WorldWideScience

Sample records for nested pcr detection

  1. [Optimized application of nested PCR method for detection of malaria].

    Science.gov (United States)

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  2. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

    Directory of Open Access Journals (Sweden)

    Amanda de Faveri Pitz

    2013-12-01

    Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  3. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

    Science.gov (United States)

    Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

    2013-01-01

    Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  4. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  5. Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

    Science.gov (United States)

    Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2011-01-01

    It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

  6. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Science.gov (United States)

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

    Science.gov (United States)

    Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

    2016-01-01

    To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

  8. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    Science.gov (United States)

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  9. Detection of tumor markers in prostate cancer and comparison of sensitivity between real time and nested PCR.

    Science.gov (United States)

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-06-27

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivity by real time PCR and nested PCR. In real time PCR, there was a significant correlation between cell number and the RNA concentration obtained (R(2)=0.9944) for PSA, PSMA, and AR. We found it possible to detect these markers from a single LNCaP cell in both real time and nested PCR. By comparison, nested PCR reached a linear curve in fewer PCR cycles than real time PCR, suggesting that nested PCR may offer PCR results more quickly than real time PCR. In conclusion, nested PCR may offer tumor maker detection in PCa cells more quickly (with fewer PCR cycles) with the same high sensitivity as real time PCR. Further study is necessary to establish and evaluate the best tool for PCa tumor marker detection.

  10. Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

    Science.gov (United States)

    da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

    2011-01-01

    The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

  11. Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

    Science.gov (United States)

    Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

    2004-01-01

    A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner. PMID:15071047

  12. Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

    OpenAIRE

    Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

    2004-01-01

    A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner.

  13. Detection of Tumor Markers in Prostate Cancer and Comparison of Sensitivity between Real Time and Nested PCR

    OpenAIRE

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-01-01

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivi...

  14. Development of Nested-PCR Assay to Detect Acidovorax citrulli, a Causal Agent of Bacterial Fruit Blotch at Cucurbitaceae

    Directory of Open Access Journals (Sweden)

    Young-Tak Kim

    2015-06-01

    Full Text Available The specific and sensitive nested-PCR method to detect Acidovorax citrulli, a causal agent of bacterial fruit blotch on cucurbitaceae, was developed. PCR primers were designed from the draft genome sequence which was obtained with the Next Generation Sequencing of A. citrulli KACC10651, and the nested-PCR primer set (Ac-ORF 21F/Ac-ORF 21R were selected by checking of specificity to A. citrulli with PCR assays. The selected nested-PCR primer amplified the 140 bp DNA only from A. citrulli strains, and detection sensitivity of the nested PCR increased 10,000 times of 1st PCR detection limit (10 ng genomic DNA/PCR. The nested PCR detected A. citrulli from the all samples of seed surface wash (external seed detection of the artificially inoculated watermelon seeds with 101 cfu/ml and above population of A. citrulli while the nested PCR could not detected A. citrulli from the mashed seed suspension (internal seed detection of the all artificially inoculated watermelon seeds. When the naturally infested watermelon seeds (10% seed infested rate with grow-out test used, the nested PCR detected A. citrulli from 2 seed samples out of 10 replication samples externally and 5 seed samples out of 10 replication samples internally. We believe that the nested-PCR developed in this study will be useful method to detect A. citrulli from the Cucurbitaceae seeds.

  15. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  16. Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

    Science.gov (United States)

    Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

    Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  18. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Comparison of ELISA, nested PCR and sequencing and a novel qPCR for detection of Giardia isolates from Jordan.

    Science.gov (United States)

    Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una

    2018-02-01

    Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR

    NARCIS (Netherlands)

    Croci, L.; Medici, de D.; Morace, G.; Fiore, A.; Scalfaro, C.; Beneduce, F.; Toti, L.

    1999-01-01

    A method for the detection of HAV in shellfish, based on the use of guanidinium isothiocyanate-contg. soln. for RNA extn. and purifn. steps, followed by nested PCR, is hereby proposed. Tests were carried out on mollusc samples spiked with HAV strain FG. Results showed that in samples subjected only

  1. Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

    OpenAIRE

    Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

    1993-01-01

    We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

  2. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  3. The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs.

    Science.gov (United States)

    Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz

    2015-06-01

    Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations.

  4. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

    Science.gov (United States)

    Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

    2014-12-01

    Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Detection of Talaromyces marneffei from Fresh Tissue of an Inhalational Murine Pulmonary Model Using Nested PCR.

    Directory of Open Access Journals (Sweden)

    Yinghui Liu

    Full Text Available Penicilliosis marneffei, often consecutive to the aspiration of Talaromyces marneffei (Penicillium marneffei, continues to be one of the significant causes of morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. Improving the accuracy of diagnosing this disease would aid in reducing the mortality of associated infections. In this study, we developed a stable and reproducible murine pulmonary model that mimics human penicilliosis marneffei using a nebulizer to deliver Talaromyces marneffei (SUMS0152 conidia to the lungs of BALB/c nude mice housed in exposure chamber. Using this model, we further revealed that nested PCR was sensitive and specific for detecting Talaromyces marneffei in bronchoalveolar lavage fluid and fresh tissues. This inhalation model may provide a more representative analysis tool for studying the development of penicilliosis marneffei, in addition to revealing that nested PCR has a predictive value in reflecting pulmonary infection.

  6. Detection of Talaromyces marneffei from Fresh Tissue of an Inhalational Murine Pulmonary Model Using Nested PCR

    Science.gov (United States)

    Liu, Yinghui; Huang, Xiaowen; Yi, Xiuwen; He, Ya; Mylonakis, Eleftherios; Xi, Liyan

    2016-01-01

    Penicilliosis marneffei, often consecutive to the aspiration of Talaromyces marneffei (Penicillium marneffei), continues to be one of the significant causes of morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. Improving the accuracy of diagnosing this disease would aid in reducing the mortality of associated infections. In this study, we developed a stable and reproducible murine pulmonary model that mimics human penicilliosis marneffei using a nebulizer to deliver Talaromyces marneffei (SUMS0152) conidia to the lungs of BALB/c nude mice housed in exposure chamber. Using this model, we further revealed that nested PCR was sensitive and specific for detecting Talaromyces marneffei in bronchoalveolar lavage fluid and fresh tissues. This inhalation model may provide a more representative analysis tool for studying the development of penicilliosis marneffei, in addition to revealing that nested PCR has a predictive value in reflecting pulmonary infection. PMID:26886887

  7. Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

    International Nuclear Information System (INIS)

    Ramadan, A.; Soukkaria, S.

    2013-01-01

    Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

  8. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

    Science.gov (United States)

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

    2014-07-21

    Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

  9. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Science.gov (United States)

    Tu, Thomas; Jilbert, Allison R

    2017-01-01

    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  10. Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R

    2014-01-01

    In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  11. Detection of environmental sources of Histoplasma capsulatum in Chiang Mai, Thailand, by nested PCR.

    Science.gov (United States)

    Norkaew, Treepradab; Ohno, Hideaki; Sriburee, Pojana; Tanabe, Koichi; Tharavichitkul, Prasit; Takarn, Piyawan; Puengchan, Tanpalang; Bumrungsri, Sara; Miyazaki, Yoshitsugu

    2013-12-01

    Histoplasmosis is a systemic mycosis caused by inhaling spores of Histoplasma capsulatum, a dimorphic fungus. This fungus grows in soil contaminated with bat and avian excreta. Each year, patients with disseminated histoplasmosis have been diagnosed in Chiang Mai, northern Thailand. No published information is currently available on the environmental sources of this fungus in Chiang Mai or anywhere else in Thailand. The aim of this study was to detect H. capsulatum in soil samples contaminated with bat guano and avian droppings by nested PCR. Two hundred and sixty-five samples were collected from the following three sources: soil contaminated with bat guano, 88 samples; soil contaminated with bird droppings, 86 samples; and soil contaminated with chicken droppings, 91 samples. Genomic DNA was directly extracted from each sample, and H. capsulatum was detected by nested PCR using a primer set specific to a gene encoding 100-kDa-like protein (HcI, HcII and HcIII, HcIV). Histoplasma capsulatum was detected in seven of 88 soil samples contaminated with bat guano, one of 21 soil samples contaminated with pigeon droppings and 10 of 91 soil samples contaminated with chicken droppings. The results indicate the possibility of the association of bat guano and chicken droppings with H. capsulatum in this area of Thailand.

  12. Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals.

    Science.gov (United States)

    Zhang, Xin; He, Chuan-Chuan; Liu, Jin-Ming; Li, Hao; Lu, Ke; Fu, Zhi-Qiang; Zhu, Chuan-Gang; Liu, Yi-Ping; Tong, Lai-Bao; Zhou, De-Bao; Zha, Li; Hong, Yang; Jin, Ya-Mei; Lin, Jiao-Jiao

    2017-04-13

    Schistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals. A specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties. The expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those

  13. Sensitive detection of Treponema pallidum DNA from the whole blood of patients with syphilis by the nested PCR assay.

    Science.gov (United States)

    Wang, Cuini; Cheng, Yuanyuan; Liu, Biao; Wang, Yuanyuan; Gong, Weiming; Qian, Yihong; Guan, Zhifang; Lu, Haikong; Gu, Xin; Shi, Mei; Zhou, Pingyu

    2018-05-09

    The aim of this work was to investigate the application of the nested PCR assay for the detection of Treponema pallidum (TP) DNA from the blood of patients with different stages of syphilis. In this study, a nested PCR method targeting the Tpp47 and polA genes (Tpp47-Tp-PCR and polA-Tp-PCR) was developed to detect TP-DNA in whole blood samples collected from 262 patients with different stages of syphilis (84 primary syphilis, 97 secondary syphilis, and 81 latent syphilis patients). The PCR assay detected T. pallidum DNA in 53.6% and 62.9% of the patients with primary and secondary syphilis, respectively, which was much higher than the detection levels in patients with latent syphilis (7.4%) (both p PCR in the early phase of the latent infection. Thus, blood RPR titers were correlated with the blood T. pallidum burden, but the correlations varied with primary and secondary syphilis. The results indicate that nested PCR is a sensitive method for detecting blood TP-DNA and is especially useful for detecting early syphilis including primary syphilis and secondary syphilis. The findings also suggest that the PCR assay may be used to complement other methods to enhance the diagnosis of syphilis.

  14. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Science.gov (United States)

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  15. In situ detection of the Clostridium botulinum type C1 toxin gene in wetland sediments with a nested PCR assay

    Science.gov (United States)

    Williamson, Judy L.; Rocke, Tonie E.; Aiken, Judd M.

    1999-01-01

    A nested PCR was developed for detection of the Clostridium botulinum type C1 toxin gene in sediments collected from wetlands where avian botulism outbreaks had or had not occurred. The C1 toxin gene was detected in 16 of 18 sites, demonstrating both the ubiquitous distribution of C. botulinum type C in wetland sediments and the sensitivity of the detection assay.

  16. Detection of Cryptococcus neoformans DNA in Tissue Samples by Nested and Real-Time PCR Assays

    OpenAIRE

    Bialek, Ralf; Weiss, Michael; Bekure-Nemariam, Kubrom; Najvar, Laura K.; Alberdi, Maria B.; Graybill, John R.; Reischl, Udo

    2002-01-01

    Two PCR protocols targeting the 18S rRNA gene of Cryptococcus neoformans were established, compared, and evaluated in murine cryptococcal meningitis. One protocol was designed as a nested PCR to be performed in conventional block thermal cyclers. The other protocol was designed as a quantitative single-round PCR adapted to LightCycler technology. One hundred brain homogenates and dilutions originating from 20 ICR mice treated with different azoles were examined. A fungal burden of 3 × 101 to ...

  17. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR.

    Science.gov (United States)

    Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W Ian; Kabuusu, Richard M; Ferguson, Hugh; Del Pozo, Jorge; Eldar, Avi; Bacharach, Eran

    2017-03-01

    Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. Copyright © 2017 American Society for Microbiology.

  19. Detection of Tilapia Lake Virus in Clinical Samples by Culturing and Nested Reverse Transcription-PCR

    Science.gov (United States)

    Kembou Tsofack, Japhette Esther; Zamostiano, Rachel; Watted, Salsabeel; Berkowitz, Asaf; Rosenbluth, Ezra; Mishra, Nischay; Briese, Thomas; Lipkin, W. Ian; Kabuusu, Richard M.; Ferguson, Hugh; del Pozo, Jorge

    2016-01-01

    ABSTRACT Tilapia are an important group of farmed fish that serve as a significant protein source worldwide. In recent years, substantial mortality of wild tilapia has been observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We have identified the etiological agent of these mass die-offs as a novel orthomyxo-like virus and named it tilapia lake virus (TiLV). Here, we provide the conditions for efficient isolation, culturing, and quantification of the virus, including the use of susceptible fish cell lines. Moreover, we describe a sensitive nested reverse transcription-PCR (RT-PCR) assay allowing the rapid detection of TiLV in fish organs. This assay revealed, for the first time to our knowledge, the presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this emerging pathogen and stressing the risk that TiLV poses for the global tilapia industry. Overall, the described procedures should provide the tilapia aquaculture industry with important tools for the detection and containment of this pathogen. PMID:27974544

  20. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  1. Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

    Science.gov (United States)

    Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

    2001-06-01

    A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

  2. Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

    Science.gov (United States)

    2013-01-01

    Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

  3. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  4. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  5. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  6. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Science.gov (United States)

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  7. Detection of Candida species by nested PCR method in one-humped camels (Camelus dromedarius).

    Science.gov (United States)

    Parin, Ugur; Erbas, Goksel; Kirkan, Sukru; Savasan, Serap; Tugba Yuksel, H; Balat, Gamze

    2018-02-01

    Systemic fungal diseases are the infections caused by false treatment protocols and generally are not taken into consideration especially in the veterinary field. One-humped camels are found in the western side of the Aegean region of our country and bred for wrestling. The aim of this study is the application of diagnosing systemic fungi infection from camel blood samples by the PCR method. In this study, specific primers for DNA topoisomerase II gene sequences were used. As a result, a systemic fungal infection was detected by the nested PCR method from 10 (20%) out of 50 DNA samples taken from camels located on the western side of the Aegean region. In this study, 3 (30%) samples were identified as Candida albicans, 3 (30%) samples were identified as C. glabrata, and 4 (40%) samples were identified as C. parapsilosis. In conclusion, the 20% positive systemic fungal infection rate in one-humped camels observed in the present study showed that the systemic fungal infections are not taken into considerations in veterinary medicine. Further studies are suggested in order to obtain and to maintain extensive data for systemic fungal diseases in our country for one-humped camels.

  8. Detecting the presence of infectious hepatitis A virus in molluscs positive to RT-nested-PCR

    NARCIS (Netherlands)

    Medici, de D.; Croci, L.; Pasquale, di S.; Fiore, A.; Toti, L.

    2001-01-01

    Aims: The objective of this study was to det. the presence of infectious hepatitis A virus (HAV) in molluscs naturally contaminated with viral HAV-RNA. Methods and Results: One hundred and forty-two mollusc samples were analyzed for the presence of viral HAV-RNA using RT-nested-PCR; pos. samples

  9. Development of a novel single tube nested PCR for enhanced detection of cytomegalovirus DNA from dried blood spots.

    Science.gov (United States)

    Atkinson, C; Emery, V C; Griffiths, P D

    2014-02-01

    Newborn screening for congenital cytomegalovirus (CCMV) using dried blood spots (DBS) has been proposed because many developed countries have DBS screening programmes in place for other diseases. The aim of this study was to develop a rapid, single tube nested polymerase chain reaction (PCR) method for enhanced detection of CMV from DBS compared to existing (single target) real time PCRs. The new method was compared with existing real time PCRs for sensitivity and specificity. Overall sensitivity of the single target PCR assays in both asymptomatic and symptomatic infants with laboratory confirmed congenital CMV was 69% (CMV PCR or culture positive before day 21 of life). In contrast, the single tube nested assay had an increased sensitivity of 81% with100% specificity. Overall the assay detected CMV from a DBS equivalent to an original blood sample which contained 500IU/ml. In conclusion this single tube nested methodology allows simultaneous amplification and detection of CMV DNA in 1.5h removing the associated contamination risk of a two step nested PCR. Owing to its increased sensitivity, it has the potential to be used as a screening assay and ultimately allow early identification and intervention for children with congenital CMV. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  11. Detection of Histoplasma capsulatum from clinical specimens by cycling probe-based real-time PCR and nested real-time PCR.

    Science.gov (United States)

    Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko

    2016-05-01

    We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  13. Detection of Toxoplasma gondii oocysts in soils in northwestern China using a new semi-nested PCR assay.

    Science.gov (United States)

    Wang, Meng; Meng, Peng; Ye, Qiang; Pu, Yuan-Hua; Yang, Xiao-Yu; Luo, Jian-Xun; Zhang, Nian-Zhang; Zhang, De-Lin

    2014-09-28

    Toxoplasma gondii is a zoonotic pathogen that can infect a range of animals and humans. Ingestion of T. gondii oocysts in soil is a significant transmission route for humans and animals acquiring toxoplasmosis. In the present study, we developed a new semi-nested PCR method to determine T. gondii oocysts distribution in soils in northwestern China. The one tube semi-nested PCR assay was developed to detect the oocysts of T. gondii in soil, targeting the repetitive 529 bp fragment of T. gondii genomic DNA. Then a total of 268 soil samples, including 148 samples from Gansu Province and 120 samples from Qinghai Province, northwestern China, were examined by the semi-nested PCR method. One third of the positive samples were sequenced. The sensitivity of the semi-nested PCR assay was 10(2)  T. gondii oocysts in 5 g soil sample. Investigation of soil samples from northwestern China showed that 34 out of 268 soil samples (12.69%) were T. gondii positive. Sequences of the partial 529 bp fragments varied from 0-1.2% among the sequenced samples. The prevalence of T. gondii oocysts in soil from cities (24/163) was slightly higher than that in soils from pasturing areas (10/105) (P = 0.21). Among the different regions in cities, the prevalence of T. gondii oocysts in soils from parks was 14.15%, whereas that in soils from schools was 19.05%. The present study firstly reported the prevalence of T. gondii oocysts in soils in northwest China using a novel semi-nested PCR assay, which provided baseline data for the effective prevention and control of toxoplasmosis in this region.

  14. Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Rudnick Stephen

    2003-01-01

    Full Text Available Abstract Background Rhinovirus, the most common cause of upper respiratory tract infections, has been implicated in asthma exacerbations and possibly asthma deaths. Although the method of transmission of rhinoviruses is disputed, several studies have demonstrated that aerosol transmission is a likely method of transmission among adults. As a first step in studies of possible airborne rhinovirus transmission, we developed methods to detect aerosolized rhinovirus by extending existing technology for detecting infectious agents in nasal specimens. Methods We aerosolized rhinovirus in a small aerosol chamber. Experiments were conducted with decreasing concentrations of rhinovirus. To determine the effect of UV irradiation on detection of rhinoviral aerosols, we also conducted experiments in which we exposed aerosols to a UV dose of 684 mJ/m2. Aerosols were collected on Teflon filters and rhinovirus recovered in Qiagen AVL buffer using the Qiagen QIAamp Viral RNA Kit (Qiagen Corp., Valencia, California followed by semi-nested RT-PCR and detection by gel electrophoresis. Results We obtained positive results from filter samples that had collected at least 1.3 TCID50 of aerosolized rhinovirus. Ultraviolet irradiation of airborne virus at doses much greater than those used in upper-room UV germicidal irradiation applications did not inhibit subsequent detection with the RT-PCR assay. Conclusion The air sampling and extraction methodology developed in this study should be applicable to the detection of rhinovirus and other airborne viruses in the indoor air of offices and schools. This method, however, cannot distinguish UV inactivated virus from infectious viral particles.

  15. Detection and Quantification of the Entomopathogenic Fungal Endophyte Beauveria bassiana in Plants by Nested and Quantitative PCR.

    Science.gov (United States)

    Garrido-Jurado, Inmaculada; Landa, Blanca B; Quesada-Moraga, Enrique

    2016-01-01

    The described protocol allows detecting as low as 10 fg the entomopathogenic fungal endophyte Beauveria bassiana in host plants by using a two-step nested PCR with the ITS1F/ITS4 and BB.fw and BB.rv primer pairs. On the other hand, a qPCR protocol using BB.fw and BB.rv primers is also available allowing the quantification of up to 26 fg of B. bassiana DNA per 20 ng of leaf DNA.

  16. Detection of Mycoplasma hyopneumoniae by ELISA and nested PCR from blood samples and nasal swabs from pigs in Slovakia

    Directory of Open Access Journals (Sweden)

    Marián Prokeš

    2012-01-01

    Full Text Available The aim of our study was to map the situation of swine mycoplasmoses on four farms in the region of Eastern Slovakia. The primary agent of Enzootic pneumonia of swine is Mycoplasma hyopneumoniae. After reviewing the health status of conventional herds and evaluation of clinical symptoms, paired samples of nasal swabs and venous blood samples were collected from 38 pigs with clinical signs of respiratory disease. Nasal swab samples were tested by nested PCR, while blood samples were used to detect antibodies against M. hyopneumoniae by blocking ELISA. The presence of M. hyopneumoniae was confirmed by nested PCR in four pigs (10.5% and by blocking ELISA in 16 pigs (42.1% of all four farms. This work presents for the first time comparison of different methods to diagnose M. hyopneumoniae infection on pig farms in Eastern Slovakia.

  17. Efficiency of Nested-PCR in Detecting Asymptomatic Cases toward Malaria Elimination Program in an Endemic Area of Iran.

    Directory of Open Access Journals (Sweden)

    Habibollah Turki

    2015-03-01

    Full Text Available The aim of this study was to detect low parasite and asymptomatic malaria infections by means of three malaria diagnostic tests, in a low transmission region of Minab district, Hormozgan Province, southern Iran.Blood samples of 200 healthy volunteers from Bagh-e-Malek area were evaluated using microscopic, rapid diagnostic tests (RDT and nested-PCR to inspect malaria parasite.The results showed no Plasmodium parasite in subjects by means of microscopy and RDT. However, 3 P. vivax positive samples (1.5% were discovered by Nested-PCR while microscopy and RDT missed the cases.Microscopy as the gold standard method and RDT correctly identified 98.5% of cases, and molecular analysis is sensitive and reliable, especially in the detection of "asymptomatic" infections for active case surveillance. Regarding the existence of asymptomatic malaria in endemic area of Hormozgan, Iran, nested-PCR could be considered as a sensitive tool to interrupt malaria transmission in the country, beside the microscopic and RDT methods.

  18. Efficiency of Nested-PCR in Detecting Asymptomatic Cases toward Malaria Elimination Program in an Endemic Area of Iran.

    Science.gov (United States)

    Turki, Habibollah; Raeisi, Ahmad; Malekzadeh, Kianoosh; Ghanbarnejad, Amin; Zoghi, Samaneh; Yeryan, Masoud; Abedi Nejad, Masoumeh; Mohseni, Fatemeh; Shekari, Mohammad

    2015-01-01

    The aim of this study was to detect low parasite and asymptomatic malaria infections by means of three malaria diagnostic tests, in a low transmission region of Minab district, Hormozgan Province, southern Iran. Blood samples of 200 healthy volunteers from Bagh-e-Malek area were evaluated using microscopic, rapid diagnostic tests (RDT) and nested-PCR to inspect malaria parasite. The results showed no Plasmodium parasite in subjects by means of microscopy and RDT. However, 3 P. vivax positive samples (1.5%) were discovered by Nested-PCR while microscopy and RDT missed the cases. Microscopy as the gold standard method and RDT correctly identified 98.5% of cases, and molecular analysis is sensitive and reliable, especially in the detection of "asymptomatic" infections for active case surveillance. Regarding the existence of asymptomatic malaria in endemic area of Hormozgan, Iran, nested-PCR could be considered as a sensitive tool to interrupt malaria transmission in the country, beside the microscopic and RDT methods.

  19. Nested PCR detection of Plasmodium malariae from microscopy confirmed P. falciparum samples in endemic area of NE India.

    Science.gov (United States)

    Dhiman, Sunil; Goswami, Diganta; Kumar, Dinesh; Rabha, Bipul; Sharma, Dhirendra Kumar; Bhola, Rakesh Kumar; Baruah, Indra; Veer, Vijay

    2013-11-01

    The present study evaluates the performance of OptiMAL-IT test and nested PCR assay in detection of malaria parasites. A total of 76 randomly selected blood samples collected from two malaria endemic areas were tested for malaria parasites using microscopy and OptiMAL-IT test in the field. PCR assays were performed in the laboratory using DNA extracted from blood spots of the same samples collected on the FTA classic cards. Of the total of 61 field confirmed malaria positive samples, only 58 (95%) were detected positive using microscopy in the laboratory. Sensitivity, specificity, positive predictive value, negative predictive value and false discovery rate of OptiMal-IT in comparison to the microscopy were 93%, 83%, 95%, 79% and 5%, respectively. On the other hand, the sensitivity and specificity of PCR assay were 97% and 100%, respectively, whereas positive predictive value, negative predictive value and false discovery rate were 100%, 90% and 0%, respectively. The overall performance of OptiMal-IT and PCR assays for malaria diagnosis was 76% and 97%, respectively. PCR assay enabled the identification of infection with Plasmodium malariae Laveran, 1881 in four samples misidentified by microscopy and Plasmodium-specific antigen (PAN) identified by the OptiMAL-IT test. In addition to the standard methods, such PCR assay could be useful to obtain the real incidence of each malaria parasite species for epidemiological perspectives.

  20. Molecular detection of Toxoplasma gondii in water samples from Scotland and a comparison between the 529bp real-time PCR and ITS1 nested PCR.

    Science.gov (United States)

    Wells, Beth; Shaw, Hannah; Innocent, Giles; Guido, Stefano; Hotchkiss, Emily; Parigi, Maria; Opsteegh, Marieke; Green, James; Gillespie, Simon; Innes, Elisabeth A; Katzer, Frank

    2015-12-15

    Waterborne transmission of Toxoplasma gondii is a potential public health risk and there are currently no agreed optimised methods for the recovery, processing and detection of T. gondii oocysts in water samples. In this study modified methods of T. gondii oocyst recovery and DNA extraction were applied to 1427 samples collected from 147 public water supplies throughout Scotland. T. gondii DNA was detected, using real time PCR (qPCR) targeting the 529bp repeat element, in 8.79% of interpretable samples (124 out of 1411 samples). The samples which were positive for T. gondii DNA originated from a third of the sampled water sources. The samples which were positive by qPCR and some of the negative samples were reanalysed using ITS1 nested PCR (nPCR) and results compared. The 529bp qPCR was the more sensitive technique and a full analysis of assay performance, by Bayesian analysis using a Markov Chain Monte Carlo method, was completed which demonstrated the efficacy of this method for the detection of T. gondii in water samples. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  2. Detection of Malassezia Species Isolated From Patients With Pityriasis Versicolor and Seborrheic Dermatitis Using Nested-PCR

    Directory of Open Access Journals (Sweden)

    Zarei Mahmoudabadi

    2014-12-01

    Full Text Available Background The species of the genus Malassezia are lipophilic and dimorphic yeasts that are regarded as part of the normal flora of the skin of humans and warm-blooded animals. These organisms are the cause of superficial mycosis in humans and other animals, and are common in pityriasis versicolor and seborrheic dermatitis. Objectives The purpose of this study was to determine the frequency of common Malassezia species in patients affected by pityriasis versicolor and seborrheic dermatitis using of the nested PCR method, in the city of Ahvaz. Patients and Methods In the present study, 85 samples from patients with pityriasis versicolor and seborrheic dermatitis were analyzed by the nested-PCR method. During the first stage, the internal transcribed spacer (ITS region from the ribosomal DNA was reproduced using primers ITS4-R and ITS1F-N. During the second stage, the product of the first step was used as DNA and using three special primer pairs, including Mf-F, 5.8SR and M.gl-F, 5.8SR and M.rt-F and M.rt-R, the inner part of the first phase was detected. Results The most common isolate was Malassezia furfur (51.3% followed by M. globosa (35.2% and M. restricta (13.5%. Amongst the 30 patients with seborrheic dermatitis, in 15 cases (65.2% M. restricta, in six cases (26.1% M. globosa and in two cases (8.7% M. furfur was detected and in seven patients no isolate was detected. Conclusions The nested-PCR is a rapid and repeatable method for identification of important Malassezia species and this method is recommended for use on more patients. In addition the most common agents of pityriasis versicolor and seborrheic dermatitis were M. furfur and M. restricta, respectively.

  3. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  4. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes.

    Science.gov (United States)

    Mousavi, Mohammad; Saravani, Ramin; Jafari Modrek, Mohammad; Shahrakipour, Mahnaz; Sekandarpour, Sina

    2016-02-01

    Toxoplasma gondii is an obligate intracellular protozoan parasite that exists worldwide. Various techniques have been developed for T. gondii detection. The aim of this study was the detection of T. gondii in diabetic patients with RE and B1 genes and the comparison of these two genes for diagnosis using the nested-PCR assay method. DNA samples from 205 diabetic patients who had been referred to the diabetes center of Ali Asghar hospital in Zahedan, Iran, were collected and analyzed using the nested-PCR assay method. Toxoplasma antibody data gathered using the enzyme-linked immunosorbent assay (ELISA) method from a previous study was used to group patients. The data were analyzed using SPSS 18. The chi-square test was used for comparison. Of the diabetic patients selected, the following results were obtained: 53 (IgG+, IgM+); 20 (IgG-, IgM+); 72 (IgG+, IgM-); and 60 (IgG-, IgM-). The nested-PCR detected the following: in the acute group, 21/53 (39.63%), 30/53 (56.60%) (IgM+, IgG+); in the chronic group, 40/72 (55.56%), 51/72 (70.83%), (IgG+, IgM-); in the false positive group, 18/20 (90%), 17/20 (85%) (IgM+, IgG-); and sero-negative samples of 38/60 (63.33%) and 60/ 41 (77.35%) for RE and B1 genes, respectively. The prevalence of toxoplasmosis showed positive in patients with diabetes in the B1 gene 139 (67.8%) and RE gene 117 (57.1%). Our study demonstrated that the B1 gene, more so than the RE gene, showed positive samples and can be used to detect toxoplasmosis, although the B1 gene, in comparison to the RE gene, did not show any superiority of molecular diagnosing capability. Results also showed that toxoplasma molecular detection methods can be used instead of routine serological detection methods in a clinical laboratory testing.

  6. Comparison between single PCR and nested PCR in detection of human papilloma viruses in paraffin-embedded OSCC and fresh oral mucosa.

    Science.gov (United States)

    Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars

    2015-01-01

    Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (pnested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  7. Use of nested PCR to detect Ceratocystis fagacearum in sapwood of diseased northern oak species

    Science.gov (United States)

    Early and accurate diagnosis of oak wilt, caused by Ceratocystis fagacearum (Cf), is important when disease control action is planned. When laboratory diagnosis is needed, standard isolation protocols that are used rely on high quality samples and require > 14 days for incubation. Use of a nested P...

  8. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Detection of Mycoplasma hyopneumoniae in lungs and nasal swabs of pigs by nested PCR Detecção de Mycoplasma hyopneumoniae em pulmões e suabes nasais de suínos por nested PCR

    Directory of Open Access Journals (Sweden)

    F.M.F. Silva

    2009-02-01

    Full Text Available Fifty-four samples were collected from growing and finishing pigs for the molecular diagnosis of enzootic porcine pneumonia. Nineteen lung fragments were obtained from pigs that showed signs of respiratory disease and 35 nasal swabs were obtained from clinically healthy pigs. For the detection of the bacterial genome in the samples, the nested PCR technique was used to amplify a fragment of 706bp. This fragment was subsequently cloned and sequenced. The sequence of obtained nucleotides was compared with six other sequences of Mycoplasma hyopneumoniae and 11 sequences of other bacteria available in the Genbank. To measure the sensitivity of the nested PCR, serial dilutions (10-1 to 10-15 of cloned fragments were conducted based on the concentration of 300ng. Ten lung fragments and eight nasal swabs showed positive for M. hyopneumoniae and the limit of detection was estimated to be 0.3fg DNA cloned. The sequence of nucleotides obtained showed 99.1% homology with the other sequences of M. hyopneumoniae, demonstrating that the nested PCR used in this study may provide an important diagnostic tool for the detection of this agent.Foram coletadas 54 amostras de animais em fase de crescimento e terminação para o diagnóstico molecular da pneumonia enzoótica suína. Dezenove fragmentos de pulmão foram obtidos de suínos que apresentavam sinais de doença respiratória e 35 suabes nasais foram obtidas de suínos clinicamente saudáveis. Para a detecção do genoma bacteriano nas amostras, foi utilizada a técnica de nested PCR que originou um fragmento de 706pb, o qual foi, posteriormente, clonado e sequenciado. A sequência de nucleotídeos obtida foi comparada com outras seis sequências de Mycoplasma hyopneumoniae e 11 sequências de outras bactérias disponíveis no Genbank. Para medir a sensibilidade da nested PCR, foram realizadas diluições seriadas (10-1 a 10-15 do fragmento clonado, partindo da concentração de 300ng. Dez fragmentos de pulm

  10. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  11. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

  12. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

  13. Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

    Science.gov (United States)

    Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

    2016-03-01

    The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

  14. Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit

    Science.gov (United States)

    Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu

    2017-01-01

    Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107

  15. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2013-06-01

    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  16. Detection the human mitochondrial DNA 4977 bp deletion induced by 60Co γ-rays in vitro by nest-PCR

    International Nuclear Information System (INIS)

    Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie; Chen Xiaosui

    2004-01-01

    Objective: To establish a method for detecting the mitochondrial DNA 4977 bp deletion (mtDNA 4977) induced by different doses of ionizing radiation. Methods: A nest-PCR method was established with 3 primer pairs for detecting the human peripheral mtDNA 4977. The final PCR products were sequenced after purified and the sequence was BLASTed with the standard genome information of human mitochondrion. The mtDNA 4977 level induced by 0-5 Gy 60 Co γ-rays of 5 healthy individuals was analyzed with the established nest-PCR. Results: The mtDNA 4977 could be detected by the established nest-PCR method. The mtDNA 4977 was observed on samples after exposed to 1-5 Gy 60 Co γ-rays, but it was not observed before (0 Gy) exposure. Conclusion: The nest-PCR method established in this study could be used to detect the mtDNA 4977 induced by ionizing radiation. (authors)

  17. A semi-nested PCR assay for molecular detection of Paracoccidioides brasiliensis in tissue samples Semi-nested PCR para a detecção molecular de Paracoccidioides brasiliensis em amostras de tecido

    Directory of Open Access Journals (Sweden)

    Andrea Cristine Koishi

    2010-12-01

    Full Text Available INTRODUCTION: Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. METHODS: In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. RESULTS: The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. CONCLUSIONS: The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.INTRODUÇÃO: A paracoccidioidomicose é uma infecção sistêmica causada pelo Paracoccidioides brasiliensis. MÉTODOS: Neste estudo, uma semi-nested PCR foi desenvolvida para o diagnóstico da paracoccidioidomicose. Os oligonucleotídeos iniciadores ITS1 e ITS4 foram usados na primeira reação, enquanto os oligonucleotídeos iniciadores MJ03 e ITS1 foram usados na segunda reação. A semi-nested PCR foi usada para investigar biopsias de cinco pacientes com lesões orais que se assemelhavam a paracoccidioidomicose. RESULTADOS: A semi-nested PCR foi positiva para quatro amostras e negativa para a amostra de um paciente, posteriormente diagnosticado com leishmaniose. CONCLUSÕES: A semi-nested PCR descrita aqui é útil para o diagnóstico da paracoccidioidomicose.

  18. Human herpesvirus infections of the central nervous system: laboratory diagnosis based on DNA detection by nested PCR in plasma and cerebrospinal fluid samples.

    Science.gov (United States)

    Rimério, Carla Aparecida Tavares; De Oliveira, Renato Souza; de Almeida Bonatelli, Murilo Queiroz; Nucci, Anamarli; Costa, Sandra Cecília Botelho; Bonon, Sandra Helena Alves

    2015-04-01

    Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the "gold standard," and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture. © 2015 Wiley Periodicals, Inc.

  19. Survival in soil and detection of co-transformed Trichoderma harzianum by nested PCR Sobrevivência em solo e detecção de co-transformantes de Trichoderma harzianum por PCR "nested"

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Queiroz

    2004-04-01

    Full Text Available The objective of this work was to evaluate the survival of two Trichoderma harzianum co-transformants, TE 10 and TE 41, carrying genes for green fluorescent protein (egfp and for resistance to benomyl, during four weeks in a contained soil microcosm. Selective culture media were used to detect viable fungal material, whose identity was confirmed by the observation of the fluorescent phenotype by direct epifluorence microscopy. PCR using two nested primer pairs specific to the egfp gene was also used to detect the transformed fungi. Although it was not possible to reliably detect the egfp gene directly from soil extracts, an enrichment step involving selective culture of soil samples in liquid medium prior to DNA extraction enabled the consistent detection of the T. harzianum co-transformants by nested PCR for the duration of the incubation period.O objetivo deste trabalho foi avaliar a sobrevivência de dois co-transformantes de Trichoderma harzianum, TE 10 e TE 41, expressando o gene da proteína de fluorescência verde (egfp e resistência a benomil, por um período de quatro semanas em microcosmo de solo, sob condições controladas. Foi utilizado um meio seletivo para detecção de material fúngico viável, o qual foi confirmado por observação quanto ao fenótipo de fluorescência em microscópio de epifluorescência direta. O fungo transformado foi detectado por PCR "nested", utilizando-se dois pares de primers específicos para o gene egfp. Foram utilizados meios líquidos enriquecidos no cultivo de amostras de solo, permitindo uma detecção consistente de co-transformantes de T. harzianum, uma vez que não foi possível a detecção do gene egfp por PCR de amostras de DNA extraídas diretamente de solo.

  20. Nested-PCR real time as alternative molecular tool for detection of Borrelia burgdorferi compared to the classical serological diagnosis of the blood.

    Science.gov (United States)

    Sroka-Oleksiak, Agnieszka; Ufir, Krzysztof; Salamon, Dominika; Bulanda, Malgorzata; Gosiewski, Tomasz

    Lyme disease, caused by Borrelia burgdorferi, is a multisystem disease that often makes difficulties to recognize caused by their genetic heterogenity. Currently, the gold standard for the detection of Lyme disease (LD) is serologic diagnostics based mainly on tests: ELISA and Western blot (WB). These methods, however, are subject to consider- able defect, especially in the initial phase of infection due to the occurrence of so-called serological window period and low specificity. For this reason, they might be replaced by molecular methods, for example polymerase chain reaction (PCR), which should be more sensitivity and specificity. In the present study we attempt to optimize the PCR reaction conditions and enhance existing test sensitivity by applying the equivalent of real time PCR - nested PCR for detection B. burgdorferi DNA in the patient's blood. The study involved 94 blood samples of patients with suspected LD. From each sample, 1.5 ml of blood was used for the isolation of bacterial DNA and PCR real time am- plification and its equivalent, in nested version. The remaining part earmarked for serologi- cal testing. Optimization of the reaction conditions made experimentally, using gradient of the temperature and gradient of the magnesium ions concentration for reaction real time in nested-PCR and PCR version. The results show that the nested-PCR real time, has a much higher sensitivity 45 (47.8%) of positive results for the detection of B. burgdorferi compared to the single- variety, without a preceding pre-amplification 2 (2.1%). Serological methods allowed the detection of infection in 41 (43.6%) samples. These results support of the nested PCR method as a better molecular tool for the detection of B. burgdorferi infection than classical PCR real time reaction. The nested-PCR real time method may be considered as a complement to ELISA and WB mainly in the early stages of infection, when in the blood circulating B. burgdorferi cells. By contrast, the

  1. Detection and identification of Toscana and other phleboviruses by RT-nested-PCR assays with degenerated primers.

    Science.gov (United States)

    Sánchez-Seco, María-Paz; Echevarría, José-Manuel; Hernández, Lourdes; Estévez, Domingo; Navarro-Marí, José-María; Tenorio, Antonio

    2003-09-01

    Phleboviruses are a large and widespread group of viruses that are transmitted by arthropods. Toscana virus is one of the principal agents that causes meningitis in humans during the summer in Italy and, possibly, in other Mediterranean countries. Rift Valley Fever virus can cause serious illness in both animals and humans, leading to high morbidity and mortality, and is considered to be a potential agent for epizootics and human epidemics. Since information on this group of viruses is still scant, reliable laboratory tools for diagnosis and epidemiological surveillance must be developed, in order to ascertain their real impact on Public Health. Sequence data obtained from Spanish isolates of Toscana virus and other phleboviruses confirmed that natural genome variability may hamper the diagnosis of these agents by molecular methods, so this must be borne in mind when developing reliable assays. In view of the above, a novel and useful protocol has been developed for the detection and specific identification of every member of the phlebovirus genus present in a sample, including Toscana virus, based on a generic RT-nested-PCR, followed by sequencing of the amplified fragment. A change in this method also allowed specific direct detection and identification of wild isolates of Toscana virus of different geographical origin, using newly designed primers. Testing clinical samples with these assays confirmed the role of Toscana virus as an agent that causes acute aseptic meningitis in the central region of Spain. Copyright 2003 Wiley-Liss, Inc.

  2. Use of Nested and Real-Time PCR for the Detection of Ceratocystis fagacearum in the Sapwood of Diseased Oak Species in Minnesota

    Science.gov (United States)

    A. Yang; J. Juzwik

    2017-01-01

    Oak wilt caused by Ceratocystis fagacearum is a significant disease of Quercus spp. in the eastern United States. Early and accurate detection of the pathogen is particularly important when disease control is planned. Nested and real-time polymerase chain reaction (PCR) methods utilizing fungal DNA extracted from sapwood drill...

  3. Comparison of two methods for the detection of hepatitis A virus in clam samples (Tapes spp.) by reverse transcription-nested PCR.

    Science.gov (United States)

    Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen

    2004-03-01

    The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.

  4. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  5. In vitro culture, PCR , and nested PCR for the detection of Theileria equi in horses submitted to exercise Cultivo in vitro, PCR e nested PCR na detecção de Theileria equi em eqüinos submetidos a exercícios

    Directory of Open Access Journals (Sweden)

    C.D. Baldani

    2008-06-01

    Full Text Available This study compared the usefulness of in vitro culture, PCR, and nested PCR for the diagnosis of Theileria equi in horses submitted to stress during exercise. Blood samples from 15 apparently healthy horses, previously conditioned to a high-speed equine treadmill, were taken prior to and after exercise. The animals were divided into two experimental groups: 30-day training schedule (G1 and 90-day training schedule (G2. Statistical analysis was performed using a chi-square test and kappa statistic was used in order to assess agreement. No significant difference was observed between samples collected at resting or after exercise. In G1, merozoites of T. equi were detected in the blood smears of four horses before in vitro culture, whereas 14 samples were positive, confirmed by culture. In G2, five and 11 horses were positive before and after culture, respectively. No PCR amplified product was observed in any of the tested animals although the PCR system based on the 16S rRNA gene of T. equi detected DNA in blood with an equivalent 8x10-5% parasitaemia. The nested PCR based on the T. equi merozoite antigen gene (EMA-1 allowed the visualization of amplified products in all the horses. Therefore, nested PCR should be considered as a means of detection of sub-clinical T. equi infections and in vitro culture could be used as a complement to other methods of diagnosis.Comparou-se a utilização do cultivo in vitro, PCR e nested PCR no diagnóstico de Theileria equi em eqüinos submetidos ao estresse induzido por exercícios. Amostras de sangue foram obtidas de 15 eqüinos submetidos a treinamento em esteira rolante de alto desempenho, sendo as amostras colhidas antes e após os exercícios. Os animais foram divididos em dois grupos experimentais: 30 dias de treinamento (G1 e 90 dias de treinamento (G2. O teste do qui-quadrado foi empregado para as análises estatísticas e o índice kappa utilizado para avaliar a concordância. Não houve diferen

  6. Clinical application of RT-nested PCR integrated with RFLP in Hantavirus detection and genotyping: a prospective study in Shandong Province, PR China.

    Science.gov (United States)

    Liu, Yun-Xi; Zhao, Zhong-Tang; Cao, Wu-Chun; Xu, Xiao-Qun; Suo, Ji-Jiang; Xing, Yu-Bin; Jia, Ning; Du, Ming-Mei; Liu, Bo-Wei; Yao, Yuan

    2013-01-01

    The aim of the present study was to evaluate the clinical usefulness of applying RT-nested PCR along with RFLP as a method for diagnosis and genotypic differentiation of Hantavirus in the acute-stage sera of HFRS patients as compared to the ELISA technique. A prospective study of patients with suspected HFRS patients was carried out. Sera were collected for serological evaluation by ELISA and RT-nested PCR testing. Primers were selected from the published sequence of the S segment of HTNV strain 76-118 and SEOV strain SR-11, which made it possible to obtain an amplicon of 403 bp by RT-nested PCR. The genotypic differentiations of the RT-nested PCR amplicons were carried out by RFLP. Sequence analyses of the amplicons were used to confirm the accuracy of the results obtained by RFLP. Of the 48 acute-stage sera from suspected HFRS patients, 35 were ELISA-positive while 41 were positive by RT-nested PCR. With Hind III and Hinf I, RFLP profiles of the RT-nested PCR amplicons of the 41 positive sera exhibited two patterns. 33 had RFLP profiles similar to the reference strain R22, and thus belonged to the SEOV type. The other 8 samples which were collected during October-December had RFLP profiles similar to the reference strain 76-118, and thus belonged to the HTNV type. Sequence phylogenetic analysis of RT-nested PCR amplicons revealed sdp1, sdp2 YXL-2008, and sdp3 as close relatives of HTNV strain 76-118, while sdp22 and sdp37 as close relatives of SEOV strain Z37 and strain R22 located in two separate clusters in the phylogenetic tree. These results were identical to those acquired by RFLP. RT-nested PCR integrated with RFLP was a rapid, simple, accurate method for detecting and differentiating the genotypes of Hantavirus in the acute-stage sera of suspected HFRS patients. In Shandong province, the main genotypes of Hantavirus belonged to the SEOV types, while the HTNV types were observed during the autumn-winter season.

  7. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  8. A nested-PCR with an Internal Amplification Control for the detection and differentiation of Bartonella henselae and B. clarridgeiae: An examination of cats in Trinidad

    Directory of Open Access Journals (Sweden)

    Ramsubeik Shalini

    2005-08-01

    Full Text Available Abstract Background Bartonella species are bacterial blood parasites of animals capable of causing disease in both animals and man. Cat-Scratch Disease (CSD in humans is caused mainly by Bartonella henselae and is acquired from the cat, which serves as a reservoir for the bacteria. A second species, B. clarridgeiae is also implicated in the disease. Diagnosis of Bartonellosis by culture requires a week or more of incubation on enriched media containing blood, and recovery is often complicated by faster growing contaminating bacteria and fungi. PCR has been explored as an alternative to culture for both the detection and species identification of Bartonella, however sensitivity problems have been reported and false negative reactions due to blood inhibitors have not generally been addressed in test design. Methods A novel, nested-PCR was designed for the detection of Bartonella henselae and B. clarridgeiae based on the strategy of targeting species-specific size differences in the 16S-23S rDNA intergenic regions. An Internal Amplification Control was used for detecting PCR inhibition. The nested-PCR was utilized in a study on 103 blood samples from pet and stray cats in Trinidad. Results None of the samples were positive by primary PCR, but the Nested-PCR detected Bartonella in 32/103 (31% cats where 16 were infected with only B. henselae, 13 with only B. clarridgeiae and 3 with both species. Of 22 stray cats housed at an animal shelter, 13 (59% were positive for either or both species, supporting the reported increased incidence of Bartonella among feral cats. Conclusion The usefulness of a single PCR for the detection of Bartonella henselae and B. clarridgeiae in the blood of cats is questionable. A nested-PCR offers increased sensitivity over a primary PCR and should be evaluated with currently used methods for the routine detection and speciation of Bartonella henselae and B. clarridgeiae. In Trinidad, B. henselae and B. clarridgeiae are the

  9. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. The efficacy of a nested PCR in detecting cytochrome c oxidase subunit 1 gene of Sarcoptes scabiei var. Hominis for diagnosing scabies.

    Science.gov (United States)

    Hahm, J E; Kim, C W; Kim, S S

    2018-04-06

    A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. A semi-nested real-time PCR method to detect low chimerism percentage in small quantity of hematopoietic stem cell transplant DNA samples.

    Science.gov (United States)

    Aloisio, Michelangelo; Bortot, Barbara; Gandin, Ilaria; Severini, Giovanni Maria; Athanasakis, Emmanouil

    2017-02-01

    Chimerism status evaluation of post-allogeneic hematopoietic stem cell transplantation samples is essential to predict post-transplant relapse. The most commonly used technique capable of detecting small increments of chimerism is quantitative real-time PCR. Although this method is already used in several laboratories, previously described protocols often lack sensitivity and the amount of the DNA required for each chimerism analysis is too high. In the present study, we compared a novel semi-nested allele-specific real-time PCR (sNAS-qPCR) protocol with our in-house standard allele-specific real-time PCR (gAS-qPCR) protocol. We selected two genetic markers and analyzed technical parameters (slope, y-intercept, R2, and standard deviation) useful to determine the performances of the two protocols. The sNAS-qPCR protocol showed better sensitivity and precision. Moreover, the sNAS-qPCR protocol requires, as input, only 10 ng of DNA, which is at least 10-fold less than the gAS-qPCR protocols described in the literature. Finally, the proposed sNAS-qPCR protocol could prove very useful for performing chimerism analysis with a small amount of DNA, as in the case of blood cell subsets.

  12. Sensitivity of nested-PCR for plasmodium detection in pooled whole blood samples and its usefulness to blood donor screening in endemic areas.

    Science.gov (United States)

    de Freitas, Daniel Roberto Coradi; Gomes, Luciano Teixeira; Fontes, Cor Jesus F; Tauil, Pedro Luiz; Pang, Lorrin W; Duarte, Elisabeth Carmen

    2014-04-01

    Transfusion-transmitted malaria is a severe disease with high fatality rate. Most Brazilian blood banks in the Amazon region perform malaria screening using microscopic examination (thick smears). Since low parasite concentrations are expected in asymptomatic blood donors a high sensitivity test should be used for donor screening. This study determined the sensitivity of a nested-PCR for plasmodium detection in pooled samples. We performed a one-stage criterion validation study with 21 positive samples pooled with samples from ten negative volunteer until three different concentrations were reached (0.33; 0.25; 0.20 parasites/μL - p/μL). Nested PCR was performed as described by Snounou et al. (1993). Sensitivities (and confidence intervals) were determined by stratum of final parasite concentration on the pooled samples. All samples with parasitemia values of 0.33 and 0.25 p/μL had 100% sensitivity (95%CI=86.3-100). One negative result was obtained from a sample with 0.20 p/μL sensitivity=95.2% (95%CI=76.2-99.9). Compared to parasitemia detectable under ideal conditions of thick smear, this nested-PCR in pooled sample was able to detect 40 times more parasites per microliter. Nested-PCR in pooled samples should be considered as a high sensitive alternative to thick smear for donor screening in blood banks at endemic regions. Local authorities need to assess cost:benefit advantages of this method compared to alternatives. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Paula Rogério Fernandes

    2008-09-01

    rDNA (ITS1 and ITS2. A pair of primers was constructed for the genus-specific amplification of a 648 bp fragment and two others to amplify T. foetus species-specific fragments of 343 and 429 bp. No cross amplification was observed against Bos taurus genomic DNA neither against the DNA of usual bovine genital pathogens. Both, single and nested-PCR assays, presented analytical sensitivity to detect at least two T. foetus organisms.

  14. Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

    Science.gov (United States)

    Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

    2017-10-01

    Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

  15. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  16. [Detection of human parvovirus B19, human bocavirus and human parvovirus 4 infections in blood samples among 95 patients with liver disease in Nanjing by nested PCR].

    Science.gov (United States)

    Tong, Rui; Zhou, Wei-Min; Liu, Xi-Jun; Wang, Yue; Lou, Yong-Liang; Tan, Wen-Jie

    2013-04-01

    To analyze the infection of human parvovirus B19, human bocavirus (HBoV) and human parvovirus 4 (PARV4) in blood samples among patients with liver disease in Nanjing by molecular detection. Nested PCR assays were designed and validated to detect B19, HBoV and PARV4, respectively. The assays were used to screen three parvoviruses in blood samples from 95 patients with different liver disease in Nanjing. The parvovirus infection was analyzed statistically. The detection limits were 10 copies of genomic DNA equivalents per reaction for each assays and the good specificity were observed. The frequency of B19 and HBoV were 2/95 (2.1%) and 9/95 (9.5%) in blood samples respectively. No PARV4 was detected. HBoV was detected in 3/5 patients with drug-induced hepatitis. Both B19 and HBoV infection were detected in blood from patients with liver disease.

  17. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

  18. Comparison of loop-mediated isothermal amplification (LAMP) and nested-PCR assay targeting the RE and B1 gene for detection of Toxoplasma gondii in blood samples of children with leukaemia.

    Science.gov (United States)

    Fallahi, Shirzad; Seyyed Tabaei, Seyyed Javad; Pournia, Yadollah; Zebardast, Nozhat; Kazemi, Bahram

    2014-07-01

    Toxoplasmosis diagnosis constitutes an important measure for disease prevention and control. In this paper, a newly described DNA amplification technique, loop-mediated isothermal amplification (LAMP), and nested-PCR targeting the repeated element (RE) and B1 gene, were compared to each other for the detection of Toxoplasma gondii DNA in blood samples of children with leukaemia. One hundred ten blood samples from these patients were analyzed by LAMP and nested-PCR. Out of 50 seropositive samples (IgM+, IgG+), positive results were obtained with 92% and 86% on RE, B1-LAMP and 82% and 68% on RE, B1-nested PCR analyses, respectively. Of the 50 seronegative samples, three, two and one samples were detected positive by RE-LAMP, B1-LAMP and RE-nested PCR assays, respectively, while none were detected positive by B1-nested PCR. None of the 10 IgM-, IgG+ samples was detected positive after testing LAMP and nested-PCR assays in duplicate. This is the first report of a study in which the LAMP method was applied with high sensitivity and efficacy for the diagnosis of T. gonii in blood samples of children with leukaemia. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    Science.gov (United States)

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  20. Differential Detection of Echinococcus Spp. Copro-DNA by Nested-PCR in Domestic and Wild Definitive Hosts in Moghan Plain, Iran

    Directory of Open Access Journals (Sweden)

    I Mobedi

    2013-03-01

    Full Text Available Background: Despite Echinococcus granulosus, there are merely two old reports of E. multilocularis infection among Iranian canids of Moghan Plain, the only area known endemic for the species. We detected specific DNA markers in fecal samples by PCR (Copro-PCR for differential diagnosis of Echinococcus species in living canids.Methods: Totally 144 fecal samples from domestic dogs, red foxes and a golden jackal were examined for genus-specific Echinococcus coproantigens using ELISA. Forty two positive or ambiguous samples were further examined for Echinococcus species-specific DNA markers by two different set of nested-PCR.Results: Twenty five out of 144 (17.4% animals were contaminated with E. granulosus including 14 (23.7% domestic dogs, 10 (11.9% red foxes and one (100% golden jackal. But none of them harboured E. multilocularis species-specific Copro-DNA. The overall prevalence of E. granulosus and E. multilocularis infections in canids of the area was estimated to be 17.4% and 0.0%, respectively. There was a significant relation between the results of Copro-PCR and CA-ELISA.Conclusion: The lack of E. multilocularis infection, compared to previous reports may be due to the differences in used diagnostic methods and/or recently limited territories of wild canids and altered their food resources in this particular area.

  1. Differential Detection of Echinococcus Spp. Copro-DNA by Nested-PCR in Domestic and Wild Definitive Hosts in Moghan Plain, Iran.

    Science.gov (United States)

    Mobedi, I; Zare-Bidaki, M; Siavashi, Mr; Naddaf, Sr; Kia, Eb; Mahmoudi, M

    2013-01-01

    Despite Echinococcus granulosus, there are merely two old reports of E. multilocularis infection among Iranian canids of Moghan Plain, the only area known endemic for the species. We detected specific DNA markers in fecal samples by PCR (Copro-PCR) for differential diagnosis of Echinococcus species in living canids. Totally 144 fecal samples from domestic dogs, red foxes and a golden jackal were examined for genus-specific Echinococcus coproantigens using ELISA. Forty two positive or ambiguous samples were further examined for Echinococcus species-specific DNA markers by two different set of nested-PCR. Twenty five out of 144 (17.4%) animals were contaminated with E. granulosus including 14 (23.7%) domestic dogs, 10 (11.9%) red foxes and one (100%) golden jackal. But none of them harboured E. multilocularis species-specific Copro-DNA. The overall prevalence of E. granulosus and E. multilocularis infections in canids of the area was estimated to be 17.4% and 0.0%, respectively. There was a significant relation between the results of Copro-PCR and CA-ELISA. The lack of E. multilocularis infection, compared to previous reports may be due to the differences in used diagnostic methods and/or recently limited territories of wild canids and altered their food resources in this particular area.

  2. Human herpesvirus 8 (HHV-8 detected by nested polymerase chain reaction (PCR in HIV patients with or without Kaposi's sarcoma. An analytic cross-sectional study

    Directory of Open Access Journals (Sweden)

    Paula Renata Lima Machado

    Full Text Available CONTEXT AND OBJECTIVE: Kaposi's sarcoma (KS is a common neoplastic disease in AIDS patients. The aim of this study was to evaluate the frequency of human herpesvirus 8 (HHV-8 infection in human immunodeficiency virus (HIV-infected patients, with or without KS manifestations and correlate HHV-8 detection with KS staging. DESIGN AND SETTING: Analytic cross-sectional study conducted in a public tertiary-level university hospital in Ribeirão Preto, São Paulo, Brazil. METHODS: Antibodies against HHV-8 lytic-phase antigens were detected by means of the immunofluorescence assay. HHV-8 DNA was detected in the patient samples through a nested polymerase chain reaction (nested PCR that amplified a region of open reading frame (ORF-26 of HHV-8. RESULTS: Anti-HHV-8 antibodies were detected in 30% of non-KS patients and 100% of patients with KS. Furthermore, the HHV-8 DNA detection rates observed in HIV-positive patients with KS were 42.8% in serum, 95.4% in blood samples and 100% in skin biopsies; and in patients without KS, the detection rate was 4% in serum. Out of the 16 serum samples from patients with KS-AIDS who were classified as stage II, two were positive (12.5%; and out of the 33 samples from patients in stage IV, 19 (57.6% were positive. CONCLUSION: We observed an association between HHV-8 detection and disease staging, which was higher in the serum of patients in stage IV. This suggests that detection of HHV-8 DNA in serum could be very useful for clinical assessment of patients with KS and for monitoring disease progression.

  3. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  4. Nested PCR detection and phylogenetic analysis of Babesia bovis and Babesia bigemina in cattle from Peri-urban localities in Gauteng Province, South Africa.

    Science.gov (United States)

    Mtshali, Phillip Senzo; Tsotetsi, Ana Mbokeleng; Thekisoe, Matlhahane Molifi Oriel; Mtshali, Moses Sibusiso

    2014-01-01

    Babesia bovis and Babesia bigemina are tick-borne hemoparasites causing babesiosis in cattle worldwide. This study was aimed at providing information about the occurrence and geographical distribution of B. bovis and B. bigemina species in cattle from Gauteng province, South Africa. A total of 268 blood samples collected from apparently healthy animals in 14 different peri-urban localities were tested using previously established nested PCR assays for the detection of B. bovis and B. bigemina species-specific genes encoding rhoptry-associated protein 1 (RAP-1) and SpeI-AvaI restriction fragment, respectively. Nested PCR assays revealed that the overall prevalence was 35.5% (95% confidence interval [CI]=± 5.73) and 76.1% (95% CI=± 5.11) for B. bovis and B. bigemina, respectively. PCR results were corroborated by sequencing amplicons of randomly selected samples. The neighbor-joining trees were constructed to study the phylogenetic relationship between B. bovis and B. bigemina sequences of randomly selected isolates. Analysis of phylogram inferred with B. bovis RAP-1 sequences indicated a close relationship between our isolates and GenBank strains. On the other hand, a tree constructed with B. bigemina gp45 sequences revealed a high degree of polymorphism among the B. bigemina isolates investigated in this study. Taken together, the results presented in this work indicate the high incidence of Babesia parasites in cattle from previously uncharacterised peri-urban areas of the Gauteng province. These findings suggest that effective preventative and control measures are essential to curtail the spread of Babesia infections among cattle populations in Gauteng.

  5. FIRST MOLECULAR DETECTION AND VP7 (G GENOTYPING OF GROUP A ROTAVIRUS BY SEMI-NESTED RT-PCR FROM SEWAGE IN NIGERIA

    Directory of Open Access Journals (Sweden)

    Babatunde Olanrewaju MOTAYO

    Full Text Available SUMMARY Rotavirus is the leading cause of viral gastroenteritis worldwide, and sewage is a major source of the virus dissemination in the environment. Our aim was to detect and genotype rotaviruses from sewages in Nigeria. One hundred and ninety sewage samples were collected between June 2014 and January 2015. The two phase concentration method using PEG 6000 and dextran was used to concentrate sewage samples following WHO protocols. Molecular detection was performed by RT-PCR, and VP7 genotyping by semi-nested multiplex PCR. A total of 14.2% (n = 27 samples tested positive. Monthly distribution showed that June to September had a lower rate (3.7% to 7.4%, while October to January recorded 11% to 26%. Genotype G1 predominated followed by G8, G9, G4 and lastly G2, 7.4% (n = 2 of isolates were nontypeable. This is the first report of rotavirus detection in sewages from Nigeria. Genotype G1 remains the most prevalent genotype. This observation calls for an effort by the governmental authorities to implement a molecular surveillance, both clinical and environmental, in order to provide vital information for the control and the vaccine efficacy not only in Nigeria, but globally.

  6. Evaluation of the efficiency of nested q-PCR in the detection of Mycobacterium tuberculosis complex directly from tuberculosis-suspected lesions in post-mortem macroscopic inspections of bovine carcasses slaughtered in the state of Mato Grosso, Brazil.

    Science.gov (United States)

    Carvalho, Ricardo César Tavares; Furlanetto, Leone Vinícius; Maruyama, Fernanda Harumy; Araújo, Cristina Pires de; Barros, Sílvia Letícia Bomfim; Ramos, Carlos Alberto do Nascimento; Dutra, Valéria; Araújo, Flábio Ribeiro de; Paschoalin, Vânia Margaret Flosi; Nakazato, Luciano; Figueiredo, Eduardo Eustáquio de Souza

    2015-08-01

    Bovine tuberculosis (BTB) is a zoonotic disease caused by Mycobacterium bovis, a member of the Mycobacterium tuberculosis complex (MTC). The quick and specific detection of this species is of extreme importance, since BTB may cause economic impacts, in addition to presenting imminent risks to human health. In the present study a nested real-time PCR test (nested q-PCR) was used in post-mortem evaluations to assess cattle carcasses with BTB-suspected lesions. A total of 41,193 cattle slaughtered in slaughterhouses located in the state of Mato Grosso, were examined. Of the examined animals, 198 (0.48%) showed BTB-suspected lesions. M. bovis was isolated in 1.5% (3/198) of the samples. Multiplex-PCR detected MTC in 7% (14/198) of the samples. The nested q-PCR test detected MTC in 28% (56/198) of the BTB-suspected lesions, demonstrating higher efficiency when compared to the multiplex-PCR and conventional microbiology. Nested q-PCR can therefore be used as a complementary test in the national program for control and eradication of bovine tuberculosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.

    Science.gov (United States)

    Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis

    2015-02-01

    Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.

  8. Nested PCR and RFLP analysis based on the 16S rRNA gene

    Science.gov (United States)

    Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

  9. Comparison of Antigen Detection and Nested PCR in CSF Samples of HIV Positive and Negative Patients with Suspected Cryptococcal Meningitis in a Tertiary Care Hospital.

    Science.gov (United States)

    Kumari, Sunita; Verma, Rajesh Kumar; Singh, Dharmendra Prasad; Yadav, Ramakant

    2016-04-01

    The cases of cryptococcal meningitis and other forms of cryptococcosis have increased in recent time and the present scenario of the condition with significant morbidity and mortality is actually posing a serious threat to the community, so an early and prompt diagnosis is necessary to prevent serious complications and thus improving the overall disease outcome. Comparison of diagnostic efficacy of nested Polymerase Chain Reaction (PCR) with Latex Agglutination Test (LAT) in the Cerebro Spinal Fluid (CSF) samples of the cases of meningitis in HIV positive and negative cases. We have compared the diagnostic efficacy of Latex Agglutination Test (LAT) with nested Polymerase Chain Reaction (PCR) in 200 Cerebrospinal Fluid (CSF) samples, including 14 HIV positive also, in the cases of suspected cryptococcal meningitis. Nested PCR was done in all cases reporting positive by LAT and results were then compared with that of India ink and culture on Sabouraud Dextrose Agar (SDA), and the isolates were further identified by urease, nitrate and sugar assimilation tests. Of the 200 cases, including 14 HIV positive, LAT was positive in 46 cases while 154 were negative. Out of these 46 LAT positive cases, nested PCR was positive in 40 cases only, while culture and India ink was positive in 38 and 33 cases respectively. Majority of the cases, 30 (65.2%) were between age group 21-50 years, while 2 (4.3%) in 0-20, and 14 (30.4%) in 51-80 years age group. Although negative staining like India ink and nigrosin are most widely used techniques, but these suffer with subjective error. Rapid method like LAT is available but it always has the scope of false positive and negative results. In such cases nested PCR can help in establishing final diagnosis.

  10. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  11. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    Directory of Open Access Journals (Sweden)

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  12. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    Science.gov (United States)

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

  13. Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

    Science.gov (United States)

    Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

    2018-03-01

    Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

  14. Development and evaluation of a nested-PCR assay for Senecavirus A diagnosis.

    Science.gov (United States)

    Feronato, Cesar; Leme, Raquel A; Diniz, Jaqueline A; Agnol, Alais Maria Dall; Alfieri, Alice F; Alfieri, Amauri A

    2018-02-01

    Senecavirus A (SVA) has been associated with vesicular disease in weaned and adult pigs and with high mortality of newborn piglets. This study aimed to establish a nested-PCR assay for the routine diagnosis of SVA infection. Tissue samples (n = 177) were collected from 37 piglets of 18 pig farms located in four different Brazilian states. For the nested-PCR, a primer set was defined to amplify an internal VP1 fragment of 316 bp of SVA genome. Of the 37 piglets, 15 (40.5%) and 23 (62.2%) were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. The SVA RNA was detected in 61/177 (34.5%) samples with the RT-PCR, while the nested-PCR assay showed 84/177 (47.5%) samples with the virus (p PCR and nested-PCR assays, respectively. Nucleotide sequencing analysis revealed similarities of 98.7-100% among SVA Brazilian strains and of 86.6-98% with SVA strains from other countries. The nested-PCR assay in this study was suitable to recover the SVA RNA in biological specimens, piglets, and/or herds that were considered as negative in the RT-PCR assay, and is proposed for the routine investigation of the SVA infection in piglets, especially when other techniques are not available or when a great number of samples has to be examined.

  15. Improved clonality detection in Hodgkin lymphoma using a semi-nested modification of the BIOMED-2 PCR assay for IGH and IGK rearrangements: A paraffin-embedded tissue study.

    Science.gov (United States)

    Han, Shusen; Masaki, Ayako; Sakamoto, Yuma; Takino, Hisashi; Murase, Takayuki; Iida, Shinsuke; Inagaki, Hiroshi

    2018-05-01

    The BIOMED-2 PCR protocols targeting IGH and IGK genes may be useful for detecting clonality in Hodgkin lymphoma (HL). The clonality detection rates, however, have not been very high with these methods using paraffin-embedded tumor sections. We previously described the usefulness of the semi-nested BIOMED-2 IGH assay in B-cell malignancies. In this study, we devised a novel semi-nested BIOMED-2 IGK assay. Employing 58 cases of classical HL, we carried out the standard BIOMED-2, BIOMED-2 followed by BIOMED-2 re-amplification, and BIOMED-2 followed by semi-nested BIOMED-2, all targeting IGH and IGK, using paraffin-embedded tissues. In both IGH and IGK assays, semi-nested assays yielded significantly higher clonality detection rates than the standard assays and re-amplification assays. Clonality was detected in 13/58 (22.4%) classical HL cases using the standard IGH/IGK assays while it was detected in 38/58 (65.5%) cases using semi-nested IGH/IGK assays. The detection rates were not associated with the HL subtypes, CD30-positive cell density, CD20-positive cell density, or Epstein-Barr virus (EBV) positivity. In conclusion, tumor clonality was detected in nearly two-thirds of classical HL cases using semi-nested BIOMED-2 IGH/IGK assays using paraffin tumor sections. These semi-nested assays may be useful when the standard IGH/IGK assays fail to detect clonality in histopathologically suspected HLs. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  16. A highly sensitive single-tube nested PCR assay for the detection of Pineapple mealybug wilt associated virus-2 (PMWaV-2)

    Science.gov (United States)

    An assay was developed for the detection of Pineapple mealybug wilt associated virus-2 (PMWaV-2), an important factor in the etiology of mealybug wilt of pineapple. The assay combines reverse transcription of RNA isolated from pineapple with a specific and very sensitive, single, closed-tube nested ...

  17. One-tube semi-nested PCR-ELISA for the detection of human cytomegalovirus DNA sequences: comparison with hybridization-based and semi-nested-based PCR-ELISA procedures

    Czech Academy of Sciences Publication Activity Database

    Smrž, Daniel; Dráber, Petr

    2003-01-01

    Roč. 283, 1-2 (2003), s. 163-172 ISSN 0022-1759 R&D Projects: GA AV ČR IBS5052201; GA AV ČR IAA5052310; GA ČR GA204/03/0594; GA ČR GA301/03/0596; GA MŠk LN00A026 Institutional research plan: CEZ:AV0Z5052915 Keywords : PCR * DNA labelin * HCMV Subject RIV: EC - Immunology Impact factor: 2.744, year: 2003

  18. Human papillomavirus detection using the Abbott RealTime high-risk HPV tests compared with conventional nested PCR coupled to high-throughput sequencing of amplification products in cervical smear specimens from a Gabonese female population.

    Science.gov (United States)

    Moussavou-Boundzanga, Pamela; Koumakpayi, Ismaël Hervé; Labouba, Ingrid; Leroy, Eric M; Belembaogo, Ernest; Berthet, Nicolas

    2017-12-21

    Cervical cancer is the fourth most common malignancy in women worldwide. However, screening with human papillomavirus (HPV) molecular tests holds promise for reducing cervical cancer incidence and mortality in low- and middle-income countries. The performance of the Abbott RealTime High-Risk HPV test (AbRT) was evaluated in 83 cervical smear specimens and compared with a conventional nested PCR coupled to high-throughput sequencing (HTS) to identify the amplicons. The AbRT assay detected at least one HPV genotype in 44.57% of women regardless of the grade of cervical abnormalities. Except for one case, good concordance was observed for the genotypes detected with the AbRT assay in the high-risk HPV category determined with HTS of the amplicon generated by conventional nested PCR. The AbRT test is an easy and reliable molecular tool and was as sensitive as conventional nested PCR in cervical smear specimens for detection HPVs associated with high-grade lesions. Moreover, sequencing amplicons using an HTS approach effectively identified the genotype of the hrHPV identified with the AbRT test.

  19. Improved clonality detection in B-cell lymphoma using a semi-nested modification of the BIOMED-2 PCR assay for IGH rearrangement: A paraffin-embedded tissue study.

    Science.gov (United States)

    Sakamoto, Yuma; Masaki, Ayako; Aoyama, Satsuki; Han, Shusen; Saida, Kosuke; Fujii, Kana; Takino, Hisashi; Murase, Takayuki; Iida, Shinsuke; Inagaki, Hiroshi

    2017-09-01

    The BIOMED-2 PCR protocol for targeting the IGH gene is widely employed for detecting clonality in B-cell malignancies. Unfortunately, the detection of clonality with this method is not very sensitive when paraffin sections are used as a DNA source. To increase the sensitivity, we devised a semi-nested modification of a JH consensus primer. The clonality detection rates of three assays were compared: the standard BIOMED-2, BIOMED-2 assay followed by BIOMED-2 re-amplification, and BIOMED-2 assay followed by semi-nested BIOMED-2. We tested more than 100 cases using paraffin-embedded tissues of various B-cell lymphomas, and found that the clonality detection rates with the above three assays were 63.9%, 79.6%, and 88.0%, respectively. While BIOMED-2 re-amplification was significantly more sensitive than the standard BIOMED-2, the semi-nested BIOMED-2 was significantly more sensitive than both the standard BIOMED-2 and BIOMED-2 re-amplification. An increase in sensitivity was observed in all lymphoma subtypes examined. In conclusion, tumor clonality may be detected in nearly 90% of B-cell lymphoma cases with semi-nested BIOMED-2. This ancillary assay may be useful when the standard BIOMED-2 fails to detect clonality in histopathologically suspected B-cell lymphomas. © 2017 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  20. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  1. [Contribution of nested PCR in the diagnosis of imported malaria in southern Algeria].

    Science.gov (United States)

    Bouiba, L; Gassen, B; Gasmi, M; Hammadi, D; Harrat, Z

    2016-12-01

    The nested PCR was used to estimate its inputs in malaria diagnosis and in the performance of the microscope operators involved in the surveillance of malaria in remote areas of South Algeria. For the period 2010 to 2015, 112 patients (93 febrile and 19 asymptomatic) coming from sub-Saharan Africa were tested for malaria in the hospital of Tamanrasset. One part of the blood taken from fingertip was used for blood smears and the second part was absorbed in filter paper for molecular diagnosis. Overall, the infection was detected by nested PCR in 63 samples versus 53 by direct examination. In addition, 11 mixed infections and 6 positive asymptomatic cases not detected by microscopy were diagnosed by PCR. Moreover, two negative samples in nested PCR were tested positive by direct examination. The molecular tool is more sensitive than the direct examination in detecting infra-microscopic parasitaemia and mixed infections...

  2. Detection of toxigenic vibrio cholera from environmental water samples by an enrichment broth cultivation-pit-stop semi-nested PCR procedure

    CSIR Research Space (South Africa)

    Theron, J

    2000-09-01

    Full Text Available V. cholerae. The PCR procedure coupled with an enrichment culture detected as few as four V. cholerae organisms in pure culture. Treated sewage, surface, ground and drinking water samples were seeded with V, cholerae and following enrichment, a...

  3. Detection of Aspergillus flavus and A. fumigatus in Bronchoalveolar Lavage Specimens of Hematopoietic Stem Cell Transplants and Hematological Malignancies Patients by Real-Time Polymerase Chain Reaction, Nested PCR and Mycological Assays

    Science.gov (United States)

    Zarrinfar, Hossein; Mirhendi, Hossein; Fata, Abdolmajid; Khodadadi, Hossein; Kordbacheh, Parivash

    2015-01-01

    Background: Pulmonary aspergillosis (PA) is one of the most serious complications in immunocompromised patients, in particular among hematopoietic stem cell transplants (HSCT) and patients with hematological malignancies. Objectives: The current study aimed to evaluate the incidence of PA and utility of molecular methods in HSCT and patients with hematological malignancies, four methods including direct examination, culture, nested polymerase chain reaction (PCR) and real-time PCR were performed on bronchoalveolar lavage (BAL) specimens in Tehran, Iran. Patients and Methods: During 16 months, 46 BAL specimens were obtained from individuals with allogeneic HSCT (n = 18) and patients with hematological malignancies (n = 28). Direct wet mounts with 20% potassium hydroxide (KOH) and culture on mycological media were performed. The molecular detection of Aspergillus fumigatus and A. flavus was done by amplifying the conserved sequences of internal transcribed spacer 1 (ITS1) ribosomal DNA by nested-PCR and the β-tubulin gene by TaqMan real-time PCR. Results: Seven (15.2%) out of 46 specimens were positive in direct examination and showed branched septate hyphae; 11 (23.9%) had positive culture including eight (72.7%) A. flavus and three (27.3%) A. fumigatus; 22 (47.8%) had positive nested-PCR and eight (17.4%) had positive real-time PCR. The incidence of invasive pulmonary aspergillosis (IPA) in these patients included proven IPA in 1 (2.2%), probable IPA in 10 (21.7%), possible IPA in 19 (41.3%) and not IPA in 16 cases (34.8%). Conclusions: The incidence of IPA in allogeneic HSCT and patients with hematological malignancies was relatively high and A. flavus was the most common cause of PA. As molecular methods had higher sensitivity, it may be useful as screening methods in HSCT and patients with hematological malignancies, or to determine when empirical antifungal therapy can be withheld. PMID:25763133

  4. Prevalence of renal lesions in slaughtered cattle in Shiraz, Iran, and detection of Leptospira in them by nested PCR-RFLP.

    Science.gov (United States)

    Taghadosi, Vahideh; Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Samiei, Azadeh

    2016-12-01

    Renal diseases in cattle are frequently not recognized due to the subclinical conditions. Some species of Leptospira are the main cause of infectious agents that damage the kidneys and lead to abortion and economic losses in cattle and are also of major concern in the public health. This study was aimed to assess the prevalence of renal lesions of slaughtered cattle in the Shiraz abattoir and to determine the correlation between rejected kidneys and infection with Leptospira using nested PCR-restriction fragment length polymorphism (RFLP) techniques. Out of 1000 inspected animals, 205 (20.5 %) revealed the renal lesions. Chronic nephritis (7.5 %), white-spotted kidney (7.3 %), and petechial hemorrhage (3.5 %) were the most prevalent forms of the lesions. A direct correlation between increasing the age and significant increase in the rate of lesions was also observed (P = 0.03). Using nested PCR-RFLP assay, 40.8 % of the tested kidneys were turned to be infected to the pathogenic species of Leptospira. The risk of infection of the kidneys with white spot to pathogenic species of Leptospira (53.8 %) was more than that of the kidneys with other lesions (25.0 %) (P = 0.014). The odd ratio indicates that the kidneys with white spot lesions are likely to be infected with pathogenic species of Leptospira, five times greater than other lesions. This study showed that renal lesions especially white-spotted kidney, which were considerably associated with Leptospira in slaughtered cattle in Shiraz, were very high. This is important in terms of public health and in particular, increases the risk of transmission of disease to human specially in the high-risk careers including farmers, veterinarians, and abattoir workers.

  5. Rapid detection of bovine coronavirus by a semi-nested RT-PCR Detecção rápida do Coronavírus Bovino (BCoV por meio de uma semi-nested RT-PCR

    Directory of Open Access Journals (Sweden)

    Karen M. Asano

    2009-11-01

    Full Text Available Bovine coronavirus (BCoV is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256 in DEPC treated ultra-pure water, in fetal bovine serum (FBS and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694. The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.O Coronavírus bovino (BCoV pertence ao grupo 2 do gênero Coronavirus (Nidovirales: Coronaviridae e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doen

  6. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    Science.gov (United States)

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

    2015-01-01

    Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (Pnested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance 27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

  7. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    Science.gov (United States)

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. An extremely sensitive nested PCR-RFLP mitochondrial marker for detection and identification of salmonids in eDNA from water samples

    Directory of Open Access Journals (Sweden)

    Laura Clusa

    2017-02-01

    Full Text Available Background Salmonids are native from the North Hemisphere but have been introduced for aquaculture and sport fishing in the South Hemisphere and inhabit most rivers and lakes in temperate and cold regions worldwide. Five species are included in the Global Invasive Species Database: rainbow trout Oncorhynchus mykiss, Atlantic salmon Salmo salar, brown trout Salmo trutta, brook trout Salvelinus fontinalis, and lake trout Salvelinus namaycush. In contrast, other salmonids are endangered in their native settings. Methods Here we have developed a method to identify salmonid species directly from water samples, focusing on the Iberian Peninsula as a case study. We have designed nested Salmonidae-specific primers within the 16S rDNA region. From these primers and a PCR-RFLP procedure the target species can be unequivocally identified from DNA extracted from water samples. Results The method was validated in aquarium experiments and in the field with water from watersheds with known salmonid populations. Finally, the method was applied to obtain a global view of the Salmonidae community in Nalón River (north coast of Spain. Discussion This new powerful, very sensitive (identifying the species down to 10 pg DNA/ml water and economical tool can be applied for monitoring the presence of salmonids in a variety of situations, from checking upstream colonization after removal of river barriers to monitoring potential escapes from fish farms.

  9. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  10. Detección del virus de la leucosis bovina en ganado criollo colombiano mediante PCR-anidado Bovine leukemia virus detection in Creole Colombian breeds using nested-PCR

    Directory of Open Access Journals (Sweden)

    Darwin Yovanny Hernández-Herrera

    2011-12-01

    Full Text Available Se evaluó la presencia del virus de la leucosis bovina (VLB en 360 muestras de ADN de ocho razas bovinas criollas: Blanco Orejinegro (BON, Casanareño (CAS, Costeño con Cuernos (CCC, Chino Santandereano (ChS, Caqueteño (CQT, Hartón del Valle (HV, Romosinuano (RS y San Martinero (SM, dos Razas Sintéticas Colombianas: Lucerna (LUC y Velásquez (VEL y dos razas foráneas: Brahmán (B y Holstein (H. Para la detección del pro-virus se amplificó una región del gen env viral, mediante PCR anidada. La presencia del VLB fue mayor en la raza HV seguido por ChS (83.3% y 60% respectivamente, VEL y LUC tuvieron el mismo porcentaje (50%, en CAS, CCC y CQT la presencia del virus fue de 26.7%, 23.3% y 16.7% respectivamente; no se encontró el virus en BON, SM y RS. En las razas foráneas la presencia fue de 83.3% para H y 6.7% para B. Se encontró dependencia altamente significativa entre la presencia del VLB y la raza, el sexo y región de origen de la muestra. El promedio de presencia en las razas criollas fue menor que en las foráneas, menor en los machos que en las hembras y en la región norte que en el suroccidente y el centro del país.Using 360 DNA samples from eight Creole bovine breeds Blanco Orejinegro (BON, Casanareño (CAS, Costeño con Cuernos (CCC, Chino Santandereano (ChS, Caqueteño (CQT, Hartón del Valle (HV, Romosinuano (RS and San Martinero (SM, two synthetic Colombian breeds: Lucerna (LUC and Velásquez (VEL and two introduced breeds Brahmán (B and Holstein (H; the presence of Bovine Leukemia Virus (BLV was evaluated through the amplification of a viral gene region env (provirus detection - nested-PCR. The percentage of presence and independence test were calculated (X². Presence of BLV was higher in HV breed, followed by ChS (83.3% and 60% respectively; VEL and LUC breeds showed the same percentage (50%. In CAS, CCC and CQT the presence of virus was 26.7%, 23.3% y 16.7% respectively. On the other hand, no virus presence was

  11. Comparative evaluation of the nested ITS PCR against the 18S PCR-RFLP in a survey of bovine trypanosomiasis in Kwale County, Kenya.

    Science.gov (United States)

    Odongo, Steven; Delespaux, Vincent; Ngotho, Maina; Bekkele, Serkalem Mindaye; Magez, Stefan

    2016-09-01

    We compared the nested internal transcribed spacer (ITS) PCR and the 18S PCR-RFLP (restriction-fragment length polymorphism) pan-trypanosome assays in a cross-sectional survey of bovine trypanosomiasis in 358 cattle in Kwale County, Kenya. The prevalence of trypanosomiasis as determined by the nested ITS PCR was 19.6% (70/358) and by 18S PCR-RFLP was 16.8% (60/358). Of the pathogenic trypanosomes detected, the prevalence of Trypanosoma congolense and Trypanosoma vivax was greater than that of Trypanosoma simiae The nested ITS PCR detected 83 parasite events, whereas the 18S PCR-RFLP detected 64; however, overall frequencies of infections and the parasite events detected did not differ between the assays (χ(2) = 0.8, df = 1, p > 0.05 and χ(2) = 2.5, df = 1, p > 0.05, respectively). The kappa statistic (0.8) showed good agreement between the tests. The nested ITS PCR and the 18S PCR-RFLP had comparable sensitivity, although the nested ITS PCR was better at detecting mixed infections (χ(2) = 5.4, df = 1, p < 0.05). © 2016 The Author(s).

  12. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  13. Detection of Trichomonas vaginalis in male patients with urethritis by nested PCR%巢式聚合酶链反应检测男性尿道炎患者尿液中阴道毛滴虫

    Institute of Scientific and Technical Information of China (English)

    乐文静; 苏晓红; 李赛; 刘玉荣; 张津萍; 朱小凤; 王宝玺

    2014-01-01

    目的 建立两种巢式聚合酶链反应(PCR)方法检测男性尿道炎患者尿液中阴道毛滴虫感染状况,评价两种巢式PCR在临床诊断中的应用价值.方法 2011年4月至2013年12月来我院性病门诊就诊的1 088例男性尿道炎患者为研究对象,收集尿道拭子标本做分泌物涂片镜检、阴道毛滴虫湿片检测以及淋球菌培养,同时收集尿液标本提取DNA,针对阴道毛滴虫重复基因组和β微管蛋白基因,采用两种巢式PCR法检测尿液中阴道毛滴虫.结果 湿片法检测阴道毛滴虫的阳性率为0,而两种巢式PCR法均检测出29例阳性标本,阳性率为2.67%,且两种巢式PCR法检测出的阳性标本一致.结论 与湿片法相比,巢式PCR法检测男性尿液标本阴道毛滴虫具有较高的灵敏度和特异性.%Objective To establish two nested PCR assays for detection of Trichomonas vaginalis in urine samples from male patients with urethritis,and to evaluate their diagnostic value.Methods One thousand and eighty-eight male patients with urethritis were enrolled from sexually transmitted disease (STD) clinic in the Hospital of Dermatology,Chinese Academy of Medical Sciences and Peking Union Medical College between April 2011 and December 2013.Urethral swabs were collected followed by smear testing,wet mount microscopic examination of Trichomonas vaginalis,and cultivation of Neisseria gonorrhoeae.Urine specimens were also obtained from these patients followed by DNA extraction.Two nested PCR assays were developed and performed to amplify the repeat genomic sequence and β-tubulin gene of Trichomonas vaginalis.Results Trichomonas vaginalis was detected in none of these swab specimens by wet mount microscopy,but in 29 (2.67%) of the urine specimens by either of the two nested PCR assays.Moreover,the positive specimens detected by the two nested PCR assays were completely consistent.Conclusion Compared with wet mount microscopy,nested PCR has higher sensitivity and

  14. In-planta detection and monitorization of endophytic colonization by a Beauveria bassiana strain using a new-developed nested and quantitative PCR-based assay and confocal laser scanning microscopy.

    Science.gov (United States)

    Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E

    2013-10-01

    Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling

  15. Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

    Science.gov (United States)

    Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

    2013-05-01

    This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

  16. Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

    Science.gov (United States)

    Macente, Sara; Fujimura Leite, Clarice Queico; Santos, Adolfo Carlos Barreto; Siqueira, Vera Lúcia Dias; Machado, Luzia Neri Cosmo; Marcondes, Nadir Rodrigues; Hirata, Mario Hiroyuki; Hirata, Rosário Dominguez Crespo

    2013-01-01

    Current study evaluated the hsp65 Nested PCR Restriction Fragment Length Polymorphism Analysis (hsp65 Nested PCR-PRA) to detect and identify Mycobacterium tuberculosis complex directly in clinical samples for a rapid and specific diagnosis of tuberculosis (TB). hsp65 Nested PCR-PRA was applied directly to 218 clinical samples obtained from 127 patients suspected of TB or another mycobacterial infection from July 2009 to July 2010. The hsp65 Nested PCR-PRA showed 100% sensitivity and 95.0 and 93.1% specificity in comparison with culture and microscopy (acid fast bacillus smear), respectively. hsp65 Nested PCR-PRA was shown to be a fast and reliable assay for diagnosing TB, which may contribute towards a fast diagnosis that could help the selection of appropriate chemotherapeutic and early epidemiological management of the cases which are of paramount importance in a high TB burden country. PMID:24260739

  17. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  18. Real-Time PCR for Universal Phytoplasma Detection and Quantification

    DEFF Research Database (Denmark)

    Christensen, Nynne Meyn; Nyskjold, Henriette; Nicolaisen, Mogens

    2013-01-01

    Currently, the most efficient detection and precise quantification of phytoplasmas is by real-time PCR. Compared to nested PCR, this method is less sensitive to contamination and is less work intensive. Therefore, a universal real-time PCR method will be valuable in screening programs and in other...

  19. Development of a duplex semi-nested PCR assay for detection of classical goose parvovirus and novel goose parvovirus-related virus in sick or dead ducks with short beak and dwarfism syndrome.

    Science.gov (United States)

    Li, Pengfei; Zhang, Ruihua; Chen, Junhao; Sun, Dapeng; Lan, Jingjing; Lin, Shaoli; Song, Shasha; Xie, Zhijing; Jiang, Shijin

    2017-11-01

    Duck short beak and dwarfism syndrome (SBDS) is an emerging infectious disease caused by a novel goose parvovirus-related virus (NGPV) in China. Until now, it remains uncertain whether the Cherry Valley ducks and mule ducks with SBDS are co-infected with classical goose parvovirus (GPV) and NGPV. In this study, a duplex semi-nested PCR assay with high specificity and sensitivity was developed for detection of the two viruses. Using the duplex PCR assay, NGPV was tested positive in all the 15 duck flocks with SBDS, whereas classical GPV was not detected in all the 133 sick and dead ducks collected from East China. A total of 87 (91.58%) Cherry Valley ducks aged from 5 to 18days and 35 (92.11%) mule ducks aged from 17 to 25days were detected positive for NGPV. In the NGPV-positive ducks, the virus detection rates were 81.97% to 8.20% in heart, liver, spleen, lung, kidney, pancreas, bile, thymus, bursa of Fabricius, and brain. The results indicated that NGPV was prevalent in the duck flocks of East China, whereas classical GPV was not detected in Cherry Valley ducks and mule ducks with SBDS. NGPV has extensive tissue tropism in Cherry Valley duck and mule duck, which could invade both the central and peripheral immune organs and break through the blood-brain barrier of ducks. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Differentiation of five enterohepatic Helicobacter species by nested PCR with high-resolution melting curve analysis.

    Science.gov (United States)

    Wu, Miaoli; Rao, Dan; Zhu, Yujun; Wang, Jing; Yuan, Wen; Zhang, Yu; Huang, Ren; Guo, Pengju

    2017-04-01

    Enterohepatic Helicobacter species (EHS) are widespread in rodent species around the world. Several studies have demonstrated that infection with EHS can interfere with the outcomes of animal experiments in cancer research and significantly influence the study results. Therefore, it is essential to establish a rapid detection and identification of EHS for biomedical research using laboratory rodents. Our study aimed to develop a rapid and sensitive method to detect and distinguish five enterohepatic Helicobacter species. Nested PCR followed by high-resolution melting curve analysis (HRM) was developed for identification of H. bilis, H. rodentium, H. muridarum, H. typhlonius, as well as H. hepaticus. To validate the accuracy of nested PCR-HRM analysis, quantitative real-time PCR methods for five different enterohepatic Helicobacter species were developed. A total of 50 cecal samples were tested using both nested PCR-HRM analysis and qPCR method. The nested PCR-HRM method could distinguish five enterohepatic Helicobacter species by different melting temperatures. The melting curve were characterized by peaks of 78.7 ± 0.12°C for H. rodentium, 80.51 ± 0.09°C for H. bilis, 81.6 ± 0.1°C for H. typhlonius, 82.11 ± 0.18°C for H. muridarum, and 82.95 ± 0.09°C for H. hepaticus. The nested PCR-HRM assay is a simple, rapid, and cost-effective assay. This assay could be a useful tool for molecular epidemiology study of enterohepatic Helicobacter infection and an attractive alternative for genotyping of enterohepatic Helicobacter species. © 2016 John Wiley & Sons Ltd.

  1. Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

    Science.gov (United States)

    Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

    2015-01-01

    To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

  2. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  3. Transgene detection by digital droplet PCR.

    Directory of Open Access Journals (Sweden)

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  4. Molecular diagnosis of strongyloidiasis in a population of an endemic area through nested-PCR.

    Science.gov (United States)

    Sharifdini, Meysam; Keyhani, Amir; Eshraghian, Mohammad Reza; Beigom Kia, Eshrat

    2018-01-01

    This study is aimed to diagnose and analyze strongyloidiasis in a population of an endemic area of Iran using nested-PCR, coupled with parasitological methods. Screening of strongyloidiasis infected people using reliable diagnostic techniques are essential to decrease the mortality and morbidity associated with this infection. Molecular methods have been proved to be highly sensitive and specific for detection of Strongyloides stercoralis in stool samples. A total of 155 fresh single stool samples were randomly collected from residents of north and northwest of Khouzestan Province, Iran. All samples were examined by parasitological methods including formalin-ether concentration and nutrient agar plate culture, and molecular method of nested-PCR. Infections with S. stercoralis were analyzed according to demographic criteria. Based on the results of nested-PCR method 15 cases (9.7%) were strongyloidiasis positive. Nested-PCR was more sensitive than parasitological techniques on single stool sampling. Elderly was the most important population index for higher infectivity with S. stercoralis . In endemic areas of S. stercoralis , old age should be considered as one of the most important risk factors of infection, especially among the immunosuppressed individuals.

  5. Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

    International Nuclear Information System (INIS)

    Pavelic, J.

    1996-07-01

    Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

  6. Nested PCR for specific diagnosis of Taenia solium taeniasis.

    Science.gov (United States)

    Mayta, Holger; Gilman, Robert H; Prendergast, Emily; Castillo, Janeth P; Tinoco, Yeny O; Garcia, Hector H; Gonzalez, Armando E; Sterling, Charles R

    2008-01-01

    Taeniasis due to Taenia solium is a disease with important public health consequences, since the larval stage is not exclusive to the animal intermediate, the pig, but also infects humans, causing neurocysticercosis. Early diagnosis and treatment of T. solium tapeworm carriers is important to prevent human cysticercosis. Current diagnosis based on microscopic observation of eggs lacks both sensitivity and specificity. In the present study, a nested-PCR assay targeting the Tso31 gene was developed for the specific diagnosis of taeniasis due to T. solium. Initial specificity and sensitivity testing was performed using stored known T. solium-positive and -negative samples. The assay was further analyzed under field conditions by conducting a case-control study of pretreatment stool samples collected from a population in an area of endemicity. Using the archived samples, the assay showed 97% (31/32) sensitivity and 100% (123/123) specificity. Under field conditions, the assay had 100% sensitivity and specificity using microscopy/enzyme-linked immunosorbent assay coproantigen testing as the gold standards. The Tso31 nested PCR described here might be a useful tool for the early diagnosis and prevention of taeniasis/cysticercosis.

  7. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  8. Diagnosis of lymphoma in paraffin wax sections by nested PCR and immunohistochemistry.

    OpenAIRE

    Kitamura, Y; Nanba, E; Inui, S; Tanigawa, T; Ichihara, K

    1996-01-01

    AIMS: To investigate whether nested polymerase chain reaction (PCR) and immunohistochemistry can be used to diagnose malignant lymphoma. METHODS: Paraffin wax embedded tissue sections from 31 patients with malignant lymphoma were analysed by nested PCR and immunohistochemistry using standard protocols. RESULTS: Nested PCR amplification of 1 pg DNA confirmed monoclonality in B cell lymphoma; PCR amplification of 10 pg DNA confirmed monoclonality in T cell lymphoma. Twenty seven (87%) samples w...

  9. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  10. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    Science.gov (United States)

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  11. The Diagnostic Utility of Bact/ALERT and Nested PCR in the Diagnosis of Tuberculous Meningitis.

    Science.gov (United States)

    Sastry, Apurba Sankar; Bhat K, Sandhya; Kumudavathi

    2013-01-01

    The early laboratory diagnosis of Tuberculous Meningitis (TBM) is crucial, to start the antitubercular chemotherapy and to prevent its complications. However, the conventional methods are either less sensitive or time consuming. Hence, the diagnostic potentials of BacT/ALERT and Polymerase Chain Reaction (PCR) was evaluated in this study. The study group comprised of 62 cases and 33 controls. The cases were divided according to Ahuja's criteria into the confirmed (two cases), highly probable (19 cases), probable (26 cases) and the possible (15 cases) subgroups. Ziehl Neelsen's (ZN) and Auramine Phenol (AP) staining, Lowenstein Jensen (LJ) medium culture, BacT/ALERT and nested Polymerase Chain Reaction (PCR) which targeted IS6110 were carried out on all the patients. The sensitivity of the LJ culture was 3.22%. BacT/ALERT showed a sensitivity and a specificity of 25.80% and 100% and those of nested PCR were found to be 40.32% and 96.97% respectively. The mean detection time of growth of the LJ culture was 31.28 days, whereas that of BacT/ALERT was 20.68 days. The contamination rate in the LJ culture and BacT/ALERT were 7.2% and 5.8% respectively. Nested PCR was found to be more sensitive, followed by BacT/ALERT as compared to the LJ culture and smear microscopy. As both false negative and false positive results have been reported for nested PCR, so it should not be used alone as a criterion for initiating or terminating the therapy, but it should be supported by clinical, radiological, cytological and other microbiological findings.

  12. The use of nested PCR in the polymerase chain reaction for the detection of Phytophthora fragariae and P. cactorum in strawberry,

    NARCIS (Netherlands)

    Lacourt, I.; Bonants, P.J.M.; Gent-Pelzer, van M.P.; Cooke, D.E.L.; Hagenaar-de Weerdt, M.; Surplus, L.; Duncan, J.M.

    1997-01-01

    Phytophthora fragariae var. fragariae Hickman, which causes red core disease of strawberry, is a quarantine organism on which a nil tolerance is placed. Detection of the fungus is by a root tip bait test which is highly specific and sensitive but time-consuming (5–6 weeks), has to be done at 12°C

  13. Use of chemical flocculation and nested PCR for Heterodera glycines detection in DNA extracts from field soils with low population densities

    Science.gov (United States)

    The soybean cyst nematode (SCN) Heterodera glycines is a major pathogen of soybean world-wide. Distinction between SCN and other members of H. schachtii sensu stricto group based on morphology is a tedious task. A molecular assay was developed to detect SCN in field soils with low population densiti...

  14. Numeric definition of the clinical performance of the nested reverse transcription-PCR for detection of hematogenous epithelial cells and correction for specific mRNA of non-target cell origin as evaluated for prostate cancer cells

    NARCIS (Netherlands)

    Schamhart, Denis; Swinnen, Johannes; Kurth, Karl-Heinz; Westerhof, Alex; Kusters, Ron; Borchers, Holger; Sternberg, Cora

    2003-01-01

    Background: Inappropriate quality management,of reverse transcription-PCR (RT-PCR) assays for the detection of blood-borne prostate cancer (PCa) cells hampers clinical conclusions. Improvement of the RT-PCR-methodology for prostate-specific, antigen (PSA) mRNA should focus on an appropriate numeric.

  15. A nested real-time PCR assay for the quantification of Plasmodium falciparum DNA extracted from dried blood spots.

    Science.gov (United States)

    Tran, Tuan M; Aghili, Amirali; Li, Shanping; Ongoiba, Aissata; Kayentao, Kassoum; Doumbo, Safiatou; Traore, Boubacar; Crompton, Peter D

    2014-10-04

    As public health efforts seek to eradicate malaria, there has been an emphasis on eliminating low-density parasite reservoirs in asymptomatic carriers. As such, diagnosing submicroscopic Plasmodium infections using PCR-based techniques has become important not only in clinical trials of malaria vaccines and therapeutics, but also in active malaria surveillance campaigns. However, PCR-based quantitative assays that rely on nucleic acid extracted from dried blood spots (DBS) have demonstrated lower sensitivity than assays that use cryopreserved whole blood as source material. The density of Plasmodium falciparum asexual parasites was quantified using genomic DNA extracted from dried blood spots (DBS) and the sensitivity of two approaches was compared: quantitative real-time PCR (qPCR) targeting the P. falciparum 18S ribosomal RNA gene, either with an initial conventional PCR amplification prior to qPCR (nested qPCR), or without an initial amplification (qPCR only). Parasite densities determined by nested qPCR, qPCR only, and light microscopy were compared. Nested qPCR results in 10-fold higher sensitivity (0.5 parasites/μl) when compared to qPCR only (five parasites/ul). Among microscopy-positive samples, parasite densities calculated by nested qPCR correlated strongly with microscopy for both asymptomatic (Pearson's r=0.58, PNested qPCR improves the sensitivity for the detection of P. falciparum blood-stage infection from clinical DBS samples. This approach may be useful for active malaria surveillance in areas where submicroscopic asymptomatic infections are prevalent.

  16. Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

    Science.gov (United States)

    Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

    2017-01-01

    In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

  17. Identification of and Screening for Human Helicobacter cinaedi Infections and Carriers via Nested PCR

    Science.gov (United States)

    Oyama, Kohta; Khan, Shahzada; Okamoto, Tatsuya; Fujii, Shigemoto; Ono, Katsuhiko; Matsunaga, Tetsuro; Yoshitake, Jun; Sawa, Tomohiro; Tomida, Junko; Kawamura, Yoshiaki

    2012-01-01

    Helicobacter cinaedi is the most frequently reported enterohepatic Helicobacter species isolated from humans. Earlier research suggested that certain patients with H. cinaedi infection may remain undiagnosed or incorrectly diagnosed because of difficulties in detecting the bacteria by conventional culture methods. Here, we report a nested PCR assay that rapidly detects the cytolethal distending toxin gene (cdt) of H. cinaedi with high specificity and sensitivity. Specificity of the assay was validated by using different species of Helicobacter and Campylobacter, as well as known H. cinaedi-positive and -negative samples. The sensitivity of detection for the cdt gene in the assay was 102 CFU/ml urine or 102 CFU/105 infected RAW 264.7 cells. In an H. cinaedi-infected mouse model, the cdt gene of H. cinaedi was effectively detected via the assay with urine (6/7), stool (2/3), and blood (2/6) samples. Importantly, it detected H. cinaedi in blood, urine, and stool samples from one patient with a suspected H. cinaedi infection and three patients with known infections. The assay was further used clinically to follow up two H. cinaedi-infected patients after antibiotic treatment. Stool samples from these two patients evaluated by nested PCR after antibiotic therapy showed clearance of bacterial DNA. Finally, analysis of stool specimens from healthy volunteers showed occasional positive reactions (4/30) to H. cinaedi DNA, which suggests intestinal colonization by H. cinaedi in healthy subjects. In conclusion, this nested PCR assay may be useful for the rapid diagnosis, antimicrobial treatment evaluation, and epidemiological study of H. cinaedi infection. PMID:23015666

  18. [Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].

    Science.gov (United States)

    Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan

    2015-02-01

    To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.

  19. Clinical and epidemiological use of nested PCR targeting the repetitive element IS1111 associated with the transposase gene from Coxiella burnetii.

    Science.gov (United States)

    Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S

    Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.

  20. Diagnosis of theileria equi infections in horses in the Azores using cELISA and nested PCR

    Science.gov (United States)

    Equine piroplasmosis is a tick-borne disease of equids that is often caused by the parasite Theileria equi. We applied competitive ELISA (cELISA) and nested PCR diagnostic methods to detect this parasite in horses by screening 162 samples from mainland Portugal where the parasite is endemic, and 143...

  1. Nested-PCR for the detection of Mycoplasma hyopneumoniae in bronchial alveolar swabs, frozen tissues and formalin-fixed paraffin-embedded swine lung samples: comparative evaluation with immunohistochemical findings and histological features

    Directory of Open Access Journals (Sweden)

    Paula R. Almeida

    2012-08-01

    Full Text Available The diagnosis of Mycoplasma hyopneumoniae infection is often performed through histopathology, immunohistochemistry (IHC and polymerase chain reaction (PCR or a combination of these techniques. PCR can be performed on samples using several conservation methods, including swabs, frozen tissue or formalin-fixed and paraffin-embedded (FFPE tissue. However, the formalin fixation process often inhibits DNA amplification. To evaluate whether M. hyopneumoniae DNA could be recovered from FFPE tissues, 15 lungs with cranioventral consolidation lesions were collected in a slaughterhouse from swine bred in herds with respiratory disease. Bronchial swabs and fresh lung tissue were collected, and a fragment of the corresponding lung section was placed in neutral buffered formalin for 48 hours. A PCR assay was performed to compare FFPE tissue samples with samples that were only refrigerated (bronchial swabs or frozen (tissue pieces. M. hyopneumoniae was detected by PCR in all 15 samples of the swab and frozen tissue, while it was detected in only 11 of the 15 FFPE samples. Histological features of M. hyopneumoniae infection were presented in 11 cases and 7 of these samples stained positive in IHC. Concordance between the histological features and detection results was observed in 13 of the FFPE tissue samples. PCR was the most sensitive technique. Comparison of different sample conservation methods indicated that it is possible to detect M. hyopneumoniae from FFPE tissue. It is important to conduct further research using archived material because the efficiency of PCR could be compromised under these conditions.

  2. Detection of Bacillus spores using PCR and FTA filters.

    Science.gov (United States)

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  3. Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

    Science.gov (United States)

    Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

    2014-05-01

    A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Validation and clinical application of a nested PCR for paracoccidioidomycosis diagnosis in clinical samples from Colombian patients.

    Science.gov (United States)

    Gaviria, Marcela; Rivera, Vanessa; Muñoz-Cadavid, Cesar; Cano, Luz Elena; Naranjo, Tonny Williams

    2015-01-01

    Paracoccidioidomycosis is a systemic and endemic mycosis, restricted to tropical and subtropical areas of Latin America. The infection is caused by the thermal dimorphic fungus Paracoccidioides brasiliensis and Paracoccidioides lutzii. The diagnosis of paracoccidioidomycosis is usually performed by microscopic examination, culture and immunodiagnostic tests to respiratory specimens, body fluids and/or biopsies; however these methods require laboratory personnel with experience and several days to produce a result. In the present study, we have validated and evaluated a nested PCR assay targeting the gene encoding the Paracoccidioides gp43 membrane protein in 191 clinical samples: 115 samples from patients with proven infections other than paracoccidioidomycosis, 51 samples as negative controls, and 25 samples from patients diagnosed with paracoccidioidomycosis. Additionally, the specificity of the nested PCR assay was also evaluated using purified DNA isolated from cultures of different microorganisms (n=35) previously identified by culture and/or sequencing. The results showed that in our hands, this nested PCR assay for gp43 protein showed specificity and sensitivity rates of 100%. The optimized nested PCR conditions in our laboratory allowed detection down to 1fg of P. brasiliensis DNA. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

  5. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  6. The Prevalence of Pneumocystis jiroveci in Bronchoalveolar Lavage Specimens of Lung Transplant Recipients Examined by the Nested PCR.

    Science.gov (United States)

    Izadi, Morteza; Jonaidi Jafari, Nematollah; Sadraei, Javid; Mahmoodzadeh Poornaki, Abbas; Rezavand, Babak; Zarrinfar, Hossein; Abdi, Jahangir; Mohammadi, Younes

    2014-12-01

    The use of immune suppressive drugs for organ transplant recipients predisposes them to opportunistic infections, especially by fungal agents. Pneumocystis jiroveci, as an opportunistic pathogen, endangers the patients' life in those with immune system disorders. Early detection of latent Pneumocystis infection in susceptible patients may help choose the optimal treatment for these patients. The aim of this study was to identify and determine the colonization of latent P. jiroveci infection among lung transplant recipients. This cross-sectional descriptive study was conducted on lung transplant recipients. Bronchoalveolar lavage (BAL) specimens were collected from 32 patients undergoing bronchoscopy. The samples were aseptically homogenized by 10 mM dithiothreitol, and their DNA was extracted. The mtLSUrRNA gene of P. jiroveci was amplified using nested PCR in two stages. Nested PCR was performed using external primers of pAZ-102-E and pAZ102-H followed by using the PCR product of the first stage and internal primers of pAZ-102-E and pAZ102-L2. The genome of P. jiroveci was revealed by a 346 bp PCR product in the initial amplification and a 120 bp product in the nested PCR. The results showed that seven BAL specimens (21.9%) from lung transplant recipients were positive for P. jiroveci. In molecular epidemiology studies, nested PCR has higher sensitivity than PCR. Results of this study support the colonization of P. jiroveci in patients receiving lung transplantation. Patients who are carriers of P. jiroveci are at a higher risk of P. jiroveci pneumonia.

  7. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    Science.gov (United States)

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  8. Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

    Science.gov (United States)

    Wen, Yan; Xing, Yan; Yuan, Lian-Chao; Liu, Jian; Zhang, Ying; Li, Huan-Ying

    2013-01-01

    We evaluated the sensitivity and specificity of a nested-polymerase chain reaction (PCR) method for detection of Mycobacterium leprae DNA from whole blood. Whole-blood specimens were subjected to nested-PCR amplification of M. leprae repeat DNA sequences in 49 multibacillary (MB) and 30 paucibacillary (PB) leprosy patients, 96 household contacts (HHCs), 18 tuberculosis (TB) patients, and 35 normal healthy individuals. M. leprae DNA was detected in 95.92% (47/49) of MB, 70% (21/30) of PB, and 6.25% (6/96) of HHC, but it was not detected in 18 TB or 35 normal controls. The sensitivities of the anti-bovine serum albumin (ND-O-BSA) immunoglobulin M (IgM) and antifusion protein of ML0405-ML2331 IgG for MB were 97.96% and 89.8%, and these values for PB were 70% and 53.33%. However, the ND-O-BSA enzyme-linked immunosorbent assay (ELISA) had lower specificity, with relatively high false-positive results for TB patients (16.67%) and normal healthy controls (10%). Based on these promising findings, we propose the use of nested PCR of whole-blood samples along with ELISA test for early detection of leprosy cases. PMID:23478578

  9. Diagnosis of Neospora caninum in bovine fetuses by histology, immunohistochemistry, and nested-PCR Pesquisa de Neospora caninum em fetos bovinos por histologia, imunoistoquímica e nested-PCR

    Directory of Open Access Journals (Sweden)

    Aline Diniz Cabral

    2009-12-01

    Full Text Available Neospora caninum, a cause of abortion and stillbirth in cattle, was studied by histology, immunohistochemistry, and nested-PCR, using primers from the Nc5 region of the genomic DNA (PCR PLUS and primers from the ITS1 region of the ribosomal DNA (PCR JB. A total of 105 fetal samples sent to the Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico from January 2006 to May 2008 were examined for evidence of N. caninum. Histological examination revealed 71.4% with non-suppurative inflammation in the heart, lung, liver, kidney, placenta, and brain. Immunohistochemistry detected infections in 8.6% of the samples, mainly in the brain, placenta, and heart. Nested-PCR JB revealed 6.7% with infections, while nested-PCR PLUS returned 20.9% positive results, mainly in brain and placenta, and in the pooled liver and heart. Kappa statistics demonstrated little agreement among the three techniques. The three methods are complementary, since they have distinct diagnostic characteristics and were combined to give a positivity rate of 24.8%.Pesquisou-se Neospora caninum como causador de abortamento e natimortalidade em bovinos, por meio de exame histopatológico (hematoxilina-eosina, imunoistoquímica (IHQ e nested-PCR, utilizando primers da região Nc5 do DNA genômico (PCR PLUS e primers da região ITS1 do DNA ribossomal (PCR JB. Foram avaliadas 105 amostras de abortamento bovino entre janeiro de 2006 a maio de 2008, encaminhadas ao Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico para diagnóstico diferencial de causas infecciosas. Observou-se em 71,4% das amostras lesões histológicas (HE caracterizadas pela presença de células inflamatórias mononucleares no coração, pulmão, fígado, rim, placenta e cérebro. A IHQ detectou 8,57% de positividade, sendo maior no cérebro, placenta e coração. A nested-PCR JB revelou 6,66% de casos positivos, enquanto que a nested-PCR PLUS apresentou maior taxa

  10. Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

    Science.gov (United States)

    Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

    2012-04-13

    Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

  11. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  12. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  13. Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

    Science.gov (United States)

    Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

    2017-01-01

    Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

  14. Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR

    Directory of Open Access Journals (Sweden)

    López-Revilla Rubén

    2010-05-01

    Full Text Available Abstract Background We have developed an ultrasensitive method based on conventional PCR preamplification followed by nested amplification through real time PCR (qPCR in the presence of the DNA intercalating agent EvaGreen. Results Amplification mixtures calibrated with a known number of pHV101 copies carrying a 645 base pair (bp-long insert of the human papillomavirus type 16 (HPV16 E6 oncogene were used to generate the E6-1 amplicon of 645 bp by conventional PCR and then the E6-2 amplicon of 237 bp by nested qPCR. Direct and nested qPCR mixtures for E6-2 amplification corresponding to 2.5 × 102-2.5 × 106 initial pHV101 copies had threshold cycle (Ct values in the ranges of 18.7-29.0 and 10.0-25.0, respectively. The Ct of qPCR mixtures prepared with 1/50 volumes of preamplified mixtures containing 50 ng of DNA of the SiHa cell line (derived from an invasive cervical cancer with one HPV16 genome per cell was 19.9. Thermal fluorescence extinction profiles of E6-2 amplicons generated from pHV101 and SiHa DNA were identical, with a peak at 85.5°C. Conclusions Our method based on conventional preamplification for 15 cycles increased 10,750 times the sensitivity of nested qPCR for the quantitation of the E6 viral oncogene and confirmed that the SiHa cell line contains one E6-HPV16 copy per cell.

  15. Early diagnosis of typhoid fever by nested PCR for flagellin gene of Salmonella enterica serotype Typhi.

    Science.gov (United States)

    Khan, S; Harish, B N; Menezes, G A; Acharya, N S; Parija, S C

    2012-11-01

    Typhoid fever caused by Salmonella Typhi continues to be a major health problem in spite of the use of antibiotics and the development of newer antibacterial drugs. Inability to make an early laboratory diagnosis and resort to empirical therapy, often lead to increased morbidity and mortality in cases of typhoid fever. This study was aimed to optimize a nested PCR for early diagnosis of typhoid fever and using it as a diagnostic tool in culture negative cases of suspected typhoid fever. Eighty patients with clinical diagnosis of typhoid fever and 40 controls were included in the study. The blood samples collected were subjected to culture, Widal and nested PCR targeting the flagellin gene of S. Typhi. The sensitivity of PCR on blood was found to be 100 per cent whereas the specificity was 76.9 per cent. The positive predictive value (PPV) of PCR was calculated to be 76.9 per cent with an accuracy of 86 per cent. None of the 40 control samples gave a positive PCR. Due to its high sensitivity and specificity nested PCR can be used as a useful tool to diagnose clinically suspected, culture negative cases of typhoid fever.

  16. COMPARISON OF A GENUS-SPECIFIC CONVENTIONAL PCR AND A SPECIES-SPECIFIC NESTED-PCR FOR MALARIA DIAGNOSIS USING FTA COLLECTED SAMPLES FROM KINGDOM OF SAUDI ARABIA.

    Science.gov (United States)

    Al-Harthi, Saeed A

    2015-12-01

    Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.

  17. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

    Science.gov (United States)

    Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

    2017-08-01

    A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  20. Association of carcinoma of the gallbladder with typhoid carriage in a typhoid endemic area using nested PCR.

    Science.gov (United States)

    Nath, Gopal; Singh, Yogesh Kumar; Kumar, Kailash; Gulati, Anil Kumar; Shukla, Vijay Kumar; Khanna, Ajay Kumar; Tripathi, Sunil Kumar; Jain, Ashok Kumar; Kumar, Mohan; Singh, Tej Bali

    2008-08-30

    Although well studied the association between chronic typhoid carrier state and carcinoma of the gallbladder (CaGB) remains unproven. The study was performed at a tertiary care medical center in North India and involved 52 patients with CaGB, 223 patients with benign gallbladder diseases, 508 healthy individuals and, 424 corpses. For the detection of Salmonella enterica serovar Typhi, hepatobiliary specimens were subjected to DNA extraction for specific nested- PCR amplification of the S. Typhi flagellin gene. Anti-Vi S. Typhi antibodies were detected in serum samples from patients by indirect haemagglutination. Thirty five of the 52 (67.3%) CaGB patients were PCR-positive for the S. Typhi flagellin gene; significantly higher than for patients with benign gallbladder diseases (95/223, 42.6%; p or = 160) in their serum were 20/52 (38.5%) for CaGB patients, 31/223 (13.9%) for patients with benign gallbladder diseases, and 47/508 (9.2%) for healthy individuals. Specific nested-PCR amplification of the S. Typhi flagellin gene in hepato-biliary specimens was more sensitive for detection of S. Typhi carriage than anti-Vi antibody titres in serum. The results demonstrate an association between typhoid carriage and gallbladder diseases, both CaGB and benign. S. Typhi specific immunosuppression is also suggested in patients with gallbladder diseases.

  1. Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

    NARCIS (Netherlands)

    Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.

    2001-01-01

    A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

  2. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  3. Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

    NARCIS (Netherlands)

    Hatta, Mochammad; Smits, Henk L.

    2007-01-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

  4. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    Science.gov (United States)

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. A nested-PCR strategy for molecular diagnosis of mollicutes in uncultured biological samples from cows with vulvovaginitis.

    Science.gov (United States)

    Voltarelli, Daniele Cristina; de Alcântara, Brígida Kussumoto; Lunardi, Michele; Alfieri, Alice Fernandes; de Arruda Leme, Raquel; Alfieri, Amauri Alcindo

    2018-01-01

    Bacteria classified in Mycoplasma (M. bovis and M. bovigenitalium) and Ureaplasma (U. diversum) genera are associated with granular vulvovaginitis that affect heifers and cows at reproductive age. The traditional means for detection and speciation of mollicutes from clinical samples have been culture and serology. However, challenges experienced with these laboratory methods have hampered assessment of their impact in pathogenesis and epidemiology in cattle worldwide. The aim of this study was to develop a PCR strategy to detect and primarily discriminate between the main species of mollicutes associated with reproductive disorders of cattle in uncultured clinical samples. In order to amplify the 16S-23S rRNA internal transcribed spacer region of the genome, a consensual and species-specific nested-PCR assay was developed to identify and discriminate between main species of mollicutes. In addition, 31 vaginal swab samples from dairy and beef affected cows were investigated. This nested-PCR strategy was successfully employed in the diagnosis of single and mixed mollicute infections of diseased cows from cattle herds from Brazil. The developed system enabled the rapid and unambiguous identification of the main mollicute species known to be associated with this cattle reproductive disorder through differential amplification of partial fragments of the ITS region of mollicute genomes. The development of rapid and sensitive tools for mollicute detection and discrimination without the need for previous cultures or sequencing of PCR products is a high priority for accurate diagnosis in animal health. Therefore, the PCR strategy described herein may be helpful for diagnosis of this class of bacteria in genital swabs submitted to veterinary diagnostic laboratories, not demanding expertise in mycoplasma culture and identification. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  7. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    Science.gov (United States)

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

    2015-10-01

    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. An Assessment of Whole Blood and Fractions by Nested PCR as a DNA Source for Diagnosing Canine Ehrlichiosis and Anaplasmosis

    Directory of Open Access Journals (Sweden)

    Tereza Emmanuelle de Farias Rotondano

    2012-01-01

    Full Text Available Ehrlichiosis and anaplasmosis are tick-borne diseases. Ehrlichia canis and Anaplasma platys infect mainly white cells and platelets, respectively. The main DNA source for PCR is peripheral blood, but the potential of blood cell fractions has not been extensively investigated. This study aims at assessment of whole blood (WB and blood fractions potential in nested PCR (nPCR to diagnose canine ehrlichiosis and anaplasmosis. The 16S rRNA gene was amplified in 71.4, 17.8, 31.57, and 30% of the WB, granulocyte (G, mononuclear cells (M, and buffy coat (BC samples. Compared to the WB, the sensitivity of the PCR was 42.86% for the M, and BC fractions, 21.43% for the G, and 33.33% for the blood clot (C. There was fair agreement between the WB and M, BC and C, and slight with the G. Fair agreement occurred between the nPCR and morulae in the blood smear. One animal was coinfected with A. platys and E. canis. This study provided the first evidence of A. platys infection in dogs in Paraíba, Brazil, and demonstrated that WB is a better DNA source than blood fractions to detect Ehrlichia and Anaplasma by nPCR, probably because of the plasma bacterial concentration following host cell lysis.

  9. Evaluation of a nested PCR test and bacterial culture of swabs from the nasal passages and from abscesses in relation to diagnosis of Streptococcus equi infection (strangles)

    DEFF Research Database (Denmark)

    Grønbæk, L.M.; Angen, Øystein; Vigre, Håkan

    2006-01-01

    . Methods: Two herds with natural outbreaks of strangles were visited over a period of 15 weeks and 323 samples originating from 35 horses investigated. The diagnostic use of a nested PCR test was evaluated using a collection of 165 isolates of Lancefield group C streptococci (species specificity) and swabs...... from nasal passages or from abscesses from horses infected with S. equi (diagnostic sensitivity). Results: All 45 S. equi isolates tested positive in the nested PCR, whereas no amplicon was formed when testing the other 120 Lancefield group C isolates. A total of 43 samples were collected from 11...... horses with and without clinical signs. Conclusions and potential relevance: The nested PCR test represents a species-specific and -sensitive method for diagnosis of S. equi from clinical samples. It may, however, be desirable in future to develop detection methods with high diagnostic sensitivity...

  10. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  11. Preliminary Evaluation of a Nest Usage Sensor to Detect Double Nest Occupations of Laying Hens

    Directory of Open Access Journals (Sweden)

    Mauro Zaninelli

    2015-01-01

    Full Text Available Conventional cage systems will be replaced by housing systems that allow hens to move freely. These systems may improve hens’ welfare, but they lead to some disadvantages: disease, bone fractures, cannibalism, piling and lower egg production. New selection criteria for existing commercial strains should be identified considering individual data about laying performance and the behavior of hens. Many recording systems have been developed to collect these data. However, the management of double nest occupations remains critical for the correct egg-to-hen assignment. To limit such events, most systems adopt specific trap devices and additional mechanical components. Others, instead, only prevent these occurrences by narrowing the nest, without any detection and management. The aim of this study was to develop and test a nest usage “sensor”, based on imaging analysis, that is able to automatically detect a double nest occupation. Results showed that the developed sensor correctly identified the double nest occupation occurrences. Therefore, the imaging analysis resulted in being a useful solution that could simplify the nest construction for this type of recording system, allowing the collection of more precise and accurate data, since double nest occupations would be managed and the normal laying behavior of hens would not be discouraged by the presence of the trap devices.

  12. Preliminary evaluation of a nest usage sensor to detect double nest occupations of laying hens.

    Science.gov (United States)

    Zaninelli, Mauro; Costa, Annamaria; Tangorra, Francesco Maria; Rossi, Luciana; Agazzi, Alessandro; Savoini, Giovanni

    2015-01-26

    Conventional cage systems will be replaced by housing systems that allow hens to move freely. These systems may improve hens' welfare, but they lead to some disadvantages: disease, bone fractures, cannibalism, piling and lower egg production. New selection criteria for existing commercial strains should be identified considering individual data about laying performance and the behavior of hens. Many recording systems have been developed to collect these data. However, the management of double nest occupations remains critical for the correct egg-to-hen assignment. To limit such events, most systems adopt specific trap devices and additional mechanical components. Others, instead, only prevent these occurrences by narrowing the nest, without any detection and management. The aim of this study was to develop and test a nest usage "sensor", based on imaging analysis, that is able to automatically detect a double nest occupation. Results showed that the developed sensor correctly identified the double nest occupation occurrences. Therefore, the imaging analysis resulted in being a useful solution that could simplify the nest construction for this type of recording system, allowing the collection of more precise and accurate data, since double nest occupations would be managed and the normal laying behavior of hens would not be discouraged by the presence of the trap devices.

  13. Detection of Mycobacterium Tuberculosis by using PCR

    International Nuclear Information System (INIS)

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  14. Molecular survey of Bartonella henselae and Bartonella clarridgeiae in pet cats across Japan by species-specific nested-PCR.

    Science.gov (United States)

    Sato, S; Kabeya, H; Negishi, A; Tsujimoto, H; Nishigaki, K; Endo, Y; Maruyama, S

    2017-10-01

    Cats are known to be the main reservoir for Bartonella henselae and Bartonella clarridgeiae, which are the agents of 'cat-scratch disease' in humans. In the present study, we investigated the prevalence of the two Bartonella species on 1754 cat bloods collected from all prefectures in Japan during 2007-2008 by a nested-polymerase chain reaction (PCR) targeting the 16S-23S rRNA internal transcribed spacer region. Overall, Bartonella DNA was detected in 4·6% (80/1754) of the cats examined. The nested-PCR showed that 48·8% (39/80) of the positive cats were infected with B. henselae mono-infection, 33·8% (27/80) with B. clarridgeiae mono-infection and 17·5% (14/80) were infected with both species. The prevalence (5·9%; 65/1103) of Bartonella infection in the western part of Japan was significantly higher than that (2·3%; 15/651) of eastern Japan (P < 0·001). Statistical analysis of the cats examined suggested a significant association between Bartonella infection and FeLV infection (OR = 1·9; 95% CI = 1·1-3·4), but not with FIV infection (OR = 1·6; 95% CI = 1·0-2·6).

  15. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  16. Comparison of Four Human Papillomavirus Genotyping Methods: Next-generation Sequencing, INNO-LiPA, Electrochemical DNA Chip, and Nested-PCR.

    Science.gov (United States)

    Nilyanimit, Pornjarim; Chansaenroj, Jira; Poomipak, Witthaya; Praianantathavorn, Kesmanee; Payungporn, Sunchai; Poovorawan, Yong

    2018-03-01

    Human papillomavirus (HPV) infection causes cervical cancer, thus necessitating early detection by screening. Rapid and accurate HPV genotyping is crucial both for the assessment of patients with HPV infection and for surveillance studies. Fifty-eight cervicovaginal samples were tested for HPV genotypes using four methods in parallel: nested-PCR followed by conventional sequencing, INNO-LiPA, electrochemical DNA chip, and next-generation sequencing (NGS). Seven HPV genotypes (16, 18, 31, 33, 45, 56, and 58) were identified by all four methods. Nineteen HPV genotypes were detected by NGS, but not by nested-PCR, INNO-LiPA, or electrochemical DNA chip. Although NGS is relatively expensive and complex, it may serve as a sensitive HPV genotyping method. Because of its highly sensitive detection of multiple HPV genotypes, NGS may serve as an alternative for diagnostic HPV genotyping in certain situations. © The Korean Society for Laboratory Medicine

  17. A nested PCR approach for improved recovery of archaeal 16S rRNA gene fragments from freshwater samples

    NARCIS (Netherlands)

    Vissers, E.W.; Bodelier, P.L.E.; Muyzer, G.; Laanbroek, R.

    2009-01-01

    In a survey on the presence of archaea in a number of European lakes, it was found that known archaeal primer sets for PCR were not suited for use in freshwater environment, as some lack selectivity, while others were too selective. A nested PCR was developed for denaturing gradient gel

  18. Detection of Flavobacterium psychrophilum from fish tissue and water samples by PCR amplification

    DEFF Research Database (Denmark)

    Wiklund, T.; Madsen, Lone; Bruun, Morten Sichlau

    2000-01-01

    investigation, the possible detection of Fl. psychrophilum from fish tissue and water samples was examined using nested PCR with DNA probes against a sequence of the 16S rRNA genes. The DNA was extracted using Chelex(R) 100 chelating resin. The primers, which were tested against strains isolated from diseased...... fish, healthy fish, fish farm environments and reference strains, proved to be specific for Fl. psychrophilum. The obtained detection limit of Fl. psychrophilum seeded into rainbow trout brain tissue was 0.4 cfu in the PCR tube, corresponding to 17 cfu mg(-1) brain tissue. The PCR-assay proved...... to be more sensitive than agar cultivation of tissue samples from the brain of rainbow trout injected with Fl. psychrophilum. In non-sterile fresh water seeded with Fl. psychrophilum the detection limit of the PCR- assay was 1.7 cfu in the PCR tube, corresponding to 110 cfu ml(-1) water. The PCR...

  19. Comparison of Microscopy, Nested-PCR, and Real-Time-PCR Assays Using High-Throughput Screening of Pooled Samples for Diagnosis of Malaria in Asymptomatic Carriers from Areas of Endemicity in Myanmar

    Science.gov (United States)

    Wang, Bo; Han, Soe-Soe; Cho, Cho; Han, Jin-Hee; Cheng, Yang; Lee, Seong-Kyun; Galappaththy, Gawrie N. L; Thimasarn, Krongthong; Soe, Myat Thu; Oo, Htet Wai; Kyaw, Myat Phone

    2014-01-01

    Asymptomatic infection is an important obstacle for controlling disease in countries where malaria is endemic. Because asymptomatic carriers do not seek treatment for their infections, they can have high levels of gametocytes and constitute a reservoir available for new infection. We employed a sample pooling/PCR-based molecular detection strategy for screening malaria infection in residents from areas of Myanmar where malaria is endemic. Blood samples (n = 1,552) were collected from residents in three areas of malaria endemicity (Kayin State, Bago, and Tanintharyi regions) of Myanmar. Two nested PCR and real-time PCR assays showed that asymptomatic infection was detected in about 1.0% to 9.4% of residents from the surveyed areas. The sensitivities of the two nested PCR and real-time PCR techniques were higher than that of microscopy examination (sensitivity, 100% versus 26.4%; kappa values, 0.2 to 0.5). Among the three regions, parasite-positive samples were highly detected in subjects from the Bago and Tanintharyi regions. Active surveillance of residents from regions of intense malaria transmission would reduce the risk of morbidity and mitigate transmission to the population in these areas of endemicity. Our data demonstrate that PCR-based molecular techniques are more efficient than microscopy for nationwide surveillance of malaria in countries where malaria is endemic. PMID:24648557

  20. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  1. A comparison between the efficiency of the Xpert MTB/RIF assay and nested PCR in identifying Mycobacterium tuberculosis during routine clinical practice.

    Science.gov (United States)

    Kim, Cheol-Hong; Woo, Heungjeong; Hyun, In Gyu; Kim, Changhwan; Choi, Jeong-Hee; Jang, Seung-Hun; Park, Sang Myeon; Kim, Dong-Gyu; Lee, Myung Goo; Jung, Ki-Suck; Hyun, Jeongwon; Kim, Hyun Soo

    2014-06-01

    Polymerase chain reaction (PCR) for the detection of Mycobacterium tuberculosis (MTB) is more sensitive, specific, and rapid than the conventional methods of acid-fast bacilli (AFB) smear and culture. The aim of this study was to determine if the Xpert MTB/rifampicin (RIF) assay had additional advantages over nested PCR for the detection of MTB in a geographical area with intermediate tuberculosis (TB) incidence. Between February and December 2013, the Xpert MTB/RIF assay and MTB nested PCR, as well as AFB smear and culture, were simultaneously performed on 198 clinical samples (160 pulmonary and 38 non-pulmonary specimens) collected from 171 patients hospitalized at Hallym University Medical Center for possible TB. The accuracy of the diagnosis of MTB culture-positive TB and the turnaround time of reporting laboratory results were calculated and compared. Rifampin resistance by the Xpert MTB/RIF assay was reviewed with that of conventional drug susceptibility testing (DST). The sensitivity, specificity, and positive and negative predictive values of the Xpert MTB/RIF assay and MTB nested PCR for diagnosis of MTB culture-positive pulmonary TB were 86.1% vs. 69.4% (P=0.1563), 97.8% vs. 94.1% (P=0.2173), 91.2% vs. 75.8% (P=0.1695), and 96.4% vs. 92.0% (P=0.2032), respectively. The median turnaround times of the Xpert MTB/RIF assay and MTB nested PCR were 0 [0-4] days and 4 [1-11] days, respectively (Pnested PCR for identifying MTB among clinically suspected TB patients, and the assay can be valuable in giving a timely identification of resistance to rifampin.

  2. Identification of Mycobacterium tuberculosis in Clinical Specimens of Patients Suspected of Having Extrapulmonary Tuberculosis by Application of Nested PCR on Five Different Genes.

    Science.gov (United States)

    Khosravi, Azar D; Alami, Ameneh; Meghdadi, Hossein; Hosseini, Atta A

    2017-01-01

    Definitive and rapid diagnosis of extrapulmonary tuberculosis (EPTB) is challenging since conventional techniques have limitations due to the paucibacillary nature of the disease. To increase the sensitivity of detection of Mycobacterium tuberculosis (MTB) in EPTB specimens, we performed a nested PCR assay targeting several genes of MTB on EPTB specimens. A total of 100 clinical specimens from suspected cases of EPTB were processed. Standard staining for acid fast bacilli (AFB) was performed as the preliminary screening test. Extracted DNAs from specimens were subjected to Nested PCR technique for the detection of five different MTB target genes of IS6110, IS1081, hsp65kd, mbp64 , and mtp40 . On performing AFB staining, only 13% of specimens were positive, of which ascites fluid (33.3%), followed by pleural effusion (30.8%) showed the greatest AFB positivity rate. We demonstrated slight improvement in yields in lymph node which comprised the majority of specimens in this study, by employing PCR targeted to IS6110 - and hsp65-genes in comparison to AFB staining. However, the yields in ascites fluid and pleural effusion were not substantially improved by PCR, but those from bone and wound were, as in nested PCR employing either gene, the same positivity rate were obtained for ascites fluid (33.3%), while for pleural effusion specimens only IS1081 based PCR showed identical positivity rate with AFB stain (30.8%). The results for bone and wound specimens, however, demonstrated an improved yield mainly by employing IS1081 gene. Here, we report higher detection rate of EPTB in clinical specimens using five different targeted MTB genes. This nested PCR approach facilitates the comparison and the selection of the most frequently detected genes. Of course this study demonstrated the priority of IS1081 followed by mtp40 and IS6110 , among the five tested genes and indicates the effectiveness of any of the three genes in the design of an efficient nested-PCR test that

  3. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  4. Detecting System of Nested Hardware Virtual Machine Monitor

    Directory of Open Access Journals (Sweden)

    Artem Vladimirovich Iuzbashev

    2015-03-01

    Full Text Available Method of nested hardware virtual machine monitor detection was proposed in this work. The method is based on HVM timing attack. In case of HVM presence in system, the number of different instruction sequences execution time values will increase. We used this property as indicator in our detection.

  5. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  6. Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

    Science.gov (United States)

    Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2015-07-01

    Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

  7. Nested-PCR and a new ELISA-based NovaLisa test kit for malaria diagnosis in an endemic area of Thailand.

    Science.gov (United States)

    Thongdee, Pimwan; Chaijaroenkul, Wanna; Kuesap, Jiraporn; Na-Bangchang, Kesara

    2014-08-01

    Microscopy is considered as the gold standard for malaria diagnosis although its wide application is limited by the requirement of highly experienced microscopists. PCR and serological tests provide efficient diagnostic performance and have been applied for malaria diagnosis and research. The aim of this study was to investigate the diagnostic performance of nested PCR and a recently developed an ELISA-based new rapid diagnosis test (RDT), NovaLisa test kit, for diagnosis of malaria infection, using microscopic method as the gold standard. The performance of nested-PCR as a malaria diagnostic tool is excellent with respect to its high accuracy, sensitivity, specificity, and ability to discriminate Plasmodium species. The sensitivity and specificity of nested-PCR compared with the microscopic method for detection of Plasmodium falciparum, Plasmodium vivax, and P. falciparum/P. vivax mixed infection were 71.4 vs 100%, 100 vs 98.7%, and 100 vs 95.0%, respectively. The sensitivity and specificity of the ELISA-based NovaLisa test kit compared with the microscopic method for detection of Plasmodium genus were 89.0 vs 91.6%, respectively. NovaLisa test kit provided comparable diagnostic performance. Its relatively low cost, simplicity, and rapidity enables large scale field application.

  8. The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.

    Science.gov (United States)

    Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won

    2012-11-01

      Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion.   Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers.   Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%).   MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.

  9. Nested-PCR do gene que codifica o antígeno b aplicada ao diagnóstico da tuberculose pulmonar Nested-PCR for gene that encodes the antigen b applied to the diagnosis of pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Karla Valéria Batista Lima

    2007-04-01

    Full Text Available A reação em cadeia da polimerase usada para amplificação de uma seqüência interna de um fragmento previamente amplificado (nested-PCR foi investigada como uma alternativa complementar a pesquisa de bacilos álcool ácido resistentes e a cultura do Mycobacterium tuberculosis em meio de Lowenstein-Jensen. Foram investigadas 144 amostras de escarro de pacientes suspeitos de tuberculose encaminhados ao Laboratório de Tuberculose do Instituto Evandro Chagas em Belém, no período de junho de 2002 a dezembro de 2003. Das 144 amostras, 121 foram caracterizadas como tuberculose, 119 foram positivas na cultura, 95 na baciloscopia e 128 na nested-PCR. A sensibilidade da nested-PCR foi 96% (116/121, enquanto a especificidade foi 48% (11/23. A nested-PCR poderá ser uma ferramenta complementar para o diagnóstico da tuberculose, pois apresenta sensibilidade equivalente à cultura, no entanto, necessita de maiores avaliações visando minimizar o número de resultados falso-positivos.The polymerase chain reaction used for amplifying an internal sequence of a previously amplified fragment (nested-PCR was investigated as a complementary alternative for searching for alcohol-acid resistant bacilli and Mycobacterium tuberculosis cultures in Lowenstein-Jensen medium. 144 sputum samples were investigated from patients with suspected tuberculosis that were sent to the Tuberculosis Laboratory of the Evandro Chagas Institute in Belém, between June 2002 and December 2003. From the 144 samples, 121 were characterized as tuberculosis: 119 were positive in cultures, 95 under bacilloscopy and 128 using nested-PCR. The sensibility of the nested-PCR was 96% (116/121, while the specificity was 48% (11/23. Nested-PCR may be a complementary tool for diagnosing tuberculosis, since it presents sensitivity equivalent to that of cultures. However, further evaluations are needed with the aim of minimizing the number of false-positive results.

  10. New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV).

    Science.gov (United States)

    Morozov, Vladimir A; Morozov, Alexey V; Denner, Joachim

    2016-05-01

    Pigs are frequently infected with porcine cytomegalovirus (PCMV). Infected adult animals may not present with symptoms of disease, and the virus remains latent. However, the virus may be transmitted to human recipients receiving pig transplants. Recently, it was shown that pig-to-non-human-primate xenotransplantations showed 2 to 3 times lower transplant survival when the donor pig was infected with PCMV. Therefore, highly sensitive methods are required to select virus-free pigs and to examine xenotransplants. Seven previously established PCR detection systems targeting the DNA polymerase gene of PCMV were examined by comparison of thermodynamic parameters of oligonucleotides, and new diagnostic nested PCR and real-time PCR systems with improved parameters and high sensitivity were established. The detection limit of conventional PCR was estimated to be 15 copies, and that of the nested PCR was 5 copies. The sensitivity of the real-time PCR with a TaqMan probe was two copies. An equal efficiency of the newly established detection systems was shown by parallel testing of DNA from sera and blood of six pigs, identifying the same animals as PCMV infected. These new diagnostic PCR systems will improve the detection of PCMV and therefore increase the safety of porcine xenotransplants.

  11. A nested PCR approach for unambiguous typing of pestiviruses infecting cattle.

    Science.gov (United States)

    Decaro, Nicola; Sciarretta, Rossana; Lucente, Maria Stella; Mari, Viviana; Amorisco, Francesca; Colaianni, Maria Loredana; Cordioli, Paolo; Parisi, Antonio; Lelli, Rossella; Buonavoglia, Canio

    2012-02-01

    An atypical pestivirus ('Hobi'-like pestivirus, putative bovine viral diarrhoea 3, BVDV-3) was identified firstly in contaminated foetal calf serum batches and isolated subsequently from an outbreak of respiratory disease in a cattle herd in Italy. The isolation of the novel pestivirus from animals affected clinically posed concerns about the validity of BVDV eradication programs, considering that 'Hobi'-like pestivirus (BVDV-3) is undetected or mistyped by the molecular diagnostic tools currently employed. In this paper, the development of a nested PCR (nPCR) assay for unambiguous typing of all bovine pestiviruses is reported. The assay consisted of a first-round amplification using an oligonucleotide pair which binds to conserved sequences located in the 5' untranslated region and capsid gene, followed by a heminested PCR using virus-specific forward primers. The assay performances were evaluated analytically, showing good sensitivity and specificity. By analysis of 100 BVDV-positive samples typed using a nPCR assay discriminating ruminant pestiviruses, five samples recognised previously as BVDV-2 were not typed when submitted to the new assay (n=2) or reacted as 'Hobi'-like pestivirus BVDV-3 (n=3). Sequence analysis of the first-round amplification products showed that the untyped strains were border disease viruses, whereas the other three strains were true 'Hobi'-like viruses. The development of a molecular assay able to identify simultaneously all bovine pestiviruses known currently will help warrant biosafety of live vaccines and other biological products and assess the molecular epidemiology of 'Hobi'-like pestivirus, thus leading to the improvement of the eradication programs through unambiguous typing of pestiviruses infecting cattle. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  13. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

    2002-01-01

    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  14. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    Science.gov (United States)

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  15. Detection of occult HBV infection by nested PCR assay among ...

    African Journals Online (AJOL)

    Occult hepatitis B virus infection (OBI) has been reported among patients with chronic hepatitis C virus (HCV) infection and hepatocellular carcinoma (HCC). This study aimed to evaluate the prevalence of OBI in chronic hepatitis C patients with and without hepatocellular carcinoma. A total of 40 chronic hepatitis C patients ...

  16. Detection of occult HBV infection by nested PCR assay among ...

    African Journals Online (AJOL)

    Shereen E. Taha

    2013-07-10

    Jul 10, 2013 ... or produce S proteins with aberrant epitopes which are not de- tected by conventional ... Inclusion criteria were: an age of 18 years or over, proven HCV infection based on viral load ...... Revista da Sociedade · Brasileira de ...

  17. PCR detection of Burkholderia multivorans in water and soil samples.

    Science.gov (United States)

    Peeters, Charlotte; Daenekindt, Stijn; Vandamme, Peter

    2016-08-12

    Although semi-selective growth media have been developed for the isolation of Burkholderia cepacia complex bacteria from the environment, thus far Burkholderia multivorans has rarely been isolated from such samples. Because environmental B. multivorans isolates mainly originate from water samples, we hypothesized that water rather than soil is its most likely environmental niche. The aim of the present study was to assess the occurrence of B. multivorans in water samples from Flanders (Belgium) using a fast, culture-independent PCR assay. A nested PCR approach was used to achieve high sensitivity, and specificity was confirmed by sequencing the resulting amplicons. B. multivorans was detected in 11 % of the water samples (n = 112) and 92 % of the soil samples (n = 25) tested. The percentage of false positives was higher for water samples compared to soil samples, showing that the presently available B. multivorans recA primers lack specificity when applied to the analysis of water samples. The results of the present study demonstrate that B. multivorans DNA is commonly present in soil samples and to a lesser extent in water samples in Flanders (Belgium).

  18. Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.

    Science.gov (United States)

    West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D

    1995-01-01

    A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625

  19. Demonstration by a nested PCR for Mycoplasma pneumoniae that M. pneumoniae load in the throat is higher in patients hospitalised for M. pneumoniae infection than in non-hospitalised subjects

    NARCIS (Netherlands)

    Dorigo-Zetsma, J. W.; Zaat, S. A.; Vriesema, A. J.; Dankert, J.

    1999-01-01

    A nested PCR protocol to detect Mycoplasma pneumoniae DNA in throat specimens was developed. An amplification control (AC) template, which is amplified by the same primers as the M. pneumoniae target sequence, was constructed. The assay allowed highly specific and sensitive detection of M.

  20. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  1. Nest site selection by Kentish plover suggests a trade-off between nest-crypsis and predator detection strategies.

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Gómez-Serrano

    Full Text Available Predation is one of the main causes of adult mortality and breeding failure for ground-nesting birds. Micro-habitat structure around nests plays a critical role in minimizing predation risk. Plovers nest in sites with little vegetation cover to maximize the incubating adult visibility, but many studies suggest a trade-off between nest-crypsis and predator detection strategies. However, this trade-off has not been explored in detail because methods used so far do not allow estimating the visibility with regards to critical factors such as slope or plant permeability to vision. Here, we tested the hypothesis that Kentish plovers select exposed sites according to a predator detection strategy, and the hypothesis that more concealed nests survive longer according to a crypsis strategy. To this end, we obtained an accurate estimation of the incubating adult's field of vision through a custom built inverted periscope. Our results showed that plovers selected nest sites with higher visibility than control points randomly selected with regards to humans and dogs, although nests located in sites with higher vegetation cover survived longer. In addition, the flushing distance (i.e., the distance at which incubating adults leave the nest when they detect a potential predator decreased with vegetation cover. Consequently, the advantages of concealing the nest were limited by the ability to detect predators, thus indirectly supporting the existence of the trade-off between crypsis and predator detection. Finally, human disturbance also constrained nest choice, forcing plovers to move to inland sites that were less suitable because of higher vegetation cover, and modulated flushing behavior, since plovers that were habituated to humans left their nests closer to potential predators. This constraint on the width of suitable breeding habitat is particularly relevant for the conservation of Kentish Plover in sand beaches, especially under the current context of

  2. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  3. Comparative study of Gram stain, potassium hydroxide smear, culture and nested PCR in the diagnosis of fungal keratitis.

    Science.gov (United States)

    Badiee, Parisa; Nejabat, Mahmood; Alborzi, Abdolvahab; Keshavarz, Fatemeh; Shakiba, Elaheh

    2010-01-01

    This study seeks to evaluate the efficacy and practicality of the molecular method, compared to the standard microbiological techniques for diagnosing fungal keratitis (FK). Patients with eye findings suspected of FK were enrolled for cornea sampling. Scrapings from the affected areas of the infected corneas were obtained and were divided into two parts: one for smears and cultures, and the other for nested PCR analysis. Of the 38 eyes, 28 were judged to have fungal infections based on clinical and positive findings in the culture, smear and responses to antifungal treatment. Potassium hydroxide, Gram staining, culture and nested PCR results (either positive or negative) matched in 76.3, 42.1, 68.4 and 81.6%, respectively. PCR is a sensitive method but due to the lack of sophisticated facilities in routine laboratory procedures, it can serve only complementarily and cannot replace conventional methods. Copyright © 2010 S. Karger AG, Basel.

  4. Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification

    Directory of Open Access Journals (Sweden)

    Alexandr Krasota

    2016-01-01

    Full Text Available Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1% patients compared with 75 (47.2%, 53 (33.3% and 31 (19.5% achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14, E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71 in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF.

  5. Diagnóstico temprano en un brote epidémico del virus Dengue en Piura usando RT-PCR y nested-PCR

    Directory of Open Access Journals (Sweden)

    Oscar Nolasco

    1997-07-01

    Full Text Available Un test de diagnóstico temprano (RT-PCR y Nested-PCR fue evaluado y comparado con métodos convencionales (cultivo in vitro, IFI y MAC-ELISA. Treinta y cuatro sueros de pacientes correspondientes de un brote epidémico de la costa norte peruana (Mancora, Piura en mayo de 1997 fueron incluidos en este estudio. Todos los sueros fueron obtenidos de pacientes que presentaron en los primeros cinco días manifestaciones clínicas siendo diagnosticados luego como dengue serotipo 1. Asimismo, RT-PCR permitió diagnosticar 82% de los sueros (28/34, sin embargo Mac-ELISA y cultivo in vitro reconocieron unicamente 41% de los sueros (14/34 y 38% de los sueros (13/34 respectivamente. Por lo tanto, el uso de esta herramienta molecular (RT-PCR y Nested-PCR permitiró dar un diagnóstico temprano a estos pacientes y actuar inmediatamente ante la presencia de un brote epidémico.

  6. Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

    Science.gov (United States)

    Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

  7. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  9. Evaluation of nested polymerase chain reaction for the early detection of Leptospira spp. DNA in serum samples from patients with leptospirosis.

    Science.gov (United States)

    Blanco, Roberta Morozetti; Romero, Eliete Caló

    2014-04-01

    The aim of this study was to analyse the nested polymerase chain reaction (nested PCR) in human serum samples of patients with clinical manifestations of leptospirosis. The cases of leptospirosis were defined by the microagglutination test (MAT). The samples were collected in 2010. Of 1042 serum samples collected from 521 patients, 28 (5.4%) were considered positive cases of leptospirosis, and 493 (94.6%) were negative. Twenty-three confirmed cases had no MAT-detectable antibodies in the acute sample (mean of 5.6 days after onset). Nested PCR was positive in 22/23 (95.7%) patients during the acute phase of the disease, with negative results by MAT. Nested PCR was negative in all convalescent serum samples with positive results by MAT. All negative cases of leptospirosis were negative by nested PCR. The nested PCR is an alternative diagnostic tool for early detection of leptospires in sera during the first 7 days of the disease. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Avian metapneumovirus RT-nested-PCR: a novel false positive reducing inactivated control virus with potential applications to other RNA viruses and real time methods.

    Science.gov (United States)

    Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J

    2012-12-01

    Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. [Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

    Science.gov (United States)

    Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

    2005-07-01

    To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

  12. Two unusual hepatitis C virus subtypes, 2j and 2q, in Spain: Identification by nested-PCR and sequencing of a NS5B region.

    Science.gov (United States)

    Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P

    2015-10-01

    Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.

  13. Combined use of real-time PCR and nested sequence-based typing in survey of human Legionella infection.

    Science.gov (United States)

    Qin, T; Zhou, H; Ren, H; Shi, W; Jin, H; Jiang, X; Xu, Y; Zhou, M; Li, J; Wang, J; Shao, Z; Xu, X

    2016-07-01

    Legionnaires' disease (LD) is a globally distributed systemic infectious disease. The burden of LD in many regions is still unclear, especially in Asian countries including China. A survey of Legionella infection using real-time PCR and nested sequence-based typing (SBT) was performed in two hospitals in Shanghai, China. A total of 265 bronchoalveolar lavage fluid (BALF) specimens were collected from hospital A between January 2012 and December 2013, and 359 sputum specimens were collected from hospital B throughout 2012. A total of 71 specimens were positive for Legionella according to real-time PCR focusing on the 5S rRNA gene. Seventy of these specimens were identified as Legionella pneumophila as a result of real-time PCR amplification of the dotA gene. Results of nested SBT revealed high genetic polymorphism in these L. pneumophila and ST1 was the predominant sequence type. These data revealed that the burden of LD in China is much greater than that recognized previously, and real-time PCR may be a suitable monitoring technology for LD in large sample surveys in regions lacking the economic and technical resources to perform other methods, such as urinary antigen tests and culture methods.

  14. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

    Science.gov (United States)

    Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

    2017-08-01

    Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

  15. PCR detection of potato cyst nematode.

    Science.gov (United States)

    Reid, Alex

    2009-01-01

    Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.

  16. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    Science.gov (United States)

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  17. Detection and quantification of Spirocerca lupi by HRM qPCR in fecal samples from dogs with spirocercosis.

    Science.gov (United States)

    Rojas, Alicia; Segev, Gilad; Markovics, Alex; Aroch, Itamar; Baneth, Gad

    2017-09-19

    Spirocerca lupi, the dog oesophageal nematode, causes a potentially fatal disease in domestic dogs, and is currently clinically diagnosed by coproscopy and oesophagoscopy. To date, a single molecular method, a semi-nested PCR, targeting the cox1 gene, has been developed to aid in the diagnosis of spirocercosis. The present study describes three novel high-resolution melt (HRM) quantitative PCR (qPCR) assays targeting fragments of the ITS1, 18S and cytb loci of S. lupi. The performance of these molecular assays in feces was compared to fecal flotation and to the previously described cox1 gene semi-nested PCR in 18 fecal samples from dogs with clinical oesophageal spirocercosis diagnosed by oesophagoscopy. The HRM qPCR for ITS1 and 18S were both able to detect 0.2 S. lupi eggs per gram (epg), while the HRM qPCR for the cytb and the semi-nested PCR for the cox1 detected 6 epg and 526 epg, respectively. Spirocerca lupi was detected in 61.1%, 44.4%, 27.8%, 11.1% and 5.6% of the fecal samples of dogs diagnosed with spirocercosis by using the ITS1 and 18S HRM qPCR assays, fecal flotation, cytb HRM qPCR and cox1 semi-nested PCR, respectively. All dogs positive by fecal flotation were also positive by ITS1 and 18S HRM qPCRs. Quantification of S. lupi eggs was successfully achieved in the HRM qPCRs and compared to the fecal flotation with no significant difference in the calculated concentrations between the HRM qPCRs that detected the 18S and ITS1 loci and the fecal flotation. The HRM qPCR for the 18S cross-amplified DNA from Toxocara canis and Toxascaris leonina. In contrast, the HRM qPCR for ITS1 did not cross-amplify DNA from other canine gastrointestinal parasites. This study presents two new molecular assays with significantly increased sensitivity for confirming and quantifying fecal S. lupi eggs. Of these, the HRM qPCR for ITS1 showed the best performance in terms of the limit of detection and absence of cross-amplification with other parasites. These assays will be

  18. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  19. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  20. Serological and nested PCR survey to determine the occurrence of Chlamydia infections in the Polish cattle population.

    Science.gov (United States)

    Szymańska-Czerwińska, Monika; Niemczuk, Krzysztof; Galińska, Elżbieta Monika

    2013-01-01

    Chlamydia spp. is an obligate intracellular agent that causes chlamydiosis in animals and humans. The aim of the presented study was to investigate the prevalence of Chlamydia infection in the Polish cattle population, both asymptomatic and having reproductive disorders. The study was performed on 4,475 serum samples collected from 16 Polish provinces at the turn of 2009-2011. The samples (3,419 from asymptomatic cattle and 1,056 from cattle with reproductive disorders) were tested by complement fixation test (CFT). Moreover, 160 and 201 samples of biological materials from both groups of cattle, respectively, were tested by nested PCR. The results obtained for two tested groups were compared by χ2 (ch-squared) test, both individually for each region (province), and generally for the whole country. The CFT results showed that the seroprevalence of Chlamydia spp. infections in the asymptomatic cattle population was 4.15%, while in the cattle with reproductive disorders--7.20%. There was a significant statistical difference between compared groups for whole country, but there were no significant differences for individual provinces. The results of PCR showed that Chlamydia spp. was present in both asymptomatic cattle and cattle having reproductive disorders. The nested PCR study confirmed the presence of Chlamydia abortus and Chlamydia suis in the tested samples. The presented study indicates that infections with Chlamydia spp. are present among Polish cattle, but the percentage of infected animals is not high.

  1. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  2. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  3. Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.

    Science.gov (United States)

    Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein

    2016-01-01

    We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

  4. Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear

    Directory of Open Access Journals (Sweden)

    Gholamreza HASSANPOUR

    2016-12-01

    Full Text Available Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria.Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction.Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR.Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

  5. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    International Nuclear Information System (INIS)

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  6. Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology.

    Science.gov (United States)

    Khan, S; Miah, M R; Khatun, S

    2015-12-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (Ptyphoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

  7. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

  8. Ureaplasma parvum prosthetic joint infection detected by PCR.

    Science.gov (United States)

    Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

    2014-06-01

    We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Malaria diagnosis from pooled blood samples: comparative analysis of real-time PCR, nested PCR and immunoassay as a platform for the molecular and serological diagnosis of malaria on a large-scale

    Directory of Open Access Journals (Sweden)

    Giselle FMC Lima

    2011-09-01

    Full Text Available Malaria diagnoses has traditionally been made using thick blood smears, but more sensitive and faster techniques are required to process large numbers of samples in clinical and epidemiological studies and in blood donor screening. Here, we evaluated molecular and serological tools to build a screening platform for pooled samples aimed at reducing both the time and the cost of these diagnoses. Positive and negative samples were analysed in individual and pooled experiments using real-time polymerase chain reaction (PCR, nested PCR and an immunochromatographic test. For the individual tests, 46/49 samples were positive by real-time PCR, 46/49 were positive by nested PCR and 32/46 were positive by immunochromatographic test. For the assays performed using pooled samples, 13/15 samples were positive by real-time PCR and nested PCR and 11/15 were positive by immunochromatographic test. These molecular methods demonstrated sensitivity and specificity for both the individual and pooled samples. Due to the advantages of the real-time PCR, such as the fast processing and the closed system, this method should be indicated as the first choice for use in large-scale diagnosis and the nested PCR should be used for species differentiation. However, additional field isolates should be tested to confirm the results achieved using cultured parasites and the serological test should only be adopted as a complementary method for malaria diagnosis.

  10. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  11. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  12. Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....

  13. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  14. Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR

    Directory of Open Access Journals (Sweden)

    Roman Wölfel

    2012-08-01

    Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

  15. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  16. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  17. Shape based kinetic outlier detection in real-time PCR

    Directory of Open Access Journals (Sweden)

    D'Atri Mario

    2010-04-01

    Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.

  18. Detection of Streptococcus pneumoniae in whole blood by PCR.

    Science.gov (United States)

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

    1995-03-01

    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  19. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Science.gov (United States)

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  20. Characterization of Leishmania Parasites Isolated From Kala- azar Patients in Kohgiloyeh and Boyerahmad, Using Semi-Nested PCR

    Directory of Open Access Journals (Sweden)

    B Sarkari

    2006-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Visceral leishmaniasis (VL is a disease commonly known as Kala-azar caused by protozoan parasites of the genus Leishmania including L. donovani, L. infantum and L. chagasi. VL is sporadic in many areas of Iran and is endemic in a few provinces such as Fars, Azarbayjan, Bushehr, Ardabil and Qom. VL has been reported from some areas of Kohgiloyeh and Boyerahmad and this study aimed to characterize the causative agent of VL in this region. Materials & Methods: Bone marrow sample was obtained from 6 VL patients from children department in Imam Sajad hospital in Yasuj. DNA was extracted from the obtained samples and was checked by semi-nested PCR to determine the species of the parasite. To do that, a segment of minicircle kinetoplast DNA was amplified, using LINR4 and LIN17 primers. Products of PCR were evaluated by electrophoresis, using 1.5% agarose and stained with ethidium bromide. Results: Parasitologically examination of bone marrow smears demonstrated amastigotes form of the parasite in the samples. For mass cultivation, isolated parasites were cultured in diphasic NNN followed by RPMI 1640 media. All the samples produced a 720 bp band in PCR assay. The isolates were compared with referent strains and it was revealed that all the isolates were L. infantum. Conclusion: Findings of this study demonstrated that the causative agent of VL in Kohgiloyeh and Boyerahmad was L. infantum. Further study is needed to explore other aspects of VL in this region.

  1. Occult HCV Infection (OCI) Diagnosis in Cirrhotic and Non-cirrhotic Naïve Patients by Intra-PBMC Nested Viral RNA PCR.

    Science.gov (United States)

    Abd Alla, Mohamed Darwish Ahmed; Elibiary, Saleh Ahmed; Wu, George Y; El-Awady, Mostafa Kamel

    2017-12-28

    Background and Aims: Occult HCV infections (OCIs) include IgG antibody seronegative cryptogenic (COCIs), as well as seropositive secondary naïve (SNOCIs) and experienced (SEOCIs) cases. We used peripheral-blood-mononuclear-cell (PBMC)-PCR to evaluate COCIs and SNOCIs prevalence, serum HCV spontaneous disappearance (SCSD) in naïve cirrhotics and non-cirrhotics, intra-PBMC HCV-RNA strands in relation to cirrhosis density in naïve non-viremia cases, and HCV-RNA seroconversion after 1 year of solitary naïve intra-PBMC infection. Methods: The anti-HCV IgG antibody-positive naïve-patients ( n = 785) were classified into viremic ( n = 673) and non-viremic [ n = 112, including non-cirrhotics ( n = 55) and cirrhotics ( n = 57)], and 62 controls without evidence of HCV-infection. Controls and post-HCV non-viremia cases ( n = 62+112 = 174) were submitted to hepatic Fibroscan-Elastography evaluation. All subjects ( n = 847) were screened for intra-PBMC HCV-RNA sense and antisense strands by nested-PCR. Results: Naïve-OCI cases (4.84%) that were diagnosed by PBMC-PCR significantly raised the total numbers of HCV-infection to 714 ( p = 0.01). The percent positivity of SNOCIs (34.82%) was significantly higher than for asymptomatic-COCIs (3.125%, p = 0.0001). Comparing PBMC-PCR with single-step-reverse-transcription (SRT)-PCR for identification of SCSD in naïve IgG antibody-positive non-viremia patients ( n = 112) revealed a decline in SCSD prevalence by PBMC-PCR (from 14.27% to 9.3%), regardless of presence of hepatic cirrhosis ( p = 0.03). SCSD was found to be higher by PBMC-PCR in non-cirrhotics compared to cirrhotics ( p = 0.0001), with an insignificant difference when using SRT-PCR ( p = 0.45). Intra-PBMC HCV-RNA infection was significantly more frequent in cirrhotics compared to both non-cirrhotics and controls ( p < 0.0005). An increased hepatic fibrosis density was recognized in intra-PBMC HCV-RNA infection with sense ( p = 0.0001) or antisense strand ( p = 0

  2. Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Partha Sarathi Mandal

    2017-03-01

    Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

  3. Single Cell HLA Matching Feasibility by Whole Genomic Amplification and Nested PCR

    Institute of Scientific and Technical Information of China (English)

    Xiao-hong Li; Fang-yin Meng

    2004-01-01

    @@ PCR based single-cell DNA analysis has been widely used in forensic science, preimplantation genetic diagnosis and so on. However, the original sample cannot be efficiently retrieved following single cell PCR, consequently the amount of information gained is limited. HLA system is too sophisticated that it is very hard to complete HLA typing by single cell. A Taq polymerase-based method using random primers to amplify whole genome termed as whole genome amplification (WGA) has demonstrated to be a useful method in increasing the copies of minimum sample. We establish a technique in this study to amplify HLA-A and HLA-B loci at same time in a single cell using WGA.

  4. Urine-Based Nested PCR for the Diagnosis of Mycobacterium tuberculosis: A Comparative Study Between HIV-Positive and HIV-Negative Patients.

    Science.gov (United States)

    Jamshidi Makiani, Mahin; Davoodian, Parivash; Baghershiroodi, Mahnaz; Nejatizadeh, Abdol Azim; Fakkhar, Farideh; Zangeneh, Mehrangiz; Jahangiri, Nadia

    2016-08-01

    While tuberculosis (TB) can be diagnosed by microscopy and culture, the sensitivity of Ziehl-Neelsen staining is variable and culture results require 4 - 8 weeks to be determined. Polymerase chain reaction (PCR) and its modifications, including nested PCR, might be promising methods for the rapid diagnosis of TB. This study aimed to evaluate the performance of nested PCR on urine samples of human immunodeficiency virus (HIV)-positive and -negative patients with different manifestations of clinical TB. In a prospective study, three early-morning urine samples from 100 patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were evaluated using a molecular target with insertion element IS6110, specific to the Mycobacterium tuberculosis genome, and nested PCR was performed. The results were analyzed with SPSS version 22. A total of 100 patients, including 74 (74%) with PTB and 26 (26%) with EPTB, were enrolled. Positive smears were seen in 38 patients (38%). Lymph nodes were the most commonly involved organ in 14 of the 26 (53.8%) EPTB patients (13.5%). Seven (23.1%) of the EPTB patients were HIV-positive. Urine PCR was positive in only 28 patients (28%). Seven HIV-positive patients with PTB showed positive urine PCR results. Moreover, PCR results were positive in only one of the seven HIV-positive subjects with EPTB. Positive PCR results were found in 20 of the 73 HIV-negative patients (27.4%) and in 8 of the 27 HIV-positive patients (29.6%). Therefore, there was no significant difference between the HIV-negative and HIV-positive patients for urine PCR (sensitivity 29.6%, specificity 72.6%; positive and negative predictive values 28% and 72%, respectively; P = 0.138). Nested PCR showed the same sensitivity in HIV-positive and HIV-negative patients. It can be applied as a rapid technique for the diagnosis of TB.

  5. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  6. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  7. Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

    Science.gov (United States)

    Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

    2016-03-12

    Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

  8. Detection of Bartonella henselae DNA in clinical samples including peripheral blood of immune competent and immune compromised patients by three nested amplifications

    Directory of Open Access Journals (Sweden)

    Karina Hatamoto Kawasato

    2013-02-01

    Full Text Available Bacteria of the genus Bartonella are emerging pathogens detected in lymph node biopsies and aspirates probably caused by increased concentration of bacteria. Twenty-three samples of 18 patients with clinical, laboratory and/or epidemiological data suggesting bartonellosis were subjected to three nested amplifications targeting a fragment of the 60-kDa heat shock protein (HSP, the internal transcribed spacer 16S-23S rRNA (ITS and the cell division (FtsZ of Bartonella henselae, in order to improve detection in clinical samples. In the first amplification 01, 04 and 05 samples, were positive by HSP (4.3%, FtsZ (17.4% and ITS (21.7%, respectively. After the second round six positive samples were identified by nested-HSP (26%, eight by nested-ITS (34.8% and 18 by nested-FtsZ (78.2%, corresponding to 10 peripheral blood samples, five lymph node biopsies, two skin biopsies and one lymph node aspirate. The nested-FtsZ was more sensitive than nested-HSP and nested-ITS (p < 0.0001, enabling the detection of Bartonella henselae DNA in 15 of 18 patients (83.3%. In this study, three nested-PCR that should be specific for Bartonella henselae amplification were developed, but only the nested-FtsZ did not amplify DNA from Bartonella quintana. We conclude that nested amplifications increased detection of B. henselae DNA, and that the nested-FtsZ was the most sensitive and the only specific to B. henselae in different biological samples. As all samples detected by nested-HSP and nested-ITS, were also by nested-FtsZ, we infer that in our series infections were caused by Bartonella henselae. The high number of positive blood samples draws attention to the use of this biological material in the investigation of bartonellosis, regardless of the immune status of patients. This fact is important in the case of critically ill patients and young children to avoid more invasive procedures such as lymph nodes biopsies and aspirates.

  9. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

    Science.gov (United States)

    Chase, D.M.; Pascho, R.J.

    1998-01-01

    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

  10. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  11. The Prevalence of Toxoplasma Infection among Free-Ranging Chickens in Southern Iran Using IFA and Nested-PCR

    Directory of Open Access Journals (Sweden)

    GhR Hatam

    2009-12-01

    Full Text Available "nBackground: As consumption of chicken meat may be as one of the sources of human infection, this study was undertaken to determine the prevalence of T. gondii in farm chickens (Gallus gallus domesti­cus in Shiraz, southern Iran. "nMethods: Two hundred and thirty one blood samples were collected from farm chickens by a cluster ran­dom sampling method and tested for toxoplasmosis by indirect fluorescent antibody technique (IFAT. The samples of the brain, heart, and liver of the chickens were tested by a Nested PCR method. The re­sults were analyzed by SPSS software using Chi-Square test and a P value <0.05 was considered statically sig­nificant. "nResults: Out of 58 seropositive chickens, 29 (1:16 in eight, 1:32 in 14, 1:64 in five and 1:128 in two birds and out of seronegative chickens, three were enrolled in the study. The most infected tissue was liver (27 out of 29 and the lowest was the heart (16 out of 29 (α=0.05, P=0.002. None of the seronegative chick­ens was positive in PCR method. Only 2 out of 8 cases with a titer of 1:16 (as cut off point were negative in PCR method whereas the remained were positive. "nConclusion: Based on cultural and food habits in our area, the meat and viscera of chicken may be impor­tant sources of infection in human when consuming semi-cooked meats. Considering the high prevalence of toxoplasmosis in chickens, standards in chicken breeding, education of environmental health personnel and standardization for preparation and handling techniques are required by Health and Veterinary organizations.

  12. FTA card utility for PCR detection of Mycobacterium leprae.

    Science.gov (United States)

    Aye, Khin Saw; Matsuoka, Masanori; Kai, Masanori; Kyaw, Kyaw; Win, Aye Aye; Shwe, Mu Mu; Thein, Min; Htoo, Maung Maung; Htoon, Myo Thet

    2011-01-01

    The suitability of the FTA® elute card for the collection of slit skin smear (SSS) samples for PCR detection of Mycobacterium leprae was evaluated. A total of 192 SSS leprosy samples, of bacillary index (BI) 1 to 5, were collected from patients attending two skin clinics in Myanmar and preserved using both FTA® elute cards and 70% ethanol tubes. To compare the efficacy of PCR detection of DNA from each BI class, PCR was performed to amplify an M. leprae-specific repetitive element. Of the 192 samples, 116 FTA® elute card and 112 70% ethanol samples were PCR positive for M. leprae DNA. When correlated with BI, area under the curve (AUC) values of the respective receiver-operating characteristic curves were similar for the FTA® elute card and ethanol collection methods (AUC=0.6). Taken together, our results indicate that the FTA® elute card, which enables the collection, transport, and archiving of clinical samples, is an attractive alternative to ethanol preservation for the detection of M. leprae DNA.

  13. Detection of Epstein Barr virus in formalin-fixed paraffin tissues by fluorescent direct in situ PCR

    Directory of Open Access Journals (Sweden)

    N Marziliano

    2009-06-01

    Full Text Available Specific viral laboratory diagnosis of primary Epstein-Barr Virus (EBV infection is usually based on antibody-detection assays. However, molecular detection is also considered the reference standard assay for diagnosis of central nervous system infections and of most cases of nasopharyngeal carcinoma (NPC. One-step or nested polymerase chain reaction (PCR has rapidly replaced immunological assays based on virus-specific Ig antibodies for the laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis. In this article, we will present a rapid, sensitive and robust molecular tool for the viral detection of EBV (EBNA-1 within tissue specimens by making use of in situ PCR (IS-PCR.

  14. A triplex quantitative real-time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7.

    Science.gov (United States)

    Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-05-02

    Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.

  15. The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to Osteichthyan Phylogenetics with Nested PCR

    Science.gov (United States)

    Zhang, Peng

    2012-01-01

    Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for

  16. In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

    Science.gov (United States)

    Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

    2003-03-01

    SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

  17. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  18. Failure of PCR to Detect Treponema pallidum ssp. pertenue DNA in Blood in Latent Yaws.

    Directory of Open Access Journals (Sweden)

    Michael Marks

    Full Text Available Yaws, caused by Treponema pallidum ssp. pertenue, is a neglected tropical disease closely related to venereal syphilis and is targeted for eradication by 2020. Latent yaws represents a diagnostic challenge, and current tools cannot adequately distinguish between individuals with true latent infection and individuals who are serofast following successful treatment. PCR on blood has previously been shown to detect T. pallidum DNA in patients with syphilis, suggesting that this approach may be of value in yaws. We performed real-time PCR for Treponema pallidum ssp. pertenue on blood samples from 140 children with positive T. pallidum Particle Agglutination (TPPA and Rapid Plasma Reagin (RPR tests and 7 controls (negative serology, all collected as part of a prospective study of yaws in the Solomon Islands. All samples were also tested by a nested PCR for T. pallidum. 12 patients had clinical evidence of active yaws whilst 128 were considered to have latent yaws. 43 children had high titre rapid plasma reagins (RPRs of ≥1:32. PCR testing with both assays gave negative results in all cases. It is possible that the failure to detect T. pallidum ssp. pertenue in blood reflects lower loads of organism in latent yaws compared to those in latent infection with T. pallidum ssp. pertenue, and/or a lower propensity for haematogenous dissemination in yaws than in syphilis. As the goal of the yaws control programme is eradication, a tool that can differentiate true latent infection from individuals who are serofast would be of value; however, PCR of blood is not that tool.

  19. Failure of PCR to Detect Treponema pallidum ssp. pertenue DNA in Blood in Latent Yaws.

    Science.gov (United States)

    Marks, Michael; Katz, Samantha; Chi, Kai-Hua; Vahi, Ventis; Sun, Yongcheng; Mabey, David C; Solomon, Anthony W; Chen, Cheng Y; Pillay, Allan

    2015-01-01

    Yaws, caused by Treponema pallidum ssp. pertenue, is a neglected tropical disease closely related to venereal syphilis and is targeted for eradication by 2020. Latent yaws represents a diagnostic challenge, and current tools cannot adequately distinguish between individuals with true latent infection and individuals who are serofast following successful treatment. PCR on blood has previously been shown to detect T. pallidum DNA in patients with syphilis, suggesting that this approach may be of value in yaws. We performed real-time PCR for Treponema pallidum ssp. pertenue on blood samples from 140 children with positive T. pallidum Particle Agglutination (TPPA) and Rapid Plasma Reagin (RPR) tests and 7 controls (negative serology), all collected as part of a prospective study of yaws in the Solomon Islands. All samples were also tested by a nested PCR for T. pallidum. 12 patients had clinical evidence of active yaws whilst 128 were considered to have latent yaws. 43 children had high titre rapid plasma reagins (RPRs) of ≥1:32. PCR testing with both assays gave negative results in all cases. It is possible that the failure to detect T. pallidum ssp. pertenue in blood reflects lower loads of organism in latent yaws compared to those in latent infection with T. pallidum ssp. pertenue, and/or a lower propensity for haematogenous dissemination in yaws than in syphilis. As the goal of the yaws control programme is eradication, a tool that can differentiate true latent infection from individuals who are serofast would be of value; however, PCR of blood is not that tool.

  20. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  1. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi

    Science.gov (United States)

    Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio

    2018-01-01

    A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297

  2. Application of bioinformatics on the detection of pathogens by Pcr

    International Nuclear Information System (INIS)

    Rezig, Slim; Sakhri, Saber

    2007-01-01

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  3. Study on Sand Flies as a Vector(s of Cutaneous Leishmaniasis by Nested PCR in Rural Areas of Damghan District, Semnan Province

    Directory of Open Access Journals (Sweden)

    Y. Rasi

    2012-01-01

    Full Text Available Introduction & Objective: Cutaneous Leishmaniasis is caused by obligatory intracellular parasite of genus Lieshmania. The disease is reported from more than half of Iran's provinces. Various species of sand flies are vector of the disease. Determination of vectors and gaining knowledge about them are important for devising of control program. Materials & Methods: This survey was performed as a cross-sectional study in order to determine the vector(s of cutaneous leishmaniasis in Damghan district during 2008-2009. Sand flies were collected from indoors and outdoors by sticky traps twice in month from April to November. Head and last abdominal segments of the samples were removed and mounted in a drop of Puri’s medium and identified. The rest of the sand flies' bodies was subjected to DNA extraction for molecular detection of Leishmania parasite by Nested PCR using specific primers of minicircle kinetoplast DNAResults: Totally, 6110 sand flies in 8 species were collected. P. papatasi had high density (46.7%. Examination of 280 female sand flies by Nested PCR showed that 28 sand flies (10%include 24 specimens P.papatasi (85.7% and 4 specimens P.caucasicus(14.3%were found naturally infected with L.major. The highest rate of infected sandflies were observed in rodents burrow (42.9%. Maximum rate of sand fly infection was in September (89.3%. Conclusion: With respect to high density of P.papatasi and isolation of L.major from it, this species was the main vector of the disease. Detection of L.major from P.caucasicus shows that this species was the secondary vector in rodent burrow. The highest rate of sand leis infected was in September, so personal protection in this month is very important and necessary. Regarding to the high density of vectors and high infection rate of them taking actions to decrease the sand fly abundance and prevention of human biting are suggested.(Sci J Hamadan Univ Med Sci 2012;18(4:47-52

  4. Comparison of a stool antigen detection kit and PCR for diagnosis of Entamoeba histolytica and Entamoeba dispar infections in asymptomatic cyst passers in Iran.

    Science.gov (United States)

    Solaymani-Mohammadi, Shahram; Rezaian, Mostafa; Babaei, Zahra; Rajabpour, Azam; Meamar, Ahmad R; Pourbabai, Ahmad A; Petri, William A

    2006-06-01

    The present study was conducted to compare stool antigen detection with PCR for the diagnosis of Entamoeba sp. infection in asymptomatic cyst passers from Iran. Entamoeba dispar and, in one case, E. moshkovskii were the Entamoeba spp. found in the amebic cyst passers. There was a 100% correlation between the results from the TechLab E. histolytica II stool antigen kit and those from nested PCR. We concluded that E. dispar is much more common in asymptomatic cyst passers in Iran and that antigen detection and PCR are comparable diagnostic modalities.

  5. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    Science.gov (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  6. Study on sensitivity of southern blotting hybridization using a 32P-labeled probe of PCR products in detecting human cytomegalovirus

    International Nuclear Information System (INIS)

    Bu Hengfu; Chen Juan; Shen Rongsen; Ma Liren; Xu Yongqiang

    1996-01-01

    Southern blotting hybridization (SBH) using a 32 P-labeled probe is one of the most practical methods for genetic diagnosis of pathogen. On the basis of establishing PCR and nested PCR for detecting human cytomegalovirus (HCMV), a 32 P-labeled probe was prepared with the amplified products of 613 bp PCR outer primers and hybridized with 300 bp inner primer amplified product, resulting in increase in detecting sensitivity from 17 ng (in 1.2% agarose electrophoresis) before SBH to 500 pg (autoradiographed), in other words, increasing the sensitivity of detecting HCMV by 10 2 dilutions after using SBH. The method of PCR and SBH using a 32 P-labeled probe could detect less than 1 gene copy of HCMV, therefore, it is a rapid and reliable diagnosis method for detecting HCMV latent infection

  7. Fast detection of deletion breakpoints using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Gulshara Abildinova

    2016-01-01

    Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

  8. Immunoliposome-PCR: a generic ultrasensitive quantitative antigen detection system

    Directory of Open Access Journals (Sweden)

    He Junkun

    2012-06-01

    Full Text Available Abstract Background The accurate quantification of antigens at low concentrations over a wide dynamic range is needed for identifying biomarkers associated with disease and detecting protein interactions in high-throughput microarrays used in proteomics. Here we report the development of an ultrasensitive quantitative assay format called immunoliposome polymerase chain reaction (ILPCR that fulfills these requirements. This method uses a liposome, with reporter DNA encapsulated inside and biotin-labeled polyethylene glycol (PEG phospholipid conjugates incorporated into the outer surface of the liposome, as a detection reagent. The antigenic target is immobilized in the well of a microplate by a capture antibody and the liposome detection reagent is then coupled to a biotin-labeled second antibody through a NeutrAvidin bridge. The liposome is ruptured to release the reporter DNA, which serves as a surrogate to quantify the protein target using real-time PCR. Results A liposome detection reagent was prepared, which consisted of a population of liposomes ~120 nm in diameter with each liposome possessing ~800 accessible biotin receptors and ~220 encapsulated reporters. This liposome detection reagent was used in an assay to quantify the concentration of carcinoembryonic antigen (CEA in human serum. This ILPCR assay exhibited a linear dose–response curve from 10-10 M to 10-16 M CEA. Within this range the assay coefficient of variance was Conclusions The ILPCR assay has several advantages over other immuno-PCR methods. The reporter DNA and biotin-labeled PEG phospholipids spontaneously incorporate into the liposomes as they form, simplifying preparation of the detection reagent. Encapsulation of the reporter inside the liposomes allows nonspecific DNA in the assay medium to be degraded with DNase I prior to quantification of the encapsulated reporter by PCR, which reduces false-positive results and improves quantitative accuracy. The ability to

  9. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  10. Detection of Fusarium oxysporum f.sp. basilici in substrates and roots by PCR.

    Science.gov (United States)

    Pugliese, M; Ferrocino, I; Gullino, M L; Garibaldi, A

    2013-01-01

    Fusarium oxysporum is a soil-borne fungus that causes vascular wilts in a wide variety of plant species. Basil is recognized as an ecological niche for Fusarium oxysporum f.sp. basilici (FOB) and this fungus is now present in most countries where basil is cultivated. The rapid identification of the species affecting basil plants is necessary to define a successful method for crop protection. The aim of this study was to develop a PCR method for the rapid detection of Fusarium oxysporum f. sp. basilici in substrates. The specificity of the primers used was tested using the DNA extracted directly from substrate samples. Fusarium oxysporum f.sp. basilici was artificially inoculated with decreasing amounts in a commercial substrate (sphagnum peat moss) and in a mixture with 40% of municipal compost, after steam disinfestation. Basil seeds (cv. Fine verde) were sown in pots that were laid on a bench in the greenhouse. At time 0 and after 7, 14 and 21 days from the inoculation, substrate and root samples were collected and prepared for microbial analysis and for the DNA extraction. DNA extraction was carried out using NucleoSpin Soil Kit (Macherey-Nagel, Germany). PCR amplification for the specific detection was carried out using primer sets Bik 1 (5'-ATT CAA GAG CTA AAG GTC C-3') and Bik 4 (5'-TTT GAC CAA GAT AGA TGC C-3') for the first PCR, while primers Bik 1 + Bik 2 (5'-AAA GGT AGT ATA TCG GAG G-3') for the nested PCR to increase detection sensitivity. Disease incidence was also assessed 21 days after seeding. The results showed the presence of amplified fragments of the expected size when the concentration of F. oxysporum f.sp. basilici was at least 3.5 Log CFU g(-1) by using DNA extract directly from substrate, before roots were infected by the pathogen. The detection of Fusarium oxysporum f. sp. basilici by PCR method developed in this study is certainly simple and fast and can be useful for its reliable detection in substrate samples, but not to guarantee that

  11. Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

    Science.gov (United States)

    Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

    2010-12-01

    Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

  12. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas

    2011-01-01

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable

  13. Detection of Histoplasma capsulatum in Organic Fertilizers by Hc100 Nested Polymerase Chain Reaction and Its Correlation with the Physicochemical and Microbiological Characteristics of the Samples.

    Science.gov (United States)

    Gómez, Luisa F; Torres, Isaura P; Jiménez-A, María Del Pilar; McEwen, Juan Gmo; de Bedout, Catalina; Peláez, Carlos A; Acevedo, José M; Taylor, María L; Arango, Myrtha

    2018-05-01

    Histoplasma capsulatum is the causative agent of histoplasmosis and this fungus inhabits soils rich in phosphorus and nitrogen that are enriched with bird and bat manure. The replacement of organic matter in agroecosystems is necessary in the tropics, and the use of organic fertilizers has increased. Cases and outbreaks due to the presence of the fungus in these components have been reported. The Instituto Colombiano Agropecuario resolution 150 of 2003 contains the parameters set by the Colombian Technical Standard (NTC 5167) on the physicochemical and microbiological features of fertilizers, but it does not regulate the search for H. capsulatum . The aim of this study was to demonstrate H. capsulatum presence in organic fertilizers by nested polymerase chain reaction (PCR). A total of 239 samples were collected: 201 (84.1%) corresponded to organic fertilizers, 30 (12.5%) to bird excrement, and 8 (3.4%) to cave soils. The Hc100 nested PCR had a detection limit of 0.1 pg/µL and a specificity of 100%. A total of 25 (10.5%) samples were positive and validated by sequencing. Seven of the positive samples represented locations where H. capsulatum was previously detected, suggesting the persistence of the fungus. No significant correlations were detected between the physicochemical and microbiological parameters with the presence of H. capsulatum by nested PCR, indicating the fungus existence in organic fertilizers that complied with the NTC 5167. The Hc100 nested PCR targeting H. capsulatum standardized in this work will improve the evaluation of organic fertilizers and ensure the prevention of outbreaks and cases due to manufacturing, marketing, and use of fertilizers contaminated with H. capsulatum .

  14. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  15. Evaluation of a single-tube fluorogenic RT-PCR assay for detection of bovine respiratory syncytial virus in clinical samples

    DEFF Research Database (Denmark)

    Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik

    2005-01-01

    understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...

  16. Hemi-nested PCR and RFLP methodologies for identifying blood meals of the Chagas disease vector, Triatoma infestans.

    Science.gov (United States)

    Roellig, Dawn M; Gomez-Puerta, Luis A; Mead, Daniel G; Pinto, Jesus; Ancca-Juarez, Jenny; Calderon, Maritza; Bern, Caryn; Gilman, Robert H; Cama, Vitaliano A

    2013-01-01

    Trypanosoma cruzi, the etiologic agent of Chagas disease, is transmitted by hematophagous reduviid bugs within the subfamily Triatominae. These vectors take blood meals from a wide range of hosts, and their feeding behaviors have been used to investigate the ecology and epidemiology of T. cruzi. In this study we describe two PCR-based methodologies that amplify a fragment of the 16S mitochondrial rDNA, aimed to improve the identification of blood meal sources for Triatoma infestans: a.--Sequence analyses of two heminested PCRs that allow the identification of mammalian and avian species, and b.--restriction fragment length polymorphism (RFLP) analysis from the mammalian PCR to identify and differentiate multi-host blood meals. Findings from both methodologies indicate that host DNA could be detected and the host species identified in samples from laboratory reared and field collected triatomines. The implications of this study are two-fold. First, these methods can be used in areas where the fauna diversity and feeding behavior of the triatomines are unknown. Secondly, the RFLP method led to the identification of multi-host DNA from T. infestans gut contents, enhancing the information provided by this assay. These tools are important contributions for ecological and epidemiological studies of vector-borne diseases.

  17. Evaluation of a PCR for detection of Actinobacillus pleuropneumoniae in mixed bacterial cultures from tonsils

    DEFF Research Database (Denmark)

    Gram, T.; Ahrens, Peter; Nielsen, J.P.

    1996-01-01

    strains of A. lignieresii. The lower detection limit of the PCR test was 10(3) A. pleuropneumoniae CFU/PCR test tube and was not affected by addition of 10(6) E. coli CFU/PCR test tube. Mixed bacterial cultures from tonsils of 101 pigs from 9 different herds were tested by culture and by PCR using four...

  18. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Detection of very low level Plasmodium falciparum infections using the nested polymerase chain reaction and a reassessment of the epidemiology of unstable malaria in Sudan

    DEFF Research Database (Denmark)

    Roper, C; Elhassan, I M; Hviid, L

    1996-01-01

    We have used the nested polymerase chain reaction (PCR) to assay for low level Plasmodium falciparum infections that were below the threshold of detection of blood film examination. This revealed a substantial group of asymptomatic, submicroscopically patent infections within the population...... of a Sudanese village present throughout the year although clinical malaria episodes were almost entirely confined to the transmission season. In our September, January, April, and June surveys, the PCR-detected prevalences were 13%, 19%, 24%, and 19%, respectively. These figures reveal a much higher prevalence...... of dry season infection than previous microscopic surveys have indicated. Furthermore, 20% of a cohort of 79 individuals were healthy throughout the September to November transmission season but were PCR-positive for P. falciparum in a least one of a series of samples taken in the ensuing months. Levels...

  20. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  1. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  2. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  3. Study On Application Of Molecular Techniques (RAPD-PCR And RAMP-PCR) To Detect Mutation In Rice Breeding

    International Nuclear Information System (INIS)

    Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham

    2007-01-01

    The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)

  4. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  5. Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

    Science.gov (United States)

    Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

    2017-06-01

    Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Detection and differentiation of Entamoeba histolytica and Entamoeba dispar isolates in clinical samples by PCR.

    Science.gov (United States)

    Helmy, Moshira M F; Rashed, Laila A; Abdel-Fattah, Hisham S

    2007-04-01

    A total of 140 out of 180 outpatients attended MISR University for Science and Technology Hospital complained of abdominal pain, diarrhoea and/or dysentery. Stool examination showed 47 (33.6%) had Entamoeba sp., 36 (25.7%) had cysts and 11 (7.9%) had trophozoites. Of 40 asymptomatic ones, 4 (10%) had cysts. A total of 51 positive stool samples for Entamoeba sp. (40 cysts & 11 trophozoites) were tested by Ne-sted Polymerase Chain Reaction (N-PCR) and Restriction Enzyme Digestion (RED) to clarify true E. histolytica from E. dispar. The results showed that 9/51 (17.6%) had E. dispar, while 31 (60.8%) had E. histolytica and 11 (21.6%) had dual infection with both E. histolytica and E. dispar. All E. histolytica PCR proved cases were from the symptomatic group, 11 had trophozoites and 34 had cysts. Thus, the result showed the potential use of molecular tools in detection of E. histolytica and E. dispar, and is a promising tool for epidemiology, particularly to differentiate pathogenic and non pathogenic Entamoeba sp.

  7. PCR detection of groundwater bacteria associated with colloidal transport

    International Nuclear Information System (INIS)

    Cruz-Perez, P.; Stetzenbach, L.D.; Alvarez, A.J.

    1996-01-01

    Colloidal transport may increase the amount of contaminant material than that which could be transported by water flow alone. The role of colloids in groundwater contaminant transport is complicated and may involve many different processes, including sorption of elements onto colloidal particles, coagulation/dissolution, adsorption onto solid surfaces, filtration, and migration. Bacteria are known to concentrate minerals and influence the transport of compounds in aqueous environments and may also serve as organic colloids, thereby influencing subsurface transport of radionuclides and other contaminants. The initial phase of the project consisted of assembling a list of bacteria capable of sequestering or facilitating mineral transport. The development and optimization of the PCR amplification assay for the detection of the organisms of interest, and the examination of regional groundwaters for those organisms, are presented for subsequent research

  8. PCR detection of groundwater bacteria associated with colloidal transport

    Energy Technology Data Exchange (ETDEWEB)

    Cruz-Perez, P.; Stetzenbach, L.D.; Alvarez, A.J.

    1996-02-29

    Colloidal transport may increase the amount of contaminant material than that which could be transported by water flow alone. The role of colloids in groundwater contaminant transport is complicated and may involve many different processes, including sorption of elements onto colloidal particles, coagulation/dissolution, adsorption onto solid surfaces, filtration, and migration. Bacteria are known to concentrate minerals and influence the transport of compounds in aqueous environments and may also serve as organic colloids, thereby influencing subsurface transport of radionuclides and other contaminants. The initial phase of the project consisted of assembling a list of bacteria capable of sequestering or facilitating mineral transport. The development and optimization of the PCR amplification assay for the detection of the organisms of interest, and the examination of regional groundwaters for those organisms, are presented for subsequent research.

  9. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  10. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    Directory of Open Access Journals (Sweden)

    Ram, S.

    2012-01-01

    Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.

  11. Human minisatellite alleles detectable only after PCR amplification.

    Science.gov (United States)

    Armour, J A; Crosier, M; Jeffreys, A J

    1992-01-01

    We present evidence that a proportion of alleles at two human minisatellite loci is undetected by standard Southern blot hybridization. In each case the missing allele(s) can be identified after PCR amplification and correspond to tandem arrays too short to detect by hybridization. At one locus, there is only one undetected allele (population frequency 0.3), which contains just three repeat units. At the second locus, there are at least five undetected alleles (total population frequency 0.9) containing 60-120 repeats; they are not detected because these tandem repeats give very poor signals when used as a probe in standard Southern blot hybridization, and also cross-hybridize with other sequences in the genome. Under these circumstances only signals from the longest tandemly repeated alleles are detectable above the nonspecific background. The structures of these loci have been compared in human and primate DNA, and at one locus the short human allele containing three repeat units is shown to be an intermediate state in the expansion of a monomeric precursor allele in primates to high copy number in the longer human arrays. We discuss the implications of such loci for studies of human populations, minisatellite isolation by cloning, and the evolution of highly variable tandem arrays.

  12. A PCR-DGGE method for detection and identification of Campylobacter, Helicobacter, Arcobacter and related Epsilobacteria and its application to saliva samples from humans and domestic pets

    DEFF Research Database (Denmark)

    Petersen, Randi Føns; Harrington, C. S.; Kortegaard, H. E.

    2007-01-01

    Results: A semi-nested PCR was developed to allow sensitive detection of all Epsilobacteria, with species separation undertaken by DGGE. A database was constructed in BioNumerics using 145 strains covering 51 Campylobacter, Arcobacter and Helicobacter taxa; Nineteen distinct DGGE profile-groups were......Aims: To develop a PCR-denaturing gradient gel electrophoresis (PCR-DGGE) method for the detection and identification of Campylobacter, Helicobacter and Arcobacter species (Epsilobacteria) in clinical samples and evaluate its efficacy on saliva samples from humans and domestic pets. Methods ans...... distinguished. This approach detected Epsilobacteria in all saliva samples collected from humans, cats and dogs, and identified Campylobacter concisus and/or Campylobacter gracilis in the human samples. The pet animal samples were taken from individuals with oral/dental diseases; PCR-DGGE identified up to four...

  13. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR

    DEFF Research Database (Denmark)

    Lund, Marianne; Nordentoft, Steen; Pedersen, Karl

    2004-01-01

    A real-time PCR assay for detecting thermophilic Campylobacter spp. directly in chicken feces has been developed. DNA was isolated from fecal material by using magnetic beads followed by PCR with a prealiquoted PCR mixture, which had been stored at -18degreesC. Campylobacter could be detected...

  14. Evaluation by latent class analysis of a magnetic capture based DNA extraction followed by real-time qPCR as a new diagnostic method for detection of Echinococcus multilocularis in definitive hosts.

    Science.gov (United States)

    Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke

    2016-10-30

    A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    Science.gov (United States)

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. Copyright © 2016 Kakumanu et al.

  16. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals

    Science.gov (United States)

    Kakumanu, Madhavi L.; Ponnusamy, Loganathan; Sutton, Haley T.; Meshnick, Steven R.; Nicholson, William L.

    2016-01-01

    A novel nested PCR assay was developed to detect Rickettsia spp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) of Rickettsia spp. The newly designed primers were evaluated using genomic DNA from 11 Rickettsia species belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to other Rickettsia-specific PCR targets (ompA, gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11 Rickettsia spp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from “Candidatus Rickettsia amblyommii.” Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adult Dermacentor variabilis ticks. The nested 23S-5S IGS assay detected Rickettsia DNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species of Rickettsia. The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species of Rickettsia in the ticks. “Candidatus Rickettsia amblyommii,” R. montanensis, R. felis, and R. bellii were frequently identified species, along with some potentially novel Rickettsia strains that were closely related to R. bellii and R. conorii. PMID:26818674

  17. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples.

    Science.gov (United States)

    Naddaf, S R; Kishdehi, M; Siavashi, Mr

    2011-01-01

    The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  18. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  19. Detection, identification and genotyping of Borrellia spp. in rodents in Slovenia by PCR and culture.

    Science.gov (United States)

    Cerar, Tjaša; Korva, Miša; Avšič-Županc, Tatjana; Ružić-Sabljić, Eva

    2015-08-08

    Borrelia burgdorferi sensu lato, the agent of Lyme borreliosis, is mainly maintained in natural foci through the transmission cycles of competent tick vectors (Ixodes sp.) and a vertebrate reservoir. Specific rodents have been identified as the principal reservoir of Borrelia burgdorferi sensu lato in Europe. Borrelia miyamotoi is the only relapsing fever spirochete transmitted by the same tick. The aim of the present study was to perform an epidemiological survey to determine the presence of B. burgdorferi sensu lato in rodents occurring in Slovenia and to explore the presence of Borrelia miyamotoi. The study was performed in two parts, retrospective and prospective; a total of 297 rodents was analyzed. Detection and identification of borrelia was performed by molecular methods and additionally in the prospective study by isolation and genotyping (MluI-LRFP and MLST). During the prospective part of the study, borrelia was isolated from 2/46 (4.3 %) lung specimens and from 10/46 (21.7 %) heart specimens of rodents. All isolated strains were identified as B. afzelii subtype Mla1, and MLST analysis revealed 5 distinct sequence types. Borrelia DNA was successfully detected by one or other of the PCR methods in 18/46 (39.1 %) and 75/251 (29.9 %) samples in the prospective and retrospective studies, respectively. LightMix® was found to be more sensitive than the ''in-house" nested PCR (91/297 (30.6 %) vs 48/297 (16.1 %)). Borrelia miyamotoi DNA was detected in 1/251 (0.4 %) and in 1/46 (2.2 %) heart specimens, in the retrospective and prospective parts of the study, respectively. We determined the prevalence of B. afzelii in rodents and report for the first time the presence of B. miyamotoi in Slovenia.

  20. Identification of Giardia lamblia and the human infectious-species of Cryptosporidium in drinking water resources in Western Saudi Arabia by nested-PCR assays.

    Science.gov (United States)

    Hawash, Y; Ghonaim, M; Hussein, Y; Alhazmi, A; Alturkistani, A

    2015-06-01

    The presence of Cryptosporidium and/or Giardia in drinking water represents a major public health problem. This study was the first report concerned with the occurrence of these protozoa in drinking water in Saudi Arabia. The study was undertaken in Al-Taif, a high altitude region, Western Saudi Arabia. Eight underground wells water, six desalinated water and five domestic brands of bottled water samples, 10 liter each, were monthly collected between May 2013 and April 2014. All samples (n = 228), were processed using an automated wash/elution station (IDEXX Laboratories, Inc.). Genomic DNA was directly isolated and purified from samples concentrates with QIAamp® Stool Mini Kit (Qiagen). The target protozoan DNA sequences were amplified using two previously published nested-PCR protocols. Of all the analyzed water, 31 samples (≈14%) were found contaminated with the target protozoa. Giardia lamblia was detected in ≈10% (7/72) of desalinated water and in ≈9% (9/96) of wells water. On the other hand, Cryptosporidium was identified in ≈8% (8/72) of desalinated water and in ≈7% (7/96) of wells water. All bottled water samples (n = 60) were (oo)cysts-free. Protozoan (oo)cysts were more frequently identified in water samples collected in the spring than in other seasons. The methodology established in our study proved sensitive, cost-effective and is amenable for future automation or semi-automation. For better understanding of the current situation that represent an important health threat to the local inhabitants, further studies concerned with (oo)cyst viability, infectivity, concentration and genotype identification are recommended.

  1. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    Science.gov (United States)

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  2. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    Science.gov (United States)

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

  3. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  4. Detection probability of gyrfalcons and other cliff-nesting raptors during aerial surveys in Alaska

    Science.gov (United States)

    Booms, Travis L.; Fuller, Mark R.; Schempf, Philip F.; McCaffery, Brian J.; Lindberg, Mark S.; Watson, Richard T.; Cade, Tom J.; Fuller, Mark; Hunt, Grainger; Potapov, Eugene

    2011-01-01

    Assessing the status of Gyrfalcons (Falco rusticolus) and other cliffnesting raptors as the Arctic climate changes often requires aerial surveys of their breeding habitats. Because traditional, count-based surveys that do not adjust for differing detection probabilities can provide faulty inference about population status (Link and Sauer 1998, Thompson 2002), it will be important to incorporate measures of detection probability into survey methods whenever possible. To evaluate the feasibility of this, we conducted repeated aerial surveys for breeding cliff-nesting raptors on the Yukon Delta National Wildlife Refuge (YDNWR) in western Alaska to estimate detection probabilities of Gyrfalcons, Golden Eagles (Aquila chrysaetos), Rough-legged Hawks (Buteo lagopus), and also Common Ravens (Corvus corax). Using the program PRESENCE, we modeled detection histories of each species based on single species occupancy modeling following MacKenzie et al. (2002, 2006). We used different observers during four helicopter replicate surveys in the Kilbuck Mountains and five fixed-wing replicate surveys in the Ingakslugwat Hills (hereafter called Volcanoes) near Bethel, Alaska. We used the following terms and definitions throughout: Survey Site: site of a nest used previously by a raptor and marked with a GPS-obtained latitude and longitude accurate to within 20 m. All GPS locations were obtained in prior years from a helicopter hovering approximately 10?20 m from a nest. The site was considered occupied if a bird or an egg was detected within approximately 500 m of the nest and this area served as our sampling unit. When multiple historical nests were located on a single cliff, we used only one GPS location to locate the survey site. Detection probability (p): the probability of a species being detected at a site given the site is occupied. Occupancy (?): the probability that the species of interest is present at a site during the survey period. A site was considered occupied if the

  5. Effects of prolonged chlorine exposures upon PCR detection of Helicobacter pylori DNA.

    Science.gov (United States)

    The effect of low doses of free chlorine on the detection by qPCR of Helicobacter pylori (H. pylori) cells by qPCR in tap water was monitored. H. pylori target sequences (within suspended, intact cells at densities of 102 to 103 cells /ml) were rendered undetectable by qPCR an...

  6. Influence of volume of sample processed on detection of Chlamydia trachomatis in urogenital samples by PCR

    NARCIS (Netherlands)

    Goessens, W H; Kluytmans, J A; den Toom, N; van Rijsoort-Vos, T H; Niesters, B G; Stolz, E; Verbrugh, H A; Quint, W G

    In the present study, it was demonstrated that the sensitivity of the PCR for the detection of Chlamydia trachomatis is influenced by the volume of the clinical sample which is processed in the PCR. An adequate sensitivity for PCR was established by processing at least 4%, i.e., 80 microliters, of

  7. Evaluation of an Improved U.S. Food and Drug Administration Method for the Detection of Cyclospora cayetanensis in Produce Using Real-Time PCR.

    Science.gov (United States)

    Murphy, Helen R; Lee, Seulgi; da Silva, Alexandre J

    2017-07-01

    Cyclospora cayetanensis is a protozoan parasite that causes human diarrheal disease associated with the consumption of fresh produce or water contaminated with C. cayetanensis oocysts. In the United States, foodborne outbreaks of cyclosporiasis have been linked to various types of imported fresh produce, including cilantro and raspberries. An improved method was developed for identification of C. cayetanensis in produce at the U.S. Food and Drug Administration. The method relies on a 0.1% Alconox produce wash solution for efficient recovery of oocysts, a commercial kit for DNA template preparation, and an optimized TaqMan real-time PCR assay with an internal amplification control for molecular detection of the parasite. A single laboratory validation study was performed to assess the method's performance and compare the optimized TaqMan real-time PCR assay and a reference nested PCR assay by examining 128 samples. The samples consisted of 25 g of cilantro or 50 g of raspberries seeded with 0, 5, 10, or 200 C. cayetanensis oocysts. Detection rates for cilantro seeded with 5 and 10 oocysts were 50.0 and 87.5%, respectively, with the real-time PCR assay and 43.7 and 94.8%, respectively, with the nested PCR assay. Detection rates for raspberries seeded with 5 and 10 oocysts were 25.0 and 75.0%, respectively, with the real-time PCR assay and 18.8 and 68.8%, respectively, with the nested PCR assay. All unseeded samples were negative, and all samples seeded with 200 oocysts were positive. Detection rates using the two PCR methods were statistically similar, but the real-time PCR assay is less laborious and less prone to amplicon contamination and allows monitoring of amplification and analysis of results, making it more attractive to diagnostic testing laboratories. The improved sample preparation steps and the TaqMan real-time PCR assay provide a robust, streamlined, and rapid analytical procedure for surveillance, outbreak response, and regulatory testing of foods for

  8. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  9. Comparison of a Stool Antigen Detection Kit and PCR for Diagnosis of Entamoeba histolytica and Entamoeba dispar Infections in Asymptomatic Cyst Passers in Iran

    OpenAIRE

    Solaymani-Mohammadi, Shahram; Rezaian, Mostafa; Babaei, Zahra; Rajabpour, Azam; Meamar, Ahmad R.; Pourbabai, Ahmad A.; Petri, William A.

    2006-01-01

    The present study was conducted to compare stool antigen detection with PCR for the diagnosis of Entamoeba sp. infection in asymptomatic cyst passers from Iran. Entamoeba dispar and, in one case, E. moshkovskii were the Entamoeba spp. found in the amebic cyst passers. There was a 100% correlation between the results from the TechLab E. histolytica II stool antigen kit and those from nested PCR. We concluded that E. dispar is much more common in asymptomatic cyst passers in Iran and that antig...

  10. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    OpenAIRE

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

  11. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    Science.gov (United States)

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  12. Relative sensitivity of conventional and real-time PCR assays for detection of SFG Rickettsia in blood and tissue samples from laboratory animals.

    Directory of Open Access Journals (Sweden)

    Galina E Zemtsova

    Full Text Available Studies on the natural transmission cycles of zoonotic pathogens and the reservoir competence of vertebrate hosts require methods for reliable diagnosis of infection in wild and laboratory animals. Several PCR-based applications have been developed for detection of infections caused by Spotted Fever group Rickettsia spp. in a variety of animal tissues. These assays are being widely used by researchers, but they differ in their sensitivity and reliability. We compared the sensitivity of five previously published conventional PCR assays and one SYBR green-based real-time PCR assay for the detection of rickettsial DNA in blood and tissue samples from Rickettsia- infected laboratory animals (n = 87. The real-time PCR, which detected rickettsial DNA in 37.9% of samples, was the most sensitive. The next best were the semi-nested ompA assay and rpoB conventional PCR, which detected as positive 18.4% and 14.9% samples respectively. Conventional assays targeting ompB, gltA and hrtA genes have been the least sensitive. Therefore, we recommend the SYBR green-based real-time PCR as a tool for the detection of rickettsial DNA in animal samples due to its higher sensitivity when compared to more traditional assays.

  13. Relative sensitivity of conventional and real-time PCR assays for detection of SFG Rickettsia in blood and tissue samples from laboratory animals.

    Science.gov (United States)

    Zemtsova, Galina E; Montgomery, Merrill; Levin, Michael L

    2015-01-01

    Studies on the natural transmission cycles of zoonotic pathogens and the reservoir competence of vertebrate hosts require methods for reliable diagnosis of infection in wild and laboratory animals. Several PCR-based applications have been developed for detection of infections caused by Spotted Fever group Rickettsia spp. in a variety of animal tissues. These assays are being widely used by researchers, but they differ in their sensitivity and reliability. We compared the sensitivity of five previously published conventional PCR assays and one SYBR green-based real-time PCR assay for the detection of rickettsial DNA in blood and tissue samples from Rickettsia- infected laboratory animals (n = 87). The real-time PCR, which detected rickettsial DNA in 37.9% of samples, was the most sensitive. The next best were the semi-nested ompA assay and rpoB conventional PCR, which detected as positive 18.4% and 14.9% samples respectively. Conventional assays targeting ompB, gltA and hrtA genes have been the least sensitive. Therefore, we recommend the SYBR green-based real-time PCR as a tool for the detection of rickettsial DNA in animal samples due to its higher sensitivity when compared to more traditional assays.

  14. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    KAUST Repository

    Wen, Weijia

    2011-03-03

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable chip with volumes as small as 1.25 µl, while the heating and cooling rate may be as fast as 12.7 °C/second ensuring that the total time needed of only 25 minutes to complete the 35 cycle PCR amplification. The PCR may be performed according to a two-temperature approach for denaturing and annealing (Td and Ta) of DNA with the PCR chip, with which the amplification of male-specific SRY gene marker by utilizing raw saliva may be achieved. The genetic identification may be in-situ detected after PCR by the optical detection system.

  15. Fast detection of genetic information by an optimized PCR in an interchangeable chip.

    KAUST Repository

    Wu, Jinbo

    2012-02-01

    In this paper, we report the construction of a polymerase chain reaction (PCR) device for fast amplification and detection of DNA. This device consists of an interchangeable PCR chamber, a temperature control component as well as an optical detection system. The DNA amplification happens on an interchangeable chip with the volumes as low as 1.25 μl, while the heating and cooling rate was as fast as 12.7°C/second ensuring that the total time needed of only 25 min to complete the 35 cycle PCR amplification. An optimized PCR with two-temperature approach for denaturing and annealing (Td and Ta) of DNA was also formulated with the PCR chip, with which the amplification of male-specific sex determining region Y (SRY) gene marker by utilizing raw saliva was successfully achieved and the genetic identification was in-situ detected right after PCR by the optical detection system.

  16. Diagnostic accuracy of a loop-mediated isothermal PCR assay for detection of Orientia tsutsugamushi during acute Scrub Typhus infection.

    Science.gov (United States)

    Paris, Daniel H; Blacksell, Stuart D; Nawtaisong, Pruksa; Jenjaroen, Kemajittra; Teeraratkul, Achara; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Kantipong, Pacharee; Day, Nicholas P J

    2011-09-01

    There is an urgent need to develop rapid and accurate point-of-care (POC) technologies for acute scrub typhus diagnosis in low-resource, primary health care settings to guide clinical therapy. In this study we present the clinical evaluation of loop-mediated isothermal PCR assay (LAMP) in the context of a prospective fever study, including 161 patients from scrub typhus-endemic Chiang Rai, northern Thailand. A robust reference comparator set comprising following 'scrub typhus infection criteria' (STIC) was used: a) positive cell culture isolate and/or b) an admission IgM titer ≥1∶12,800 using the 'gold standard' indirect immunofluorescence assay (IFA) and/or c) a 4-fold rising IFA IgM titer and/or d) a positive result in at least two out of three PCR assays. Compared to the STIC criteria, all PCR assays (including LAMP) demonstrated high specificity ranging from 96-99%, with sensitivities varying from 40% to 56%, similar to the antibody based rapid test, which had a sensitivity of 47% and a specificity of 95%. The diagnostic accuracy of the LAMP assay was similar to realtime and nested conventional PCR assays, but superior to the antibody-based rapid test in the early disease course. The combination of DNA- and antibody-based detection methods increased sensitivity with minimal reduction of specificity, and expanded the timeframe of adequate diagnostic coverage throughout the acute phase of scrub typhus.

  17. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Science.gov (United States)

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Real-Time PCR Detection and QUantification of Soilborne Fungal Pathogens : the Case of Rosellinia necatrix, Phytophthora nicotianae, P. citrophthora and Verticillium dahliae

    Directory of Open Access Journals (Sweden)

    L. Schena

    2004-08-01

    Full Text Available Conventional and Scorpion primers were designed from the ITS regions to identify Rosellinia necatrix, Phytophthora nicotianae, and P. citrophthora and from the IGS regions to identify Verticillium dahliae and V. alboatrum. Specificity of primers and probes was assessed using genomic DNA from a large number of fungi from several hosts and by means of BLAST analyses, to exclude the presence of similar sequences in other micro-organisms among available DNA databases (GenBank. Simple and rapid procedures for DNA extraction from naturally infected matrices (soils, roots, bark, and/or woody tissues were utilised to yield DNA of a purity and quality suitable for PCR assays. Combining these protocols with a double amplification (nested Scorpion-PCR, the real-time detection of these pathogens was possible from naturally infested soils and from infected citrus roots (P. nicotianae and P. citrophthora, from the roots and bark of stone fruits and olive (R. necatrix and from olive branches (V. dahliae. For target pathogens, the limit of detection was 1 pg µl-1 in Scorpion-PCR and 1 fg µl-1 in nested Scorpion-PCR. High and significant correlations between pathogen propagule concentrations and real-time PCR cycle thresholds (Ct were obtained. Moreover, specific tests with R. necatrix seem to indicate that its DNA is quite rapidly degraded in the soil, excluding the risk of false positives due to the presence of dead cells.

  19. Detection of Cutaneous Leishmaniasis by PCR in Fasa district in 2012

    Directory of Open Access Journals (Sweden)

    Mehdi Sharafi

    2013-09-01

    Material & Methods: Slit biopsies were collected from 138 suspected cases of cutaneous leishmaniasis who were presented, consecutively, in Fasa district from April 2011 to February 2012. After the microscopy, the entire smear was then scraped off the slide surface for DNA extraction and PCR assay. Results: All 138 investigated smears were reported positive by microscopy and nested PCR assay. In PCR, One of the smears had the 750-bp band, indicative of L. tropica and the rest had the 560-bp band indicative of L. major. Conclusion: In conclusion, the cutaneous leishmaniasis found in Fasa district is predominantly Rural Cutaneous Leishmaniasis. The PCR-based assay used in the present study appears to be a suitable and powerful tool for the characterization of Leishmanial species.

  20. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  1. A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

    Science.gov (United States)

    Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

    2013-12-27

    Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

  2. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  3. Ants detect but do not discriminate diseased workers within their nest

    Science.gov (United States)

    Leclerc, Jean-Baptiste; Detrain, Claire

    2016-08-01

    Social insects have evolved an array of individual and social behaviours that limit pathogen entrance and spread within the colony. The detection of ectoparasites or of fungal spores on a nestmate body triggers their removal by allogrooming and appears as a primary component of social prophylaxis. However, in the case of fungal infection, one may wonder whether ant workers are able to detect, discriminate and keep at bay diseased nestmates that have no spores over their cuticle but which constitute a latent sanitary risk due to post-mortem corpse sporulation. Here, we investigate the ability of Myrmica rubra workers to detect and discriminate a healthy from a diseased nestmate infected by the entomopathogen Metarhizium anisopliae. During dyadic encounters in a neutral location, workers were more aggressive towards isolated sick nestmates on the 3rd post-infection day. However, no such detection or discrimination of fungus-infected nestmates occurred in a social context inside the nest or at the nest entrance. Gatekeepers never actively rejected incoming diseased nestmates that rather spontaneously isolated themselves outside the nest. Our study reveals that ant workers may detect health-dependent cues and that their `acceptance level' of sick nestmates is tunable depending on the social context. This raises questions about possible trade-offs between a social closure to pathogens and risks of erroneous rejection of healthy nestmates. Social isolation of moribund ants also appears as a widespread prophylactic strategy of social insects allowing them to reduce exposure to pathogens and to spare costs associated with the management of infected individuals.

  4. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  5. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.

    Science.gov (United States)

    Tessitore, Marion Vaglio; Sottini, Alessandra; Roccaro, Aldo M; Ghidini, Claudia; Bernardi, Simona; Martellosio, Giovanni; Serana, Federico; Imberti, Luisa

    2017-04-05

    A normal number of T-cell receptor excision circles (TRECs) and K-deleting recombination excision circles (KRECs) is considered a biomarker for adequate new T- and B-cell production. In newborns, detection of TRECs and KRECs by real time PCR from dried blood spotted on filter paper is used for the screening of severe immunodeficiency. In adults, elderly and during diseases, where the number of TRECs is lower than in newborns and children, a large amount of DNA and a sensitive method of amplification are necessary to identify newly produced lymphocytes. DNA was prepared from blood of 203 healthy adults (range: 18-91 years old) absorbed for 10 s on flocked swabs and let to dry, or from peripheral blood mononuclear cells. DNA was subjected to digital PCR and to well established conventional real time PCR-based method using TREC- and KREC-specific primers and probes. The number of TRECs and KRECs was expressed per mL of blood. Statistical analysis was performed by nested ANOVA, Pearson coefficient of determination, and by linear regression tests. The novel method for the storage of dried blood on nylon flocked swabs and the use of digital PCR allow quantification of TRECs and KRECs with high degree of sensitivity, specificity, accuracy, and precision. TRECs and KRECs were amplified by digital PCR in all tested blood samples, including those obtained from elderly individuals (>70 years old) and that were negative by real time PCR. Furthermore, values of TRECs and KRECs obtained by digital PCR were in the range of those acquired by real time PCR. Our findings demonstrate that DNA isolation from dried blood on flocked swabs followed by digital PCR-based analysis represents a useful tool for studying new lymphocyte production in adults and elderly individuals. This suggests the potential use of the methodology when monitoring of clinical variables is limited by the number of molecules that can be amplified and detected, such as in patients with immunodeficiency or under

  6. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  7. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  8. Effect of specific or random c-DNA priming on sensitivity of tyrosinase nested RT-PCR : Potential clinical relevance

    NARCIS (Netherlands)

    Calogero, A; Hospers, GAP; Timmer-Bosscha, H; Mulder, NH; Schraffordt Koops, H.

    2000-01-01

    The reverse transcriptase polymerase chain reaction (RT-PCR) can be of clinical relevance in identifying malignant melanoma cells in blood or tissues of patients at risk for disseminated melanoma. The diagnostic value of this marker however, is still controversial. The objective of this study was to

  9. PCR detection of Bartonella spp. in the dog

    Directory of Open Access Journals (Sweden)

    Jarmila Konvalinová

    2014-01-01

    Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.

  10. Pathogen Causing Disease of Diagnosis PCR Tecnology

    OpenAIRE

    SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

    2013-01-01

    Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

  11. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Rajeh Ali

    2014-06-20

    Jun 20, 2014 ... in 2013. Objectives: This study aimed to investigate S. aureus in some clinical samples by PCR and study .... culture, the isolates of S. aureus were incubated at 37 °C for. 18–24 h .... characteristics, and ability to form biofilm.

  12. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  13. Specific PCR-based detection of Alternaria helianthi

    DEFF Research Database (Denmark)

    Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.

    2012-01-01

    Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...

  14. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Science.gov (United States)

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  15. A one-step, real-time PCR assay for rapid detection of rhinovirus.

    Science.gov (United States)

    Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

  16. An N-targeting real-time PCR strategy for the accurate detection of spring viremia of carp virus.

    Science.gov (United States)

    Shao, Ling; Xiao, Yu; He, Zhengkan; Gao, Longying

    2016-03-01

    Spring viremia of carp virus (SVCV) is a highly pathogenic agent of several economically important Cyprinidae fish species. Currently, there are no effective vaccines or drugs for this virus, and prevention of the disease mostly relies on prompt diagnosis. Previously, nested RT-PCR and RT-qPCR detection methods based on the glycoprotein gene G have been developed. However, the high genetic diversity of the G gene seriously limits the reliability of those methods. Compared with the G gene, phylogenetic analyses indicate that the nucleoprotein gene N is more conserved. Furthermore, studies in other members of the Rhabdoviridae family reveals that their gene transcription level follows the order N>P>M>G>L, indicating that an N gene based RT-PCR should have higher sensitivity. Therefore, two pairs of primers and two corresponding probes targeting the conserved regions of the N gene were designed. RT-qPCR assays demonstrated all primers and probes could detect phylogenetically distant isolates specifically and efficiently. Moreover, in artificially infected fish, the detected copy numbers of the N gene were much higher than those of the G gene in all tissues, and both the N and G gene copy numbers were highest in the kidney and spleen. Testing in 1100 farm-raised fish also showed that the N-targeting strategy was more reliable than the G-targeting methods. The method developed in this study provides a reliable tool for the rapid diagnosis of SVCV. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    International Nuclear Information System (INIS)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  18. Detection of circulating tumor cells by nested RT-PCR targeting ...

    African Journals Online (AJOL)

    CK20mRNAs in colorectal carcinoma patients. ... There was a statistically significant difference in the prevalence of EGFR/CEA and CK20mRNAs expression between the early disease group (stage I and II) and the advanced disease group (stage III

  19. Detection of low plasma estradiol concentrations in nesting green turtles (Chelonia mydas) by HPLC/Ms-Ms.

    Science.gov (United States)

    Mahmoud, I Y; Alkindi, A Y; Khan, T; Al-Bahry, S N

    2011-03-01

    In previous studies on nesting green turtles under natural conditions from different geographical regions, 17-β-estradiol (E(2) ) was either undetectable or detected at very low levels. RIA and other related techniques were not sensitive enough to measure low E(2) values in the green turtles. In this study, a sensitive method was used in detecting low hormone concentrations: high performance liquid chromatography with tandem quadruple mass spectrometry (HPLC-MS/MS). Using this technique, estradiol for the first time was detected in nesting green turtles during the peak season (June-October) at Ras Al-Hadd Reserve, Oman. The E(2) values recorded from this study were the highest ever recorded from nesting green turtles in any geographical region, but the levels did not vary significantly throughout different phases of nesting. The presence of E(2) during nesting presumably plays a role in the physiology and behavior of this species. Ras Al-Hadd hosts one of the largest nesting populations of green turtles in the world, and an understanding of their nesting patterns may be of value in conservation and management programs for this endangered species. Copyright © 2011 Wiley-Liss, Inc., A Wiley Company.

  20. Nested-PCR using MPB64 fragment improves the diagnosis of pleural and meningeal tuberculosis Nested-PCR usando o fragmento MPB64 melhora o diagnóstico da tuberculose pleural e meníngea

    Directory of Open Access Journals (Sweden)

    Luiz C. Martins

    2000-06-01

    Full Text Available Fluids in which Mycobacterium tuberculosis are seldom found, such as pleural and cerebrospinal liquids, are good candidates to be studied using PCR techniques. We detail our experience with a PCR assay applied to pleural and cerebrospinal fluids using the primer MPB64. Seventy three specimens were analyzed: 30 pleural fluids (PF, 26 pleural biopsies (PB and 17 cerebrospinal fluids (CSF. The gold standard for the diagnosis of tuberculous meningitis was the positive culture for M. tuberculosis in CSF. Tuberculous pleural effusion was diagnosed when cultures of PF and/or PB were positive for M. tuberculosis, or the PB histology showed granulomas. Our results, compared to the gold standards employed, showed a sensitivity of 70%, specificity of 88%, positive predictive value of 82% and negative predictive value of 80%. The high specificity of the MPB64 fragment while still retaining a good sensitivity makes it very well suited for pleural and cerebrospinal tuberculosis diagnosis.O Mycobacterium tuberculosis é raramente encontrado em fluidos como o líquido pleural e o cérebroespinhal, tornando estas localizações de difícil diagnóstico. Apresentamos nossa experiência com uma técnica de PCR aplicada a líquido pleural e cerebroespinhal com o uso do primer MPB64. Sessenta e três espécimes foram analisados: 30 líquidos pleurais (PF, 26 biópsias pleurais (PB e 17 líquidos cerebroespinhais (CSF. O gold standard para o diagnóstico de meningite tuberculosa foi a cultura positiva para M. tuberculosis no CSF. Tuberculose pleural era diagnosticada quando culturas do PF e/ou PB eram positivas para M. tuberculosis, ou a histologia da PB mostrava granulomas. Nossos resultados, comparados aos gold standards empregados, mostram sensitividade de 70%, especificidade de 88%, valor preditivo positivo de 82% e valor preditivo negativo de 80%. A elevada especificidade e boa sensibilidade do fragmento MPB64 o transformam em um bom parâmetro para o diagn

  1. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  2. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  3. Fluorescence quantitative PCR in detection of HBV DNA

    International Nuclear Information System (INIS)

    Shen Zheng; Li Ming; Shen Xia

    2003-01-01

    Objective: To study the relationship between the serum content of HBV-DNA and expression of serological markers with HBV infection patients. Methods: Serum samples from 375 hepatitis B patients with different clinical status and 70 normal persons were quantitated for HBV-DNA by FQ-PCR. Results: The average of HBV-DNA contents in the patient in the groups of HBsAg (+) and of HBeAg(+) were significantly higher than those in the group of HBsAg(-) and of HBeAg(-). Even in the group of HBeAg negative, high HBV-DNA contents might still be present in both the HBeAg(+) and HBeAg(-) groups. Conclusion: FQ-PCR can be used to monitor the real state of HBV infection, replication and the course of disease

  4. Identification of Ancylostoma ceylanicum in children from a tribal community in Tamil Nadu, India using a semi-nested PCR-RFLP tool.

    Science.gov (United States)

    George, Santosh; Kaliappan, Saravanakumar Puthupalayam; Kattula, Deepthi; Roy, Sheela; Geldhof, Peter; Kang, Gagandeep; Vercruysse, Jozef; Levecke, Bruno

    2015-04-01

    It is generally assumed that hookworm infections in humans are caused by Necator americanus and Ancylostoma duodenale. However, previous studies have also reported the presence of the animal hookworm A. ceylanicum in human stools. We determined hookworm infections in children in a tribal community in Tamil Nadu, India, using a semi-nested PCR-RFLP approach. The results indicate that human species account for a majority of the hookworm infections (N. americanus 39/41 [95%]; A. duodenale 6/41 [15%]), whereas the animal hookworm A. ceylanicum only accounts for a minority of the infections (5%; 2/41). The results emphasize the need to consider zoonotic ancylostomiasis while developing strategies to control hookworm infections. © The Author 2015. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  6. Microfluidic PCR Amplification and MiSeq Amplicon Sequencing Techniques for High-Throughput Detection and Genotyping of Human Pathogenic RNA Viruses in Human Feces, Sewage, and Oysters

    Directory of Open Access Journals (Sweden)

    Mamoru Oshiki

    2018-04-01

    Full Text Available Detection and genotyping of pathogenic RNA viruses in human and environmental samples are useful for monitoring the circulation and prevalence of these pathogens, whereas a conventional PCR assay followed by Sanger sequencing is time-consuming and laborious. The present study aimed to develop a high-throughput detection-and-genotyping tool for 11 human RNA viruses [Aichi virus; astrovirus; enterovirus; norovirus genogroup I (GI, GII, and GIV; hepatitis A virus; hepatitis E virus; rotavirus; sapovirus; and human parechovirus] using a microfluidic device and next-generation sequencer. Microfluidic nested PCR was carried out on a 48.48 Access Array chip, and the amplicons were recovered and used for MiSeq sequencing (Illumina, Tokyo, Japan; genotyping was conducted by homology searching and phylogenetic analysis of the obtained sequence reads. The detection limit of the 11 tested viruses ranged from 100 to 103 copies/μL in cDNA sample, corresponding to 101–104 copies/mL-sewage, 105–108 copies/g-human feces, and 102–105 copies/g-digestive tissues of oyster. The developed assay was successfully applied for simultaneous detection and genotyping of RNA viruses to samples of human feces, sewage, and artificially contaminated oysters. Microfluidic nested PCR followed by MiSeq sequencing enables efficient tracking of the fate of multiple RNA viruses in various environments, which is essential for a better understanding of the circulation of human pathogenic RNA viruses in the human population.

  7. Inferences about nested subsets structure when not all species are detected

    Science.gov (United States)

    Cam, E.; Nichols, J.D.; Hines, J.E.; Sauer, J.R.

    2000-01-01

    Comparisons of species composition among ecological communities of different size have often provided evidence that the species in communities with lower species richness form nested subsets of the species in larger communities. In the vast majority of studies, the question of nested subsets has been addressed using information on presence-absence, where a '0' is interpreted as the absence of a given species from a given location. Most of the methodological discussion in earlier studies investigating nestedness concerns the approach to generation of model-based matrices. However, it is most likely that in many situations investigators cannot detect all the species present in the location sampled. The possibility that zeros in incidence matrices reflect nondetection rather than absence of species has not been considered in studies addressing nested subsets, even though the position of zeros in these matrices forms the basis of earlier inference methods. These sampling artifacts are likely to lead to erroneous conclusions about both variation over space in species richness and the degree of similarity of the various locations. Here we propose an approach to investigation of nestedness, based on statistical inference methods explicitly incorporating species detection probability, that take into account the probabilistic nature of the sampling process. We use presence-absence data collected under Pollock?s robust capture-recapture design, and resort to an estimator of species richness originally developed for closed populations to assess the proportion of species shared by different locations. We develop testable predictions corresponding to the null hypothesis of a nonnested pattern, and an alternative hypothesis of perfect nestedness. We also present an index for assessing the degree of nestedness of a system of ecological communities. We illustrate our approach using avian data from the North American Breeding Bird Survey collected in Florida Keys.

  8. A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.

    Science.gov (United States)

    Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P

    2015-06-01

    Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.

  9. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  10. How to evaluate PCR assays for the detection of low-level DNA

    DEFF Research Database (Denmark)

    Banch-Clausen, Frederik; Urhammer, Emil; Rieneck, Klaus

    2015-01-01

    distribution describing parameters for singleplex real-time PCR-based detection of low-level DNA. The model was tested against experimental data of diluted cell-free foetal DNA. Also, the model was compared with a simplified formula to enable easy predictions. The model predicted outcomes that were...... not significantly different from experimental data generated by testing of cell-free foetal DNA. Also, the simplified formula was applicable for fast and accurate assay evaluation. In conclusion, the model can be applied for evaluation of sensitivity of real-time PCR-based detection of low-level DNA, and may also......High sensitivity of PCR-based detection of very low copy number DNA targets is crucial. Much focus has been on design of PCR primers and optimization of the amplification conditions. Very important are also the criteria used for determining the outcome of a PCR assay, e.g. how many replicates...

  11. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  12. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia Persica in Animal Blood Samples

    Directory of Open Access Journals (Sweden)

    SR Naddaf

    2011-06-01

    Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  13. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples

    Directory of Open Access Journals (Sweden)

    SR Naddaf

    2011-06-01

    Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml.  Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.  

  14. Detection of Small Numbers of Campylobacter jejuni and Campylobacter coli Cells in Environmental Water, Sewage, and Food Samples by a Seminested PCR Assay

    Science.gov (United States)

    Waage, Astrid S.; Vardund, Traute; Lund, Vidar; Kapperud, Georg

    1999-01-01

    A rapid and sensitive assay was developed for detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples. Water and sewage samples were filtered, and the filters were enriched overnight in a nonselective medium. The enrichment cultures were prepared for PCR by a rapid and simple procedure consisting of centrifugation, proteinase K treatment, and boiling. A seminested PCR based on specific amplification of the intergenic sequence between the two Campylobacter flagellin genes, flaA and flaB, was performed, and the PCR products were visualized by agarose gel electrophoresis. The assay allowed us to detect 3 to 15 CFU of C. jejuni per 100 ml in water samples containing a background flora consisting of up to 8,700 heterotrophic organisms per ml and 10,000 CFU of coliform bacteria per 100 ml. Dilution of the enriched cultures 1:10 with sterile broth prior to the PCR was sometimes necessary to obtain positive results. The assay was also conducted with food samples analyzed with or without overnight enrichment. As few as ≤3 CFU per g of food could be detected with samples subjected to overnight enrichment, while variable results were obtained for samples analyzed without prior enrichment. This rapid and sensitive nested PCR assay provides a useful tool for specific detection of C. jejuni or C. coli in drinking water, as well as environmental water, sewage, and food samples containing high levels of background organisms. PMID:10103261

  15. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

    Science.gov (United States)

    Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

  16. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    NARCIS (Netherlands)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  17. Real-time PCR for detection of Theileria equi and Babesia caballi ...

    African Journals Online (AJOL)

    Real-time PCR for detection of Theileria equi and Babesia caballi parasites in ticks. ... This study aimed to develop a real-time PCR screening test for Babesia caballi and Theileria equi in ticks. Adult D. reticulatus were ... This test is suitable for application in epidemiological surveillance of equine babesiosis and theileriosis.

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies

    NARCIS (Netherlands)

    Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco

    2005-01-01

    Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and

  20. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Science.gov (United States)

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  1. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Science.gov (United States)

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Enzyme immunoassay for the detection of porcine gelatine in edible bird's nests.

    Science.gov (United States)

    Tukiran, Nur Azira; Ismail, Amin; Mustafa, Shuhaimi; Hamid, Muhajir

    2015-01-01

    Porcine gelatine is a common adulterant found in edible bird's nests (EBNs) used to increase the net weight prior to sale. This study aimed to develop indirect enzyme-linked immunosorbent assays (ELISAs) for porcine gelatine adulteration using anti-peptide polyclonal antibodies. Three indirect ELISAs were developed (PAB1, 2 and 3), which had limits of detection (LODs) of 0.12, 0.10 and 0.11 µg g(-1), respectively. When applied to standard solutions of porcine gelatine, the inter- and intra-assays showed coefficients of variation (CVs) less than 20% and were able to detect at least 0.5 ng µg(-1) (0.05%) porcine gelatine in spiked samples. The proposed ELISA offers attractions for quality control in the EBN industry.

  3. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  4. Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Kang Feng-feng

    2012-03-01

    Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

  5. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  6. Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

    Science.gov (United States)

    Wan, Weijie; Yeow, John T W

    2012-04-01

    This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

  7. Prevalence of Ehrlichia canis using the nested-PCR, correlation with the presence of morulae and thrombocytopenia in dogs treated in Veterinary Hospital of the Federal University of Espirito Santo

    Directory of Open Access Journals (Sweden)

    Mara Rúbia Rocha Pereira Sales

    2015-03-01

    Full Text Available ABSTRACT. Sales M.R.R.P., Ignacchiti M.D.C., Mendes Junior A.F., Suhett W.G., Porfírio L.C., Marins M., Aptekmann K.P. & Pereira Júnior O.S. [Prevalence of Ehrlichia canis using the nested-PCR, correlation with the presence of morulae and thrombocytopenia in dogs treated in Veterinary Hospital of the Federal University of Espirito Santo.] Prevalência de Ehrlichia canis pela Nested- -PCR, correlação com a presença de mórula e trombocitopenia em cães atendidos no Hospital Veterinário da Universidade Federal do Espírito Santo. Revista Brasileira de Medicina Veterinária, 37(1:47-51, 2015. Centro de Ciências Agrárias, Universidade Federal do Espírito Santo, Rua Projetada s/nº, Caixa Postal 25, Pontal, Marataízes, ES 29349-000, Brasil. E-mail: mararrps@yahoo.com.br Ehrlichia canis, is the primary etiologic agent of canine monocytic ehrlichiosis. The disease is mainly transmitted by the brown dog ticks Rhipicephalus sanguineus in different endemic regions of Brazil. The purpose of this study was determinated using the Nested Polymerase Chain Reaction (nested-PCR the prevalence of Ehrlichia canis in 85 dogs, regardless of race, age, sex or health status, treated at the Veterinary Hospital of Federal University of Espirito Santo, in Alegre-ES and evaluate its correlation with the presence of morulae and thrombocytopenia. It was observed that 1.17% of the samples were positive by blood smear, for the presence of morulae. However, the nested-PCR showed 5.88% positivity of samples. And 17.64% samples showed thrombocytopenia. By analyzing all the techniques, it was concluded that the introduction of diagnostic techniques such as nested-PCR is an important method for aid in early diagnosis of pathologies.

  8. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  9. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  10. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  11. Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.

    Directory of Open Access Journals (Sweden)

    María José Ramírez-Lázaro

    Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.

  12. Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

    Science.gov (United States)

    Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

    2010-01-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

  13. Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

    Science.gov (United States)

    Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

    2009-09-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

  14. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  15. Evaluation of conventional PCR for detection of Strongylus vulgaris on horse farms.

    Science.gov (United States)

    Bracken, M K; Wøhlk, C B M; Petersen, S L; Nielsen, M K

    2012-03-23

    Strongyle parasites are ubiquitous in grazing horses. Of these, the bloodworm Strongylus vulgaris is regarded as most pathogenic. Increasing levels of anthelmintic resistance in strongyle parasites has led to recommendations of decreased treatment intensities, and there is now a pronounced need for reliable tools for detection of parasite burdens in general and S. vulgaris in particular. The only method currently available for diagnosing S. vulgaris in practice is the larval culture, which is laborious and time-consuming, so veterinary practitioners most often pool samples from several horses together in one culture to save time. Recently, molecular tools have been developed to detect S. vulgaris in faecal samples. The aim of this study was to compare the performance of a conventional polymerase chain reaction (PCR) assay with the traditional larval culture and furthermore test the performance of pooled versus individual PCR for farm screening purposes. Faecal samples were obtained from 331 horses on 18 different farms. Farm size ranged from 6 to 56 horses, and horses aged between 2 months and 31 years. Larval cultures and PCR were performed individually on all horses. In addition, PCR was performed on 66 faecal pools consisting of 3-5 horses each. Species-specific PCR primers previously developed were used for the PCR. PCR and larval culture detected S. vulgaris in 12.1 and 4.5% of individual horses, respectively. On the farm level, eight farms tested positive with the larval culture, while 13 and 11 farms were positive with the individual and pooled PCRs, respectively. The individual PCR method was statistically superior to the larval culture, while no statistical difference could be detected between pooled and individual PCR for farm screening. In conclusion, pooled PCR appears to be a useful tool for farm screening for S. vulgaris. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Directory of Open Access Journals (Sweden)

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  17. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Science.gov (United States)

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  18. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  19. Comparison of clinical performance of antigen based-enzyme immunoassay (EIA) and major outer membrane protein (MOMP)-PCR for detection of genital Chlamydia trachomatis infection.

    Science.gov (United States)

    Nateghi Rostami, Mahmoud; Hossein Rashidi, Batool; Aghsaghloo, Fatemeh; Nazari, Razieh

    2016-06-01

    Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen worldwide. Early detection and treatment of C.trachomatis genital infection prevent serious reproductive complications. Performances of enzyme immunoassay (EIA) and major outer membrane protein (MOMP)-polymerase chain reaction (PCR) for diagnosis of genital C.trachomatis infection in women were compared. In this cross sectional study a total of 518 women volunteers were included (33.67±8.3 yrs) who had been referred to Gynecology clinics of Qom province, Iran, were included. Endocervical swab specimens were collected to detect lipopolysaccharide (LPS) antigen in EIA and to amplify MOMP gene of C.trachomatis in PCR. Results were confirmed using ompI nested-PCR. Sensitivity, specificity, positive (PPV) and negative predictive values (NPV) were calculated for performance of the tests. Odds ratios were determined using binary logistic regression analysis. In total, 37 (7.14%) cases were positive by EIA and/or MOMP-PCR. All discrepant results were confirmed by nested-PCR. Sensitivity, specificity, PPV and NPV values of EIA were 59.46%, 100%, 100% and 96.98%, and those of MOMP-PCR were 97.30%, 100%, 100%, 99.79%, respectively. Reproductive complications including 2.7% ectopic pregnancy, 5.4% stillbirth, 5.4% infertility, and 10.8% PROM were recorded. The risk of developing chlamydiosis was increased 4.8-fold in volunteers with cervicitis (p<0.05; OR 4.80; 95% CI 1.25-18.48). C.trachomatis infection should be regarded in women of reproductive ages especially those with cervicitis. Primary screening of women by using the low cost antigen-EIA is recommended; however, due to the low sensitivity of Ag-EIA, verification of the negative results by a DNA amplification method is needed.

  20. Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

    Science.gov (United States)

    Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

    2015-07-01

    Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  2. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  3. Detection probabilities of woodpecker nests in mixed conifer forests in Oregon

    Science.gov (United States)

    Robin E. Russell; Victoria A. Saab; Jay J. Rotella; Jonathan G. Dudley

    2009-01-01

    Accurate estimates of Black-backed (Picoides arcticus) and Hairy Woodpecker (P. villosus) nests and nest survival rates in post-fire landscapes provide land managers with information on the relative importance of burned forests to nesting woodpeckers. We conducted multiple-observer surveys in burned and unburned mixed coniferous forests in Oregon to identify important...

  4. Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

    Science.gov (United States)

    Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

    2011-01-01

    In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

  5. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    Science.gov (United States)

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  6. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    Science.gov (United States)

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  7. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Directory of Open Access Journals (Sweden)

    Yong Huang

    Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  8. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Science.gov (United States)

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  9. Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.

    Science.gov (United States)

    Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús

    2018-01-01

    The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

    Science.gov (United States)

    Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

    2017-02-08

    Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

  11. PCR detection of Streptococcus mutans and Aggregatibacter actinomycetemcomitans in dental plaque samples from Haitian adolescents.

    Science.gov (United States)

    Psoter, Walter J; Ge, Yao; Russell, Stefanie L; Chen, Zhou; Katz, Ralph V; Jean-Charles, Germain; Li, Yihong

    2011-08-01

    Streptococcus mutans and Aggregatibacter actinomycetemcomitans are oral pathogens associated with dental caries and periodontitis, respectively. The aim of this study was to determine the colonization of these two microorganisms in the dental plaque of a group of Haitian adolescents using two different polymerase chain reaction (PCR) methods, standard PCR, and quantitative real-time PCR (qPCR) assays. Fifty-four pooled supra-gingival plaque samples and 98 pooled sub-gingival plaque samples were obtained from 104 12- to19-year-old rural-dwelling Haitians. The total genomic DNA of bacteria was isolated from these samples, and all participants also received caries and periodontal examinations. Caries prevalence was 42.2%, and the mean decayed, missing, and filled surface (DMFS) was 2.67 ± 5.3. More than half of the adolescents (53.3%) experienced periodontal pockets (Community Periodontal Index score ≥3). S. mutans was detected in 67.3% by qPCR and 38.8% by PCR of the supra-gingival plaque samples (p plaque samples. Neither age nor gender was significantly correlated to the bacterial colonization. The results demonstrated a moderate-to-high prevalence of S. mutans and A. actinomycetemcomitans in the Haitian adolescent population, and qPCR is more sensitive than standard PCR in field conditions. These findings suggest that qPCR should be considered for field oral epidemiologic studies and may be necessary in investigations having major logistic challenges.

  12. Critical assessment of digital PCR for the detection and quantification of genetically modified organisms.

    Science.gov (United States)

    Demeke, Tigst; Dobnik, David

    2018-07-01

    The number of genetically modified organisms (GMOs) on the market is steadily increasing. Because of regulation of cultivation and trade of GMOs in several countries, there is pressure for their accurate detection and quantification. Today, DNA-based approaches are more popular for this purpose than protein-based methods, and real-time quantitative PCR (qPCR) is still the gold standard in GMO analytics. However, digital PCR (dPCR) offers several advantages over qPCR, making this new technique appealing also for GMO analysis. This critical review focuses on the use of dPCR for the purpose of GMO quantification and addresses parameters which are important for achieving accurate and reliable results, such as the quality and purity of DNA and reaction optimization. Three critical factors are explored and discussed in more depth: correct classification of partitions as positive, correctly determined partition volume, and dilution factor. This review could serve as a guide for all laboratories implementing dPCR. Most of the parameters discussed are applicable to fields other than purely GMO testing. Graphical abstract There are generally three different options for absolute quantification of genetically modified organisms (GMOs) using digital PCR: droplet- or chamber-based and droplets in chambers. All have in common the distribution of reaction mixture into several partitions, which are all subjected to PCR and scored at the end-point as positive or negative. Based on these results GMO content can be calculated.

  13. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Spatial distribution, risk factors and haemato-biochemical alterations associated with Theileria equi infected equids of Punjab (India) diagnosed by indirect ELISA and nested PCR.

    Science.gov (United States)

    Sumbria, Deepak; Singla, L D; Kumar, Sanjay; Sharma, Amrita; Dahiya, Rajesh K; Setia, Raj

    2016-03-01

    Equine piroplasmosis is a febrile, tick-borne disease of equids predominately caused by obligatory intra-erythrocytic protozoa Theileria equi in the Indian sub-continent. A cross-sectional study was carried out on 464 equids (426 horses and 38 donkeys/mules) in Punjab, India to assess the level of exposure to equine piroplasmosis by 18S rRNA gene nested polymerase chain reaction (nPCR) and equine merozoite antigen-2 (EMA2) indirect-ELISA (enzyme linked immunosorbent assay), to investigate risk factors and haemato-biochemical alterations associated with the infection. The endemicity of the disease was confirmed by positive PCR amplification in 21.77% and positive antibody titers in 49.78% equid samples. There was a fair agreement between these two diagnostic techniques (Kappa coefficient=0.326). The spatial distribution analysis revealed an increasing trend of T. equi prevalence from north-eastern to south-western region of Punjab by both the techniques correspondingly, which proffered a direct relation with temperature and inverse with humidity variables. The relatively prominent risk factor associated with sero-positivity was the presence of other domestic animals in the herd, while the propensity of finding a positive PCR amplification was higher in donkeys/mules, animal kept at unorganised farm or those used for commercial purposes as compared to their counterparts. There was a significant increase in globulins, gamma glutamyl-transferase, total bilirubin, direct bilirubin, indirect bilirubin, glucose levels and decrease in total erythrocyte count, haemoglobin, packed cell volume by animals, which were revealed positive by nPCR (may or may not positive by indirect-ELISA) and increase in creatinine, total bilirubin, direct bilirubin, glucose and decrease in total erythrocytes count by animals, which were revealed positive by indirect-ELISA (alone). To our knowledge, this study, for the first time, brings out a comprehensive report on the status on spatial

  15. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  16. Real-time PCR in detection and quantitation of Leishmania donovani for the diagnosis of Visceral Leishmaniasis patients and the monitoring of their response to treatment

    Science.gov (United States)

    Ghosh, Prakash; Khan, Md. Anik Ashfaq; Duthie, Malcolm S.; Vallur, Aarthy C.; Picone, Alessandro; Howard, Randall F.; Reed, Steven G.

    2017-01-01

    Sustained elimination of Visceral Leishmaniasis (VL) requires the reduction and control of parasite reservoirs to minimize the transmission of Leishmania donovani infection. A simple, reproducible and definitive diagnostic procedure is therefore indispensable for the early and accurate detection of parasites in VL, Relapsed VL (RVL) and Post Kala-azar Dermal Leishmaniasis (PKDL) patients, all of whom are potential reservoirs of Leishmania parasites. To overcome the limitations of current diagnostic approaches, a novel quantitative real-time polymerase chain reaction (qPCR) method based on Taqman chemistry was devised for the detection and quantification of L. donovani in blood and skin. The diagnostic efficacy was evaluated using archived peripheral blood buffy coat DNA from 40 VL, 40 PKDL, 10 RVL, 20 cured VL, and 40 cured PKDL along with 10 tuberculosis (TB) cases and 80 healthy endemic controls. Results were compared to those obtained using a Leishmania-specific nested PCR (Ln-PCR). The real time PCR assay was 100% (95% CI, 91.19–100%) sensitive in detecting parasite genomes in VL and RVL samples and 85.0% (95% CI, 70.16–94.29%) sensitive for PKDL samples. In contrast, the sensitivity of Ln-PCR was 77.5% (95% CI, 61.55–89.16%) for VL samples, 100% (95%CI, 69.15–100%) for RVL samples, and 52.5% (95% CI, 36.13–68.49%) for PKDL samples. There was significant discordance between the two methods with the overall sensitivity of the qPCR assay being considerably higher than Ln-PCR. None of the assay detected L. donovani DNA in buffy coats from cured VL cases, and reduced infectious burdens were demonstrated in cured PKDL cases who remained positive in 7.5% (3/40) and 2.5% (1/40) cases by real-time PCR and Ln-PCR, respectively. Both assays were 100% (95% CI, 95.98–100) specific with no positive signals in either endemic healthy control or TB samples. The real time PCR assay we developed offers a molecular tool for accurate detection of circulating L

  17. Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

    Science.gov (United States)

    Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

    2015-01-01

    We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

  18. Real-Time PCR Assay To Detect Smallpox Virus

    Science.gov (United States)

    Sofi Ibrahim, M.; Kulesh, David A.; Saleh, Sharron S.; Damon, Inger K.; Esposito, Joseph J.; Schmaljohn, Alan L.; Jahrling, Peter B.

    2003-01-01

    We developed a highly sensitive and specific assay for the rapid detection of smallpox virus DNA on both the Smart Cycler and LightCycler platforms. The assay is based on TaqMan chemistry with the orthopoxvirus hemagglutinin gene used as the target sequence. With genomic DNA purified from variola virus Bangladesh 1975, the limit of detection was estimated to be approximately 25 copies on both machines. The assay was evaluated in a blinded study with 322 coded samples that included genomic DNA from 48 different isolates of variola virus; 25 different strains and isolates of camelpox, cowpox, ectromelia, gerbilpox, herpes, monkeypox, myxoma, rabbitpox, raccoonpox, skunkpox, vaccinia, and varicella-zoster viruses; and two rickettsial species at concentrations mostly ranging from 100 fg/μl to 1 ng/μl. Contained within those 322 samples were variola virus DNA, obtained from purified viral preparations, at concentrations of 1 fg/μl to 1 ng/μl. On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%). Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/μl to 1 ng/μl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform. Thus, the clinical sensitivities were 96.1% for the Smart Cycler instrument and 99.5% for the LightCycler instrument. The vast majority of these samples were derived from virus-infected cell cultures and variola virus-infected tissues; thus, the DNA material contained both viral DNA and cellular DNA. Of the 43 samples that contained purified variola virus DNA ranging in concentration from 1 fg/μl to 1 ng/μl, the assay correctly detected the virus in all 43 samples on both the Smart Cycler

  19. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  20. Optimization of Quantitative PCR Methods for Enteropathogen Detection

    Science.gov (United States)

    Liu, Jie; Gratz, Jean; Amour, Caroline; Nshama, Rosemary; Walongo, Thomas; Maro, Athanasia; Mduma, Esto; Platts-Mills, James; Boisen, Nadia; Nataro, James; Haverstick, Doris M.; Kabir, Furqan; Lertsethtakarn, Paphavee; Silapong, Sasikorn; Jeamwattanalert, Pimmada; Bodhidatta, Ladaporn; Mason, Carl; Begum, Sharmin; Haque, Rashidul; Praharaj, Ira; Kang, Gagandeep; Houpt, Eric R.

    2016-01-01

    Detection and quantification of enteropathogens in stool specimens is useful for diagnosing the cause of diarrhea but is technically challenging. Here we evaluate several important determinants of quantification: specimen collection, nucleic acid extraction, and extraction and amplification efficiency. First, we evaluate the molecular detection and quantification of pathogens in rectal swabs versus stool, using paired flocked rectal swabs and whole stool collected from 129 children hospitalized with diarrhea in Tanzania. Swabs generally yielded a higher quantification cycle (Cq) (average 29.7, standard deviation 3.5 vs. 25.3 ± 2.9 from stool, P<0.001) but were still able to detect 80% of pathogens with a Cq < 30 in stool. Second, a simplified total nucleic acid (TNA) extraction procedure was compared to separate DNA and RNA extractions and showed 92% (318/344) sensitivity and 98% (951/968) specificity, with no difference in Cq value for the positive results (ΔCq(DNA+RNA-TNA) = -0.01 ± 1.17, P = 0.972, N = 318). Third, we devised a quantification scheme that adjusts pathogen quantity to the specimen’s extraction and amplification efficiency, and show that this better estimates the quantity of spiked specimens than the raw target Cq. In sum, these methods for enteropathogen quantification, stool sample collection, and nucleic acid extraction will be useful for laboratories studying enteric disease. PMID:27336160

  1. MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

    Directory of Open Access Journals (Sweden)

    Rodrigo Staggemeier

    2014-04-01

    Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

  2. Detection of Mycobacterium avium subsp. paratuberculosis in Milk from Clinically Affected Cows by PCR and culture

    DEFF Research Database (Denmark)

    Giese, Steen Bjørck; Ahrens, Peter

    1999-01-01

    Milk and faecal samples from cows with clinical symptoms of paratuberculosis were examined for the presence of Mycobacterium avium subsp.paratuberculosis (M. a. paratuberculosis) by culture and PCR. M. a. paratuberculosis was isolated in varied numbers from faeces or intestinal mucosa in 8 of 11...... animals. In milk from 5 cows (all faecal culture-positive) we cultivated a few colonies of M. a. paratuberculosis (less than 100 CFU per mi). Milk samples from 2 cows were PCR-positive (both animals were faecal culture-positive, and 1 cow was milk culture positive). One cow was culture......-negative on intestinal mucosa, but culture-positive in milk, and both faeces and milk were negative in culture and PCR from 2 cows. In conclusion the presence of M. a. paratuberculosis could be detected in raw milk by PCR but cultivation of milk was more sensitive in detecting the organism....

  3. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  4. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Comparison of clinical performance of antigen basedenzyme immunoassay (EIA and major outer membrane protein (MOMP-PCR for detection of genital Chlamydia trachomatis infection

    Directory of Open Access Journals (Sweden)

    Mahmoud Nateghi Rostami

    2016-06-01

    Full Text Available Background: Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen worldwide. Early detection and treatment of C.trachomatis genital infection prevent serious reproductive complications. Objective: Performances of enzyme immunoassay (EIA and major outer membrane protein (MOMP-polymerase chain reaction (PCR for diagnosis of genital C.trachomatis infection in women were compared. Materials and Methods: In this cross sectional study a total of 518 women volunteers were included (33.67±8.3 yrs who had been referred to Gynecology clinics of Qom province, Iran, were included. Endocervical swab specimens were collected to detect lipopolysaccharide (LPS antigen in EIA and to amplify MOMP gene of C.trachomatis in PCR. Results were confirmed using ompI nested-PCR. Sensitivity, specificity, positive (PPV and negative predictive values (NPV were calculated for performance of the tests. Odds ratios were determined using binary logistic regression analysis. Results: In total, 37 (7.14% cases were positive by EIA and/or MOMP-PCR. All discrepant results were confirmed by nested-PCR. Sensitivity, specificity, PPV and NPV values of EIA were 59.46%, 100%, 100% and 96.98%, and those of MOMPPCR were 97.30%, 100%, 100%, 99.79%, respectively. Reproductive complications including 2.7% ectopic pregnancy, 5.4% stillbirth, 5.4% infertility, and 10.8% PROM were recorded. The risk of developing chlamydiosis was increased 4.8-fold in volunteers with cervicitis (p<0.05; OR 4.80; 95% CI 1.25-18.48. Conclusion: C.trachomatis infection should be regarded in women of reproductive ages especially those with cervicitis. Primary screening of women by using the low cost antigen-EIA is recommended; however, due to the low sensitivity of Ag-EIA, verification of the negative results by a DNA amplification method is needed.

  6. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  7. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    Science.gov (United States)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  8. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR

    OpenAIRE

    Cai, Yicun; He, Yuping; Lv, Rong; Chen, Hongchao; Wang, Qiang; Pan, Liangwen

    2017-01-01

    Meat products often consist of meat from multiple animal species, and inaccurate food product adulteration and mislabeling can negatively affect consumers. Therefore, a cost-effective and reliable method for identification and quantification of animal species in meat products is required. In this study, we developed a duplex droplet digital PCR (dddPCR) detection and quantification system to simultaneously identify and quantify the source of meat in samples containing a mixture of beef (Bos t...

  9. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Directory of Open Access Journals (Sweden)

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  10. Real-Time PCR using a PCR Microchip with Integrated Thermal System and Polymer Waveguides for the Detection of Campylobacter jejuni

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Sekulovic, Andrea; Kutter, Jörg Peter

    2006-01-01

    A novel real-time PCR microchip platform with integrated thermal system and polymer waveguides has been developed. By using the integrated optical system of the real-time PCR chip, cadF – a virulence gene of Campylobacter jejuni, could specifically be detected. Two different DNA binding dyes, SYTOX...

  11. Development of a Machine Vision Method for the Monitoring of Laying Hens and Detection of Multiple Nest Occupations

    Directory of Open Access Journals (Sweden)

    Mauro Zaninelli

    2018-01-01

    Full Text Available Free range systems can improve the welfare of laying hens. However, the access to environmental resources can be partially limited by social interactions, feeding of hens, and productivity, can be not stable and damaging behaviors, or negative events, can be observed more frequently than in conventional housing systems. In order to reach a real improvement of the hens’ welfare the study of their laying performances and behaviors is necessary. With this purpose, many systems have been developed. However, most of them do not detect a multiple occupation of the nest negatively affecting the accuracy of data collected. To overcome this issue, a new “nest-usage-sensor” was developed and tested. It was based on the evaluation of thermografic images, as acquired by a thermo-camera, and the performing of patter recognitions on images acquired from the nest interior. The sensor was setup with a “Multiple Nest Occupation Threshold” of 796 colored pixels and a template of triangular shape and sizes of 43 × 33 pixels (high per base. It was tested through an experimental nesting system where 10 hens were reared for a month. Results showed that the evaluation of thermografic images could increase the detection performance of a multiple occupation of the nest and to apply an image pattern recognition technique could allow for counting the number of hens in the nest in case of a multiple occupation. As a consequence, the accuracy of data collected in studies on laying performances and behaviors of hens, reared in a free-range housing system, could result to be improved.

  12. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Improved detection of canine Angiostrongylus vasorum infection using real-time PCR and indirect ELISA.

    Science.gov (United States)

    Jefferies, Ryan; Morgan, Eric R; Helm, Jenny; Robinson, Matthew; Shaw, Susan E

    2011-12-01

    This study reports the development of a real-time PCR assay and an indirect ELISA to improve on current detection of canine Angiostrongylus vasorum infection. A highly specific fluorescent probe-based, real-time PCR assay was developed to target the A. vasorum second internal transcribed spacer region and detected DNA in EDTA blood, lung tissue, broncho-alveolar larvage fluid, endotracheal mucus, pharyngeal swabs and faecal samples. PCR was fast (∼1 h), highly efficient when using EDTA blood samples, consistently detected a single molecule of parasite DNA and did not amplify DNA from other parasitic nematodes or definitive host species. An indirect ELISA was also developed using the soluble protein fraction from adult A. vasorum worms. Some cross-reactive antigen recognition was observed when tested against sera from dogs infected with Crenosoma vulpis (n = 8), Toxocara canis (n = 5) and Dirofilaria immitis (n = 5). This was largely overcome by setting the cut-off for a positive result at an appropriately high level. Field evaluation of the real-time PCR and ELISA was conducted by testing sera and EDTA blood from dogs with suspected A. vasorum infection (n = 148) and compared with the Baermann's larval migration test in faeces. Thirty-one dogs were positive by at least one test. Of these, 20 (65%) were detected by the Baermann method, 18 (58%) by blood PCR, 24 (77%) by ELISA and 28 (90%) by blood PCR and ELISA together. Combined testing using real-time PCR and ELISA therefore improved the detection rate of A. vasorum infection and holds promise for improved clinical diagnosis and epidemiological investigation.

  14. Mycobacterium paratuberculosis detection in cow's milk in Argentina by immunomagnetic separation-PCR.

    Science.gov (United States)

    Gilardoni, Liliana Rosa; Fernández, Bárbara; Morsella, Claudia; Mendez, Laura; Jar, Ana María; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor

    2016-01-01

    The aim of this study was to standardize a diagnosis procedure to detect Mycobacterium avium subsp. paratuberculosis (Map) DNA in raw cow milk samples under field conditions. A procedure that combines both immunomagnetic separation and IS900-PCR detection (IMS-IS1 PCR) was employed on milk samples from 265 lactating Holstein cows from Map infected and uninfected herds in Argentina. IMS-IS1 PCR results were analyzed and compared with those obtained from milk and fecal culture and serum ELISA. The extent of agreement between both tests was determined by the Kappa test. IMS-IS1 PCR showed a detection limit of 10(1) CFU of Map/mL of milk, when 50:50 mix of monoclonal and polyclonal antibodies were used to coat magnetic beads. All of the 118 samples from the Map uninfected herds were negative for the set of the tests. In Map infected herds, 80 out of 147 cows tested positive by milk IMS-IS1 PCR (55%), of which 2 (1.4%) were also positive by milk culture, 15 (10%) by fecal culture, and 20 (14%) by serum ELISA. Kappa statistics (95% CI) showed a slight agreement between the different tests (<0.20), and the proportions of agreement were ≤0.55. The IMS-IS1 PCR method detected Map in milk of the cows that were not positive in other techniques. This is the first report dealing with the application of IMS-IS1 PCR in the detection of Map in raw milk samples under field conditions in Argentina. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  15. A MIQE-compliant real-time PCR assay for Aspergillus detection.

    Directory of Open Access Journals (Sweden)

    Gemma L Johnson

    Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness

  16. PCR detection of malaria parasites in desiccated Anopheles mosquitoes is uninhibited by storage time and temperature

    Directory of Open Access Journals (Sweden)

    Rider Mark A

    2012-06-01

    Full Text Available Abstract Background Reliable methods to preserve mosquito vectors for malaria studies are necessary for detecting Plasmodium parasites. In field settings, however, maintaining a cold chain of storage from the time of collection until laboratory processing, or accessing other reliable means of sample preservation is often logistically impractical or cost prohibitive. As the Plasmodium infection rate of Anopheles mosquitoes is a central component of the entomological inoculation rate and other indicators of transmission intensity, storage conditions that affect pathogen detection may bias malaria surveillance indicators. This study investigated the effect of storage time and temperature on the ability to detect Plasmodium parasites in desiccated Anopheles mosquitoes by real-time polymerase chain reaction (PCR. Methods Laboratory-infected Anopheles stephensi mosquitoes were chloroform-killed and stored over desiccant for 0, 1, 3, and 6 months while being held at four different temperatures: 28, 37, -20 and -80°C. The detection of Plasmodium DNA was evaluated by real-time PCR amplification of a 111 base pair region of block 4 of the merozoite surface protein. Results Varying the storage time and temperature of desiccated mosquitoes did not impact the sensitivity of parasite detection. A two-way factorial analysis of variance suggested that storage time and temperature were not associated with a loss in the ability to detect parasites. Storage of samples at 28°C resulted in a significant increase in the ability to detect parasite DNA, though no other positive associations were observed between the experimental storage treatments and PCR amplification. Conclusions Cold chain maintenance of desiccated mosquito samples is not necessary for real-time PCR detection of parasite DNA. Though field-collected mosquitoes may be subjected to variable conditions prior to molecular processing, the storage of samples over an inexpensive and logistically

  17. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  18. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

    Science.gov (United States)

    Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

    2014-06-01

    The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  19. Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    2018-04-01

    Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

  20. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  1. Post-PCR detection of nucleic acids using metalloporphyrin labels and time-resolved fluorescence

    International Nuclear Information System (INIS)

    O'Shea, Desmond J.; O'Sullivan, Paul J.; Ponomarev, Gelii V.; Papkovsky, Dmitri B.

    2005-01-01

    Phosphorescent platinum(II)-coproporphyrin label (PtCP) was evaluated in post-PCR detection of nucleic acids by time-resolved fluorescence (TR-F) using three common formats. PtCP-labelled oligonucleotide primers and PtCP-dUTP were incorporated in a PCR to produce labelled amplified target -173 or 305 bp DNA. Alternatively, aminoallyl-dUTP was incorporated in a PCR and the product was subsequently labelled with PtCP. The resulting PCR mixtures containing labelled dsDNA were separated on 1.5% agarose gels and then analysed by ethidium bromide staining and by direct detection of PtCP label on a commercial TR-F plate reader Victor 2 (Perkin Elmer Life Sciences) used in scanning mode. In all cases label incorporation and high yields of amplified DNA were observed. Direct TR-F detection of PtCP-labelled DNA from a gel provided high sensitivity and signal to noise ratio, with limits of detection in the range of 9-22 pg for all three formats. The sensitivity achieved with PtCP label was considerably better than that achieved with ethidium bromide staining (∼1 ng of dsDNA) or with conventional fluorescent label FITC. Neither the FITC label nor ethidium bromide staining interfered with PtCP detection, thus allowing multiplexed detection

  2. Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.

    Science.gov (United States)

    Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin

    2017-12-01

    Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.

  3. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensi