a reporter construct and subsequent treatment with 15d-PGJ2 demonstrated a dose-dependent inhibition of the TNF-α promoter. Additional studies demonstrated that inhibition of histone deacetylases with trichostatin A (TSA) or overexpression of histone acetyltransferase CBP could overcome 15d-PGJ2-mediated repression of the TNF-α promoter, suggesting that an important mechanism whereby 15d-PGJ2 suppresses a cytokine is through factors that regulate histone modifications. To examine the endogenous TNF-α promoter, chromatin immunoprecipitations (ChIP) were performed. ChIP assays demonstrated that LPS stimulation induced an increase in histone H3 and H4 acetylation at the TNF-α promoter, which was reduced in cells pretreated with 15d-PGJ2. These results highlight the ability of acetylation and deacetylation factors to affect the TNF-α promoter and demonstrate that an additional important mechanism whereby 15d-PGJ2 mediates TNF-α transcriptional repression by altering levels of acetylated histone H3 and H4 at its promoter

  18. CRH promotes human colon cancer cell proliferation via IL-6/JAK2/STAT3 signaling pathway and VEGF-induced tumor angiogenesis.

    Science.gov (United States)

    Fang, Xianjun; Hong, Yali; Dai, Li; Qian, Yuanyuan; Zhu, Chao; Wu, Biao; Li, Shengnan

    2017-11-01

    Corticotrophin-releasing hormone (CRH) has been demonstrated to participate in various diseases. Our previous study showed that its receptor CRHR1 mediated the development of colitis-associated cancer in mouse model. However, the detailed mechanisms remain unclear. In this study, we explored the oncogenetic role of CRH/CRHR1 signaling in colon cancer cells. Cell proliferation and colony formation assays revealed that CRH contributed to cell proliferation. Moreover, tube formation assay showed that CRH-treated colon cancer cell supernatant significantly promoted tube formation of human umbilical vein endothelial cells (HUVECs). And these effects could be reversed by the CRHR1 specific antagonist Antalarmin. Further investigation showed that CRH significantly upregulated the expressions of interlukin-6 (IL-6) and vascular endothelial growth factor (VEGF) through activating nuclear factor-kappa B (NF-κB). The CRH-induced IL-6 promoted phosphorylation of janus kinase 2 (JAK2) and signal transducers and activators of transcription 3 (STAT3). STAT3 inhibition by Stattic significantly inhibited the CRH-induced cell proliferation. In addition, silence of VEGF resulted in declined tube formation induced by CRH. Taken together, CRH/CRHR1 signaling promoted human colon cancer cell proliferation via NF-κB/IL-6/JAK2/STAT3 signaling pathway and tumor angiogenesis via NF-κB/VEGF signaling pathway. Our results provide evidence to support a critical role for the CRH/CRHR1 signaling in colon cancer progression and suggest its potential utility as a new therapeutic target for colon cancer. © 2017 Wiley Periodicals, Inc.

  19. Using the ANGELO model to develop the children's healthy living program multilevel intervention to promote obesity preventing behaviors for young children in the U.S.-affiliated Pacific Region.

    Science.gov (United States)

    Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel

    2014-12-01

    Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.

  20. Elucidating Key Motifs Required for Arp2/3-Dependent and Independent Actin Nucleation by Las17/WASP

    Science.gov (United States)

    Urbanek, Agnieszka N.; Smaczynska-de Rooij, Iwona I.

    2016-01-01

    Actin nucleation is the key rate limiting step in the process of actin polymerization, and tight regulation of this process is critical to ensure actin filaments form only at specific times and at defined regions of the cell. Arp2/3 is a well-characterised protein complex that can promote nucleation of new filaments, though its activity requires additional nucleation promotion factors (NPFs). The best recognized of these factors are the WASP family of proteins that contain binding motifs for both monomeric actin and for Arp2/3. Previously we demonstrated that the yeast WASP homologue, Las17, in addition to activating Arp2/3 can also nucleate actin filaments de novo, independently of Arp2/3. This activity is dependent on its polyproline rich region. Through biochemical and in vivo analysis we have now identified key motifs within the polyproline region that are required for nucleation and elongation of actin filaments, and have addressed the role of the WH2 domain in the context of actin nucleation without Arp2/3. We have also demonstrated that full length Las17 is able to bind liposomes giving rise to the possibility of direct linkage of nascent actin filaments to specific membrane sites to which Las17 has been recruited. Overall, we propose that Las17 functions as the key initiator of de novo actin filament formation at endocytic sites by nucleating, elongating and tethering nascent filaments which then serve as a platform for Arp2/3 recruitment and function. PMID:27637067

  1. Anatomical region-dependent enhancement of 3-dimensional chondrogenic differentiation of human mesenchymal stem cells by soluble meniscus extracellular matrix.

    Science.gov (United States)

    Rothrauff, Benjamin B; Shimomura, Kazunori; Gottardi, Riccardo; Alexander, Peter G; Tuan, Rocky S

    2017-02-01

    Extracellular matrix (ECM) derived from decellularized tissues has been found to promote tissue neogenesis, most likely mediated by specific biochemical and physical signaling motifs that promote tissue-specific differentiation of progenitor cells. Decellularized ECM has been suggested to be efficacious for the repair of tissue injuries. However, decellularized meniscus contains a dense collagenous structure, which impedes cell seeding and infiltration and is not readily applicable for meniscus repair. In addition, the meniscus consists of two distinct anatomical regions that differ in vascularity and cellular phenotype. The purpose of this study was to explore the region-specific bioactivity of solubilized ECM derived from the inner and outer meniscal regions as determined in 2D and 3D cultures of adult mesenchymal stem cells (MSCs). When added as a medium supplement to 2D cultures of MSCs, urea-extracted fractions of the inner (imECM) and outer meniscal ECM (omECM) enhanced cell proliferation while imECM most strongly upregulated fibrochondrogenic differentiation on the basis of gene expression profiles. When added to 3D cultures of MSCs seeded in photocrosslinked methacrylated gelatin (GelMA) hydrogels, both ECM fractions upregulated chondrogenic differentiation as determined by gene expression and protein analyses, as well as elevated sulfated glycosaminoglycan sGAG content, compared to ECM-free controls. The chondrogenic effect at day 21 was most pronounced with imECM supplementation, but equivalent between ECM groups by day 42. Despite increased cartilage matrix, imECM and omECM constructs possessed compressive moduli similar to controls. In conclusion, soluble meniscal ECM may be considered for use as a tissue-specific reagent to enhance chondrogenesis for MSC-based 3D cartilage tissue engineering. The inner region of the knee meniscus is frequently injured and possesses a poor intrinsic healing capacity. Solubilized extracellular matrix (ECM) derived from

  2. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    Science.gov (United States)

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.

  3. HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

    Energy Technology Data Exchange (ETDEWEB)

    Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)

    2016-04-15

    Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

  4. HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

    International Nuclear Information System (INIS)

    Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi

    2016-01-01

    Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

  5. DNA rearrangement in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene

    International Nuclear Information System (INIS)

    Tsujimoto, Y.; Bashir, M.M.; Givol, I.; Cossman, J.; Jaffe, E.; Croce, C.M.

    1987-01-01

    In most human lymphomas, the chromosome translocation t(14;18) occurs within two breakpoint clustering regions on chromosome 18, the major one at the 3' untranslated region of the bcl-2 gene and the minor one at 3' of the gene. Analysis of a panel of follicular lymphoma DNAs using probes for the first exon of the bcl-2 gene indicates that DNA rearrangements may also occur 5' to the involved bcl-2 gene. In this case the IgH locus and the bcl-2 gene are found in an order suggesting that an inversion also occurred during the translocation process. The coding region of the bcl-2 gene, however, are left intact in all cases of follicular lymphoma studied to date

  6. Role of regional policies in promoting networking and innovation activity of firms

    OpenAIRE

    Kirsi Mukkala; Jari Ritsilä

    2004-01-01

    The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

  7. FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease

    Directory of Open Access Journals (Sweden)

    Ho-Chang Kuo

    2015-01-01

    Full Text Available Kawasaki disease (KD is characterized by pediatric systemic vasculitis of an unknown cause. The low affinity immunoglobulin gamma Fc region receptor II-a (FCGR2A gene was reported to be involved in the susceptibility of KD. DNA methylation is one of the epigenetic mechanisms that control gene expression; thus, we hypothesized that methylation status of CpG islands in FCGR2A promoter associates with the susceptibility and therapeutic outcomes of Kawasaki disease. In this study, 36 KD patients and 24 healthy subjects from out-patient clinic were recruited. Eleven potential methylation sites within the targeted promoter region of FCGR2A were selected for investigation. We marked the eleven methylation sites from A to K. Our results indicated that methylation at the CpG sites G, H, and J associated with the risk of KD. CpG sites B, C, E, F, H, J, and K were found to associate with the outcomes of IVIG treatment. In addition, CpG sites G, J, and K were predicted as transcription factors binding sites for NF-kB, Myc-Max, and SP2, respectively. Our study reported a significant association among the promoter methylation of FCGR2A, susceptibility of KD, and the therapeutic outcomes of IVIG treatment. The methylation levels of CpG sites of FCGR2A gene promoter should be an important marker for optimizing IVIG therapy.

  8. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  9. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  10. PRL-3 promotes the motility, invasion, and metastasis of LoVo colon cancer cells through PRL-3-integrin β1-ERK1/2 and-MMP2 signaling

    Directory of Open Access Journals (Sweden)

    Wu Jian

    2009-11-01

    Full Text Available Abstract Background Phosphatase of regenerating liver-3 (PRL-3 plays a causative role in tumor metastasis, but the underlying mechanisms are not well understood. In our previous study, we observed that PRL-3 could decrease tyrosine phosphorylation of integrin β1 and enhance activation of ERK1/2 in HEK293 cells. Herein we aim to explore the association of PRL-3 with integrin β1 signaling and its functional implications in motility, invasion, and metastasis of colon cancer cell LoVo. Methods Transwell chamber assay and nude mouse model were used to study motility and invasion, and metastsis of LoVo colon cancer cells, respectively. Knockdown of integrin β1 by siRNA or lentivirus were detected with Western blot and RT-PCR. The effect of PRL-3 on integrin β1, ERK1/2, and MMPs that mediate motility, invasion, and metastasis were measured by Western blot, immunofluorencence, co-immunoprecipitation and zymographic assays. Results We demonstrated that PRL-3 associated with integrin β1 and its expression was positively correlated with ERK1/2 phosphorylation in colon cancer tissues. Depletion of integrin β1 with siRNA, not only abrogated the activation of ERK1/2 stimulated by PRL-3, but also abolished PRL-3-induced motility and invasion of LoVo cells in vitro. Similarly, inhibition of ERK1/2 phosphorylation with U0126 or MMP activity with GM6001 also impaired PRL-3-induced invasion. In addition, PRL-3 promoted gelatinolytic activity of MMP2, and this stimulation correlated with decreased TIMP2 expression. Moreover, PRL-3-stimulated lung metastasis of LoVo cells in a nude mouse model was inhibited when integrin β1 expression was interfered with shRNA. Conclusion Our results suggest that PRL-3's roles in motility, invasion, and metastasis in colon cancer are critically controlled by the integrin β1-ERK1/2-MMP2 signaling.

  11. Sonic hedgehog expressing and responding cells generate neuronal diversity in the medial amygdala

    Directory of Open Access Journals (Sweden)

    Machold Robert P

    2010-05-01

    Full Text Available Abstract Background The mammalian amygdala is composed of two primary functional subdivisions, classified according to whether the major output projection of each nucleus is excitatory or inhibitory. The posterior dorsal and ventral subdivisions of the medial amygdala, which primarily contain inhibitory output neurons, modulate specific aspects of innate socio-sexual and aggressive behaviors. However, the development of the neuronal diversity of this complex and important structure remains to be fully elucidated. Results Using a combination of genetic fate-mapping and loss-of-function analyses, we examined the contribution and function of Sonic hedgehog (Shh-expressing and Shh-responsive (Nkx2-1+ and Gli1+ neurons in the medial amygdala. Specifically, we found that Shh- and Nkx2-1-lineage cells contribute differentially to the dorsal and ventral subdivisions of the postnatal medial amygdala. These Shh- and Nkx2-1-lineage neurons express overlapping and non-overlapping inhibitory neuronal markers, such as Calbindin, FoxP2, nNOS and Somatostatin, revealing diverse fate contributions in discrete medial amygdala nuclear subdivisions. Electrophysiological analysis of the Shh-derived neurons additionally reveals an important functional diversity within this lineage in the medial amygdala. Moreover, inducible Gli1CreER(T2 temporal fate mapping shows that early-generated progenitors that respond to Shh signaling also contribute to medial amygdala neuronal diversity. Lastly, analysis of Nkx2-1 mutant mice demonstrates a genetic requirement for Nkx2-1 in inhibitory neuronal specification in the medial amygdala distinct from the requirement for Nkx2-1 in cerebral cortical development. Conclusions Taken together, these data reveal a differential contribution of Shh-expressing and Shh-responding cells to medial amygdala neuronal diversity as well as the function of Nkx2-1 in the development of this important limbic system structure.

  12. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  13. Impacts of Built-Up Area Expansion in 2D and 3D on Regional Surface Temperature

    Directory of Open Access Journals (Sweden)

    Hongyan Cai

    2017-10-01

    Full Text Available Many studies have reported the thermal effects of urban expansion from non-built-up land; however, how changes in building height in built-up land influence the regional thermal environment is still uncertain. Thus, taking the transitional region between the Chinese megacities of Beijing and Tianjin as the study area, this study investigated the impacts of built-up land expansion in 2D and 3D on regional land surface temperature (LST. The expansion in 2D refers to the conversion from non-built-up land to built-up land, whereas the expansion in 3D characterized the building height change in the built-up land, referring to the conversion from low- and moderate-rise building (LMRB to high-rise building (HRB lands. The land use change from 2010 to 2015 was manually interpreted from high spatial resolution SPOT5 and Gaofen2 images, and the LST information in the corresponding period was derived from Landsat5/8 thermal images using an image-based method. The results showed that between 2010 and 2015, approximately 87.25 km2 non-built-up land was transformed to built-up land, and 13.21 km2 LMRB land was built into HRB land. These two types of built-up land expansions have induced opposing thermal effects in regard to regional surface temperature. The built-up land expansions from cropland and urban green land have raised the regional LST. However, the built-up land expansion from LMRB to HRB lands has induced a cooling effect. Thus, this study suggested that for the cooling urban design, the building height should also be considered. Furthermore, for future studies on thermal impacts of urbanization, it should be cautioned that, besides the urban area expansion, the building height change should also be emphasized due to its potential cooling effects.

  14. Promoter- and cell-specific epigenetic regulation of CD44, Cyclin D2, GLIPR1 and PTEN by Methyl-CpG binding proteins and histone modifications

    International Nuclear Information System (INIS)

    Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi

    2010-01-01

    The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile

  15. Expeditious Entry to Novel 2-Methylene-2,3-dihydrofuro[3,2-c] chromen-2-ones from 6-Chloro-4-hydroxychromen-2-one and Propargylic Alcohols

    Directory of Open Access Journals (Sweden)

    Josefina Díez

    2011-08-01

    Full Text Available A catalytic system consisting of the ruthenium(II complex [Ru(η3-2-C3H4Me(CO(dppf][SbF6] (dppf = 1,1’-bis(diphenylphosphinoferrocene and trifluoroacetic acid has been used to promote the coupling of secondary propargylic alcohols with 6-chloro-4-hydroxychromen-2-one. The reactions afforded unusual 2-methylene-2,3-dihydrofuro[3,2-c]chromen-2-ones in good yields.

  16. Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.

    Science.gov (United States)

    Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan

    2015-12-01

    Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.

  17. miR-664 negatively regulates PLP2 and promotes cell proliferation and invasion in T-cell acute lymphoblastic leukaemia

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Hong; Miao, Mei-hua; Ji, Xue-qiang; Xue, Jun; Shao, Xue-jun, E-mail: xuejunshao@hotmail.com

    2015-04-03

    MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. However, the role of microRNAs in leukaemia, particularly T-cell acute lymphoblastic leukaemia (T-ALL), has remained elusive. Here, we identified miR-664 and its predicted target gene PLP2 were differentially expressed in T-ALL using bioinformatics methods. In T-ALL cell lines, CCK-8 proliferation assay indicated that the cell proliferation was promoted by miR-664, while miR-664 inhibitor could significantly inhibited the proliferation. Moreover, migration and invasion assay showed that overexpression of miR-664 could significantly promoted the migration and invasion of T-ALL cells, whereas miR-664 inhibitor could reduce cell migration and invasion. luciferase assays confirmed that miR-664 directly bound to the 3'untranslated region of PLP2, and western blotting showed that miR-664 suppressed the expression of PLP2 at the protein levels. This study indicated that miR-664 negatively regulates PLP2 and promotes proliferation and invasion of T-ALL cell lines. Thus, miR-664 may represent a potential therapeutic target for T-ALL intervention. - Highlights: • miR-664 mimics promote the proliferation and invasion of T-ALL cells. • miR-664 inhibitors inhibit the proliferation and invasion of T-ALL cells. • miR-664 targets 3′ UTR of PLP2 in T-ALL cells. • miR-664 negatively regulates PLP2 in T-ALL cells.

  18. PCI-24781 down-regulates EZH2 expression and then promotes glioma apoptosis by suppressing the PIK3K/Akt/mTOR pathway.

    Science.gov (United States)

    Zhang, Wei; Lv, Shengqing; Liu, Jun; Zang, Zhenle; Yin, Junyi; An, Ning; Yang, Hui; Song, Yechun

    2014-10-01

    PCI-24781 is a novel histone deacetylase inhibitor that inhibits tumor proliferation and promotes cell apoptosis. However, it is unclear whether PCI-24781 inhibits Enhancer of Zeste 2 (EZH2) expression in malignant gliomas. In this work, three glioma cell lines were incubated with various concentrations of PCI-24781 (0, 0.25, 0.5, 1, 2.5 and 5 μM) and analyzed for cell proliferation by the MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] assay and colony formation, and cell cycle and apoptosis were assessed by flow cytometry. The expression of EZH2 and apoptosis-related proteins was assessed by western blotting. Malignant glioma cells were also transfected with EZH2 siRNA to examine how PCI-24781 suppresses tumor cells. EZH2 was highly expressed in the three glioma cell lines. Incubation with PCI-24781 reduced cell proliferation and increased cell apoptosis by down-regulating EZH2 in a concentration-dependent manner. These effects were simulated by EZH2 siRNA. In addition, PCI-24781 or EZH2 siRNA accelerated cell apoptosis by down-regulating the expression of AKT, mTOR, p70 ribosomal protein S6 kinase (p70s6k), glycogen synthase kinase 3A and B (GSK3a/b) and eukaryotic initiation factor 4E binding protein 1 (4E-BP1). These data suggest that PCI-24781 may be a promising therapeutic agent for treating gliomas by down-regulating EZH2 which promotes cell apoptosis by suppressing the phosphatidylinositol 3-kinase (PI3K)/Akt/mammalian target of the rapamycin (mTOR) pathway.

  19. THE ARIZONA RADIO OBSERVATORY CO MAPPING SURVEY OF GALACTIC MOLECULAR CLOUDS. II. THE W3 REGION IN CO J = 2-1, 13CO J = 2-1, AND CO J = 3-2 EMISSION

    International Nuclear Information System (INIS)

    Bieging, John H.; Peters, William L.

    2011-01-01

    We present fully sampled 38'' resolution maps of the CO and 13 CO J = 2-1 lines in the molecular clouds toward the H II region complex W3. The maps cover a 2. 0 0 x 1. 0 67 section of the galactic plane and span -70 to -20 km s -1 (LSR) in velocity with a resolution of ∼1.3 km s -1 . The velocity range of the images includes all the gas in the Perseus spiral arm. We also present maps of CO J = 3-2 emission for a 0. 0 5 x 0. 0 33 area containing the H II regions W3 Main and W3(OH). The J = 3-2 maps have velocity resolution of 0.87 km s -1 and 24'' angular resolution. Color figures display the peak line brightness temperature, the velocity-integrated intensity, and velocity channel maps for all three lines, and also the (CO/ 13 CO) J = 2-1 line intensity ratios as a function of velocity. The line intensity image cubes are made available in standard FITS format as electronically readable files. We compare our molecular line maps with the 1.1 mm continuum image from the BOLOCAM Galactic Plane Survey (BGPS). From our 13 CO image cube, we derive kinematic information for the 65 BGPS sources in the mapped field, in the form of Gaussian component fits.

  20. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  1. Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

    Directory of Open Access Journals (Sweden)

    Xiaoji Zeng

    2018-04-01

    Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

  2. Structural requirement of carboxyl-terminal globular domains of laminin alpha 3 chain for promotion of rapid cell adhesion and migration by laminin-5.

    Science.gov (United States)

    Hirosaki, T; Mizushima, H; Tsubota, Y; Moriyama, K; Miyazaki, K

    2000-07-21

    The basement membrane protein laminin-5, a heterotrimer of laminin alpha3, beta3, and gamma2 chains, potently promotes cellular adhesion and motility. It has been supposed that the carboxyl-terminal globular region of the alpha3 chain consisting of five distinct domains (G1 to G5) is important for its interaction with integrins. To clarify the function of each G domain, we transfected cDNAs for the full-length (wild type (WT)) and five deletion derivatives (DeltaGs) of the alpha3 chain into human fibrosarcoma cell line HT1080, which expressed and secreted the laminin beta3 and gamma2 chains but not the alpha3 chain. The transfectants with the alpha3 chain cDNAs lacking G5 (DeltaG(5)), G4-5 (DeltaG(4-5)), G3-5 (DeltaG(3-5)), and G2-5 (DeltaG(2-5)) secreted laminin-5 variants at levels comparable to that with WT cDNA. However, the transfectant with the cDNA without any G domains (DeltaG(1-5)) secreted little laminin-5, suggesting that the G domains are essential for the efficient assembly and secretion of the heterotrimer alpha3beta3gamma2. The transfectants with WT, DeltaG(5), and DeltaG(4-5) cDNAs survived in serum-free medium longer than those with DeltaG(3-5), DeltaG(2-5), and DeltaG(1-5) cDNAs. The transfectants with WT, DeltaG(5), and DeltaG(4-5) cDNAs secreted apparently the same size of laminin-5, which lacked G4 and G5 due to proteolytic cleavage between G3 and G4, and these laminin-5 forms potently promoted integrin alpha(3)beta(1)-dependent cell adhesion and migration. However, the laminin-5 forms of DeltaG(3-5) and DeltaG(2-5) hardly promoted the cell adhesion and motility. These findings demonstrate that the G3 domain, but not the G4 and G5 domains, of the alpha3 chain is essential for the potent promotion of cell adhesion and motility by laminin-5.

  3. Effect of β2-adrenergic receptor gene (ADRB2 3′ untranslated region polymorphisms on inhaled corticosteroid/long-acting β2-adrenergic agonist response

    Directory of Open Access Journals (Sweden)

    Ambrose Helen J

    2012-05-01

    Full Text Available Abstract Background Evidence suggests that variation in the length of the poly-C repeat in the 3′ untranslated region (3′UTR of the β2-adrenergic receptor gene (ADRB2 may contribute to interindividual variation in β-agonist response. However, methodology in previous studies limited the assessment of the effect of sequence variation in the context of poly-C repeat length. The objectives of this study were to design a novel genotyping method to fully characterize sequence variation in the ADRB2 3′UTR poly-C repeat in asthma patients treated with inhaled corticosteroid and long-acting β2-adrenergic agonist (ICS/LABA combination therapy, and to analyze the effect of the poly-C repeat polymorphism on clinical response. Methods In 2,250 asthma patients randomized to treatment with budesonide/formoterol or fluticasone/salmeterol in a six-month study (AstraZeneca study code: SD-039-0735, sequence diversity in the ADRB2 poly-C repeat region was determined using a novel sequencing-based genotyping method. The relationship between the poly-C repeat polymorphism and the incidence of severe asthma exacerbations, and changes in pulmonary function and asthma symptoms from baseline to the average during the treatment period, were analyzed. Results Poly-C repeat genotypes were assigned in 97% (2,192/2,250 of patients. Of the 13 different poly-C repeat alleles identified, six alleles occurred at a frequency of >5% in one or more population in this study. The repeat length of these six common alleles ranged from 10 to 14 nucleotides. Twelve poly-C repeat genotypes were observed at a frequency of >1%. No evidence of an association between poly-C repeat genotype and the incidence of severe asthma exacerbations was observed. Patients’ pulmonary function measurements improved and asthma symptoms declined when treated with ICS/LABA combination therapy regardless of poly-C repeat genotype. Conclusions The extensive sequence diversity present in the poly

  4. MicroRNA-181b promotes ovarian cancer cell growth and invasion by targeting LATS2

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Ying; Gao, Yan, E-mail: gaoyanhdhos@126.com

    2014-05-09

    Highlights: • miR-181b is upregulated in human ovarian cancer tissues. • miR-181b promotes ovarian cancer cell proliferation and invasion. • LATS2 is a direct target of miR-181b. • LATS2 is involved in miR-181b-induced ovarian cancer cell growth and invasion. - Abstract: MicroRNAs (miRNAs) are strongly implicated in tumorigenesis and metastasis. In this study, we showed significant upregulation of miR-181b in ovarian cancer tissues, compared with the normal ovarian counterparts. Forced expression of miR-181b led to remarkably enhanced proliferation and invasion of ovarian cancer cells while its knockdown induced significant suppression of these cellular events. The tumor suppressor gene, LATS2 (large tumor suppressor 2), was further identified as a novel direct target of miR-181b. Specifically, miR-181b bound directly to the 3′-untranslated region (UTR) of LATS2 and suppressed its expression. Restoration of LATS2 expression partially reversed the oncogenic effects of miR-181b. Our results indicate that miR-181b promotes proliferation and invasion by targeting LATS2 in ovarian cancer cells. These findings support the utility of miR-181b as a potential diagnostic and therapeutic target for ovarian cancer.

  5. Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

    DEFF Research Database (Denmark)

    Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

    2012-01-01

    to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

  6. TUG1 promotes osteosarcoma tumorigenesis by upregulating EZH2 expression via miR-144-3p.

    Science.gov (United States)

    Cao, Jiaqing; Han, Xinyou; Qi, Xin; Jin, Xiangyun; Li, Xiaolin

    2017-10-01

    lncRNA-TUG1 (Taurine upregulated 1) is up-regulated and highly correlated with poor prognosis and disease status in osteosarcoma. TUG1 knockdown inhibits osteosarcoma cell proliferation, migration and invasion, and promotes apoptosis. However, its mechanism of action has not been well addressed. Growing evidence documented that lncRNA works as competing endogenous (ce)RNAs to modulate the expression and biological functions of miRNA. As a putative combining target of TUG1, miR-144-3p has been associated with the progress of osteosarcoma. To verify whether TUG1 functions through regulating miR-144-3p, the expression levels of TUG1 and miR-144-3p in osteosarcoma tissues and cell lines were determined. TUG1 was upregulated in osteosarcoma tissues and cell lines, and negatively correlated with miR-144-3p. TUG1 knockdown induced miR-144-3p expression in MG63 and U2OS cell lines. Results from dual luciferase reporter assay, RNA-binding protein immuno-precipitation (RIP) and applied biotin-avidin pull-down system confirmed TUG1 regulated miR-144-3p expression through direct binding. EZH2, a verified target of miR-144-3p was upregulated in osteosarcoma tissues and negatively correlated with miR-144-3p. EZH2 was negatively regulated by miR-144-3p and positively regulated by TUG1. Gain-and loss-of-function experiments were performed to analyze the role of TUG1, miR-144-3p and EZH2 in the migration and EMT of osteosarcoma cells. EZH2 over-expression partly abolished TUG1 knockdown or miR-144-3p overexpression induced inhibition of migration and EMT in osteosarcoma cells. In addition, TUG1 knockdown represses the activation of Wnt/β-catenin pathway, which was reversed by EZH2 over-expression. The activator of Wnt/β-catenin pathway LiCl could partially block the TUG1-knockdown induced osteosarcoma cell migration and EMT inhibition. In conclusion, our results showed that TUG1 plays an important role in osteosarcoma development through miRNA-144-3p/EZH2/Wnt/β-catenin pathway.

  7. Unique developmental trajectories and genetic regulation of ventricular and outflow tract progenitors in the zebrafish second heart field

    DEFF Research Database (Denmark)

    Paffett-Lugassy, Noelle; Novikov, Natasha; Jeffrey, Spencer

    2017-01-01

    temporarily sequestered in the mesodermal cores of pharyngeal arch 2 (PA2), where they downregulate nkx2.5 expression. While there, they intermingle with precursors for PA2-derived head muscles (HMs) and hypobranchial artery endothelium, which we demonstrate are co-specified with SHF progenitors in the nkx2...

  8. Molecular dissection of the interaction between the SH3 domain and the SH2-Kinase Linker region in PTK6.

    Science.gov (United States)

    Kim, Han Ie; Jung, Jinwon; Lee, Eun-Saem; Kim, Yong-Chul; Lee, Weontae; Lee, Seung-Taek

    2007-11-03

    PTK6 (also known as Brk) is an intracellular tyrosine kinase that contains SH3, SH2, and tyrosine kinase catalytic (Kinase) domains. The SH3 domain of PTK6 interacts with the N-terminal half of the linker (Linker) region between the SH2 and Kinase domains. Site-directed mutagenesis and surface plasmon resonance studies showed that a tryptophan residue (Trp44) in the SH3 domain and proline residues in the Linker region, in the order of Pro177, Pro175, and Pro179, contribute to the interaction. The three-dimensional modeled structure of the SH3-Linker complex was in agreement with the biochemical data. Disruption of the intramolecular interaction between the SH3 domain and the Linker region by mutation of Trp44, Pro175, Pro177, and Pro179 markedly increased the catalytic activity of PTK6 in HEK 293 cells. These results demonstrate that Trp44 in the SH3 domain and Pro177, Pro175, and Pro179 in the N-terminal half of the Linker region play important roles in the SH3-Linker interaction to maintain the protein in an inactive conformation along with the phosphorylated Tyr447-SH2 interaction.

  9. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  10. Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter

    Directory of Open Access Journals (Sweden)

    Surleen Kaur

    2016-03-01

    Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP

  11. Familial Atrial Septal Defect and Sudden Cardiac Death

    DEFF Research Database (Denmark)

    Ellesøe, Sabrina Gade; Johansen, Morten Munk; Bjerre, Jesper Vandborg

    2016-01-01

    OBJECTIVE: Atrial septal defect (ASD) is the second most common congenital heart defect (CHD) and is observed in families as an autosomal dominant trait as well as in nonfamilial CHD. Mutations in the NKX2-5 gene, located on chromosome 5, are associated with ASD, often combined with conduction...... disturbances, cardiomyopathies, complex CHD, and sudden cardiac death as well. Here, we show that NKX2-5 mutations primarily occur in ASD patients with conduction disturbances and heritable ASD. Furthermore, these families are at increased risk of sudden cardiac death. RESULTS: We screened 39 probands...... with familial CHD for mutations in NKX2-5 and discovered a novel mutation in one family (2.5%) with ASD and atrioventricular block. A review of the literature revealed 59 different NKX2-5 mutations in 202 patients. Mutations were significantly more common in familial cases compared to nonfamilial cases (P = 7...

  12. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  13. Hypoxic human cancer cells are sensitized to BH-3 mimetic–induced apoptosis via downregulation of the Bcl-2 protein Mcl-1

    OpenAIRE

    Harrison, Luke R.E.; Micha, Dimitra; Brandenburg, Martin; Simpson, Kathryn L.; Morrow, Christopher J.; Denneny, Olive; Hodgkinson, Cassandra; Yunus, Zaira; Dempsey, Clare; Roberts, Darren; Blackhall, Fiona; Makin, Guy; Dive, Caroline

    2011-01-01

    Solid tumors contain hypoxic regions in which cancer cells are often resistant to chemotherapy-induced apoptotic cell death. Therapeutic strategies that specifically target hypoxic cells and promote apoptosis are particularly appealing, as few normal tissues experience hypoxia. We have found that the compound ABT-737, a Bcl-2 homology domain 3 (BH-3) mimetic, promotes apoptotic cell death in human colorectal carcinoma and small cell lung cancer cell lines exposed to hypoxia. This hypoxic indu...

  14. Collision-induced absorption in the region of the ν2 + ν3 band of carbon dioxide

    Science.gov (United States)

    Baranov, Yu. I.

    2018-03-01

    The IR absorption spectra of pure carbon dioxide in the region of the forbidden ν2 + ν3 vibrational transition at 3004 cm-1 have been recorded using a Fourier-transform spectrometer. A multipass-optical cell with the path length of 100 m was used in the study. The data were taken at room temperature of 294.8 K with a resolution of 0.02 cm-1 over the spectral region 2500-3500 cm-1. A sample pressures varied from 207 to 463 kPa (2.04-4.57 atm). The measured binary absorption coefficients provide the band integrated intensity value of (2.39 ± 0.04) ∗ 10-4 cm-2 amagat-2. The result is compared with those from previous works. The observed band profile features are discussed.

  15. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  16. Direct contact with endoderm-like cells efficiently induces cardiac progenitors from mouse and human pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Hideki Uosaki

    Full Text Available RATIONALE: Pluripotent stem cell-derived cardiac progenitor cells (CPCs have emerged as a powerful tool to study cardiogenesis in vitro and a potential cell source for cardiac regenerative medicine. However, available methods to induce CPCs are not efficient or require high-cost cytokines with extensive optimization due to cell line variations. OBJECTIVE: Based on our in-vivo observation that early endodermal cells maintain contact with nascent pre-cardiac mesoderm, we hypothesized that direct physical contact with endoderm promotes induction of CPCs from pluripotent cells. METHOD AND RESULT: To test the hypothesis, we cocultured mouse embryonic stem (ES cells with the endodermal cell line End2 by co-aggregation or End2-conditioned medium. Co-aggregation resulted in strong induction of Flk1(+ PDGFRa(+ CPCs in a dose-dependent manner, but the conditioned medium did not, indicating that direct contact is necessary for this process. To determine if direct contact with End2 cells also promotes the induction of committed cardiac progenitors, we utilized several mouse ES and induced pluripotent (iPS cell lines expressing fluorescent proteins under regulation of the CPC lineage markers Nkx2.5 or Isl1. In agreement with earlier data, co-aggregation with End2 cells potently induces both Nkx2.5(+ and Isl1(+ CPCs, leading to a sheet of beating cardiomyocytes. Furthermore, co-aggregation with End2 cells greatly promotes the induction of KDR(+ PDGFRa(+ CPCs from human ES cells. CONCLUSIONS: Our co-aggregation method provides an efficient, simple and cost-effective way to induce CPCs from mouse and human pluripotent cells.

  17. 3D Mapping for Urban and Regional Planning

    DEFF Research Database (Denmark)

    Bodum, Lars

    2002-01-01

    The process of mapping in 3D for urban and regional planning purposes is not an uncomplicated matter. It involves both the construction of a new data-model and new routines for the geometric modeling of the physical objects. This is due to the fact that most of the documentation until now has been...... registered and georeferenced to the 2D plan. This paper will outline a new method for 3D mapping where new LIDAR (laser-scanning) technology and additional 2D maps with attributes will be combined to create a 3D map of an urban area. The 3D map will afterwards be used in a real-time simulation system (also...... known as Virtual Reality system) for urban and regional planning purposes. This initiative will be implemented in a specific geographic region (North Jutland County in Denmark) by a new research centre at Aalborg University called Centre for 3D GeoInformation. The key question for this research team...

  18. Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions

    Science.gov (United States)

    Kulesa, Craig A.

    Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us

  19. Art27 interacts with GATA4, FOG2 and NKX2.5 and is a novel co-repressor of cardiac genes.

    Directory of Open Access Journals (Sweden)

    Daniel R Carter

    Full Text Available Transcription factors play a crucial role in regulation of cardiac biology. FOG-2 is indispensable in this setting, predominantly functioning through a physical interaction with GATA-4. This study aimed to identify novel co-regulators of FOG-2 to further elaborate on its inhibitory activity on GATA-4. The Art27 transcription factor was identified by a yeast-2-hybrid library screen to be a novel FOG-2 protein partner. Characterisation revealed that Art27 is co-expressed with FOG-2 and GATA-4 throughout cardiac myocyte differentiation and in multiple structures of the adult heart. Art27 physically interacts with GATA-4, FOG-2 and other cardiac transcription factors and by this means, down-regulates their activity on cardiac specific promoters α-myosin heavy chain, atrial natriuretic peptide and B-type natriuretic peptide. Regulation of endogenous cardiac genes by Art27 was shown using microarray analysis of P19CL6-Mlc2v-GFP cardiomyocytes. Together these results suggest that Art27 is a novel transcription factor that is involved in downregulation of cardiac specific genes by physically interacting and inhibiting the activity of crucial transcriptions factors involved in cardiac biology.

  20. Identification of an ovine atadenovirus gene whose product activates the viral E2 promoter: possible involvement of E2F-1

    International Nuclear Information System (INIS)

    Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter

    2004-01-01

    Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth

  1. Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Hua

    2006-08-01

    Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

  2. Active form Notch4 promotes the proliferation and differentiation of 3T3-L1 preadipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Peng-Yeh [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China); Tsai, Chong-Bin [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China); Department of Ophthalmology, Chiayi Christian Hospital, Chiayi 600, Taiwan, ROC (China); Tseng, Min-Jen, E-mail: biomjt@ccu.edu.tw [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China)

    2013-01-18

    Highlights: ► Notch4IC modulates the ERK pathway and cell cycle to promote 3T3-L1 proliferation. ► Notch4IC facilitates 3T3-L1 differentiation by up-regulating proadipogenic genes. ► Notch4IC promotes proliferation during the early stage of 3T3-L1 adipogenesis. ► Notch4IC enhances differentiation during subsequent stages of 3T3-L1 adipogenesis. -- Abstract: Adipose tissue is composed of adipocytes, which differentiate from precursor cells in a process called adipogenesis. Many signal molecules are involved in the transcriptional control of adipogenesis, including the Notch pathway. Previous adipogenic studies of Notch have focused on Notch1 and HES1; however, the role of other Notch receptors in adipogenesis remains unclear. Q-RT-PCR analyses showed that the augmentation of Notch4 expression during the differentiation of 3T3-L1 preadipocytes was comparable to that of Notch1. To elucidate the role of Notch4 in adipogenesis, the human active form Notch4 (N4IC) was transiently transfected into 3T3-L1 cells. The expression of HES1, Hey1, C/EBPδ and PPARγ was up-regulated, and the expression of Pref-1, an adipogenic inhibitor, was down-regulated. To further characterize the effect of N4IC in adipogenesis, stable cells expressing human N4IC were established. The expression of N4IC promoted proliferation and enhanced differentiation of 3T3-L1 cells compared with those of control cells. These data suggest that N4IC promoted proliferation through modulating the ERK pathway and the cell cycle during the early stage of 3T3-L1 adipogenesis and facilitated differentiation through up-regulating adipogenic genes such as C/EBPα, PPARγ, aP2, LPL and HSL during the middle and late stages of 3T3-L1 adipogenesis.

  3. Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

    Science.gov (United States)

    El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

    2018-04-05

    Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

  4. Promoter- and cell-specific epigenetic regulation of CD44, Cyclin D2, GLIPR1 and PTEN by Methyl-CpG binding proteins and histone modifications

    Directory of Open Access Journals (Sweden)

    Schwarzenbach Heidi

    2010-06-01

    Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one

  5. Trichostatin A, a histone deacetylase inhibitor, suppresses JAK2/STAT3 signaling via inducing the promoter-associated histone acetylation of SOCS1 and SOCS3 in human colorectal cancer cells.

    Science.gov (United States)

    Xiong, Hua; Du, Wan; Zhang, Yan-Jie; Hong, Jie; Su, Wen-Yu; Tang, Jie-Ting; Wang, Ying-Chao; Lu, Rong; Fang, Jing-Yuan

    2012-02-01

    Aberrant janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling is involved in the oncogenesis of several cancers. Suppressors of cytokine signaling (SOCS) genes and SH2-containing protein tyrosine phosphatase 1 (SHP1) proteins, which are negative regulators of JAK/STAT signaling, have been reported to have tumor suppressor functions. However, in colorectal cancer (CRC) cells, the mechanisms that regulate SOCS and SHP1 genes, and the cause of abnormalities in the JAK/STAT signaling pathway, remain largely unknown. The present study shows that trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, leads to the hyperacetylation of histones associated with the SOCS1 and SOCS3 promoters, but not the SHP1 promoter in CRC cells. This indicates that histone modifications are involved in the regulation of SOCS1 and SOCS3. Moreover, upregulation of SOCS1 and SOCS3 expression was achieved using TSA, which also significantly downregulated JAK2/STAT3 signaling in CRC cells. We also demonstrate that TSA suppresses the growth of CRC cells, and induces G1 cell cycle arrest and apoptosis through the regulation of downstream targets of JAK2/STAT3 signaling, including Bcl-2, survivin and p16(ink4a) . Therefore, our data demonstrate that TSA may induce SOCS1 and SOCS3 expression by inducing histone modifications and consequently inhibits JAK2/STAT3 signaling in CRC cells. These results also establish a mechanistic link between the inhibition of JAK2/STAT3 signaling and the anticancer action of TSA in CRC cells. Copyright © 2011 Wiley Periodicals, Inc.

  6. Stress relaxation of La1/2Sr1/2MnO3 and La2/3Ca1/3MnO3 at solid oxide fuel cell interfaces

    International Nuclear Information System (INIS)

    Lussier, A.; Dvorak, J.; Stadler, S.; Holroyd, J.; Liberati, M.; Arenholz, E.; Ogale, S.B.; Wu, T.; Venkatesan, T.; Idzerda, Y.U.

    2008-01-01

    Interfacial stress is thought to have significant effects on electrical and oxygen transport properties in thin films of importance in solid oxide fuel cell applications. We investigate how in-plane biaxial stress modifies the electronic structure of La 2/3 Ca 1/3 MnO 3 and La 1/2 Sr 1/2 MnO 3 thin films prepared by pulsed laser deposition on three different substrates to vary the in-plane stress from tensile to compressive. The electronic structure was probed by X-ray absorption spectroscopy of the Mn L 2,3 -edge to characterize the interfacial disruption in this region in an element-specific, site-specific manner. The compressive or tensile interfacial strain modifies the relative concentrations of La and Sr in the interfacial region in order to achieve a better lattice match to the contact material. This atomic migration generates an interfacial region dominated by a compound with a single valency for the transition metal ion, resulting in a severe barrier to oxygen and electron transport through this region

  7. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  8. Further evidence for mesons with spin 3, 4, and 5 in the mass region 2.0 to 2.6 GeV/c2

    International Nuclear Information System (INIS)

    Carter, A.A.

    1977-04-01

    The experimental trajectories of dsigma/dΩ zeros in the complex z-plane for anti p p elastic scattering in the backward hemisphere over the c.m. energy region 2.0 to 2.6 GeV are determined. The results support the existence of dominant states with Jsup(PC) = 3 -- , 4 ++ , 5 -- at masses consistent with enhancements seen in other anti p p formation reactions. (author)

  9. Activin Signals through SMAD2/3 to Increase Photoreceptor Precursor Yield during Embryonic Stem Cell Differentiation.

    Science.gov (United States)

    Lu, Amy Q; Popova, Evgenya Y; Barnstable, Colin J

    2017-09-12

    In vitro differentiation of mouse embryonic stem cells (ESCs) into retinal fates can be used to study the roles of exogenous factors acting through multiple signaling pathways during retina development. Application of activin A during a specific time frame that corresponds to early embryonic retinogenesis caused increased generation of CRX + photoreceptor precursors and decreased PAX6 + retinal progenitor cells (RPCs). Following activin A treatment, SMAD2/3 was activated in RPCs and bound to promoter regions of key RPC and photoreceptor genes. The effect of activin on CRX expression was repressed by pharmacological inhibition of SMAD2/3 phosphorylation. Activin signaling through SMAD2/3 in RPCs regulates expression of transcription factors involved in cell type determination and promotes photoreceptor lineage specification. Our findings can contribute to the production of photoreceptors for cell replacement therapy. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Genomic structure and promoter functional analysis of GnRH3 gene in large yellow croaker (Larimichthys crocea).

    Science.gov (United States)

    Huang, Wei; Zhang, Jianshe; Liao, Zhi; Lv, Zhenming; Wu, Huifei; Zhu, Aiyi; Wu, Changwen

    2016-01-15

    Gonadotropin-releasing hormone III (GnRH3) is considered to be a key neurohormone in fish reproduction control. In the present study, the cDNA and genomic sequences of GnRH3 were cloned and characterized from large yellow croaker Larimichthys crocea. The cDNA encoded a protein of 99 amino acids with four functional motifs. The full-length genome sequence was composed of 3797 nucleotides, including four exons and three introns. Higher identities of amino acid sequences and conserved exon-intron organizations were found between LcGnRH3 and other GnRH3 genes. In addition, some special features of the sequences were detected in partial species. For example, two specific residues (V and A) were found in the family Sciaenidae, and the unique 75-72 bp type of the open reading frame 2 and 3 existed in the family Cyprinidae. Analysis of the 2576 bp promoter fragment of LcGnRH3 showed a number of transcription factor binding sites, such as AP1, CREB, GATA-1, HSF, FOXA2, and FOXL1. Promoter functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the brain, including the olfactory region, the terminal nerve ganglion, the telencephalon, and the hypothalamus. The expression pattern was generally consistent with the endogenous GnRH3 GFP-expressing transgenic zebrafish lines, but the details were different. These results indicate that the structure and function of LcGnRH3 are generally similar to the other teleost GnRH3 genes, but there exist some distinctions among them. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Combined XRD and XANES studies of a Re-promoted Co/γ-Al2O3 catalyst at Fischer–Tropsch synthesis conditions

    DEFF Research Database (Denmark)

    Rønning, Magnus; Tsakoumis, Nikolaos E.; Voronov, Alexey

    2010-01-01

    A cobalt based Fischer–Tropsch catalyst was studied during the initial stages of the reaction at industrially relevant conditions. The catalyst consists of 20wt% cobalt supported on γ-Al2O3 and promoted by 1wt% of rhenium. X-ray diffraction (XRD) in combination with X-ray absorption near edge...

  12. Natural type 3/type 2 intertypic vaccine-related poliovirus recombinants with the first crossover sites within the VP1 capsid coding region.

    Science.gov (United States)

    Zhang, Yong; Zhu, Shuangli; Yan, Dongmei; Liu, Guiyan; Bai, Ruyin; Wang, Dongyan; Chen, Li; Zhu, Hui; An, Hongqiu; Kew, Olen; Xu, Wenbo

    2010-12-21

    Ten uncommon natural type 3/type 2 intertypic poliovirus recombinants were isolated from stool specimens from nine acute flaccid paralysis case patients and one healthy vaccinee in China from 2001 to 2008. Complete genomic sequences revealed their vaccine-related genomic features and showed that their first crossover sites were randomly distributed in the 3' end of the VP1 coding region. The length of donor Sabin 2 sequences ranged from 55 to 136 nucleotides, which is the longest donor sequence reported in the literature for this type of poliovirus recombination. The recombination resulted in the introduction of Sabin 2 neutralizing antigenic site 3a (NAg3a) into a Sabin 3 genomic background in the VP1 coding region, which may have been altered by some of the type 3-specific antigenic properties, but had not acquired any type 2-specific characterizations. NAg3a of the Sabin 3 strain seems atypical; other wild-type poliovirus isolates that have circulated in recent years have sequences of NAg3a more like the Sabin 2 strain. 10 natural type 3/type 2 intertypic VP1 capsid-recombinant polioviruses, in which the first crossover sites were found to be in the VP1 coding region, were isolated and characterized. In spite of the complete replacement of NAg3a by type 2-specific amino acids, the serotypes of the recombinants were not altered, and they were totally neutralized by polyclonal type 3 antisera but not at all by type 2 antisera. It is possible that recent type 3 wild poliovirus isolates may be a recombinant having NAg3a sequences derived from another strain during between 1967 and 1980, and the type 3/type 2 recombination events in the 3' end of the VP1 coding region may result in a higher fitness.

  13. Natural type 3/type 2 intertypic vaccine-related poliovirus recombinants with the first crossover sites within the VP1 capsid coding region.

    Directory of Open Access Journals (Sweden)

    Yong Zhang

    Full Text Available BACKGROUND: Ten uncommon natural type 3/type 2 intertypic poliovirus recombinants were isolated from stool specimens from nine acute flaccid paralysis case patients and one healthy vaccinee in China from 2001 to 2008. PRINCIPAL FINDINGS: Complete genomic sequences revealed their vaccine-related genomic features and showed that their first crossover sites were randomly distributed in the 3' end of the VP1 coding region. The length of donor Sabin 2 sequences ranged from 55 to 136 nucleotides, which is the longest donor sequence reported in the literature for this type of poliovirus recombination. The recombination resulted in the introduction of Sabin 2 neutralizing antigenic site 3a (NAg3a into a Sabin 3 genomic background in the VP1 coding region, which may have been altered by some of the type 3-specific antigenic properties, but had not acquired any type 2-specific characterizations. NAg3a of the Sabin 3 strain seems atypical; other wild-type poliovirus isolates that have circulated in recent years have sequences of NAg3a more like the Sabin 2 strain. CONCLUSIONS: 10 natural type 3/type 2 intertypic VP1 capsid-recombinant polioviruses, in which the first crossover sites were found to be in the VP1 coding region, were isolated and characterized. In spite of the complete replacement of NAg3a by type 2-specific amino acids, the serotypes of the recombinants were not altered, and they were totally neutralized by polyclonal type 3 antisera but not at all by type 2 antisera. It is possible that recent type 3 wild poliovirus isolates may be a recombinant having NAg3a sequences derived from another strain during between 1967 and 1980, and the type 3/type 2 recombination events in the 3' end of the VP1 coding region may result in a higher fitness.

  14. Solid state compatibility in the ZnO-rich region of ZnO-Bi2O3-Sb2O3 and ZnO-Bi2O3-Sb2O5 systems

    Directory of Open Access Journals (Sweden)

    Jardiel, T.

    2010-04-01

    Full Text Available The obtaining of ZnO-Bi2O3-Sb2O3 (ZBS based varistor thick films with high non-linear properties is constrained by the bismuth loss by vaporization that takes place during the sintering step of these ceramics, a process which is yet more critical in the thick film geometry due to its inherent high are/volume ratio. This volatilization can be controlled to a certain extent by modifying the proportions of the Bi and/or Sb precursors. Obviously this requires a clear knowledge of the different solid state compatibilities in the mentioned ZBS system. In this sense a detailed study of the thermal evolution of the ZnO-Bi2O3-Sb2O3 and ZnO-Bi2O3-Sb2O5 systems in the ZnO-rich region of interest for varistors, is presented in this contribution. A different behaviour is observed when using Sb2O3 or Sb2O5 as starting precursor, which should be attributed to the oxidation process experimented by Sb2O3 compound during the heating. On the other hand the use of high amounts of Bi in the starting formulation leads to the formation of a liquid phase at lower temperatures, which would allow the use of lower sintering temperatures.La obtención de varistors en lámina gruesa basados en ZnO-Bi2O3-Sb2O3 (ZBS y con propiedades altamente no-lineales está limitada por la perdida de bismuto por volatilización durante la sinterización de estos cerámicos, un proceso que es todavía más crítico en la geometría de lámina gruesa debido a su elevada relación área/volumen inherente. Dicha volatilización puede ser no obstante controlada hasta cierta extensión modificando las proporciones de los precursores de Bi y/o Sb. Obviamente ello conlleva un amplio conocimiento de las diferentes compatibilidades en estado sólido en el mencionado sistema ZBS. En este sentido, en la presente contribución se presenta un estudio detallado de la evolución térmica de los sistemas ZnO-Bi2O3-Sb2O3 y ZnO-Bi2O3-Sb2O5 en la región rica en ZnO de interés para varistores. Como

  15. A pilot study on genetic variation in purine-rich elements in the nephrin gene promoter in type 2 diabetic patients

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2007-01-01

    Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls

  16. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    Science.gov (United States)

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  17. saRNA-guided Ago2 targets the RITA complex to promoters to stimulate transcription.

    Science.gov (United States)

    Portnoy, Victoria; Lin, Szu Hua Sharon; Li, Kathy H; Burlingame, Alma; Hu, Zheng-Hui; Li, Hao; Li, Long-Cheng

    2016-03-01

    Small activating RNAs (saRNAs) targeting specific promoter regions are able to stimulate gene expression at the transcriptional level, a phenomenon known as RNA activation (RNAa). It is known that RNAa depends on Ago2 and is associated with epigenetic changes at the target promoters. However, the precise molecular mechanism of RNAa remains elusive. Using human CDKN1A (p21) as a model gene, we characterized the molecular nature of RNAa. We show that saRNAs guide Ago2 to and associate with target promoters. saRNA-loaded Ago2 facilitates the assembly of an RNA-induced transcriptional activation (RITA) complex, which, in addition to saRNA-Ago2 complex, includes RHA and CTR9, the latter being a component of the PAF1 complex. RITA interacts with RNA polymerase II to stimulate transcription initiation and productive elongation, accompanied by monoubiquitination of histone 2B. Our results establish the existence of a cellular RNA-guided genome-targeting and transcriptional activation mechanism and provide important new mechanistic insights into the RNAa process.

  18. The Role of Training and Promotion to Increase The 3rd Party Funds Indonesian Islamic Banking

    Directory of Open Access Journals (Sweden)

    Rahmat Hidayat

    2014-03-01

    Full Text Available Objective – This study aims to determine whether the role of training is much larger than the promotion in raising third-party funds in Islamic banks in Indonesia given the cost of the training is spent is greater than the cost of promotion. This study empirically examines the relationship and impact of training and promotion to raise funds for a 3rd party in Indonesia Islamic banks.Methods – This study uses secondary data Islamic commercial banks in the form of panel (time-series and cross-section of Bank Indonesia data from 2010 until 2012. There are two independent variables training cost (X1 and promotion cost (X2 and one dependent variable is 3rd-party funds (Y. The analysis technique used path analysis to examine the role of training and the promotion of financial performance (The 3rd Party Funds.Result – Simultaneously, training and promotion gives an effect by 52%, and partially or individual training gives an insignificant negative effect, while the promotion has a significant positive impact on financial performance (financial-party funds on Islamic banking.Conclusion – The role of promotion is higher in raising The 3rd Party Funds than training. Keywords : Cost, Training, Promotion, The 3rd Party Funds 

  19. The PAGES 2k Network, Phase 3: Themes and Call for Participation

    Science.gov (United States)

    von Gunten, L.; Mcgregor, H. V.; Martrat, B.; St George, S.; Neukom, R.; Bothe, O.; Linderholm, H. W.; Phipps, S. J.; Abram, N.

    2017-12-01

    The past 2000 years (the "2k" interval) provides critical context for understanding recent anthropogenic forcing of the climate and provides baseline information about the characteristics of natural climate variability. It also presents opportunities to improve the interpretation of proxy observations and to evaluate the climate models used to make future projections. Phases 1 and 2 of the PAGES 2k Network focussed on building regional and global surface temperature reconstructions for terrestrial regions and the oceans, and comparing these with model simulations to identify mechanisms of climate variation on interannual to bicentennial time scales. Phase 3 was launched in May 2017 and aims to address major questions around past hydroclimate, climate processes and proxy uncertainties. Its scientific themes are: Theme 1: "Climate Variability, Modes and Mechanisms"Further understand the mechanisms driving regional climate variability and change on interannual to centennial time scales; Theme 2: "Methods and Uncertainties"Reduce uncertainties in the interpretation of observations imprinted in paleoclimatic archives by environmental sensors; Theme 3: "Proxy and Model Understanding"Identify and analyse the extent of agreement between reconstructions and climate model simulations. Research is organized as a linked network of well-defined projects, identified and led by 2k community members. The 2k projects focus on specific scientific questions aligned with Phase 3 themes, rather than being defined along regional boundaries. New 2k projects can be proposed at any time at http://www.pastglobalchanges.org/ini/wg/2k-network/projects An enduring element of PAGES 2k is a culture of collegiality, transparency, and reciprocity. Phase 3 seeks to stimulate community based projects and facilitate collaboration between researchers from different regions and career stages, drawing on the breadth and depth of the global PAGES 2k community. All PAGES 2k projects also promote best

  20. Nd(BrO3)3-Yb(BrO3)3-H2O and Nd2(SeO4)3-Yb2(SeO4)3-H2O systems at 25 deg C

    International Nuclear Information System (INIS)

    Serebrennikov, V.V.; Batyreva, V.A.; Tsybukova, T.N.

    1981-01-01

    Using the methods of isothermal solubility the Nd(BrO 3 ) 3 - Yb(BrO 3 ) 3 -H 2 O and Nd 2 (SeO 4 ) 3 -Yb 2 (SeO 4 ) 3 -H 2 O systems are studied at 25 deg C. The compositions of the solid phases are determined by the method of ''residues''. The formation of two series of solid solutions in both systems is established. Besides, there is a crystallization region of Nd 2 (SeO 4 ) 3 in the system of selenates. The solubility diagrams of the systems are presented [ru

  1. 22 CFR 101.2 - Promotion of American interests.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...

  2. 2-Aminopyrimidine-3,3,3-triphenylpropanoic acid (1/1).

    Science.gov (United States)

    Serafin, Mateusz F; Wheeler, Kraig A

    2007-11-01

    The title bimolecular compound, C(4)H(5)N(3).C(21)H(18)O(2), constructed from 2-aminopyrimidine and 3,3,3-triphenylpropanoic acid, forms a tetramolecular hydrogen-bonded motif via O-H...N, N-H...O and N-H...N contacts. This aggregate organizes to give crystal-packing motifs with hydrophilic and hydrophobic regions.

  3. Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

    KAUST Repository

    Othoum, Ghofran K

    2013-05-01

    Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

  4. Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

    KAUST Repository

    Othoum, Ghofran K

    2013-01-01

    Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

  5. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  6. [Ru(bipy)3]2+ nanoparticle-incorporate dental light cure resin to promote photobiomodulation therapy for enhanced vital pulp tissue repair

    Science.gov (United States)

    Mosca, Rodrigo C.; Young, Nicholas; Zeituni, Carlos A.; Arany, Praveen R.

    2018-02-01

    The use of nanoparticle on dental light cure resin is not new, currently several compounds (nanoadditives) are used to promote better communication between the restorative material and biological tissues. The interest for this application is growing up to enhance mechanical proprieties to dental tissue cells regeneration. Bioactive nanoparticles and complex compounds with multiple functions are the major target for optimizing the restorative materials. In this work, we incorporate [Ru(bipy)3]2+ nanoparticles, that absorbs energy at 450 nm (blue-light) and emits strongly at 620 nm (red-light), in PLGA Microspheres and insert it in Dental Light Cure Resin to promote the Photobiomodulation Therapy (PBM) effects to accelerate dental pulp repair by in vitro using cytotoxicity and proliferation assay.

  7. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan

    2011-12-01

    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  8. Using evolutionary tools to refine the new hypervariable region 3 within the envelope 2 protein of hepatitis C virus.

    Science.gov (United States)

    Torres-Puente, Manuela; Cuevas, José M; Jiménez-Hernández, Nuria; Bracho, María Alma; García-Robles, Inmaculada; Wrobel, Borys; Carnicer, Fernando; del Olmo, Juan; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2008-01-01

    The envelope 2 protein of hepatitis C virus (HCV) presents three hypervariable regions, named HVR1, HVR2 and HVR3, in which the presence of antigenic sites has been described. Genetic variability in these regions may reflect the generation of escape mutants as a consequence of the immune response. Therefore, these regions would tend to accumulate amino acid changes along the infection process, an effect that could be accelerated by antiviral treatments. In this study, we have analyzed the E1-E2 region of 23 HCV patients non-responders to antiviral treatment, 7 of which were infected with subtype 1a, 15 with subtype 1b, and 1 with a new HCV-1 subtype, before and after 6 and/or 12 months of peg-interferon+ribavirin treatment. We have sequenced about 100 clones from each sample, analyzing a total of 4906 sequences. A detailed analysis of the evolutionary forces acting along the genome region studied confirmed the existence of the three hypervariable regions, characterized by significant changes in amino acid composition between samples taken at different times from the same patient and a high number of sites evolving under positive selection. Moreover, for the recently described HVR3, our results suggest that its location could be restricted to residues 434-450, instead of the originally postulated 431-466.

  9. Oral Probiotic VSL#3 Prevents Autoimmune Diabetes by Modulating Microbiota and Promoting Indoleamine 2,3-Dioxygenase-Enriched Tolerogenic Intestinal Environment

    Directory of Open Access Journals (Sweden)

    Jayashree Dolpady

    2016-01-01

    Full Text Available The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal immune homeostasis. In this study we show that modifications of the gut microbiota induced by oral treatment with Lactobacillaceae-enriched probiotic VSL#3, alone or in combination with retinoic acid (RA, protect NOD mice from T1D by affecting inflammasome at the intestinal level. In particular, we show that VSL#3 treatment inhibits IL-1β expression while enhancing release of protolerogenic components of the inflammasome, such as indoleamine 2,3-dioxygenase (IDO and IL-33. Those modifications of the intestinal microenvironment in VSL#3-treated NOD mice modulate gut immunity by promoting differentiation of tolerogenic CD103+ DCs and reducing differentiation/expansion of Th1 and Th17 cells in the intestinal mucosa and at the sites of autoimmunity, that is, within the pancreatic lymph nodes (PLN of VSL#3-treated NOD mice. Our data provide a link between dietary factors, microbiota composition, intestinal inflammation, and immune homeostasis in autoimmune diabetes and could pave the way for new therapeutic approaches aimed at changing the intestinal microenvironment with probiotics to counterregulate autoimmunity and prevent T1D.

  10. Crystal structure of the Src family kinase Hck SH3-SH2 linker regulatory region supports an SH3-dominant activation mechanism.

    Science.gov (United States)

    Alvarado, John J; Betts, Laurie; Moroco, Jamie A; Smithgall, Thomas E; Yeh, Joanne I

    2010-11-12

    Most mammalian cell types depend on multiple Src family kinases (SFKs) to regulate diverse signaling pathways. Strict control of SFK activity is essential for normal cellular function, and loss of kinase regulation contributes to several forms of cancer and other diseases. Previous x-ray crystal structures of the SFKs c-Src and Hck revealed that intramolecular association of their Src homology (SH) 3 domains and SH2 kinase linker regions has a key role in down-regulation of kinase activity. However, the amino acid sequence of the Hck linker represents a suboptimal ligand for the isolated SH3 domain, suggesting that it may form the polyproline type II helical conformation required for SH3 docking only in the context of the intact structure. To test this hypothesis directly, we determined the crystal structure of a truncated Hck protein consisting of the SH2 and SH3 domains plus the linker. Despite the absence of the kinase domain, the structures and relative orientations of the SH2 and SH3 domains in this shorter protein were very similar to those observed in near full-length, down-regulated Hck. However, the SH2 kinase linker adopted a modified topology and failed to engage the SH3 domain. This new structure supports the idea that these noncatalytic regions work together as a "conformational switch" that modulates kinase activity in a manner unique to the SH3 domain and linker topologies present in the intact Hck protein. Our results also provide fresh structural insight into the facile induction of Hck activity by HIV-1 Nef and other Hck SH3 domain binding proteins and implicate the existence of innate conformational states unique to individual Src family members that "fine-tune" their sensitivities to activation by SH3-based ligands.

  11. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  12. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  13. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  14. BAG3 promotes stem cell-like phenotype in breast cancer by upregulation of CXCR4 via interaction with its transcript.

    Science.gov (United States)

    Liu, Bao-Qin; Zhang, Song; Li, Si; An, Ming-Xin; Li, Chao; Yan, Jing; Wang, Jia-Mei; Wang, Hua-Qin

    2017-07-13

    BAG3 is an evolutionarily conserved co-chaperone expressed at high levels and has a prosurvival role in many tumor types. The current study reported that BAG3 was induced under specific floating culture conditions that enrich breast cancer stem cell (BCSC)-like cells in spheres. Ectopic BAG3 overexpression increased CD44 + /CD24 - CSC subpopulations, first-generation and second-generation mammosphere formation, indicating that BAG3 promotes CSC self-renewal and maintenance in breast cancer. We further demonstrated that mechanically, BAG3 upregulated CXCR4 expression at the post-transcriptional level. Further studies showed that BAG3 interacted with CXCR4 mRNA and promoted its expression via its coding and 3'-untranslational regions. BAG3 was also found to be positively correlated with CXCR4 expression and unfavorable prognosis in patients with breast cancer. Taken together, our data demonstrate that BAG3 promotes BCSC-like phenotype through CXCR4 via interaction with its transcript. Therefore, this study establishes BAG3 as a potential adverse prognostic factor and a therapeutic target of breast cancer.

  15. The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

    Science.gov (United States)

    Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

    2007-01-01

    Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

  16. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

    Science.gov (United States)

    Fanguin, Pauline

    2014-05-01

    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  17. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  18. PI3K/Akt signaling mediated Hexokinase-2 expression inhibits cell apoptosis and promotes tumor growth in pediatric osteosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhuo, Baobiao; Li, Yuan; Li, Zhengwei; Qin, Haihui; Sun, Qingzeng; Zhang, Fengfei; Shen, Yang; Shi, Yingchun [Department of Surgery, The Children' s Hospital of Xuzhou, Xuzhou, Jiangsu Province 221006 (China); Wang, Rong, E-mail: wangrong2008163@163.com [Department of Ultrasonography, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu Province 221006 (China)

    2015-08-21

    Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway and glucose metabolism in OS remains largely unexplored. In this study, we showed that elevated Hexokinase-2 (HK2) expression, which catalyzes the first essential step of glucose metabolism by conversion of glucose into glucose-6-phosphate, was induced by activated PI3K/Akt signaling. Immunohistochemical analysis showed that HK2 was overexpressed in 83.3% (25/30) specimens detected and was closely correlated with Ki67, a cell proliferation index. Silencing of endogenous HK2 resulted in decreased aerobic glycolysis as demonstrated by reduced glucose consumption and lactate production. Inhibition of PI3K/Akt signaling also suppressed aerobic glycolysis and this effect can be reversed by reintroduction of HK2. Furthermore, knockdown of HK2 led to increased cell apoptosis and reduced ability of colony formation; meanwhile, these effects were blocked by 2-Deoxy-D-glucose (2-DG), a glycolysis inhibitor through its actions on hexokinase, indicating that HK2 functions in cell apoptosis and growth were mediated by altered aerobic glycolysis. Taken together, our study reveals a novel relationship between PI3K/Akt signaling and aerobic glycolysis and indicates that PI3K/Akt/HK2 might be potential therapeutic approaches for OS. - Highlights: • PI3K/Akt signaling contributes to elevated expression of HK2 in osteosarcoma. • HK2 inhibits cell apoptosis and promotes tumor growth through enhanced Warburg effect. • Inhibition of glycolysis blocks the oncogenic activity of HK2.

  19. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  20. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  1. Glucocorticoid-mediated activation of GSK3β promotes tau phosphorylation and impairs memory in type 2 diabetes.

    Science.gov (United States)

    Dey, Aditi; Hao, Shuai; Wosiski-Kuhn, Marlena; Stranahan, Alexis M

    2017-09-01

    Type 2 diabetes is increasingly recognized as a risk factor for Alzheimer's disease, but the underlying mechanisms remain poorly understood. Hyperphosphorylation of the microtubule-associated protein tau has been reported in rodent models of diabetes, including db/db mice, which exhibit insulin resistance and chronically elevated glucocorticoids due to leptin receptor insufficiency. In this report, we investigated endocrine mechanisms for hippocampal tau phosphorylation in db/db and wild-type mice. By separately manipulating peripheral and intrahippocampal corticosterone levels, we determined that hippocampal corticosteroid exposure promotes tau phosphorylation and activates glycogen synthase kinase 3β (GSK3β). Subsequent experiments in hippocampal slice preparations revealed evidence for a nongenomic interaction between glucocorticoids and GSK3β. To examine whether GSK3β activation mediates tau phosphorylation and impairs memory in diabetes, db/db and wild-type mice received intrahippocampal infusions of TDZD-8, a non-ATP competitive thiadiazolidinone inhibitor of GSK3β. Intrahippocampal TDZD-8 blocked tau hyperphosphorylation and normalized hippocampus-dependent memory in db/db mice, suggesting that pathological synergy between diabetes and Alzheimer's disease may involve glucocorticoid-mediated activation of GSK3β. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Kynurenine 3-Monooxygenase Gene Associated With Nicotine Initiation and Addiction: Analysis of Novel Regulatory Features at 5′ and 3′-Regions

    Directory of Open Access Journals (Sweden)

    Hassan A. Aziz

    2018-06-01

    Full Text Available Tobacco smoking is widespread behavior in Qatar and worldwide and is considered one of the major preventable causes of ill health and death. Nicotine is part of tobacco smoke that causes numerous health risks and is incredibly addictive; it binds to the α7 nicotinic acetylcholine receptor (α7nAChR in the brain. Recent studies showed α7nAChR involvement in the initiation and addiction of smoking. Kynurenic acid (KA, a significant tryptophan metabolite, is an antagonist of α7nAChR. Inhibition of kynurenine 3-monooxygenase enzyme encoded by KMO enhances the KA levels. Modulating KMO gene expression could be a useful tactic for the treatment of tobacco initiation and dependence. Since KMO regulation is still poorly understood, we aimed to investigate the 5′ and 3′-regulatory factors of KMO gene to advance our knowledge to modulate KMO gene expression. In this study, bioinformatics methods were used to identify the regulatory sequences associated with expression of KMO. The displayed differential expression of KMO mRNA in the same tissue and different tissues suggested the specific usage of the KMO multiple alternative promoters. Eleven KMO alternative promoters identified at 5′-regulatory region contain TATA-Box, lack CpG Island (CGI and showed dinucleotide base-stacking energy values specific to transcription factor binding sites (TFBSs. The structural features of regulatory sequences can influence the transcription process and cell type-specific expression. The uncharacterized LOC105373233 locus coding for non-coding RNA (ncRNA located on the reverse strand in a convergent manner at the 3′-side of KMO locus. The two genes likely expressed by a promoter that lacks TATA-Box harbor CGI and two TFBSs linked to the bidirectional transcription, the NRF1, and ZNF14 motifs. We identified two types of microRNA (miR in the uncharacterized LOC105373233 ncRNA, which are like hsa-miR-5096 and hsa-miR-1285-3p and can target the miR recognition

  3. RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration

    International Nuclear Information System (INIS)

    Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long

    2011-01-01

    Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.

  4. Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the CALB2 promoter.

    Science.gov (United States)

    Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat

    2018-04-27

    The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments

  5. NFE2 Induces miR-423-5p to Promote Gluconeogenesis and Hyperglycemia by Repressing the Hepatic FAM3A-ATP-Akt Pathway.

    Science.gov (United States)

    Yang, Weili; Wang, Junpei; Chen, Zhenzhen; Chen, Ji; Meng, Yuhong; Chen, Liming; Chang, Yongsheng; Geng, Bin; Sun, Libo; Dou, Lin; Li, Jian; Guan, Youfei; Cui, Qinghua; Yang, Jichun

    2017-07-01

    Hepatic FAM3A expression is repressed under obese conditions, but the underlying mechanism remains unknown. This study determined the role and mechanism of miR-423-5p in hepatic glucose and lipid metabolism by repressing FAM3A expression. miR-423-5p expression was increased in the livers of obese diabetic mice and in patients with nonalcoholic fatty liver disease (NAFLD) with decreased FAM3A expression. miR-423-5p directly targeted FAM3A mRNA to repress its expression and the FAM3A-ATP-Akt pathway in cultured hepatocytes. Hepatic miR-423-5p inhibition suppressed gluconeogenesis and improved insulin resistance, hyperglycemia, and fatty liver in obese diabetic mice. In contrast, hepatic miR-423-5p overexpression promoted gluconeogenesis and hyperglycemia and increased lipid deposition in normal mice. miR-423-5p inhibition activated the FAM3A-ATP-Akt pathway and repressed gluconeogenic and lipogenic gene expression in diabetic mouse livers. The miR-423 precursor gene was further shown to be a target gene of NFE2, which induced miR-423-5p expression to repress the FAM3A-ATP-Akt pathway in cultured hepatocytes. Hepatic NFE2 overexpression upregulated miR-423-5p to repress the FAM3A-ATP-Akt pathway, promoting gluconeogenesis and lipid deposition and causing hyperglycemia in normal mice. In conclusion, under the obese condition, activation of the hepatic NFE2/miR-423-5p axis plays important roles in the progression of type 2 diabetes and NAFLD by repressing the FAM3A-ATP-Akt signaling pathway. © 2017 by the American Diabetes Association.

  6. Phylogenetic analysis of influenza A viruses (H3N2 circulating in Zhytomyr region during 2013–2014 epidemic season

    Directory of Open Access Journals (Sweden)

    Boyalska O. G.

    2015-06-01

    Full Text Available Aim. To perform phylogenetic analysis of the hemagglutinin (HA and neuraminidase (NA genes of influenza A(H3N2 viruses circulating in the Zhytomyr region during 2013–2014 epidemic season. To make comparison of the HA and NA genes sequences of the Zhytomyr region isolates with the HA and NA genes sequences of influenza viruses circulating in the world. Methods. Laboratory diagnosis was conducted by real-time polymerase chain reaction (RT-PCR. In this study the sequencing and phylogenetic analysis were carried out. Results. For the first time the genes of influenza A(H3N2 viruses isolated in the Zhytomyr region during 2013–2014 epidemic season, coding hemagglutinin and neuraminidase were compared with their orthologs. According to the results of this comparison the phylogenetic tree was constructed. Additionally, the amino acid substitutions of the influenza viruses circulating in Ukraine and worldwide were analyzed. Conclusions. The nucleotide sequences of the influenza A(H3N2 viruses genes HA and NA isolated in the Zhytomyr region were identified. Based on the nucleotide sequences of HA and NA we constructed the influenza virus phylogenetic tree demonstrating that the virus isolated in the Zhytomyr region was closely related to the Ukrainian isolate from Kharkov and in the world to the isolates from Germany, Romania, Italy.

  7. Pim kinases phosphorylate multiple sites on Bad and promote 14-3-3 binding and dissociation from Bcl-XL

    Directory of Open Access Journals (Sweden)

    Hastie C James

    2006-01-01

    Full Text Available Abstract Background Pim-1, 2 and 3 are a group of enzymes related to the calcium calmodulin family of protein kinases. Over-expression of Pim-1 and Pim-2 in mice promotes the development of lymphomas, and up-regulation of Pim expression has been observed in several human cancers. Results Here we show that the pim kinases are constitutively active when expressed in HEK-293 cells and are able to phosphorylate the Bcl-2 family member Bad on three residues, Ser112, Ser136 and Ser155 in vitro and in cells. In vitro mapping showed that Pim-2 predominantly phosphorylated Ser112, while Pim-1 phosphorylated Ser112, but also Ser136 and Ser155 at a reduced rate compared to Ser112. Pim-3 was found to be the least specific for Ser112, and the most effective at phosphorylating Ser136 and Ser155. Pim-3 was also able to phosphorylate other sites in Bad in vitro, including Ser170, another potential in vivo site. Mutation of Ser136 to alanine prevented the phosphorylation of Ser112 and Ser155 by Pim kinases in HEK-293 cells, suggesting that this site must be phosphorylated first in order to make the other sites accessible. Pim phosphorylation of Bad was also found to promote the 14-3-3 binding of Bad and block its association with Bcl-XL. Conclusion All three Pim kinase family members predominantly phosphorylate Bad on Ser112 and in addition are capable of phosphorylating Bad on multiple sites associated with the inhibition of the pro-apoptotic function of Bad in HEK-293 cells. This would be consistent with the proposed function of Pim kinases in promoting cell proliferation and preventing cell death.

  8. Omeprazole blocks STAT6 binding to the eotaxin-3 promoter in eosinophilic esophagitis cells.

    Directory of Open Access Journals (Sweden)

    Xi Zhang

    Full Text Available Patients who have esophageal eosinophilia without gastroesophageal reflux disease (GERD nevertheless can respond to proton pump inhibitors (PPIs, which can have anti-inflammatory actions independent of effects on gastric acid secretion. In esophageal cell cultures, omeprazole has been reported to inhibit Th2 cytokine-stimulated expression of eotaxin-3, an eosinophil chemoattractant contributing to esophageal eosinophilia in eosinophilic esophagitis (EoE. The objective of this study was to elucidate molecular mechanisms underlying PPI inhibition of IL-4-stimulated eotaxin-3 production by esophageal cells.Telomerase-immortalized and primary cultures of esophageal squamous cells from EoE patients were treated with IL-4 in the presence or absence of acid-activated omeprazole or lansoprazole. We measured eotaxin-3 protein secretion by ELISA, mRNA expression by PCR, STAT6 phosphorylation and nuclear translocation by Western blotting, eotaxin-3 promoter activation by an exogenous reporter construct, and STAT6, RNA polymerase II, and trimethylated H3K4 binding to the endogenous eotaxin-3 promoter by ChIP assay. Omeprazole in concentrations ≥5 µM significantly decreased IL-4-stimulated eotaxin-3 protein secretion and mRNA expression. Lansoprazole also blocked eotaxin-3 protein secretion. Omeprazole had no effect on eotaxin-3 mRNA stability or on STAT6 phosphorylation and STAT6 nuclear translocation. Rather, omeprazole blocked binding of IL-4-stimulated STAT6, RNA polymerase II, and trimethylated H3K4 to the eotaxin-3 promoter.PPIs, in concentrations achieved in blood with conventional dosing, significantly inhibit IL-4-stimulated eotaxin-3 expression in EoE esophageal cells and block STAT6 binding to the promoter. These findings elucidate molecular mechanisms whereby patients with Th2 cytokine-driven esophageal eosinophilia can respond to PPIs, independent of effects on gastric acid secretion.

  9. The influence of Fe2O3 in the humidity sensor performance of ZrO2:TiO2-based porous ceramics

    International Nuclear Information System (INIS)

    Cosentino, I.C.; Muccillo, E.N.S.; Muccillo, R.

    2007-01-01

    ZrO 2 :TiO 2 ceramics were prepared with different porosity values by two methods: (a) sintering at 1150, 1300 and 1500 deg. C, corresponding to the temperatures of the first, second and third sintering stages, according to dilatometry results; (b) adding Fe 2 O 3 (2.0 and 5.0 mol%) to ZrO 2 :TiO 2 powders before sintering. The ZrO 2 :TiO 2 specimens were characterized by X-ray diffraction, mercury porosimetry, scanning electron microscopy and impedance spectroscopy. The impedance spectroscopy analysis was carried out under different relative humidities. The bulk electrical resistivity in the low frequency region (10-100 Hz) decreases for increasing relative humidity. Increasing the sintering temperature from the first to the third sintering stage promoted grain growth, as expected, with consequent decrease of the intergranular porosity. The use of Fe 2 O 3 as sintering aid reduced the porosity of the specimens, but increased the electrical response under humid environments in comparison with specimens sintered without Fe 2 O 3

  10. Esrrb directly binds to Gata6 promoter and regulates its expression with Dax1 and Ncoa3

    International Nuclear Information System (INIS)

    Uranishi, Kousuke; Akagi, Tadayuki; Koide, Hiroshi; Yokota, Takashi

    2016-01-01

    Estrogen-related receptor beta (Esrrb) is expressed in embryonic stem (ES) cells and is involved in self-renewal ability and pluripotency. Previously, we found that Dax1 is associated with Esrrb and represses its transcriptional activity. Further, the disruption of the Dax1–Esrrb interaction increases the expression of the extra-embryonic endoderm marker Gata6 in ES cells. Here, we investigated the influences of Esrrb and Dax1 on Gata6 expression. Esrrb overexpression in ES cells induced endogenous Gata6 mRNA and Gata6 promoter activity. In addition, the Gata6 promoter was found to contain the Esrrb recognition motifs ERRE1 and ERRE2, and the latter was the responsive element of Esrrb. Associations between ERRE2 and Esrrb were then confirmed by biotin DNA pulldown and chromatin immunoprecipitation assays. Subsequently, we showed that Esrrb activity at the Gata6 promoter was repressed by Dax1, and although Dax1 did not bind to ERRE2, it was associated with Esrrb, which directly binds to ERRE2. In addition, the transcriptional activity of Esrrb was enhanced by nuclear receptor co-activator 3 (Ncoa3), which has recently been shown to be a binding partner of Esrrb. Finally, we showed that Dax1 was associated with Ncoa3 and repressed its transcriptional activity. Taken together, the present study indicates that the Gata6 promoter is activated by Esrrb in association with Ncoa3, and Dax1 inhibited activities of Esrrb and Ncoa3, resulting maintenance of the undifferentiated status of ES cells. - Highlights: • Esrrb induced Gata6 expression in ES cells. • Gata6 promoter activity was enhanced by Esrrb, which was repressed by Dax1. • Dax1 associated with the Gata6 promoter via Esrrb. • Dax1 associated with Ncoa3 and repressed its transcriptional activity.

  11. MICB gene diversity and balancing selection on its promoter region in Yao population in southern China.

    Science.gov (United States)

    Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming

    2016-12-01

    To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  12. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Science.gov (United States)

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  13. Loss of expression and promoter methylation of SLIT2 are associated with sessile serrated adenoma formation.

    Directory of Open Access Journals (Sweden)

    Andrew D Beggs

    2013-05-01

    Full Text Available Serrated adenomas form a distinct subtype of colorectal pre-malignant lesions that may progress to malignancy along a different molecular pathway than the conventional adenoma-carcinoma pathway. Previous studies have hypothesised that BRAF mutation and promoter hypermethylation plays a role, but the evidence for this is not robust. We aimed to carry out a whole-genome loss of heterozygosity analysis, followed by targeted promoter methylation and expression analysis to identify potential pathways in serrated adenomas. An initial panel of 9 sessile serrated adenomas (SSA and one TSA were analysed using Illumina Goldengate HumanLinkage panel arrays to ascertain regions of loss of heterozygosity. This was verified via molecular inversion probe analysis and microsatellite analysis of a further 32 samples. Methylation analysis of genes of interest was carried out using methylation specific PCR (verified by pyrosequencing and immunohistochemistry used to correlate loss of expression of genes of interest. All experiments used adenoma samples and normal tissue samples as control. SSA samples were found on whole-genome analysis to have consistent loss of heterozygosity at 4p15.1-4p15.31, which was not found in the sole TSA, adenomas, or normal tissues. Genes of interest in this region were PDCH7 and SLIT2, and combined MSP/IHC analysis of these genes revealed significant loss of SLIT2 expression associated with promoter methylation of SLIT2. Loss of expression of SLIT2 by promoter hypermethylation and loss of heterozygosity events is significantly associated with serrated adenoma development, and SLIT2 may represent a epimutated tumour suppressor gene according to the Knudson "two hit" hypothesis.

  14. The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

    Science.gov (United States)

    Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

    2013-04-01

    which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

  15. Cell- and stage-specific chromatin structure across the Complement receptor 2 (CR2/CD21) promoter coincide with CBF1 and C/EBP-beta binding in B cells.

    Science.gov (United States)

    Cruickshank, Mark N; Fenwick, Emily; Karimi, Mahdad; Abraham, Lawrence J; Ulgiati, Daniela

    2009-08-01

    Stringent developmental transcription requires multiple transcription factor (TF) binding sites, cell-specific expression of signaling molecules, TFs and co-regulators and appropriate chromatin structure. During B-lymphopoiesis, human Complement receptor 2 (CR2/CD21) is detected on immature and mature B cells but not on B cell precursors and plasma cells. We examined cell- and stage-specific human CR2 gene regulation using cell lines modeling B-lymphopoiesis. Chromatin accessibility assays revealed a region between -409 and -262 with enhanced accessibility in mature B cells and pre-B cells, compared to either non-lymphoid or plasma cell-types, however, accessibility near the transcription start site (TSS) was elevated only in CR2-expressing B cells. A correlation between histone acetylation and CR2 expression was observed, while histone H3K4 dimethylation was enriched near the TSS in both CR2-expressing B cells and non-expressing pre-B cells. Candidate sites within the CR2 promoter were identified which could regulate chromatin, including a matrix attachment region associated with CDP, SATB1/BRIGHT and CEBP-beta sites as well as two CBF1 sites. ChIP assays verified that both CBF1 and C/EBP-beta bind the CR2 promoter in B cells raising the possibility that these factors facilitate or respond to alterations in chromatin structure to control the timing and/or level of CR2 transcription.

  16. Bölgesel Yenilik Sistemlerinde Devletin Rolü: Düzey 2 Bölgelerine İlişkin Ampirik Bir Analiz(The Role of State in Regional Innovation System: An Empirical Analysis of NUTS 2 Region

    Directory of Open Access Journals (Sweden)

    Gökhan DÖKMEN

    2012-01-01

    Full Text Available The state has a regulatory role in regional innovation systems. The regulatory role of the state in systemic approach covers a variety of areas such as building habitats for innovation and entrepreneurship, promotion of clustering and supporting innovative networks. This study examines the impact of public policies such as public investment, investment subsidies and advanced technology investment in state university on regional innovation. The relation between regional innovation and public policy tools has been tested for 1999-2008 period on 20 NUTS 2 regions by using panel DOLS (dynamic ordinary least square method. The result showed a positive and statistically significant equilibrium relation regional innovation and public expenditure. Further, investment subsidies and advanced technology investment have no significant impact on regional innovation capacity in NUTS2 regions.

  17. ABF2, ABF3, and ABF4 Promote ABA-Mediated Chlorophyll Degradation and Leaf Senescence by Transcriptional Activation of Chlorophyll Catabolic Genes and Senescence-Associated Genes in Arabidopsis.

    Science.gov (United States)

    Gao, Shan; Gao, Jiong; Zhu, Xiaoyu; Song, Yi; Li, Zhongpeng; Ren, Guodong; Zhou, Xin; Kuai, Benke

    2016-09-06

    Chlorophyll (Chl) degradation is an integral process of leaf senescence, and NYE1/SGR1 has been demonstrated as a key regulator of Chl catabolism in diverse plant species. In this study, using yeast one-hybrid screening, we identified three abscisic acid (ABA)-responsive element (ABRE)-binding transcription factors, ABF2 (AREB1), ABF3, and ABF4 (AREB2), as the putative binding proteins of the NYE1 promoter. Through the transactivation analysis, electrophoretic mobility shift assay, and chromatin immunoprecipitation, we demonstrated that ABF2, ABF3, and ABF4 directly bound to and activated the NYE1 promoter in vitro and in vivo. ABA is a positive regulator of leaf senescence, and exogenously applied ABA can accelerate Chl degradation. The triple mutant of the ABFs, abf2abf3abf4, as well as two ABA-insensitive mutants, abi1-1 and snrk2.2/2.3/2.6, exhibited stay-green phenotypes after ABA treatment, along with decreased induction of NYE1 and NYE2 expression. In contrast, overexpression of ABF4 accelerated Chl degradation upon ABA treatment. Interestingly, ABF2/3/4 could also activate the expression of two Chl catabolic enzyme genes, PAO and NYC1, by directly binding to their promoters. In addition, abf2abf3abf4 exhibited a functional stay-green phenotype, and senescence-associated genes (SAGs), such as SAG29 (SWEET15), might be directly regulated by the ABFs. Taken together, our results suggest that ABF2, ABF3, and ABF4 likely act as key regulators in mediating ABA-triggered Chl degradation and leaf senescence in general in Arabidopsis. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  18. Reduced MeCP2 expression is frequent in autism frontal cortex and correlates with aberrant MECP2 promoter methylation.

    Science.gov (United States)

    Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M

    2006-01-01

    Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.

  19. The Study of Electrical Properties for Multilayer La2O3/Al2O3 Dielectric Stacks and LaAlO3 Dielectric Film Deposited by ALD.

    Science.gov (United States)

    Feng, Xing-Yao; Liu, Hong-Xia; Wang, Xing; Zhao, Lu; Fei, Chen-Xi; Liu, He-Lei

    2017-12-01

    The capacitance and leakage current properties of multilayer La 2 O 3 /Al 2 O 3 dielectric stacks and LaAlO 3 dielectric film are investigated in this paper. A clear promotion of capacitance properties is observed for multilayer La 2 O 3 /Al 2 O 3 stacks after post-deposition annealing (PDA) at 800 °C compared with PDA at 600 °C, which indicated the recombination of defects and dangling bonds performs better at the high-k/Si substrate interface for a higher annealing temperature. For LaAlO 3 dielectric film, compared with multilayer La 2 O 3 /Al 2 O 3 dielectric stacks, a clear promotion of trapped charges density (N ot ) and a degradation of interface trap density (D it ) can be obtained simultaneously. In addition, a significant improvement about leakage current property is observed for LaAlO 3 dielectric film compared with multilayer La 2 O 3 /Al 2 O 3 stacks at the same annealing condition. We also noticed that a better breakdown behavior for multilayer La 2 O 3 /Al 2 O 3 stack is achieved after annealing at a higher temperature for its less defects.

  20. XTACC3-XMAP215 association reveals an asymmetric interaction promoting microtubule elongation

    DEFF Research Database (Denmark)

    Mortuza, Gulnahar B; Cavazza, Tommaso; Garcia-Mayoral, Maria Flor

    2014-01-01

    215 (chTOG), dissecting the mechanism by which their interaction promotes microtubule elongation during spindle assembly. Using SAXS, we show that the TACC domain (TD) is an elongated structure that mediates the interaction with the C terminus of XMAP215. Our data suggest that one TD and two XMAP215...... molecules associate to form a four-helix coiled-coil complex. A hybrid methods approach was used to define the precise regions of the TACC heptad repeat and the XMAP215 C terminus required for assembly and functioning of the complex. We show that XTACC3 can induce the recruitment of larger amounts of XMAP...

  1. Beta-Defensin 2 and 3 Promote Bacterial Clearance of Pseudomonas aeruginosa by Inhibiting Macrophage Autophagy through Downregulation of Early Growth Response Gene-1 and c-FOS

    Directory of Open Access Journals (Sweden)

    Yongjian Wu

    2018-02-01

    Full Text Available Beta-defensins 2 and 3 (BD2 and BD3 are inducible peptides present at the sites of infection, and they are well characterized for their antimicrobial activities and immune-regulatory functions. However, no study has thoroughly investigated their immunomodulatory effects on macrophage-mediated immune responses against Pseudomonas aeruginosa (PA. Here, we use THP-1 and RAW264.7 cell lines and demonstrate that BD2 and BD3 suppressed macrophage autophagy but enhanced the engulfment of PA and Zymosan bioparticles as well as the formation of phagolysosomes, using immunofluorescence staining and confocal microscopy. Plate count assay showed that macrophage-mediated phagocytosis and intracellular killing of PA were promoted by BD2 and BD3. Furthermore, microarray and real-time PCR showed that the expression of two genes, early growth response gene-1 (EGR1 and c-FOS, was attenuated by BD2 and BD3. Western blot revealed that BD2 and BD3 inhibited the expression and nuclear translocation of EGR1 and c-FOS. Knockdown of EGR1 and c-FOS by siRNA transfection suppressed macrophage autophagy before and after PA infection; while overexpression of these two transcription factors enhanced autophagy but reversed the role of BD2 and BD3 on macrophage-mediated PA eradication. Together, these results demonstrate a novel immune defense activity of BD2 and BD3, which promotes clearance of PA by inhibiting macrophage autophagy through downregulation of EGR1 and c-FOS.

  2. Long-term exposure to PM2.5 lowers influenza virus resistance via down-regulating pulmonary macrophage Kdm6a and mediates histones modification in IL-6 and IFN-β promoter regions.

    Science.gov (United States)

    Ma, Jing-Hui; Song, Shao-Hua; Guo, Meng; Zhou, Ji; Liu, Fang; Peng, Li; Fu, Zhi-Ren

    2017-11-18

    Atmospheric particulates, especially PM2.5, not only damage the respiratory system, but also play important roles in pulmonary immunity. China is influenced by atmospheric diffusion conditions, industrial manufacturers, and heating and discharging. PM2.5 levels in the air rise substantially in the winter, which is also a period of flu high-incidence. Although an epidemiological link exists between PM2.5 and flu, we do not understand how long-term PM2.5 inhalation affects pulmonary immunity and the influenza virus response. Our study has prepared an in vivo PM2.5 mouse pharyngeal wall drop-in model and has found that PM2.5 exposure leads to mouse inflammatory injuries and furthers influenza A infection. Our results suggest that short-term exposure to PM2.5 significantly enhances the survival rate of influenza A-contaminated mice, while long-term PM2.5 inhalation lowers the capacity of pulmonary macrophages to secrete IL-6 and IFN-β. A disorder in the pulmonary innate defense system results in increased death rates following influenza infection. On a macromolecular level, this mechamism involves Kdm6a down-regulation after long-term exposure to PM 2.5 and a resultant increase in H3K4 and H3K9 methylation in IL-6 and IFN-β promoter regions. In summary, PM2.5 causes injuries of lung tissue cells and downregulates immune defense mechanisms in the lung. Copyright © 2017. Published by Elsevier Inc.

  3. Enzymatically crosslinked gelatin hydrogel promotes the proliferation of adipose tissue-derived stromal cells

    Directory of Open Access Journals (Sweden)

    Gang Yang

    2016-09-01

    Full Text Available Gelatin hydrogel crosslinked by microbial transglutaminase (mTG exhibits excellent performance in cell adhesion, proliferation, and differentiation. We examined the gelation time and gel strength of gelatin/mTG hydrogels in various proportions to investigate their physical properties and tested their degradation performances in vitro. Cell morphology and viability of adipose tissue-derived stromal cells (ADSCs cultured on the 2D gel surface or in 3D hydrogel encapsulation were evaluated by immunofluorescence staining. Cell proliferation was tested via Alamar Blue assay. To investigate the hydrogel effect on cell differentiation, the cardiac-specific gene expression levelsof Nkx2.5, Myh6, Gja1, and Mef2c in encapsulated ADSCs with or without cardiac induction medium were detected by real-time RT-PCR. Cell release from the encapsulated status and cell migration in a 3D hydrogel model were assessed in vitro. Results show that the gelatin/mTG hydrogels are not cytotoxic and that their mechanical properties are adjustable. Hydrogel degradation is related to gel concentration and the resident cells. Cell growth morphology and proliferative capability in both 2D and 3D cultures were mainly affected by gel concentration. PCR result shows that hydrogel modulus together with induction medium affects the cardiac differentiation of ADSCs. The cell migration experiment and subcutaneous implantation show that the hydrogels are suitable for cell delivery.

  4. On the Formation of the C{sub 2}H{sub 6}O Isomers Ethanol (C{sub 2}H{sub 5}OH) and Dimethyl Ether (CH{sub 3}OCH{sub 3}) in Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Bergantini, Alexandre; Maksyutenko, Pavlo; Kaiser, Ralf I., E-mail: ralfk@hawaii.edu [Department of Chemistry, University of Hawaii at Mānoa, Honolulu, HI 96822 (United States)

    2017-06-01

    The structural isomers ethanol (CH{sub 3}CH{sub 2}OH) and dimethyl ether (CH{sub 3}OCH{sub 3}) were detected in several low-, intermediate-, and high-mass star-forming regions, including Sgr B2, Orion, and W33A, with the relative abundance ratios of ethanol/dimethyl ether varying from about 0.03 to 3.4. Until now, no experimental data regarding the formation mechanisms and branching ratios of these two species in laboratory simulation experiments could be provided. Here, we exploit tunable photoionization reflectron time-of-flight mass spectrometry (PI-ReTOF-MS) to detect and analyze the production of complex organic molecules (COMs) resulting from the exposure of water/methane (H{sub 2}O/CH{sub 4}) ices to energetic electrons. The main goal is to understand the formation mechanisms in star-forming regions of two C{sub 2}H{sub 6}O isomers: ethanol (CH{sub 3}CH{sub 2}OH) and dimethyl ether (CH{sub 3}OCH{sub 3}). The results show that the experimental branching ratios favor the synthesis of ethanol versus dimethyl ether (31 ± 11:1). This finding diverges from the abundances observed toward most star-forming regions, suggesting that production routes on interstellar grains to form dimethyl ether might be missing; alternatively, ethanol can be overproduced in the present simulation experiments, such as via radical–radical recombination pathways involving ethyl and hydroxyl radicals. Finally, the PI-ReTOF-MS data suggest the formation of methylacetylene (C{sub 3}H{sub 4}), ketene (CH{sub 2}CO), propene (C{sub 3}H{sub 6}), vinyl alcohol (CH{sub 2}CHOH), acetaldehyde (CH{sub 3}CHO), and methyl hydroperoxide (CH{sub 3}OOH), in addition to ethane (C{sub 2}H{sub 6}), methanol (CH{sub 3}OH), and CO{sub 2} detected from infrared spectroscopy. The yield of all the confirmed species is also determined.

  5. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

    Science.gov (United States)

    Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

    2017-09-12

    Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription

    Directory of Open Access Journals (Sweden)

    Chen-Chun Pai

    2017-09-01

    Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.

  7. Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

    Directory of Open Access Journals (Sweden)

    Mostafa M Abbas

    Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

  8. An HDAC2-TET1 switch at distinct chromatin regions significantly promotes the maturation of pre-iPS to iPS cells

    Science.gov (United States)

    Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong

    2015-01-01

    The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799

  9. Ternary phosphates in Ca3(PO4)2-Na3Ln(PO4)2 (Ln-Nd, Eu, Er) systems

    International Nuclear Information System (INIS)

    Lazoryak, B.I.; Ivanov, L.N.; Strunenkova, T.V.; Golubev, V.N.; Viting, B.N.

    1990-01-01

    Ternary phosphates, formed in Ca 3 (PO 4 ) 2 -Na 3 Ln(PO 4 ) 2 (Ln-Nd, Eu, Er) systems were investigated by the methods of X-ray phase, luminescent analyses and IR spectroscopy. 5 regions of homogeneity were found. Two of them (I and II) were distinguished for all systems. Samples in the region of up to 14.285 mol.% Na 3 Ln(PO 4 ) 2 crystallize on the basis of β-Ca 3 (PO 4 ) 2 structure, and in other homogeneity regions - on the basis of β-K 2 SO 4 structure

  10. Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

    Directory of Open Access Journals (Sweden)

    Susanne Schmeier

    2009-01-01

    Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

  11. The promoter for intestinal cell kinase is head-to-head with F-Box 9 and contains functional sites for TCF7L2 and FOXA factors

    Directory of Open Access Journals (Sweden)

    Cohn Steven M

    2010-05-01

    Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are

  12. E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor

    International Nuclear Information System (INIS)

    Hiebert, S.W.; Lipp, M.; Nevins, J.R.

    1989-01-01

    E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription

  13. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  14. Coherent photoproduction of π+ on 3He in the (3,3) resonance region

    International Nuclear Information System (INIS)

    Boyard, J.-L.

    1975-01-01

    An experimental study of the 3 He(γ,π + ) 3 H reaction has been performed in the (3,3) resonance region with a bremsstrahlung photon beam and a liquid 3 He target. A magnetic spectrometer followed by a wire chamber analyzed the momentum of the outgoing pions and defined their emission angle. The tritons were detected in coincidence with the pions by two methods: a telescope of thin plastic scintillators below 40MeV; or a magnetic spectrometer followed by a series of plastic scintillators for higher energies. The experiment shows two main features: at a fixed four-momentum transfer q 2 , the resonance is shifted towards lower energies, this shift increasing with q 2 ; at a fixed angle, but variable q 2 , the minimum of the charge form factor observed in the elastic scattering of electrons on 3 He does not appear. Calculations explain partly these two effects [fr

  15. The human luteinizing hormone receptor gene