WorldWideScience

Sample records for naphtho-homologated dna bases

  1. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  2. Principles of DNA architectonics: design of DNA-based nanoobjects

    International Nuclear Information System (INIS)

    Vinogradova, O A; Pyshnyi, D V

    2012-01-01

    The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

  3. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

    2008-01-01

    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  4. DNA-based watermarks using the DNA-Crypt algorithm

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-01-01

    Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

  5. DNA-based watermarks using the DNA-Crypt algorithm

    Directory of Open Access Journals (Sweden)

    Barnekow Angelika

    2007-05-01

    Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  6. DNA-based watermarks using the DNA-Crypt algorithm.

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-05-29

    The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  7. Processing of free radical damaged DNA bases

    International Nuclear Information System (INIS)

    Wallace, S.

    2003-01-01

    Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant

  8. Metallic Nanostructures Based on DNA Nanoshapes

    Directory of Open Access Journals (Sweden)

    Boxuan Shen

    2016-08-01

    Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.

  9. DNA-Based Applications in Nanobiotechnology

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2010-01-01

    Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

  10. Charge transport through DNA based electronic barriers

    Science.gov (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  11. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  12. Recent progress on DNA based walkers.

    Science.gov (United States)

    Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun

    2015-08-01

    DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. DNA Based Electrochromic and Photovoltaic Cells

    Science.gov (United States)

    2012-01-01

    using deoxyribonucleic acid complex as an electron blocking layer App. Phys. Lett. 88 (2006) 171109. 23. F.H.C. Crick , J.D. Watson . The complementary...9550-09-1-0647 final 01-09-2009 ; 30-11-2011 DNA Based Electrochromic and Photovoltaic Cells FA 9550-09-1-0647 Pawlicka, Agnieszka, J. Instituto de...Available. DNA is an abundant natural product with very good biodegradation properties and can be used to obtain gel polymer electrolytes (GPEs) with high

  14. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  15. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  16. Communication: Electron ionization of DNA bases

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, M. A.; Krishnakumar, E., E-mail: ekkumar@tifr.res.in

    2016-04-28

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.

  17. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  18. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas

    2012-06-06

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  19. DNA Array-Based Gene Profiling

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario

    2005-01-01

    Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987

  20. Excited state dynamics of DNA bases

    Czech Academy of Sciences Publication Activity Database

    Kleinermanns, K.; Nachtigallová, Dana; de Vries, M. S.

    2013-01-01

    Roč. 32, č. 2 (2013), s. 308-342 ISSN 0144-235X R&D Projects: GA ČR GAP208/12/1318 Grant - others:National Science Foundation(US) CHE-0911564; NASA (US) NNX12AG77G; Deutsche Forschungsgemeinschaft(DE) SFB 663; Deutsche Forschungsgemeinschaft(DE) KI 531-29 Institutional support: RVO:61388963 Keywords : DNA bases * nucleobases * excited state * dynamics * computations * gas phase * conical intersections Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.920, year: 2013

  1. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Fei Chen

    2003-01-01

    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  2. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    Science.gov (United States)

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  3. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  4. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  5. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  6. DNA sequence modeling based on context trees

    NARCIS (Netherlands)

    Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.

    2015-01-01

    Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such

  7. Electroporation-based DNA delivery technology

    DEFF Research Database (Denmark)

    Gothelf, A; Gehl, Julie

    2014-01-01

    DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....

  8. Induced Polarization Influences the Fundamental Forces in DNA Base Flipping

    OpenAIRE

    Lemkul, Justin A.; Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base...

  9. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    DIRECTOR

    2013-07-10

    Jul 10, 2013 ... Electrophoresis) buffer, 2 µl of SYBR-safe (DNA staining dye) was added to it, mixed properly, ..... tools in plant genetic resources conservation: a guide to the technologies. IPGRI. Rome ... Creating Capital. Seethalakshmi KK ...

  10. A nuclear DNA-based species determination and DNA quantification assay for common poultry species.

    Science.gov (United States)

    Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S

    2014-12-01

    DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.

  11. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  12. Indicator Based and Indicator - Free Electrochemical DNA Biosensors

    National Research Council Canada - National Science Library

    Kerman, Kagan

    2001-01-01

    The utility and advantages of an indicator free and MB based sequence specific DNA hybridization biosensor based on guanine and adenine oxidation signals and MB reduction signals have been demonstrated...

  13. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    Science.gov (United States)

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  15. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  16. A NOVEL ROLLING BASED DNA CRYPTOGRAPHY

    Directory of Open Access Journals (Sweden)

    Rejwana Haque

    2017-05-01

    Full Text Available DNA Cryptography can be defined as a hiding data in terms of DNA Sequence. In this paper we propose a new DNA Encryption Technique where three different types of ordering is use to make binary data into cipher text. The main stages of this encryption technique are: Key Analysis, Data and Key Arrangement, Roll in encoding, Secondary Arrangement and Shifting. Decryption process has six main steps to obtain the original binary data from the encrypted data and key. Decryption steps are: Key Analysis, Shifting, Secondary Arrangement, Key Arrangement, Roll-out decoding, Data Arrangement. Here key size is half of binary data and the key is varies from data to data so key are used as one time pad. In this paper we also discuss about the implementation from sample data and security analysis for this given method.

  17. Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases?

    Science.gov (United States)

    Lee, Andrea J; Wallace, Susan S

    2017-06-01

    The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. DNA hybridization sensor based on pentacene thin film transistor.

    Science.gov (United States)

    Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang

    2011-01-15

    A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Towards DNA-Based Programmable Matter

    Science.gov (United States)

    2012-02-28

    thiolated   ssDNA  was  first  immobilized  onto  the  gold...surface.  The  surface  was  then  passivated  with   mercaptohexanol.  Subsequently,  another  complementary   thiolated ...right).       Approach  3:  DNA-­‐mediated  interaction  between   polymer -­‐coated  surfaces   We  also  tried

  20. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  1. Mapping Base Modifications in DNA by Transverse-Current Sequencing

    Science.gov (United States)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2018-02-01

    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  2. DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

    Science.gov (United States)

    Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

    2017-12-15

    The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Highly sensitive DNA sensors based on cerium oxide nanorods

    Science.gov (United States)

    Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh

    2018-04-01

    In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.

  4. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  5. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  6. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  7. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.

  8. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  9. Oxidative DNA base modifications as factors in carcinogenesis

    International Nuclear Information System (INIS)

    Olinski, R.; Jaruga, P.; Zastawny, T.H.

    1998-01-01

    Reactive oxygen species can cause extensive DNA modifications including modified bases. Some of the DNA base damage has been found to possess premutagenic properties. Therefore, if not repaired, it can contribute to carcinogenesis. We have found elevated amounts of modified bases in cancerous and precancerous tissues as compared with normal tissues. Most of the agents used in anticancer therapy are paradoxically responsible for induction of secondary malignancies and some of them may generate free radicals. The results of our experiments provide evidence that exposure of cancer patients to therapeutic doses of ionizing radiation and anticancer drugs cause base modifications in genomic DNA of lymphocytes. Some of these base damages could lead to mutagenesis in critical genes and ultimately to secondary cancers such as leukemias. This may point to an important role of oxidative base damage in cancer initiation. Alternatively, the increased level of the modified base products may contribute to genetic instability and metastatic potential of tumor cells. (author)

  10. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  11. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  12. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2012-01-01

    Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  13. A Rewritable, Random-Access DNA-Based Storage System.

    Science.gov (United States)

    Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica

    2015-09-18

    We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.

  14. A universal DNA-based protein detection system.

    Science.gov (United States)

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  15. Ultraviolet enhancement of DNA base release by bleomycin

    International Nuclear Information System (INIS)

    Kakinuma, J.; Tanabe, M.; Orii, H.

    1984-01-01

    The effect of UV irradiation on base-releasing activity of bleomycin was studied on bleomycin A 2 -DNA reaction mixture in the presence of Fe(II) and 2-mercaptoethanol. This effect was measured by the release of free bases from calf thymus DNA with high-performance liquid chromatography. UV irradiation enhanced DNA base-releasing activity of bleomycin and simultaneously caused disappearance of fluorescence emission maximum at 355 nm assigned to bithiazole rings and increase in the intensity of a peak at 400 nm. UV irradiation at 295 nm, the UV absorption maximum of bleomycin, is the most effective in releasing free bases and in changing fluorescence emission patterns. From these results, we suggest that some alterations in the bithiazole group of bleomycin molecule were initiated by UV irradiation and contributed to increased base-releasing activity of bleomycin through a yet unexplained mechanism, presumably through bleomycin dimer formation. (orig.)

  16. DNA based random key generation and management for OTP encryption.

    Science.gov (United States)

    Zhang, Yunpeng; Liu, Xin; Sun, Manhui

    2017-09-01

    One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

  17. Application of DNA-based methods in forensic entomology.

    Science.gov (United States)

    Wells, Jeffrey D; Stevens, Jamie R

    2008-01-01

    A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.

  18. Transforming bases to bytes: Molecular computing with DNA

    Indian Academy of Sciences (India)

    Despite the popular image of silicon-based computers for computation, an embryonic field of mole- cular computation is emerging, where molecules in solution perform computational ..... [4] Mao C, Sun W, Shen Z and Seeman N C 1999. A nanomechanical device based on the B-Z transition of DNA; Nature 397 144–146.

  19. DNA based methods used for characterization and detection of food ...

    African Journals Online (AJOL)

    Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

  20. The current state of eukaryotic DNA base damage and repair.

    Science.gov (United States)

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-02

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas; Castro, David; Foulds, Ian G.; Parameswaran, Ash M.; Sumanpreet, K. Chhina

    2012-01-01

    the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two

  2. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  3. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Science.gov (United States)

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  4. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Directory of Open Access Journals (Sweden)

    Md. Mahbubur Rahman

    2015-02-01

    Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  5. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  6. Improved chaos-based video steganography using DNA alphabets

    Directory of Open Access Journals (Sweden)

    Nirmalya Kar

    2018-03-01

    Full Text Available DNA based steganography plays a vital role in the field of privacy and secure communication. Here, we propose a DNA properties-based mechanism to send data hidden inside a video file. Initially, the video file is converted into image frames. Random frames are then selected and data is hidden in these at random locations by using the Least Significant Bit substitution method. We analyze the proposed architecture in terms of peak signal-to-noise ratio as well as mean squared error measured between the original and steganographic files averaged over all video frames. The results show minimal degradation of the steganographic video file. Keywords: Chaotic map, DNA, Linear congruential generator, Video steganography, Least significant bit

  7. DNA methylation based biomarkers: Practical considerations and applications

    DEFF Research Database (Denmark)

    Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg

    2012-01-01

    of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...

  8. Trial watch: Naked and vectored DNA-based anticancer vaccines.

    Science.gov (United States)

    Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

    2015-05-01

    One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

  9. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  10. DNA-based random number generation in security circuitry.

    Science.gov (United States)

    Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C

    2010-06-01

    DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.

  11. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  12. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  13. DNA-based asymmetric organometallic catalysis in water

    NARCIS (Netherlands)

    Oelerich, Jens; Roelfes, Gerard

    2013-01-01

    Here, the first examples of DNA-based organometallic catalysis in water that give rise to high enantioselectivities are described. Copper complexes of strongly intercalating ligands were found to enable the asymmetric intramolecular cyclopropanation of alpha-diazo-beta-keto sulfones in water. Up to

  14. DNA/RNA-based formulations for treatment of breast cancer.

    Science.gov (United States)

    Xie, Zhaolu; Zeng, Xianghui

    2017-12-01

    To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.

  15. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  16. DNA-Based Self-Assembly of Fluorescent Nanodiamonds.

    Science.gov (United States)

    Zhang, Tao; Neumann, Andre; Lindlau, Jessica; Wu, Yuzhou; Pramanik, Goutam; Naydenov, Boris; Jelezko, Fedor; Schüder, Florian; Huber, Sebastian; Huber, Marinus; Stehr, Florian; Högele, Alexander; Weil, Tanja; Liedl, Tim

    2015-08-12

    As a step toward deterministic and scalable assembly of ordered spin arrays we here demonstrate a bottom-up approach to position fluorescent nanodiamonds (NDs) with nanometer precision on DNA origami structures. We have realized a reliable and broadly applicable surface modification strategy that results in DNA-functionalized and perfectly dispersed NDs that were then self-assembled in predefined geometries. With optical studies we show that the fluorescence properties of the nitrogen-vacancy color centers in NDs are preserved during surface modification and DNA assembly. As this method allows the nanoscale arrangement of fluorescent NDs together with other optically active components in complex geometries, applications based on self-assembled spin lattices or plasmon-enhanced spin sensors as well as improved fluorescent labeling for bioimaging could be envisioned.

  17. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  18. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  19. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  20. Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers

    Directory of Open Access Journals (Sweden)

    MEMEN SURAHMAN

    2010-07-01

    Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.

  1. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)

    2017-10-20

    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  2. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  3. Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.

    Science.gov (United States)

    Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei

    2016-11-01

    Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.

  4. Computational modeling of a carbon nanotube-based DNA nanosensor

    Energy Technology Data Exchange (ETDEWEB)

    Kalantari-Nejad, R; Bahrami, M [Mechanical Engineering Department, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Rafii-Tabar, H [Department of Medical Physics and Biomedical Engineering and Research Centre for Medical Nanotechnology and Tissue Engineering, Shahid Beheshti University of Medical Sciences, Evin, Tehran (Iran, Islamic Republic of); Rungger, I; Sanvito, S, E-mail: mbahrami@aut.ac.ir [School of Physics and CRANN, Trinity College, Dublin 2 (Ireland)

    2010-11-05

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  5. Computational modeling of a carbon nanotube-based DNA nanosensor

    International Nuclear Information System (INIS)

    Kalantari-Nejad, R; Bahrami, M; Rafii-Tabar, H; Rungger, I; Sanvito, S

    2010-01-01

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  6. A dynamic bead-based microarray for parallel DNA detection

    International Nuclear Information System (INIS)

    Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P

    2011-01-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

  7. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  8. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  9. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  10. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    Science.gov (United States)

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  12. Electrochemical DNA biosensor based on avidin-biotin conjugation for influenza virus (type A) detection

    Science.gov (United States)

    Chung, Da-Jung; Kim, Ki-Chul; Choi, Seong-Ho

    2011-09-01

    An electrochemical DNA biosensor (E-DNA biosensor) was fabricated by avidin-biotin conjugation of a biotinylated probe DNA, 5'-biotin-ATG AGT CTT CTA ACC GAG GTC GAA-3', and an avidin-modified glassy carbon electrode (GCE) to detect the influenza virus (type A). An avidin-modified GCE was prepared by the reaction of avidin and a carboxylic acid-modified GCE, which was synthesized by the electrochemical reduction of 4-carboxyphenyl diazonium salt. The current value of the E-DNA biosensor was evaluated after hybridization of the probe DNA and target DNA using cyclic voltammetry (CV). The current value decreased after the hybridization of the probe DNA and target DNA. The DNA that was used follows: complementary target DNA, 5'-TTC GAC CTC GGT TAG AAG ACT CAT-3' and two-base mismatched DNA, 5'-TTC GAC AGC GGT TAT AAG ACT CAT-3'.

  13. Magnetophoresis of flexible DNA-based dumbbell structures

    Science.gov (United States)

    Babić, B.; Ghai, R.; Dimitrov, K.

    2008-02-01

    Controlled movement and manipulation of magnetic micro- and nanostructures using magnetic forces can give rise to important applications in biomedecine, diagnostics, and immunology. We report controlled magnetophoresis and stretching, in aqueous solution, of a DNA-based dumbbell structure containing magnetic and diamagnetic microspheres. The velocity and stretching of the dumbbell were experimentally measured and correlated with a theoretical model based on the forces acting on individual magnetic beads or the entire dumbbell structures. The results show that precise and predictable manipulation of dumbbell structures is achievable and can potentially be applied to immunomagnetic cell separators.

  14. Developing a biological dosimeter based on mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

    1996-12-31

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.

  15. Developing a biological dosimeter based on mitochondrial DNA

    International Nuclear Information System (INIS)

    Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.

    1995-01-01

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs

  16. Electrochemical DNA biosensor based on the BDD nanograss array electrode.

    Science.gov (United States)

    Jin, Huali; Wei, Min; Wang, Jinshui

    2013-04-10

    The development of DNA biosensor has attracted considerable attention due to their potential applications, including gene analysis, clinical diagnostics, forensic study and more medical applications. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry in this study. Electrochemical DNA biosensor was developed based on the BDD film electrode (fBDD) and BDD nanograss array electrode (nBDD). In comparison with fBDD and AuNPs/CA/fBDD electrode, the lower semicircle diameter of electrochemical impedance spectroscopy obtained on nBDD and AuNPs/CA/nBDD electrode indicated that the presence of nanograss array improved the reactive site, reduced the interfacial resistance, and made the electron transfer easier. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry. The experimental results demonstrated that the prepared AuNPs/CA/nBDD electrode was suitable for DNA hybridization with favorable performance of faster response, higher sensitivity, lower detection limit and satisfactory selectivity, reproducibility and stability.

  17. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  19. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva

    2016-06-10

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  20. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva; Borja, Á ngel; Irigoien, Xabier; Rodrí guez-Ezpeleta, Naiara

    2016-01-01

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  1. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  2. Cloud-based adaptive exon prediction for DNA analysis.

    Science.gov (United States)

    Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen

    2018-02-01

    Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.

  3. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  4. DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis

    Science.gov (United States)

    Lucena-Aguilar, Gema; Sánchez-López, Ana María; Barberán-Aceituno, Cristina; Carrillo-Ávila, José Antonio; López-Guerrero, José Antonio

    2016-01-01

    High-quality human DNA samples and associated information of individuals are necessary for biomedical research. Biobanks act as a support infrastructure for the scientific community by providing a large number of high-quality biological samples for specific downstream applications. For this purpose, biobank methods for sample preparation must ensure the usefulness and long-term functionality of the products obtained. Quality indicators are the tool to measure these parameters, the purity and integrity determination being those specifically used for DNA. This study analyzes the quality indicators in DNA samples derived from 118 frozen human tissues in optimal cutting temperature (OCT) reactive, 68 formalin-fixed paraffin-embedded (FFPE) tissues, 119 frozen blood samples, and 26 saliva samples. The results obtained for DNA quality are discussed in association with the usefulness for downstream applications and availability of the DNA source in the target study. In brief, if any material is valid, blood is the most approachable option of prospective collection of samples providing high-quality DNA. However, if diseased tissue is a requisite or samples are available, the recommended source of DNA would be frozen tissue. These conclusions will determine the best source of DNA, according to the planned downstream application. Furthermore our results support the conclusion that a complete procedure of DNA quantification and qualification is necessary to guarantee the appropriate management of the samples, avoiding low confidence results, high costs, and a waste of samples. PMID:27158753

  5. DNA based identification of medicinal materials in Chinese patent medicines

    Science.gov (United States)

    Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo

    2012-12-01

    Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.

  6. Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization

    International Nuclear Information System (INIS)

    Liu, P.; Hun, X.; Qing, H.

    2011-01-01

    We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)

  7. A DNA-based nanomechanical device with three robust states

    OpenAIRE

    Chakraborty, Banani; Sha, Ruojie; Seeman, Nadrian C.

    2008-01-01

    DNA has been used to build a variety of devices, ranging from those that are controlled by DNA structural transitions to those that are controlled by the addition of specific DNA strands. These sequence-dependent devices fulfill the promise of DNA in nanotechnology because a variety of devices in the same physical environment can be controlled individually. Many such devices have been reported, but most of them contain one or two structurally robust end states, in addition to a floppy interme...

  8. Statistical length of DNA based on AFM image measured by a computer

    International Nuclear Information System (INIS)

    Chen Xinqing; Qiu Xijun; Zhang Yi; Hu Jun; Wu Shiying; Huang Yibo; Ai Xiaobai; Li Minqian

    2001-01-01

    Taking advantage of image processing technology, the contour length of DNA molecule was measured automatically by a computer. Based on the AFM image of DNA, the topography of DNA was simulated into a curve. Then the DNA length was measured automatically by inserting mode. It was shown that the experimental length of a naturally deposited DNA (180.4 +- 16.4 nm) was well consistent with the theoretical length (185.0 nm). Comparing to other methods, the present approach had advantages of precision and automatism. The stretched DNA was also measured. It present approach had advantages of precision and automatism. The stretched DNA was also measured. It was shown that the experimental length (343.6 +- 20.7 nm) was much longer than the theoretical length (307.0 nm). This result indicated that the stretching process had a distinct effect on the DNA length. However, the method provided here avoided the DNA-stretching effect

  9. Design and specificity of long ssDNA donors for CRISPR-based knock-in

    OpenAIRE

    Leonetti, Manuel; Li, Han; Beckman, Kyle; Pessino, Veronica; Huang, Bo; Weissman, Jonathan

    2017-01-01

    CRISPR/Cas technologies have transformed our ability to manipulate genomes for research and gene-based therapy. In particular, homology-directed repair after genomic cleavage allows for precise modification of genes using exogenous donor sequences as templates. While both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) forms of donors have been used as repair templates, a systematic comparison of the performance and specificity of repair using ssDNA versus dsDNA donors is still la...

  10. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  11. Electrochemical DNA biosensor based on MNAzyme-mediated signal amplification

    International Nuclear Information System (INIS)

    Diao, Wei; Tang, Min; Ding, Xiaojuan; Zhang, Ye; Yang, Jianru; Cheng, Wenbin; Mo, Fei; Wen, Bo; Xu, Lulu; Yan, Yurong

    2016-01-01

    The authors describe an electrochemical sensing strategy for highly sensitive and specific detection of target (analyte) DNA based on an amplification scheme mediated by a multicomponent nucleic acid enzyme (MNAzyme). MNAzymes were formed by multicomponent complexes which produce amplified “output” signals in response to specific “input” signal. In the presence of target nucleic acid, multiple partial enzymes (partzymes) oligonucleotides are assembled to form active MNAzymes. These can cleave H0 substrate into two pieces, thereby releasing the activated MNAzyme to undergo an additional cycle of amplification. Here, the two pieces contain a biotin-tagged sequence and a byproduct. The biotin-tagged sequences are specifically captured by the detection probes immobilized on the gold electrode. By employing streptavidinylated alkaline phosphatase as an enzyme label, an electrochemical signal is obtained. The electrode, if operated at a working potential of 0.25 V (vs. Ag/AgCl) in solution of pH 7.5, covers the 100 pM to 0.25 μM DNA concentration range, with a 79 pM detection limit. In our perception, the strategy introduced here has a wider potential in that it may be applied to molecular diagnostics and pathogen detection. (author)

  12. A history of the DNA repair and mutagenesis field: The discovery of base excision repair.

    Science.gov (United States)

    Friedberg, Errol C

    2016-01-01

    This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.

  13. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  14. PCR-based detection of a rare linear DNA in cell culture.

    Science.gov (United States)

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  15. DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity

    NARCIS (Netherlands)

    Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard

    2008-01-01

    This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to

  16. Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

    Science.gov (United States)

    Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

    2018-01-01

    Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

  17. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Science.gov (United States)

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. DNA methylation-based classification of central nervous system tumours

    DEFF Research Database (Denmark)

    Capper, David; Jones, David T.W.; Sill, Martin

    2018-01-01

    Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging - with substantial inter-observer variabil......Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging - with substantial inter......-observer variability in the histopathological diagnosis of many tumour types. Here we present a comprehensive approach for the DNA methylation-based classification of central nervous system tumours across all entities and age groups, and demonstrate its application in a routine diagnostic setting. We show...

  19. A sequence-dependent rigid-base model of DNA

    Science.gov (United States)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

    2013-02-01

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  20. A sequence-dependent rigid-base model of DNA.

    Science.gov (United States)

    Gonzalez, O; Petkevičiūtė, D; Maddocks, J H

    2013-02-07

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  1. DNA microarray-based PCR ribotyping of Clostridium difficile.

    Science.gov (United States)

    Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian

    2015-02-01

    This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  3. Slow elimination of injured liver DNA bases of γ-irradiated old mice

    International Nuclear Information System (INIS)

    Gaziev, A.I.; Malakhov, L.V.; Fomenko, L.A.

    1982-01-01

    The paper presents a study of the elimination of injured bases from the liver DNA of old and young mice after their exposure to γ rays. The presented data show that if DNA from the liver of irradiated mice is treated with incision enzymes, its priming activity is increased. In the case of enzymatic treatment of DNA isolated 5 h after irradiation we find a great difference between the priming activity of the liver DNA of old and young mice. The reason for this difference is that the liver DNA of 20-month old mice 5 h after irradiation still has many unrepaired injured bases. These data indicated that the rate of incision of γ-injured DNA bases in the liver of old mice is lower than in the liver of young mice. In the liver of mice of different age the rate of restitution of DNA, single-strand breaks induced by γ rays in doses up to 100 Gy is the same. At the same time, the level of induced reparative synthesis of DNA in cells of an old organism is lower than in cells of a young organism. The obtained data suggest that reduction of the rate of elimination of modified bases from the cell DNA of 20-month old mice is due to reduction of the activity of the DNA repair enzymes or to restrictions in the chromatin in the access of these enzymes to the injured regions of DNA in the cells of old animals

  4. Fundamental study of the radiation monitoring system based on evaluation of DNA lesions

    International Nuclear Information System (INIS)

    Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.

    2011-01-01

    The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)

  5. Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.

    Science.gov (United States)

    Gryson, Nicolas

    2010-03-01

    The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.

  6. Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor

    Science.gov (United States)

    Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh

    2017-09-01

    The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.

  7. DNA Base Excision Repair (BER) and Cancer Gene Therapy: Use of the Human N-mythlpurien DNA Glycosylase (MPG) to Sensitize Breast Cancer Cells to Low Dose Chemotherapy

    National Research Council Canada - National Science Library

    Harvey, Tia

    2003-01-01

    The DNA Base Excision Repair (PER) pathway is responsible for the repair of alkylation and oxidative DNA damage resulting in protection against the deleterious effects of endogenous and exogenous agents encountered on a daily basis...

  8. The use of gold nanoparticle aggregation for DNA computing and logic-based biomolecular detection

    International Nuclear Information System (INIS)

    Lee, In-Hee; Yang, Kyung-Ae; Zhang, Byoung-Tak; Lee, Ji-Hoon; Park, Ji-Yoon; Chai, Young Gyu; Lee, Jae-Hoon

    2008-01-01

    The use of DNA molecules as a physical computational material has attracted much interest, especially in the area of DNA computing. DNAs are also useful for logical control and analysis of biological systems if efficient visualization methods are available. Here we present a quick and simple visualization technique that displays the results of the DNA computing process based on a colorimetric change induced by gold nanoparticle aggregation, and we apply it to the logic-based detection of biomolecules. Our results demonstrate its effectiveness in both DNA-based logical computation and logic-based biomolecular detection

  9. Phylogeny of the Serrasalmidae (Characiformes based on mitochondrial DNA sequences

    Directory of Open Access Journals (Sweden)

    Guillermo Ortí

    2008-01-01

    Full Text Available Previous studies based on DNA sequences of mitochondrial (mt rRNA genes showed three main groups within the subfamily Serrasalminae: (1 a "pacu" clade of herbivores (Colossoma, Mylossoma, Piaractus; (2 the "Myleus" clade (Myleus, Mylesinus, Tometes, Ossubtus; and (3 the "piranha" clade (Serrasalmus, Pygocentrus, Pygopristis, Pristobrycon, Catoprion, Metynnis. The genus Acnodon was placed as the sister taxon of clade (2+3. However, poor resolution within each clade was obtained due to low levels of variation among rRNA gene sequences. Complete sequences of the hypervariable mtDNA control region for a total of 45 taxa, and additional sequences of 12S and 16S rRNA from a total of 74 taxa representing all genera in the family are now presented to address intragroup relationships. Control region sequences of several serrasalmid species exhibit tandem repeats of short motifs (12 to 33 bp in the 3' end of this region, accounting for substantial length variation. Bayesian inference and maximum parsimony analyses of these sequences identify the same groupings as before and provide further evidence to support the following observations: (a Serrasalmus gouldingi and species of Pristobrycon (non-striolatus form a monophyletic group that is the sister group to other species of Serrasalmus and Pygocentrus; (b Catoprion, Pygopristis, and Pristobrycon striolatus form a well supported clade, sister to the group described above; (c some taxa assigned to the genus Myloplus (M. asterias, M tiete, M ternetzi, and M rubripinnis form a well supported group whereas other Myloplus species remain with uncertain affinities (d Mylesinus, Tometes and Myleus setiger form a monophyletic group.

  10. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  11. Recognition of base J in duplex DNA by J-binding protein

    NARCIS (Netherlands)

    Sabatini, Robert; Meeuwenoord, Nico; van Boom, Jacques H.; Borst, Piet

    2002-01-01

    beta-d-Glucosylhydroxymethyluracil, also called base J, is an unusual modified DNA base conserved among Kinetoplastida. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes. We have previously found a J-binding

  12. Isothermal amplification of environmental DNA (eDNA for direct field-based monitoring and laboratory confirmation of Dreissena sp.

    Directory of Open Access Journals (Sweden)

    Maggie R Williams

    Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a

  13. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. DNA methylation-based classification of central nervous system tumours.

    Science.gov (United States)

    Capper, David; Jones, David T W; Sill, Martin; Hovestadt, Volker; Schrimpf, Daniel; Sturm, Dominik; Koelsche, Christian; Sahm, Felix; Chavez, Lukas; Reuss, David E; Kratz, Annekathrin; Wefers, Annika K; Huang, Kristin; Pajtler, Kristian W; Schweizer, Leonille; Stichel, Damian; Olar, Adriana; Engel, Nils W; Lindenberg, Kerstin; Harter, Patrick N; Braczynski, Anne K; Plate, Karl H; Dohmen, Hildegard; Garvalov, Boyan K; Coras, Roland; Hölsken, Annett; Hewer, Ekkehard; Bewerunge-Hudler, Melanie; Schick, Matthias; Fischer, Roger; Beschorner, Rudi; Schittenhelm, Jens; Staszewski, Ori; Wani, Khalida; Varlet, Pascale; Pages, Melanie; Temming, Petra; Lohmann, Dietmar; Selt, Florian; Witt, Hendrik; Milde, Till; Witt, Olaf; Aronica, Eleonora; Giangaspero, Felice; Rushing, Elisabeth; Scheurlen, Wolfram; Geisenberger, Christoph; Rodriguez, Fausto J; Becker, Albert; Preusser, Matthias; Haberler, Christine; Bjerkvig, Rolf; Cryan, Jane; Farrell, Michael; Deckert, Martina; Hench, Jürgen; Frank, Stephan; Serrano, Jonathan; Kannan, Kasthuri; Tsirigos, Aristotelis; Brück, Wolfgang; Hofer, Silvia; Brehmer, Stefanie; Seiz-Rosenhagen, Marcel; Hänggi, Daniel; Hans, Volkmar; Rozsnoki, Stephanie; Hansford, Jordan R; Kohlhof, Patricia; Kristensen, Bjarne W; Lechner, Matt; Lopes, Beatriz; Mawrin, Christian; Ketter, Ralf; Kulozik, Andreas; Khatib, Ziad; Heppner, Frank; Koch, Arend; Jouvet, Anne; Keohane, Catherine; Mühleisen, Helmut; Mueller, Wolf; Pohl, Ute; Prinz, Marco; Benner, Axel; Zapatka, Marc; Gottardo, Nicholas G; Driever, Pablo Hernáiz; Kramm, Christof M; Müller, Hermann L; Rutkowski, Stefan; von Hoff, Katja; Frühwald, Michael C; Gnekow, Astrid; Fleischhack, Gudrun; Tippelt, Stephan; Calaminus, Gabriele; Monoranu, Camelia-Maria; Perry, Arie; Jones, Chris; Jacques, Thomas S; Radlwimmer, Bernhard; Gessi, Marco; Pietsch, Torsten; Schramm, Johannes; Schackert, Gabriele; Westphal, Manfred; Reifenberger, Guido; Wesseling, Pieter; Weller, Michael; Collins, Vincent Peter; Blümcke, Ingmar; Bendszus, Martin; Debus, Jürgen; Huang, Annie; Jabado, Nada; Northcott, Paul A; Paulus, Werner; Gajjar, Amar; Robinson, Giles W; Taylor, Michael D; Jaunmuktane, Zane; Ryzhova, Marina; Platten, Michael; Unterberg, Andreas; Wick, Wolfgang; Karajannis, Matthias A; Mittelbronn, Michel; Acker, Till; Hartmann, Christian; Aldape, Kenneth; Schüller, Ulrich; Buslei, Rolf; Lichter, Peter; Kool, Marcel; Herold-Mende, Christel; Ellison, David W; Hasselblatt, Martin; Snuderl, Matija; Brandner, Sebastian; Korshunov, Andrey; von Deimling, Andreas; Pfister, Stefan M

    2018-03-22

    Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging-with substantial inter-observer variability in the histopathological diagnosis of many tumour types. Here we present a comprehensive approach for the DNA methylation-based classification of central nervous system tumours across all entities and age groups, and demonstrate its application in a routine diagnostic setting. We show that the availability of this method may have a substantial impact on diagnostic precision compared to standard methods, resulting in a change of diagnosis in up to 12% of prospective cases. For broader accessibility, we have designed a free online classifier tool, the use of which does not require any additional onsite data processing. Our results provide a blueprint for the generation of machine-learning-based tumour classifiers across other cancer entities, with the potential to fundamentally transform tumour pathology.

  15. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de

    2006-01-01

    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....

  16. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  17. Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

  18. Potential for DNA-based identification of Great Lakes fauna: Match and mismatch between taxa inventories and DNA barcode libraries

    Science.gov (United States)

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However, the abi...

  19. Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

    Science.gov (United States)

    Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

    2010-03-01

    Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

  20. Novel DNA sequence detection method based on fluorescence energy transfer

    International Nuclear Information System (INIS)

    Kobayashi, S.; Tamiya, E.; Karube, I.

    1987-01-01

    Recently the detection of specific DNA sequence, DNA analysis, has been becoming more important for diagnosis of viral genomes causing infections disease and human sequences related to inherited disorders. These methods typically involve electrophoresis, the immobilization of DNA on a solid support, hybridization to a complementary probe, the detection using labeled with /sup 32/P or nonisotopically with a biotin-avidin-enzyme system, and so on. These techniques are highly effective, but they are very time-consuming and expensive. A principle of fluorescene energy transfer is that the light energy from an excited donor (fluorophore) is transferred to an acceptor (fluorophore), if the acceptor exists in the vicinity of the donor and the excitation spectrum of donor overlaps the emission spectrum of acceptor. In this study, the fluorescence energy transfer was applied to the detection of specific DNA sequence using the hybridization method. The analyte, single-stranded DNA labeled with the donor fluorophore is hybridized to a probe DNA labeled with the acceptor. Because of the complementary DNA duplex formation, two fluorophores became to be closed to each other, and the fluorescence energy transfer was occurred

  1. Microcantilver-based DNA hybridization sensors for Salmonella identification

    Directory of Open Access Journals (Sweden)

    Carlo Ricciardi

    2012-02-01

    Full Text Available The detection of pathogenic microorganisms in foods remains a challenging since the safety of foodstuffs has to be ensured by the food producing companies. Conventional methods for the detection and identification of bacteria mainly rely on specific microbiological and biochemical identification. Biomolecular methods, are commonly used as a support for traditional techniques, thanks to their high sensitivity, specificity and not excessive costs. However, new methods like biosensors for example, can be an exciting alternative to the more traditional tecniques for the detection of pathogens in food. In this study we report Salmonella enterica serotype Enteritidis DNA detection through a novel class of label-free biosensors: microcantilevers (MCs. In general, MCs can operate as a microbalance and is used to detect the mass of the entities anchored to the cantilever surface using the decrease in the resonant frequency. We use DNA hybridization as model reaction system and for this reason, specific single stranded probe DNA of the pathogen and three different DNA targets (single-stranded complementary DNA, PCR product and serial dilutions of DNA extracted from S. Enteritidis strains were applied. Two protocols were reported in order to allow the probe immobilization on cantilever surface: i MC surface was functionalized with 3-aminopropyltriethoxysilane and glutaraldehyde and an amino-modified DNA probe was used; ii gold-coated sensors and thiolated DNA probes were used in order to generate a covalent bonding (Th-Au. For the first one, measures after hybridization with the PCR product showed related frequency shift 10 times higher than hybridization with complementary probe and detectable signals were obtained at the concentrations of 103 and 106 cfu/mL after hybridization with bacterial DNA. There are currently optimizations of the second protocol, where preliminary results have shown to be more uniform and therefore more precise within each of the

  2. DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.

    Science.gov (United States)

    Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao

    2016-01-13

    Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.

  3. EVOLUTIONARY RELATIONSHIPS BETWEEN 4 SPECIES OF CLADOPHORA (CLADOPHORALES, CHLOROPHYTA) BASED ON DNA-DNA HYBRIDIZATION

    NARCIS (Netherlands)

    BOT, PVM; BRUSSAARD, CPD; STAM, WT; VANDENHOEK, C

    1991-01-01

    Analysis of the reassociation kinetics of the DNA from Cladophora pellucida (Huds.) Kutz. indicates that the genome of this benthic alga is comprised of approximately 75% repetitive sequences. Single-copy sequences reassociated with a rate constant of 1.8 x 10(-3) M-1.s-1, which corresponds to a

  4. Electron accommodation dynamics in the DNA base thymine

    Science.gov (United States)

    King, Sarah B.; Stephansen, Anne B.; Yokoi, Yuki; Yandell, Margaret A.; Kunin, Alice; Takayanagi, Toshiyuki; Neumark, Daniel M.

    2015-07-01

    The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I-T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from -120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I-T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I-T VDE, which suggests that if the dipole-bound anion acts as a "doorway" to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.

  5. Electron accommodation dynamics in the DNA base thymine

    Energy Technology Data Exchange (ETDEWEB)

    King, Sarah B.; Yandell, Margaret A.; Kunin, Alice [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Stephansen, Anne B. [Department of Chemistry, University of Copenhagen, Universitetsparken 5, DK-2100 København Ø (Denmark); Yokoi, Yuki; Takayanagi, Toshiyuki [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Neumark, Daniel M., E-mail: dneumark@berkeley.edu [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2015-07-14

    The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I{sup −}T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from −120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I{sup −}T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I{sup −}T VDE, which suggests that if the dipole-bound anion acts as a “doorway” to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.

  6. DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging

    Directory of Open Access Journals (Sweden)

    Ricardo Gredilla

    2011-01-01

    Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.

  7. Oxidatively-induced DNA damage and base excision repair in euthymic patients with bipolar disorder.

    Science.gov (United States)

    Ceylan, Deniz; Tuna, Gamze; Kirkali, Güldal; Tunca, Zeliha; Can, Güneş; Arat, Hidayet Ece; Kant, Melis; Dizdaroglu, Miral; Özerdem, Ayşegül

    2018-05-01

    Oxidatively-induced DNA damage has previously been associated with bipolar disorder. More recently, impairments in DNA repair mechanisms have also been reported. We aimed to investigate oxidatively-induced DNA lesions and expression of DNA glycosylases involved in base excision repair in euthymic patients with bipolar disorder compared to healthy individuals. DNA base lesions including both base and nucleoside modifications were measured using gas chromatography-tandem mass spectrometry and liquid chromatography-tandem mass spectrometry with isotope-dilution in DNA samples isolated from leukocytes of euthymic patients with bipolar disorder (n = 32) and healthy individuals (n = 51). The expression of DNA repair enzymes OGG1 and NEIL1 were measured using quantitative real-time polymerase chain reaction. The levels of malondialdehyde were measured using high performance liquid chromatography. Seven DNA base lesions in DNA of leukocytes of patients and healthy individuals were identified and quantified. Three of them had significantly elevated levels in bipolar patients when compared to healthy individuals. No elevation of lipid peroxidation marker malondialdehyde was observed. The level of OGG1 expression was significantly reduced in bipolar patients compared to healthy individuals, whereas the two groups exhibited similar levels of NEIL1 expression. Our results suggest that oxidatively-induced DNA damage occurs and base excision repair capacity may be decreased in bipolar patients when compared to healthy individuals. Measurement of oxidatively-induced DNA base lesions and the expression of DNA repair enzymes may be of great importance for large scale basic research and clinical studies of bipolar disorder. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  9. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    DEFF Research Database (Denmark)

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong

    2011-01-01

    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...

  10. Electrochemical DNA biosensor based on grafting-to mode of terminal deoxynucleoside transferase-mediated extension.

    Science.gov (United States)

    Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua

    2017-12-15

    Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-09-01

    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. comparison between dna-based, pomological and chemical ...

    African Journals Online (AJOL)

    2015-09-01

    Sep 1, 2015 ... of extra virgin olive oil and consequently for better marketing. Habitually, the ... Several molecular marker techniques such as random amplified .... negatively correlated to the rate of unsaponifiable matter. .... DNA Extraction.

  13. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  14. DNA hydrogel-based supercapacitors operating in physiological fluids

    OpenAIRE

    Hur, Jaehyun; Im, Kyuhyun; Hwang, Sekyu; Choi, ByoungLyong; Kim, Sungjee; Hwang, Sungwoo; Park, Nokyoung; Kim, Kinam

    2013-01-01

    DNA nanostructures have been attractive due to their structural properties resulting in many important breakthroughs especially in controlled assemblies and many biological applications. Here, we report a unique energy storage device which is a supercapacitor that uses nanostructured DNA hydrogel (Dgel) as a template and layer-by-layer (LBL)-deposited polyelectrolyte multilayers (PEMs) as conductors. Our device, named as PEM-Dgel supercapacitor, showed excellent performance in direct contact ...

  15. Slow elimination of DNA damaged bases in the liver of old gamma-irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Gaziev, A I; Malakhova, L V; Fomenko, L A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki

    1981-01-01

    Elimination of the DNA damaged bases in the liver of old and young mice after their gamma-irradiation is studied. It is established that the incision rate of DNA gamma-damaged bases in the liver of old mice is lower than in the liver of the young ones. It is supposed to be connected with the decrease of the activity of DNA reparation ferments or with the presence of limitations in chromatin for the access of these ferments to the damaged parts of DNA in the cells of old animals.

  16. DNA origami-based standards for quantitative fluorescence microscopy.

    Science.gov (United States)

    Schmied, Jürgen J; Raab, Mario; Forthmann, Carsten; Pibiri, Enrico; Wünsch, Bettina; Dammeyer, Thorben; Tinnefeld, Philip

    2014-01-01

    Validating and testing a fluorescence microscope or a microscopy method requires defined samples that can be used as standards. DNA origami is a new tool that provides a framework to place defined numbers of small molecules such as fluorescent dyes or proteins in a programmed geometry with nanometer precision. The flexibility and versatility in the design of DNA origami microscopy standards makes them ideally suited for the broad variety of emerging super-resolution microscopy methods. As DNA origami structures are durable and portable, they can become a universally available specimen to check the everyday functionality of a microscope. The standards are immobilized on a glass slide, and they can be imaged without further preparation and can be stored for up to 6 months. We describe a detailed protocol for the design, production and use of DNA origami microscopy standards, and we introduce a DNA origami rectangle, bundles and a nanopillar as fluorescent nanoscopic rulers. The protocol provides procedures for the design and realization of fluorescent marks on DNA origami structures, their production and purification, quality control, handling, immobilization, measurement and data analysis. The procedure can be completed in 1-2 d.

  17. A DNA-based nanomechanical device with three robust states.

    Science.gov (United States)

    Chakraborty, Banani; Sha, Ruojie; Seeman, Nadrian C

    2008-11-11

    DNA has been used to build a variety of devices, ranging from those that are controlled by DNA structural transitions to those that are controlled by the addition of specific DNA strands. These sequence-dependent devices fulfill the promise of DNA in nanotechnology because a variety of devices in the same physical environment can be controlled individually. Many such devices have been reported, but most of them contain one or two structurally robust end states, in addition to a floppy intermediate or even a floppy end state. We describe a system in which three different structurally robust end states can be obtained, all resulting from the addition of different set strands to a single floppy intermediate. This system is an extension of the PX-JX(2) DNA device. The three states are related to each other by three different motions, a twofold rotation, a translation of approximately 2.1-2.5 nm, and a twofold screw rotation, which combines these two motions. We demonstrate the transitions by gel electrophoresis, by fluorescence resonance energy transfer, and by atomic force microscopy. The control of this system by DNA strands opens the door to trinary logic and to systems containing N devices that are able to attain 3(N) structural states.

  18. DENA: A Configurable Microarchitecture and Design Flow for Biomedical DNA-Based Logic Design.

    Science.gov (United States)

    Beiki, Zohre; Jahanian, Ali

    2017-10-01

    DNA is known as the building block for storing the life codes and transferring the genetic features through the generations. However, it is found that DNA strands can be used for a new type of computation that opens fascinating horizons in computational medicine. Significant contributions are addressed on design of DNA-based logic gates for medical and computational applications but there are serious challenges for designing the medium and large-scale DNA circuits. In this paper, a new microarchitecture and corresponding design flow is proposed to facilitate the design of multistage large-scale DNA logic systems. Feasibility and efficiency of the proposed microarchitecture are evaluated by implementing a full adder and, then, its cascadability is determined by implementing a multistage 8-bit adder. Simulation results show the highlight features of the proposed design style and microarchitecture in terms of the scalability, implementation cost, and signal integrity of the DNA-based logic system compared to the traditional approaches.

  19. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    Science.gov (United States)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  20. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    Science.gov (United States)

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model

    Science.gov (United States)

    Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978

  2. Investigation of the charge effect on the electrochemical transduction in a quinone-based DNA sensor

    DEFF Research Database (Denmark)

    Reisberg, S.; Piro, B.; Noel, V.

    2008-01-01

    To elucidate the mechanism involved in the electrochemical transduction process of a conducting polymer-based DNA sensor, peptide nucleic acids (PNA) were used. PNA are DNA analogues having similar hybridization properties but are neutral. This allows to discriminate the electrostatic effect of D...... strands from the steric hindrance generated on the bioelectrode upon hybridization. It can be concluded that DNA conformational changes are determinant in the transduction process and that the electrostatic effect is negligible....

  3. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  4. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-01

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  5. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

    1991-01-01

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  6. Electrochemical DNA biosensors based on platinum nanoparticles combined carbon nanotubes

    International Nuclear Information System (INIS)

    Zhu Ningning; Chang Zhu; He Pingang; Fang Yuzhi

    2005-01-01

    Platinum nanoparticles were used in combination with multi-walled carbon nanotubes (MWCNTs) for fabricating sensitivity-enhanced electrochemical DNA biosensor. Multi-walled carbon nanotubes and platinum nanoparticles were dispersed in Nafion, which were used to fabricate the modification of the glassy carbon electrode (GCE) surface. Oligonucleotides with amino groups at the 5' end were covalently linked onto carboxylic groups of MWCNTs on the electrode. The hybridization events were monitored by differential pulse voltammetry (DPV) measurement of the intercalated daunomycin. Due to the ability of carbon nanotubes to promote electron-transfer reactions, the high catalytic activities of platinum nanoparticles for chemical reactions, the sensitivity of presented electrochemical DNA biosensors was remarkably improved. The detection limit of the method for target DNA was 1.0 x 10 -11 mol l -1

  7. DNA origami-based nanoribbons: assembly, length distribution, and twist

    Energy Technology Data Exchange (ETDEWEB)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C [Lehrstuhl fuer Bioelektronik, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany); Castro, Carlos E, E-mail: simmel@ph.tum.de [Labor fuer Biomolekulare Nanotechnologie, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany)

    2011-07-08

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  8. DNA origami-based nanoribbons: assembly, length distribution, and twist

    International Nuclear Information System (INIS)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C; Castro, Carlos E

    2011-01-01

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  9. Spreadsheet-based program for alignment of overlapping DNA sequences.

    Science.gov (United States)

    Anbazhagan, R; Gabrielson, E

    1999-06-01

    Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

  10. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  11. Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.

    Science.gov (United States)

    Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P

    2017-09-01

    Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

  12. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  13. Feasibility of using DNA-immobilized nanocellulose-based immunoadsorbent for systemic lupus erythematosus plasmapheresis.

    Science.gov (United States)

    Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert

    2016-07-01

    The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  15. MitBASE : a comprehensive and integrated mitochondrial DNA database. The present status

    NARCIS (Netherlands)

    Attimonelli, M.; Altamura, N.; Benne, R.; Brennicke, A.; Cooper, J. M.; D'Elia, D.; Montalvo, A.; Pinto, B.; de Robertis, M.; Golik, P.; Knoop, V.; Lanave, C.; Lazowska, J.; Licciulli, F.; Malladi, B. S.; Memeo, F.; Monnerot, M.; Pasimeni, R.; Pilbout, S.; Schapira, A. H.; Sloof, P.; Saccone, C.

    2000-01-01

    MitBASE is an integrated and comprehensive database of mitochondrial DNA data which collects, under a single interface, databases for Plant, Vertebrate, Invertebrate, Human, Protist and Fungal mtDNA and a Pilot database on nuclear genes involved in mitochondrial biogenesis in Saccharomyces

  16. Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

    Science.gov (United States)

    Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

    2013-12-15

    We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.

    Science.gov (United States)

    Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil

    2017-10-01

    Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.

  18. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  19. Random amplified polymorphic DNA (RAPD) based assessment of ...

    African Journals Online (AJOL)

    SAM

    2014-05-07

    May 7, 2014 ... Knowledge of genetic distances between genotypes is important for efficient organization and conservation of ... after maize, wheat, and pearl millet (FAO, 2006). Sor- ... properties, which tend to reduce the nutritional quality of sorghum .... extraction. The DNA extraction buffer was modified from Jhingan.

  20. DNA fingerprinting based on simple sequence repeat (SSR ...

    African Journals Online (AJOL)

    New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

  1. SSR marker based DNA fingerprinting and diversity study in rice ...

    African Journals Online (AJOL)

    The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

  2. Alkyltransferase-like proteins: brokers dealing with alkylated DNA bases.

    Science.gov (United States)

    Schärer, Orlando D

    2012-07-13

    A new pathway for the repair of DNA alkylation damage is described in this issue of Molecular Cell (Latypov et al., 2012). Alkyltransferase-like enzymes mark O(6)-alkylguanine lesions and, depending on adduct size, channel them into global genome or transcription-coupled nucleotide excision repair pathways. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  4. One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.

    Science.gov (United States)

    Ensslen, Philipp; Wagenknecht, Hans-Achim

    2015-10-20

    Light-harvesting complexes collect light energy and deliver it by a cascade of energy and electron transfer processes to the reaction center where charge separation leads to storage as chemical energy. The design of artificial light-harvesting assemblies faces enormous challenges because several antenna chromophores need to be kept in close proximity but self-quenching needs to be avoided. Double stranded DNA as a supramolecular scaffold plays a promising role due to its characteristic structural properties. Automated DNA synthesis allows incorporation of artificial chromophore-modified building blocks, and sequence design allows precise control of the distances and orientations between the chromophores. The helical twist between the chromophores, which is induced by the DNA framework, controls energy and electron transfer and thereby reduces the self-quenching that is typically observed in chromophore aggregates. This Account summarizes covalently multichromophore-modified DNA and describes how such multichromophore arrays were achieved by Watson-Crick-specific and DNA-templated self-assembly. The covalent DNA systems were prepared by incorporation of chromophores as DNA base substitutions (either as C-nucleosides or with acyclic linkers as substitutes for the 2'-deoxyribofuranoside) and as DNA base modifications. Studies with DNA base substitutions revealed that distances but more importantly relative orientations of the chromophores govern the energy transfer efficiencies and thereby the light-harvesting properties. With DNA base substitutions, duplex stabilization was faced and could be overcome, for instance, by zipper-like placement of the chromophores in both strands. For both principal structural approaches, DNA-based light-harvesting antenna could be realized. The major disadvantages, however, for covalent multichromophore DNA conjugates are the poor yields of synthesis and the solubility issues for oligonucleotides with more than 5-10 chromophore

  5. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Nanostructured ZnO-based biosensor: DNA immobilization and hybridization

    Directory of Open Access Journals (Sweden)

    Ahmed Mishaal Mohammed

    2017-09-01

    Full Text Available An electrochemical DNA biosensor was successfully fabricated by using (3-aminopropyl triethoxysilane (APTES with zinc oxide (ZnO nanorods synthesized using microwave-assisted chemical bath deposition method on thermally oxidized SiO2 thin films. The structural quality and morphology of the ZnO nanorods were determined by employing scanning electron microscopy (SEM and X-ray diffraction (XRD, which show a hexagonal wurtzite structure with a preferred orientation along the (101 direction. The surface of the SiO2 thin films was chemically modified with ZnO. Label-free detection DNA immobilization and hybridization were performed using potassium hexacyanoferrate with cyclic voltammetry (CV measurements. The capacitance, permittivity, and conductivity profiles of the fabricated sensor clearly indicate DNA immobilization and hybridization. Results show that the capacitance values of bare, ZnO- modified surface immobilization, and target DNA hybridization were 46×10−12F, 47×10−8F, 27μF, and 17μF, respectively, at 1Hz. The permittivity measurement increased from 3.94×103 to 251×103 and 165×103 at the frequency range of approximately 200 to 1Hz for bare and DNA immobilization and hybridization, respectively. The measured conductivity values for the bare, ZnO, immobilized, and hybridization device were 2.4×10−9, 10×10−8, 1.6×10−7, and 1.3×10−7Scm−1, respectively. Keywords: Zinc oxide, Biosensor, Capacitance, Permittivity, Conductivity

  7. UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.

    Science.gov (United States)

    Baldock, Brandi L; Hutchison, James E

    2016-12-20

    DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.

  8. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    Science.gov (United States)

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  9. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    Science.gov (United States)

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  10. Optimization of DNA Sensor Model Based Nanostructured Graphene Using Particle Swarm Optimization Technique

    Directory of Open Access Journals (Sweden)

    Hediyeh Karimi

    2013-01-01

    Full Text Available It has been predicted that the nanomaterials of graphene will be among the candidate materials for postsilicon electronics due to their astonishing properties such as high carrier mobility, thermal conductivity, and biocompatibility. Graphene is a semimetal zero gap nanomaterial with demonstrated ability to be employed as an excellent candidate for DNA sensing. Graphene-based DNA sensors have been used to detect the DNA adsorption to examine a DNA concentration in an analyte solution. In particular, there is an essential need for developing the cost-effective DNA sensors holding the fact that it is suitable for the diagnosis of genetic or pathogenic diseases. In this paper, particle swarm optimization technique is employed to optimize the analytical model of a graphene-based DNA sensor which is used for electrical detection of DNA molecules. The results are reported for 5 different concentrations, covering a range from 0.01 nM to 500 nM. The comparison of the optimized model with the experimental data shows an accuracy of more than 95% which verifies that the optimized model is reliable for being used in any application of the graphene-based DNA sensor.

  11. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  12. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    Science.gov (United States)

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

    2012-01-01

    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  13. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. A new model for ancient DNA decay based on paleogenomic meta-analysis.

    Science.gov (United States)

    Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G

    2017-06-20

    The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

    Science.gov (United States)

    Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

    2013-01-01

    To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

  16. DNA hydrogel-based supercapacitors operating in physiological fluids

    Science.gov (United States)

    Hur, Jaehyun; Im, Kyuhyun; Hwang, Sekyu; Choi, ByoungLyong; Kim, Sungjee; Hwang, Sungwoo; Park, Nokyoung; Kim, Kinam

    2013-01-01

    DNA nanostructures have been attractive due to their structural properties resulting in many important breakthroughs especially in controlled assemblies and many biological applications. Here, we report a unique energy storage device which is a supercapacitor that uses nanostructured DNA hydrogel (Dgel) as a template and layer-by-layer (LBL)-deposited polyelectrolyte multilayers (PEMs) as conductors. Our device, named as PEM-Dgel supercapacitor, showed excellent performance in direct contact with physiological fluids such as artificial urine and phosphate buffered saline without any need of additional electrolytes, and exhibited almost no cytotoxicity during cycling tests in cell culture medium. Moreover, we demonstrated that the PEM-Dgel supercapacitor has greater charge-discharge cycling stability in physiological fluids than highly concentrated acid electrolyte solution which is normally used for supercapacitor operation. These conceptually new supercapacitors have the potential to be a platform technology for the creation of implantable energy storage devices for packageless applications directly utilizing biofluids. PMID:23412432

  17. Chemical Morphing of DNA Containing Four Noncanonical Bases.

    Science.gov (United States)

    Eremeeva, Elena; Abramov, Michail; Margamuljana, Lia; Rozenski, Jef; Pezo, Valerie; Marlière, Philippe; Herdewijn, Piet

    2016-06-20

    The ability of alternative nucleic acids, in which all four nucleobases are substituted, to replicate in vitro and to serve as genetic templates in vivo was evaluated. A nucleotide triphosphate set of 5-chloro-2'-deoxyuridine, 7-deaza-2'-deoxyadenosine, 5-fluoro-2'-deoxycytidine, and 7-deaza-2'deoxyguanosine successfully underwent polymerase chain reaction (PCR) amplification using templates of different lengths (57 or 525mer) and Taq or Vent (exo-) DNA polymerases as catalysts. Furthermore, a fully morphed gene encoding a dihydrofolate reductase was generated by PCR using these fully substituted nucleotides and was shown to transform and confer trimethoprim resistance to E. coli. These results demonstrated that fully modified templates were accurately read by the bacterial replication machinery and provide the first example of a long fully modified DNA molecule being functional in vivo. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    Science.gov (United States)

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat

    2018-03-01

    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  19. Opto-electronic DNA chip-based integrated card for clinical diagnostics.

    Science.gov (United States)

    Marchand, Gilles; Broyer, Patrick; Lanet, Véronique; Delattre, Cyril; Foucault, Frédéric; Menou, Lionel; Calvas, Bernard; Roller, Denis; Ginot, Frédéric; Campagnolo, Raymond; Mallard, Frédéric

    2008-02-01

    Clinical diagnostics is one of the most promising applications for microfluidic lab-on-a-chip or lab-on-card systems. DNA chips, which provide multiparametric data, are privileged tools for genomic analysis. However, automation of molecular biology protocol and use of these DNA chips in fully integrated systems remains a great challenge. Simplicity of chip and/or card/instrument interfaces is amongst the most critical issues to be addressed. Indeed, current detection systems for DNA chip reading are often complex, expensive, bulky and even limited in terms of sensitivity or accuracy. Furthermore, for liquid handling in the lab-on-cards, many devices use complex and bulky systems, either to directly manipulate fluids, or to ensure pneumatic or mechanical control of integrated valves. All these drawbacks prevent or limit the use of DNA-chip-based integrated systems, for point-of-care testing or as a routine diagnostics tool. We present here a DNA-chip-based protocol integration on a plastic card for clinical diagnostics applications including: (1) an opto-electronic DNA-chip, (2) fluid handling using electrically activated embedded pyrotechnic microvalves with closing/opening functions. We demonstrate both fluidic and electric packaging of the optoelectronic DNA chip without major alteration of its electronical and biological functionalities, and fluid control using novel electrically activable pyrotechnic microvalves. Finally, we suggest a complete design of a card dedicated to automation of a complex biological protocol with a fully electrical fluid handling and DNA chip reading.

  20. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Science.gov (United States)

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  1. High-Throughput Array Instrument for DNA-Based Breast Cancer Diagnostics

    National Research Council Canada - National Science Library

    Swerdlow, Harold

    2000-01-01

    ...) for breast-cancer diagnostics. These methods are based upon large numbers of discrete DNA spots placed on glass microscope slides typically, and hybridized to a probe derived from a tIssue or blood sample...

  2. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage

    Science.gov (United States)

    Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.

    1999-01-01

    DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315

  3. The essential component in DNA-based information storage system: robust error-tolerating module

    Directory of Open Access Journals (Sweden)

    Aldrin Kay-Yuen eYim

    2014-11-01

    Full Text Available The size of digital data is ever increasing and is expected to grow to 40,000EB by 2020, yet the estimated global information storage capacity in 2011 is less than 300EB, indicating that most of the data are transient. DNA, as a very stable nano-molecule, is an ideal massive storage device for long-term data archive. The two most notable illustrations are from Church et al. and Goldman et al., whose approaches are well-optimized for most sequencing platforms – short synthesized DNA fragments without homopolymer. Here we suggested improvements on error handling methodology that could enable the integration of DNA-based computational process, e.g. algorithms based on self-assembly of DNA. As a proof of concept, a picture of size 438 bytes was encoded to DNA with Low-Density Parity-Check error-correction code. We salvaged a significant portion of sequencing reads with mutations generated during DNA synthesis and sequencing and successfully reconstructed the entire picture. A modular-based programming framework - DNAcodec with a XML-based data format was also introduced. Our experiments demonstrated the practicability of long DNA message recovery with high error-tolerance, which opens the field to biocomputing and synthetic biology.

  4. Radiation chemistry of the base components of DNA and related substances

    International Nuclear Information System (INIS)

    Teoule, R.

    1979-01-01

    The loss of UV absorption may be considered as a useful index to evaluate the extent of base destruction. The variations observed reflect the sum of different phenomena: the modification of base stacking, hydrogen bond rupture between DNA bases and the saturation of conjugated double bonds of heterocycles. Another way to measure the base degradation is by formic acid hydrolysis. Radiation products are very sensitive to the formic acid hydrolysis performed at 180 deg C. In aerated solutions, an important event responsible for the degradation of pyrimidine bases is the formation of hydroperoxide. This review consists of the following subheadings: identification of the DNA base damages; thymine fragment in aerated solutions and in deaerated solutions; adenine fragment; and cytosine fragment. The review concludes with the remarks: one has to be very cautious in the extrapolation of the results obtained by the gamma irradiation of free bases in solution to DNA. Free bases are liberated but no nucleoside during irradiation. (Yamashita, S.)

  5. Droplet-based microscale colorimetric biosensor for multiplexed DNA analysis via a graphene nanoprobe

    International Nuclear Information System (INIS)

    Xiang Xia; Luo Ming; Shi Liyang; Ji Xinghu; He Zhike

    2012-01-01

    Graphical abstract: With a microvalve manipulate technique combined with droplet platform, a microscale fluorescence-based colorimetric sensor for multiplexed DNA analysis is developed via a graphene nanoprobe. Highlights: ► A quantitative detection for multiplexed DNA is first realized on droplet platform. ► The DNA detection is relied on a simple fluorescence-based colorimetric method. ► GO is served as a quencher for two different DNA fluorescent probes. ► This present work provides a rapid, sensitive, visual and convenient detection tool for droplet biosensor. - Abstract: The development of simple and inexpensive DNA detection strategy is very significant for droplet-based microfluidic system. Here, a droplet-based biosensor for multiplexed DNA analysis is developed with a common imaging device by using fluorescence-based colorimetric method and a graphene nanoprobe. With the aid of droplet manipulation technique, droplet size adjustment, droplet fusion and droplet trap are realized accurately and precisely. Due to the high quenching efficiency of graphene oxide (GO), in the absence of target DNAs, the droplet containing two single-stranded DNA probes and GO shows dark color, in which the DNA probes are labeled carboxy fluorescein (FAM) and 6-carboxy-X-rhodamine (ROX), respectively. The droplet changes from dark to bright color when the DNA probes form double helix with the specific target DNAs leading to the dyes far away from GO. This colorimetric droplet biosensor exhibits a quantitative capability for simultaneous detection of two different target DNAs with the detection limits of 9.46 and 9.67 × 10 −8 M, respectively. It is also demonstrated that this biosensor platform can become a promising detection tool in high throughput applications with low consumption of reagents. Moreover, the incorporation of graphene nanoprobe and droplet technique can drive the biosensor field one more step to some extent.

  6. A flexible fluorescence correlation spectroscopy based method for quantification of the DNA double labeling efficiency with precision control

    International Nuclear Information System (INIS)

    Hou, Sen; Tabaka, Marcin; Sun, Lili; Trochimczyk, Piotr; Kaminski, Tomasz S; Kalwarczyk, Tomasz; Zhang, Xuzhu; Holyst, Robert

    2014-01-01

    We developed a laser-based method to quantify the double labeling efficiency of double-stranded DNA (dsDNA) in a fluorescent dsDNA pool with fluorescence correlation spectroscopy (FCS). Though, for quantitative biochemistry, accurate measurement of this parameter is of critical importance, before our work it was almost impossible to quantify what percentage of DNA is doubly labeled with the same dye. The dsDNA is produced by annealing complementary single-stranded DNA (ssDNA) labeled with the same dye at 5′ end. Due to imperfect ssDNA labeling, the resulting dsDNA is a mixture of doubly labeled dsDNA, singly labeled dsDNA and unlabeled dsDNA. Our method allows the percentage of doubly labeled dsDNA in the total fluorescent dsDNA pool to be measured. In this method, we excite the imperfectly labeled dsDNA sample in a focal volume of <1 fL with a laser beam and correlate the fluctuations of the fluorescence signal to get the FCS autocorrelation curves; we express the amplitudes of the autocorrelation function as a function of the DNA labeling efficiency; we perform a comparative analysis of a dsDNA sample and a reference dsDNA sample, which is prepared by increasing the total dsDNA concentration c (c > 1) times by adding unlabeled ssDNA during the annealing process. The method is flexible in that it allows for the selection of the reference sample and the c value can be adjusted as needed for a specific study. We express the precision of the method as a function of the ssDNA labeling efficiency or the dsDNA double labeling efficiency. The measurement precision can be controlled by changing the c value. (letter)

  7. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  8. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    Science.gov (United States)

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  9. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  10. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  11. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  13. Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.

    Science.gov (United States)

    Xiao, Lu; Xiang, Yu

    2016-06-01

    The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    Science.gov (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Characterization of polymer, DNA-based, and silk thin film resistivities and of DNA-based films prepared for enhanced electrical conductivity

    Science.gov (United States)

    Yaney, Perry P.; Ouchen, Fahima; Grote, James G.

    2009-08-01

    DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.

  16. Anhydrous crystals of DNA bases are wide gap semiconductors.

    Science.gov (United States)

    Maia, F F; Freire, V N; Caetano, E W S; Azevedo, D L; Sales, F A M; Albuquerque, E L

    2011-05-07

    We present the structural, electronic, and optical properties of anhydrous crystals of DNA nucleobases (guanine, adenine, cytosine, and thymine) found after DFT (Density Functional Theory) calculations within the local density approximation, as well as experimental measurements of optical absorption for powders of these crystals. Guanine and cytosine (adenine and thymine) anhydrous crystals are predicted from the DFT simulations to be direct (indirect) band gap semiconductors, with values 2.68 eV and 3.30 eV (2.83 eV and 3.22 eV), respectively, while the experimentally estimated band gaps we have measured are 3.83 eV and 3.84 eV (3.89 eV and 4.07 eV), in the same order. The electronic effective masses we have obtained at band extremes show that, at low temperatures, these crystals behave like wide gap semiconductors for electrons moving along the nucleobases stacking direction, while the hole transport are somewhat limited. Lastly, the calculated electronic dielectric functions of DNA nucleobases crystals in the parallel and perpendicular directions to the stacking planes exhibit a high degree of anisotropy (except cytosine), in agreement with published experimental results.

  17. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification.

    Science.gov (United States)

    Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng

    2014-06-15

    Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

    Science.gov (United States)

    Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

    2018-06-01

    Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

  19. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  20. A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis

    Science.gov (United States)

    Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan

    2009-01-01

    DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301

  1. DNA-based stable isotope probing: a link between community structure and function

    International Nuclear Information System (INIS)

    Uhlik, Ondrej; Jecna, Katerina; Leigh, Mary Beth; Mackova, Martina; Macek, Tomas

    2009-01-01

    DNA-based molecular techniques permit the comprehensive determination of microbial diversity but generally do not reveal the relationship between the identity and the function of microorganisms. The first direct molecular technique to enable the linkage of phylogeny with function is DNA-based stable isotope probing (DNA-SIP). Applying this method first helped describe the utilization of simple compounds, such as methane, methanol or glucose and has since been used to detect microbial communities active in the utilization of a wide variety of compounds, including various xenobiotics. The principle of the method lies in providing 13C-labeled substrate to a microbial community and subsequent analyses of the 13C-DNA isolated from the community. Isopycnic centrifugation permits separating 13C-labeled DNA of organisms that utilized the substrate from 12C-DNA of the inactive majority. As the whole metagenome of active populations is isolated, its follow-up analysis provides successful taxonomic identification as well as the potential for functional gene analyses. Because of its power, DNA-SIP has become one of the leading techniques of microbial ecology research. But from other point of view, it is a labor-intensive method that requires careful attention to detail during each experimental step in order to avoid misinterpretation of results.

  2. Designing thermal diode and heat pump based on DNA nanowire: Multifractal approach

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@iaurmia.ac.ir; Panahinia, R.

    2017-07-12

    The management of heat flow in DNA nano wire was considered. Thermal diode effect in DNA and the domain of its appearance dependent to system parameters have been detected. The appearance of directed thermal flow in thermodynamic sizes proposes the possibility of designing the macroscopic thermal rectifier. By applying driven force, pumping effect has been also observed. The resonance frequency of DNA and threshold amplitudes of driving force for attaining permanent pumping effect have been detected. Forasmuch as detecting negative differential thermal resistance (NDTR) phenomenon, DNA can act as a thermal transistor. By using an analytical parallel investigation based on Rényi spectrum analysis, threshold values to transition to NDTR and pumping regimes have been detected. - Highlights: • The control and management of heat current in DNA have been investigated. • Directed thermal flow and NDTR in DNA have been identified. • By increasing the system size, the reversed thermal rectification appeared. So, it is proposed the possibility of designing the macroscopic thermal rectifier. • Pumping effect accompanied with detection of resonance frequency of DNA has been observed. • To verify the results, we did a parallel analysis based on multifractal concept to detect threshold values for transition to pumping state and NDTR regime.

  3. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting

    Science.gov (United States)

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai

    2009-01-01

    SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241

  4. Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

    KAUST Repository

    Fornander, Louise H

    2013-12-03

    The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

  5. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  6. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Eiko E Kuramae

    Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.

  7. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  8. The radiation chemistry of the purine bases within DNA and related model compounds

    International Nuclear Information System (INIS)

    Cadet, J.; Berger, M.; Shaw, A.

    1986-01-01

    Both the direct and indirect effects of ionizing radiations are believed to contribute to the chemical changes induced in cellular DNA. Relevant information on the possible degradation pathways has been provided by studies using DNA model compounds, the major proportion of which have focused on pyrimidine components and sugar derivatives. With the development of powerful analytical tools such as high performance liquid chromatography and soft ionization mass spectrometry techniques, progress has recently been made in the elucidation of the nature of the radiation-induced chemical modifications of purine bases in DNA and related nucleosides and nucleotides. This short review details recent aspects of the radiation-induced degradation of adenine and guanine bases in DNA and its model compounds as the result of both direct and indirect effects. 11 refs., 2 figs., 1 tab

  9. Physically transient photonics: random versus distributed feedback lasing based on nanoimprinted DNA.

    Science.gov (United States)

    Camposeo, Andrea; Del Carro, Pompilio; Persano, Luana; Cyprych, Konrad; Szukalski, Adam; Sznitko, Lech; Mysliwiec, Jaroslaw; Pisignano, Dario

    2014-10-28

    Room-temperature nanoimprinted, DNA-based distributed feedback (DFB) laser operation at 605 nm is reported. The laser is made of a pure DNA host matrix doped with gain dyes. At high excitation densities, the emission of the untextured dye-doped DNA films is characterized by a broad emission peak with an overall line width of 12 nm and superimposed narrow peaks, characteristic of random lasing. Moreover, direct patterning of the DNA films is demonstrated with a resolution down to 100 nm, enabling the realization of both surface-emitting and edge-emitting DFB lasers with a typical line width of <0.3 nm. The resulting emission is polarized, with a ratio between the TE- and TM-polarized intensities exceeding 30. In addition, the nanopatterned devices dissolve in water within less than 2 min. These results demonstrate the possibility of realizing various physically transient nanophotonics and laser architectures, including random lasing and nanoimprinted devices, based on natural biopolymers.

  10. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  11. Design and Test of an Oscillation-based System Architecture for DNA Sensor Arrays

    NARCIS (Netherlands)

    Liu, Hongyuan; Kerkhoff, Hans G.; Richardson, Andrew; Zhang, X.; Nouet, Pascal; Azais, Florence

    2005-01-01

    A DfT strategy for MEMS-based DNA sensors is investigated in this paper. Based on a fault-free and defect model developed for a single sensing element and the VHDL-AMS simulation results, it is implied that an oscillation-based interface might be a potential solution for both testing and read out of

  12. Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

    International Nuclear Information System (INIS)

    Shamim, S.; Murtaza, S.; Nazar, M.F.

    2016-01-01

    A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

  13. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  14. Synthesis and DNA interaction of a Sm(III) complex of a Schiff base ...

    African Journals Online (AJOL)

    The interaction between the Sm(III) complex of an ionic Schiff base [HL]-, derived from vanillin and L-tryptophan, and herring sperm DNA at physiological pH (7.40) has been studied by UV-Vis absorption, fluorescence and viscosity methods. The binding ratios nSm(III) : nK[HL] = 1:1 and nSm(III)L: nDNA =5:1 were confirmed ...

  15. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  16. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    OpenAIRE

    Ann-Charlotte Wallenhammar; Albin Gunnarson; Fredrik Hansson; Anders Jonsson

    2016-01-01

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to plantin...

  17. Feasibility study of molecular memory device based on DNA using methylation to store information

    International Nuclear Information System (INIS)

    Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

    2016-01-01

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  18. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    International Nuclear Information System (INIS)

    Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.

    2015-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor

  19. Feasibility study of molecular memory device based on DNA using methylation to store information

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

    2016-07-14

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  20. Highly Sensitive DNA Sensor Based on Upconversion Nanoparticles and Graphene Oxide.

    Science.gov (United States)

    Alonso-Cristobal, P; Vilela, P; El-Sagheer, A; Lopez-Cabarcos, E; Brown, T; Muskens, O L; Rubio-Retama, J; Kanaras, A G

    2015-06-17

    In this work we demonstrate a DNA biosensor based on fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er nanoparticles and graphene oxide (GO). Monodisperse NaYF4:Yb,Er nanoparticles with a mean diameter of 29.1 ± 2.2 nm were synthesized and coated with a SiO2 shell of 11 nm, which allowed the attachment of single strands of DNA. When these DNA-functionalized NaYF4:Yb,Er@SiO2 nanoparticles were in the proximity of the GO surface, the π-π stacking interaction between the nucleobases of the DNA and the sp(2) carbons of the GO induced a FRET fluorescence quenching due to the overlap of the fluorescence emission of the NaYF4:Yb,Er@SiO2 and the absorption spectrum of GO. By contrast, in the presence of the complementary DNA strands, the hybridization leads to double-stranded DNA that does not interact with the GO surface, and thus the NaYF4:Yb,Er@SiO2 nanoparticles remain unquenched and fluorescent. The high sensitivity and specificity of this sensor introduces a new method for the detection of DNA with a detection limit of 5 pM.

  1. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    Science.gov (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  2. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  3. Identification of Neoceratitis asiatica (Becker) (Diptera: Tephritidae) based on morphological characteristics and DNA barcode.

    Science.gov (United States)

    Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong

    2017-12-12

    Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.

  4. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Science.gov (United States)

    Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E

    2014-01-01

    Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  5. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Directory of Open Access Journals (Sweden)

    Katja Limmer

    Full Text Available Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA, parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  6. Differential Genetic Associations for Systemic Lupus Erythematosus Based on Anti–dsDNA Autoantibody Production

    Science.gov (United States)

    Chung, Sharon A.; Taylor, Kimberly E.; Graham, Robert R.; Nititham, Joanne; Lee, Annette T.; Ortmann, Ward A.; Jacob, Chaim O.; Alarcón-Riquelme, Marta E.; Tsao, Betty P.; Harley, John B.; Gaffney, Patrick M.; Moser, Kathy L.; Petri, Michelle; Demirci, F. Yesim; Kamboh, M. Ilyas; Manzi, Susan; Gregersen, Peter K.; Langefeld, Carl D.; Behrens, Timothy W.; Criswell, Lindsey A.

    2011-01-01

    Systemic lupus erythematosus (SLE) is a clinically heterogeneous, systemic autoimmune disease characterized by autoantibody formation. Previously published genome-wide association studies (GWAS) have investigated SLE as a single phenotype. Therefore, we conducted a GWAS to identify genetic factors associated with anti–dsDNA autoantibody production, a SLE–related autoantibody with diagnostic and clinical importance. Using two independent datasets, over 400,000 single nucleotide polymorphisms (SNPs) were studied in a total of 1,717 SLE cases and 4,813 healthy controls. Anti–dsDNA autoantibody positive (anti–dsDNA +, n = 811) and anti–dsDNA autoantibody negative (anti–dsDNA –, n = 906) SLE cases were compared to healthy controls and to each other to identify SNPs associated specifically with these SLE subtypes. SNPs in the previously identified SLE susceptibility loci STAT4, IRF5, ITGAM, and the major histocompatibility complex were strongly associated with anti–dsDNA + SLE. Far fewer and weaker associations were observed for anti–dsDNA – SLE. For example, rs7574865 in STAT4 had an OR for anti–dsDNA + SLE of 1.77 (95% CI 1.57–1.99, p = 2.0E-20) compared to an OR for anti–dsDNA – SLE of 1.26 (95% CI 1.12–1.41, p = 2.4E-04), with pheterogeneity<0.0005. SNPs in the SLE susceptibility loci BANK1, KIAA1542, and UBE2L3 showed evidence of association with anti–dsDNA + SLE and were not associated with anti–dsDNA – SLE. In conclusion, we identified differential genetic associations with SLE based on anti–dsDNA autoantibody production. Many previously identified SLE susceptibility loci may confer disease risk through their role in autoantibody production and be more accurately described as autoantibody propensity loci. Lack of strong SNP associations may suggest that other types of genetic variation or non-genetic factors such as environmental exposures have a greater impact on susceptibility to anti–dsDNA – SLE. PMID

  7. Differential genetic associations for systemic lupus erythematosus based on anti-dsDNA autoantibody production.

    Directory of Open Access Journals (Sweden)

    Sharon A Chung

    2011-03-01

    Full Text Available Systemic lupus erythematosus (SLE is a clinically heterogeneous, systemic autoimmune disease characterized by autoantibody formation. Previously published genome-wide association studies (GWAS have investigated SLE as a single phenotype. Therefore, we conducted a GWAS to identify genetic factors associated with anti-dsDNA autoantibody production, a SLE-related autoantibody with diagnostic and clinical importance. Using two independent datasets, over 400,000 single nucleotide polymorphisms (SNPs were studied in a total of 1,717 SLE cases and 4,813 healthy controls. Anti-dsDNA autoantibody positive (anti-dsDNA +, n = 811 and anti-dsDNA autoantibody negative (anti-dsDNA -, n = 906 SLE cases were compared to healthy controls and to each other to identify SNPs associated specifically with these SLE subtypes. SNPs in the previously identified SLE susceptibility loci STAT4, IRF5, ITGAM, and the major histocompatibility complex were strongly associated with anti-dsDNA + SLE. Far fewer and weaker associations were observed for anti-dsDNA - SLE. For example, rs7574865 in STAT4 had an OR for anti-dsDNA + SLE of 1.77 (95% CI 1.57-1.99, p = 2.0E-20 compared to an OR for anti-dsDNA - SLE of 1.26 (95% CI 1.12-1.41, p = 2.4E-04, with p(heterogeneity<0.0005. SNPs in the SLE susceptibility loci BANK1, KIAA1542, and UBE2L3 showed evidence of association with anti-dsDNA + SLE and were not associated with anti-dsDNA - SLE. In conclusion, we identified differential genetic associations with SLE based on anti-dsDNA autoantibody production. Many previously identified SLE susceptibility loci may confer disease risk through their role in autoantibody production and be more accurately described as autoantibody propensity loci. Lack of strong SNP associations may suggest that other types of genetic variation or non-genetic factors such as environmental exposures have a greater impact on susceptibility to anti-dsDNA - SLE.

  8. Ultrasensitive Electrochemical Detection of Clostridium perfringens DNA Based Morphology-Dependent DNA Adsorption Properties of CeO2 Nanorods in Dairy Products

    Directory of Open Access Journals (Sweden)

    Xingcan Qian

    2018-06-01

    Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.

  9. A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43% in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97 and lower for avian species (0.70. PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

  10. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Science.gov (United States)

    Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

    2013-01-01

    Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  11. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  12. Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

    Science.gov (United States)

    Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

    2012-02-01

    We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

  13. Application and comparison of large-scale solution-based DNA capture-enrichment methods on ancient DNA

    DEFF Research Database (Denmark)

    Avila Arcos, Maria del Carmen; Cappellini, Enrico; Romero-Navarro, J. Alberto

    2011-01-01

    The development of second-generation sequencing technologies has greatly benefitted the field of ancient DNA (aDNA). Its application can be further exploited by the use of targeted capture-enrichment methods to overcome restrictions posed by low endogenous and contaminating DNA in ancient samples...

  14. Immunological detection of modified DNA bases in irradiated food

    International Nuclear Information System (INIS)

    Williams, J.H.H.; Tyreman, A.L.; Deeble, D.J.; Jones, M.; Smith, C.J.; Christiansen, J.F.; Beaumont, P.C.

    1996-01-01

    Ionising radiation is fatal to all known life forms given sufficient exposure in terms of dose and duration. This property has been used beneficially to sterilise a range of materials, particularly medical products where the removal of all contaminating organisms is deemed essential. Irradiation has long been used to sterilise food for consumption by certain categories of patients. The method is attractive because all potentially contaminating organisms can be removed by one simple treatment. Irradiation also slows down or stops certain processes such as sprouting. There are, however, disadvantages to irradiating food. It is not only DNA that is affected as alterations in lipid and protein components of the food may lead to a loss of quality. Although irradiation will kill bacteria it will probably not affect any toxin produced by those bacteria prior to treatment. Irradiation achieves its effects by damaging molecules, particularly nucleic acids. Consequently, if any of the damage to nucleic acids could be shown to by by a process unique to irradiation, and the products of this unique process could be measured, then there is the basis for a detection system. Furthermore, if the damage could be shown to be proportional to the dose of radiation received then the dose could also be quantified. Legislation, therefore, requires that assays be developed for use in different countries, those which totally ban irradiated food, those which require irradiated food to be labelled and those which have selective laws relating to specific foods and specific levels of irradiation. (author)

  15. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    Science.gov (United States)

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2017-06-15

    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  16. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    Science.gov (United States)

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  17. Cell cycle regulation of DNA polymerase beta in rotenone-based Parkinson's disease models.

    Directory of Open Access Journals (Sweden)

    Hongcai Wang

    Full Text Available In Parkinson's disease (PD, neuronal cells undergo mitotic catastrophe and endoreduplication prior to cell death; however, the regulatory mechanisms remain to be defined. In this study, we investigated cell cycle regulation of DNA polymerase β (poly β in rotenone-based dopaminergic cellular and animal models. Incubation with a low concentration (0.25 µM of rotenone for 1.5 to 7 days resulted in a flattened cell body and decreased DNA replication during S phase, whereas a high concentration (2 µM of rotenone exposure resulted in enlarged, multi-nucleated cells and converted the mitotic cycle into endoreduplication. Consistently, DNA poly β, which is mainly involved in DNA repair synthesis, was upregulated to a high level following exposure to 2 µM rotenone. The abrogation of DNA poly β by siRNA transfection or dideoxycytidine (DDC treatment attenuated the rotenone-induced endoreduplication. The cell cycle was reactivated in cyclin D-expressing dopaminergic neurons from the substantia nigra (SN of rats following stereotactic (ST infusion of rotenone. Increased DNA poly β expression was observed in the substantia nigra pars compacta (SNc and the substantia nigra pars reticulate (SNr of rotenone-treated rats. Collectively, in the in vitro model of rotenone-induced mitotic catastrophe, the overexpression of DNA poly β promotes endoreduplication; in the in vivo model, the upregulation of DNA poly β and cell cycle reentry were also observed in the adult rat substantia nigra. Therefore, the cell cycle regulation of DNA poly β may be involved in the pathological processes of PD, which results in the induction of endoreduplication.

  18. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  19. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  20. A novel input-parasitic compensation technique for a nanopore-based CMOS DNA detection sensor

    Science.gov (United States)

    Kim, Jungsuk

    2016-12-01

    This paper presents a novel input-parasitic compensation (IPC) technique for a nanopore-based complementary metal-oxide-semiconductor (CMOS) DNA detection sensor. A resistive-feedback transimpedance amplifier is typically adopted as the headstage of a DNA detection sensor to amplify the minute ionic currents generated from a nanopore and convert them to a readable voltage range for digitization. But, parasitic capacitances arising from the headstage input and the nanopore often cause headstage saturation during nanopore sensing, thereby resulting in significant DNA data loss. To compensate for the unwanted saturation, in this work, we propose an area-efficient and automated IPC technique, customized for a low-noise DNA detection sensor, fabricated using a 0.35- μm CMOS process; we demonstrated this prototype in a benchtop test using an α-hemolysin ( α-HL) protein nanopore.

  1. Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe

    Science.gov (United States)

    He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing

    2011-11-01

    The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.

  2. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. DNA-based construction at the nanoscale: emerging trends and applications

    Science.gov (United States)

    Lourdu Xavier, P.; Chandrasekaran, Arun Richard

    2018-02-01

    The field of structural DNA nanotechnology has evolved remarkably—from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes—in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.

  4. Synthesis, structure, DNA/BSA binding and antibacterial studies of NNO tridentate Schiff base metal complexes

    Science.gov (United States)

    Sakthi, Marimuthu; Ramu, Andy

    2017-12-01

    A new salicylaldehyde derived 2,4-diiodo-6-((2-phenylaminoethylimino)methyl)phenol Schiff base(L) and its transition metal complexes of the type MLCl where, M = Cu(II), Ni(II), Co(II), Mn(II) and Zn(II) have been synthesized. The coordination mode of Schiff base holding NNO donor atoms with metal ions was well investigated by elemental analysis, ESI-mass as well as IR, UV-vis, CV and NMR spectral studies. The binding efficiency and mode of these complexes with biological macromolecules viz., herring sperm DNA (HS- DNA) and bovine serum albumin (BSA) have been explored through various spectroscopic techniques. The characteristic changes in absorption, emission and, circular dichroism spectra of the complexes with DNA indicate the noticeable interaction between them. From the all spectral information complexes could interact with DNA via non-intercalation mode of binding. The hyperchromisim in absorption band and hypochromisim in emission intensity of BSA with different complex concentrations shown significant information, and the binding affinity value has been predicted from Stern-Volmer plots. Further, all the complexes could cleave the circular plasmid pUC19 DNA efficiently by using an activator H2O2. The ligand and all metal(II) complexes showed good antibacterial activities. The molecular docking studies of the complexes with DNA were performed in order to make a comparison and conclusion with spectral technic results.

  5. Chloroplast DNA variation in European white oaks phylogeography and patterns of diversity based on data from over 2600 populations

    NARCIS (Netherlands)

    Petit, R.J.; Csaikl, U.M.; Bordács, S.; Burg, K.; Coart, E.; Cottrell, J.; Dam, van B.C.; Deans, J.D.; Dumolin-LapOgue, S.; Fineschi, S.; Finkeldey, R.; Gillies, A.; Glaz, I.; Goicoechea, P.G.; Jensen, J.S.; König, A.O.; Lowe, A.J.; Madsen, S.F.; Mátyás, G.; Munro, R.C.; Olalde, M.; Pemonge, M.H.; Popescu, F.; Slade, D.; Tabbener, H.; Taurchini, D.; Vries, de S.G.M.; Ziegenhagen, B.; Kremer, A.

    2002-01-01

    A consortium of 16 laboratories have studied chloroplast DNA (cpDNA) variation in European white oaks. A common strategy for molecular screening, based on restriction analysis of four PCR-amplified cpDNA fragments, was used to allow comparison among the different laboratories. A total of 2613 oak

  6. Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand.

    Science.gov (United States)

    Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes

    2012-01-01

    Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.

  7. DNA minor groove targeted alkylating agents based on bisbenzimidazole carriers: synthesis, cytotoxicity and sequence-specificity of DNA alkylation.

    Science.gov (United States)

    Smaill, J B; Fan, J Y; Denny, W A

    1998-12-01

    A series of bisbenzimidazoles bearing a variety of alkylating agents [ortho- and meta-mustards, imidazolebis(hydroxymethyl), imidazolebis(methylcarbamate) and pyrrolebis(hydroxymethyl)], appended by a propyl linker chain, were prepared and investigated for sequence-specificity of DNA alkylation and their cytotoxicity. Previous work has shown that, for para-aniline mustards, a propyl linker is optimal for cytotoxicity. Alkaline cleavage assays using a variety of different labelled oligonucleotides showed that the preferred sequences for adenine alkylation were 5'-TTTANANAANN and 5'-ATTANANAANN (underlined bases show the drug alkylation sites), with AT-rich sequences required on both the 5' and 3' sides of the alkylated adenine. The different aniline mustards showed little variation in alkylation pattern and similar efficiencies of DNA cross-link formation despite the changes in orientation and positioning of the mustard, suggesting that the propyl linker has some flexibility. The imidazole- and pyrrolebis(hydroxymethyl) alkylators showed no DNA strand cleavage following base treatment, indicating that no guanine or adenine N3 or N7 adducts were formed. Using the PCR-based polymerase stop assay, these alkylators showed PCR blocks at 5'-C*G sites (the * nucleotide indicates the blocked site), particularly at 5'-TAC*GA 5'-AGC*GGA, and 5'-AGCC*GGT sequences, caused by guanine 2-NH2 lesions on the opposite strand. Only the (more reactive) imidazolebis(methylcarbamoyl) and pyrrolebis(hydroxymethyl) alkylators demonstrated interstrand cross-linking ability. All of the bifunctional mustards showed large (approximately 100-fold) increases in cytotoxicity over chlorambucil, with the corresponding monofunctional mustards being 20- to 60-fold less cytotoxic. These results suggest that in the mustards the propyl linker provides sufficient flexibility to achieve delivery of the alkylator to favoured (adenine N3) sites in the minor groove, regardless of its exact geometry with

  8. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Science.gov (United States)

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  9. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  10. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier

    2014-01-01

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL −1 and 50 μg mL −1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  11. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  12. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  13. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  14. A DNA-based semantic fusion model for remote sensing data.

    Directory of Open Access Journals (Sweden)

    Heng Sun

    Full Text Available Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  15. A DNA-based semantic fusion model for remote sensing data.

    Science.gov (United States)

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  16. A Quantitative Tool for Producing DNA-Based Diagnostic Arrays

    Energy Technology Data Exchange (ETDEWEB)

    Tom J. Whitaker

    2008-07-11

    The purpose of this project was to develop a precise, quantitative method to analyze oligodeoxynucleotides (ODNs) on an array to enable a systematic approach to quality control issues affecting DNA microarrays. Two types of ODN's were tested; ODN's formed by photolithography and ODN's printed onto microarrays. Initial work in Phase I, performed in conjunction with Affymetrix, Inc. who has a patent on a photolithographic in situ technique for creating DNA arrays, was very promising but did seem to indicate that the atomization process was not complete. Soon after Phase II work was under way, Affymetrix had further developed fluorescent methods and indicated they were no longer interested in our resonance ionization technique. This was communicated to the program manager and it was decided that the project would continue and be focused on printed ODNs. The method being tested is called SIRIS, Sputter-Initiated Resonance Ionization Spectroscopy. SIRIS has been shown to be a highly sensitive, selective, and quantitative tool for atomic species. This project was aimed at determining if an ODN could be labeled in such a way that SIRIS could be used to measure the label and thus provide quantitative measurements of the ODN on an array. One of the largest problems in this study has been developing a method that allows us to know the amount of an ODN on a surface independent of the SIRIS measurement. Even though we could accurately determine the amount of ODN deposited on a surface, the amount that actually attached to the surface is very difficult to measure (hence the need for a quantitative tool). A double-labeling procedure was developed in which 33P and Pt were both used to label ODNs. The radioactive 33P could be measured by a proportional counter that maps the counts in one dimension. This gave a good measurement of the amount of ODN remaining on a surface after immobilization and washing. A second label, Pt, was attached to guanine nucleotides in the

  17. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    Science.gov (United States)

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

    2018-02-12

    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre

    2006-01-01

    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  19. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  20. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Science.gov (United States)

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  2. Biosensor for label-free DNA quantification based on functionalized LPGs.

    Science.gov (United States)

    Gonçalves, Helena M R; Moreira, Luis; Pereira, Leonor; Jorge, Pedro; Gouveia, Carlos; Martins-Lopes, Paula; Fernandes, José R A

    2016-10-15

    A label-free fiber optic biosensor based on a long period grating (LPG) and a basic optical interrogation scheme using off the shelf components is used for the detection of in-situ DNA hybridization. A new methodology is proposed for the determination of the spectral position of the LPG mode resonance. The experimental limit of detection obtained for the DNA was 62±2nM and the limit of quantification was 209±7nM. The sample specificity was experimentally demonstrated using DNA targets with different base mismatches relatively to the probe and was found that the system has a single base mismatch selectivity. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Multiway study of hybridization in nanoscale semiconductor labeled DNA based on fluorescence resonance energy transfer

    DEFF Research Database (Denmark)

    Gholami, Somayeh; Kompany Zare, Mohsen

    2013-01-01

    donor-QD acceptor) upon hybridization with a label free target was monitored by two-dimensional photoluminescence excitation spectroscopy (2D-PLE). Detection of a target oligonucleotide strand, using sandwiched nanoassembly in a separation-free format, was performed with the appearance of a new feature...... and model based analysis of 2D-PLE data was implemented by means of PAR-AFAC and hard trilinear decomposition (HTD), allowing to fit a proper model for FRET-based sandwich DNA hybridization systems. This study is the first successful application of a multiway chemometric technique to consider FRET based DNA...... hybridization in sandwiched nanoassemblies. A multi-equilibria model was properly fitted to the data and confirmed there is a competition between ternary and binary complex formation. Equilibrium constants of DNA hybridization in sandwiched nanoassemblies were estimated for the first time. Equilibrium constants...

  4. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  5. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  6. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  7. Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

    Science.gov (United States)

    Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

    2018-09-15

    Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.

    Science.gov (United States)

    Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike

    2018-05-01

    We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.

  9. High-speed DNA-based rolling motors powered by RNase H

    Science.gov (United States)

    Yehl, Kevin; Mugler, Andrew; Vivek, Skanda; Liu, Yang; Zhang, Yun; Fan, Mengzhen; Weeks, Eric R.

    2016-01-01

    DNA-based machines that walk by converting chemical energy into controlled motion could be of use in applications such as next generation sensors, drug delivery platforms, and biological computing. Despite their exquisite programmability, DNA-based walkers are, however, challenging to work with due to their low fidelity and slow rates (~1 nm/min). Here, we report DNA-based machines that roll rather than walk, and consequently have a maximum speed and processivity that is three-orders of magnitude greater than conventional DNA motors. The motors are made from DNA-coated spherical particles that hybridise to a surface modified with complementary RNA; motion is achieved through the addition of RNase H, which selectively hydrolyses hybridised RNA. Spherical motors move in a self-avoiding manner, whereas anisotropic particles, such as dimerised particles or rod-shaped particles travel linearly without a track or external force. Finally, we demonstrate detection of single nucleotide polymorphism by measuring particle displacement using a smartphone camera. PMID:26619152

  10. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    Science.gov (United States)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  11. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  12. DNA base-calling from a nanopore using a Viterbi algorithm.

    Science.gov (United States)

    Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-05-16

    Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  13. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  14. A CCD-based system for the detection of DNA in electrophoresis gels by UV absorption

    International Nuclear Information System (INIS)

    Mahon, A.R.; MacDonald, J.H.; Mainwood, A.; Ott, R.J.

    1999-01-01

    A method and apparatus for the detection and quantification of large fragments of unlabelled nucleic acids in agarose gels is presented. The technique is based on ultraviolet (UV) absorption by nucleotides. A deuterium source illuminates individual sample lanes of an electrophoresis gel via an array of optical fibres. As DNA bands pass through the illuminated region of the gel the amount of UV light transmitted is reduced because of absorption by the DNA. During electrophoresis the regions of DNA are detected on-line using a UV-sensitive charge coupled device (CCD). As the absorption coefficient is proportional to the mass of DNA the technique is inherently quantitative. The mass of DNA in a region of the gel is approximately proportional to the integrated signal in the corresponding section of the CCD image. This system currently has a detection limit of less than 1.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. In addition the DNA sample remains in its native state. The removal of the carcinogenic dye from the detection procedure greatly reduces associated biological hazards. (author)

  15. Detection of DNA hybridization based on SnO2 nanomaterial enhanced fluorescence

    International Nuclear Information System (INIS)

    Gu Cuiping; Huang Jiarui; Ni Ning; Li Minqiang; Liu Jinhuai

    2008-01-01

    In this paper, enhanced fluorescence emissions were firstly investigated based on SnO 2 nanomaterial, and its application in the detection of DNA hybridization was also demonstrated. The microarray of SnO 2 nanomaterial was fabricated by the vapour phase transport method catalyzed by patterned Au nanoparticles on a silicon substrate. A probe DNA was immobilized on the substrate with patterned SnO 2 nanomaterial, respectively, by covalent and non-covalent linking schemes. When a fluorophore labelled target DNA was hybridized with a probe DNA on the substrate, fluorescence emissions were only observed on the surface of SnO 2 nanomaterial, which indicated the property of enhancing fluorescence signals from the SnO 2 nanomaterial. By comparing the different fluorescence images from covalent and non-covalent linking schemes, the covalent method was confirmed to be more effective for immobilizing a probe DNA. With the combined use of SnO 2 nanomaterial and the covalent linking scheme, the target DNA could be detected at a very low concentration of 10 fM. And the stability of SnO 2 nanomaterial under the experimental conditions was also compared with silicon nanowires. The findings strongly suggested that SnO 2 nanomaterial could be extensively applied in detections of biological samples with enhancing fluorescence property and high stability

  16. Pros and cons of methylation-based enrichment methods for ancient DNA

    Science.gov (United States)

    Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

    2015-01-01

    The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828

  17. Dielectrophoretic trapping of DNA-coated gold nanoparticles on silicon based vertical nanogap devices.

    Science.gov (United States)

    Strobel, Sebastian; Sperling, Ralph A; Fenk, Bernhard; Parak, Wolfgang J; Tornow, Marc

    2011-06-07

    We report on the successful dielectrophoretic trapping and electrical characterization of DNA-coated gold nanoparticles on vertical nanogap devices (VNDs). The nanogap devices with an electrode distance of 13 nm were fabricated from Silicon-on-Insulator (SOI) material using a combination of anisotropic reactive ion etching (RIE), selective wet chemical etching and metal thin-film deposition. Au nanoparticles (diameter 40 nm) coated with a monolayer of dithiolated 8 base pairs double stranded DNA were dielectrophoretically trapped into the nanogap from electrolyte buffer solution at MHz frequencies as verified by scanning and transmission electron microscopy (SEM/TEM) analysis. First electrical transport measurements through the formed DNA-Au-DNA junctions partially revealed an approximately linear current-voltage characteristic with resistance in the range of 2-4 GΩ when measured in solution. Our findings point to the importance of strong covalent bonding to the electrodes in order to observe DNA conductance, both in solution and in the dry state. We propose our setup for novel applications in biosensing, addressing the direct interaction of biomolecular species with DNA in aqueous electrolyte media.

  18. Chromatin associated mechanisms in base excision repair - nucleosome remodeling and DNA transcription, two key players.

    Science.gov (United States)

    Menoni, Hervé; Di Mascio, Paolo; Cadet, Jean; Dimitrov, Stefan; Angelov, Dimitar

    2017-06-01

    Genomic DNA is prone to a large number of insults by a myriad of endogenous and exogenous agents. The base excision repair (BER) is the major mechanism used by cells for the removal of various DNA lesions spontaneously or environmentally induced and the maintenance of genome integrity. The presence of persistent DNA damage is not compatible with life, since abrogation of BER leads to early embryonic lethality in mice. There are several lines of evidences showing existence of a link between deficient BER, cancer proneness and ageing, thus illustrating the importance of this DNA repair pathway in human health. Although the enzymology of BER mechanisms has been largely elucidated using chemically defined DNA damage substrates and purified proteins, the complex interplay of BER with another vital process like transcription or when DNA is in its natural state (i.e. wrapped in nucleosome and assembled in chromatin fiber is largely unexplored. Cells use chromatin remodeling factors to overcome the general repression associated with the nucleosomal organization. It is broadly accepted that energy-dependent nucleosome remodeling factors disrupt histones-DNA interactions at the expense of ATP hydrolysis to favor transcription as well as DNA repair. Importantly, unlike transcription, BER is not part of a regulated developmental process but represents a maintenance system that should be efficient anytime and anywhere in the genome. In this review we will discuss how BER can deal with chromatin organization to maintain genetic information. Emphasis will be placed on the following challenging question: how BER is initiated within chromatin? Copyright © 2017 Elsevier Inc. All rights reserved.

  19. HLA class I sequence-based typing using DNA recovered from frozen plasma.

    Science.gov (United States)

    Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L

    2012-08-31

    We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. A treatise on benzimidazole based Schiff base metal(II) complexes accentuating their biological efficacy: Spectroscopic evaluation of DNA interactions, DNA cleavage and antimicrobial screening

    Energy Technology Data Exchange (ETDEWEB)

    Kumaravel, Ganesan; Raman, Natarajan, E-mail: ramchem1964@gmail.com

    2017-01-01

    Two novel imidazole derived Schiff bases, (Z)-1-(1H-benzo[d]imidazol-2-yl)-N-benzylidenemethanamine (L{sup 1}) and 1-(1H-benzo[d]imidazol-2-yl)-N-(4-nitrobenzylidene) methanamine, and a series of their transition metal complexes of the types [M(L{sup 1}){sub 2}]Cl{sub 2} and [M(L{sup 2}){sub 2}]Cl{sub 2} where, M = Cu(II), Ni(II), Co(II) and Zn(II) have been designed and synthesized. These compounds were characterized by various spectral and physicochemical data. UV–Vis, magnetic susceptibility and molar conductivity data indicate that all the complexes adopt square planar geometry. The EPR spectral data of the Cu(II) complexes have provided supportive evidence to the conclusion derived on the basis of electronic absorption and magnetic moment values. Moreover, the interaction of complexes with DNA via intercalation has been explored by absorption, fluorescence spectroscopy, cyclic voltammetry, viscosity and circular dichroism. Agarose gel electrophoresis technique reveals that the complexes are good metallonucleases. All the compounds have relatively high antibacterial and antifungal potencies. Among the metal complexes, Cu(II) complexes exhibit higher efficacy against all the pathogens. - Highlights: • Synthesis of new and efficient benzimidazole based DNA targeting complexes • Synthesis of efficient metallointercalators • Excellent DNA exploiting ability of Cu(II) complexes • Efficient antimicrobial agents against various pathogens.

  1. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  2. Triazene-Based Traceless Linkers for DNA-Directed Chemistry and Development of Methods for Linking Nanomaterials to DNA Origami

    DEFF Research Database (Denmark)

    Hejesen, Christian

    2013-01-01

    , kan triazen linkeren ydermere introducere ny kemi på en DNA streng ved kløvning. Det andet projekt, der er beskrevet i dette kapitel, omhandler de indledende studier og resultater for en DNA-dirigeret palladium katalyseret Suzuki-Miyaura krydskobling. I kapitel 3 bliver DNA origami feltet kort...... med ren DNA bliver kulstof-nanorørene dispergeret med syntetisk polymer der indeholder DNA. Denne polymer gør det muligt at binde kulstof-nanorørene på en DNA origami, der så kan analyseret ved hjælp af atomar kraftmikroskopi. Kapitel 4 omhandler et projekt omhandler arbejde der er udført ved Arizona...

  3. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  4. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  5. Ascaris phylogeny based on multiple whole mtDNA genomes

    DEFF Research Database (Denmark)

    Nejsum, Peter; Hawash, Mohamed B F; Betson, Martha

    2016-01-01

    and C) of human and pig Ascaris based on partial cox1 sequences. In the present study, we selected major haplotypes from these different clusters to characterize their whole mitochondrial genomes for phylogenetic analysis. We also undertook coalescent simulations to investigate the evolutionary history...

  6. A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

    Science.gov (United States)

    Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

    2015-07-01

    In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Comparative DNA isolation behaviours of silica and polymer based sorbents in batch fashion: monodisperse silica microspheres with bimodal pore size distribution as a new sorbent for DNA isolation.

    Science.gov (United States)

    Günal, Gülçin; Kip, Çiğdem; Eda Öğüt, S; İlhan, Hasan; Kibar, Güneş; Tuncel, Ali

    2018-02-01

    Monodisperse silica microspheres with bimodal pore-size distribution were proposed as a high performance sorbent for DNA isolation in batch fashion under equilibrium conditions. The proposed sorbent including both macroporous and mesoporous compartments was synthesized 5.1 μm in-size, by a "staged shape templated hydrolysis and condensation method". Hydrophilic polymer based sorbents were also obtained in the form of monodisperse-macroporous microspheres ca 5.5 μm in size, with different functionalities, by a developed "multi-stage microsuspension copolymerization" technique. The batch DNA isolation performance of proposed material was comparatively investigated using polymer based sorbents with similar morphologies. Among all sorbents tried, the best DNA isolation performance was achieved with the monodisperse silica microspheres with bimodal pore size distribution. The collocation of interconnected mesoporous and macroporous compartments within the monodisperse silica microspheres provided a high surface area and reduced the intraparticular mass transfer resistance and made easier both the adsorption and desorption of DNA. Among the polymer based sorbents, higher DNA isolation yields were achieved with the monodisperse-macroporous polymer microspheres carrying trimethoxysilyl and quaternary ammonium functionalities. However, batch DNA isolation performances of polymer based sorbents were significantly lower with respect to the silica microspheres.

  8. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  9. A DNA methylation-based definition of biologically distinct breast cancer subtypes.

    Science.gov (United States)

    Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel

    2015-03-01

    In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta.

    Science.gov (United States)

    Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N

    2004-07-16

    A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

  11. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  12. Phosphorescent quantum dots/doxorubicin nanohybrids based on photoinduced electron transfer for detection of DNA.

    Science.gov (United States)

    Miao, Yanming; Zhang, Zhifeng; Gong, Yan; Yan, Guiqin

    2014-09-15

    MPA-capped Mn-doped ZnS QDs/DXR nanohybrids (MPA: 3-mercaptopropionic acid; QDs: quantum dots; DXR: cetyltrimethyl ammonium bromide) were constructed via photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for detection of DNA. DXR as a quencher will quench the RTP of Mn-doped ZnS QDs via PIET, thereby forming Mn-doped ZnS QDs/DXR nanohybrids and storing RTP. With the addition of DNA, it will be inserted into DXR and thus DXR will be competitively desorbed from the surface of Mn-doped ZnS QDs, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this, a new method for DNA detection was built. The sensor for DNA has a detection limit of 0.039 mg L(-1) and a linear range from 0.1 to 14 mg L(-1). The present QDs-based RTP method does not need deoxidants or other inducers as required by conventional RTP detection methods, and avoids interference from autofluorescence and the scattering light of the matrix that are encountered in spectrofluorometry. Therefore, this method can be used to detect the DNA content in body fluid. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  14. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  15. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  16. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  17. Synthesis of Acridine-based DNA Bis-intercalating Agents

    Directory of Open Access Journals (Sweden)

    P. Mack

    2001-02-01

    Full Text Available Methods for the synthesis of N1, N8-bis(9-acridinyl-N4-(4-hydroxybenzyl-spermidine and N1, N7-(hydroxybenzyl-bis-(3-aminopropylamine were investigated. Thus monocyanoethylation of 4-methoxybenzylamine followed by treatment with 4-chlorobutyronitrile gave the dinitrile N-(2-cyanoethyl-N-(3-cyanopropyl-4-methoxybenzylamine. Subsequent in situ reduction with lithium aluminium hydride gave the corresponding diamine. Biscyanoethylation of 4-methoxybenzylamine with 2 mole of acrylonitrile followed by reduction yielded the diamine N, N-bis-(3-aminopropyl-4-methoxybenzylamine. Both diamines reacted smoothly with 9-methoxyacridine to give the bis-(9-acridinyl compounds 11 and 15 but with 4,5-dimethyl-9-methoxyacridine, the bis compound 16 was produced in only low yields. Demethylation of the dinitriles by a variety of approaches all failed to give the corresponding hydroxybenzyl derivatives. These studies yielded useful methylated tyrosine derivatives which could also be iodinated. This study has been useful for elucidating chemical methods needed for the synthesis of the desired tyrosine-based bis acridine compound and for alerting us to the need to synthesise a more labile protected tyrosine intermediate which will be easily deprotected to afford the desired tyrosine-based bis acridine compound.

  18. Optimizing DNA assembly based on statistical language modelling.

    Science.gov (United States)

    Fang, Gang; Zhang, Shemin; Dong, Yafei

    2017-12-15

    By successively assembling genetic parts such as BioBrick according to grammatical models, complex genetic constructs composed of dozens of functional blocks can be built. However, usually every category of genetic parts includes a few or many parts. With increasing quantity of genetic parts, the process of assembling more than a few sets of these parts can be expensive, time consuming and error prone. At the last step of assembling it is somewhat difficult to decide which part should be selected. Based on statistical language model, which is a probability distribution P(s) over strings S that attempts to reflect how frequently a string S occurs as a sentence, the most commonly used parts will be selected. Then, a dynamic programming algorithm was designed to figure out the solution of maximum probability. The algorithm optimizes the results of a genetic design based on a grammatical model and finds an optimal solution. In this way, redundant operations can be reduced and the time and cost required for conducting biological experiments can be minimized. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.

    Science.gov (United States)

    Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E

    2014-06-01

    The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.

  20. MD study of pyrimidine base damage on DNA and its recognition by repair enzyme

    International Nuclear Information System (INIS)

    Pinak, M.

    2000-01-01

    The molecular dynamics (MD) simulation was used on the study of two specific damages of pyrimidine bases of DNA. Pyrimidine bases are major targets either of free radicals induced by ionizing radiation in DNA surrounding environment or UV radiation. Thymine dimer (TD) is UV induced damage, in which two neighboring thymines in one strand are joined by covalent bonds of C(5)-C(5) and C(6)-C(6) atoms of thymines. Thymine glycol (TG) is ionizing radiation induced damage in which the free water radical adds to unsaturated bond C(5)-C(6) of thymine. Both damages are experimentally suggested to be mutagenetic and carcinogenic unless properly repaired by repair enzymes. In the case of MD of TD, there is detected strong kink around the TD site that is not observed in native DNA. In addition there is observed the different value of electrostatic energy at the TD site - negative '-10 kcal/mol', in contrary to nearly neutral value of native thymine site. Structural changes and specific electrostatic energy - seems to be important for proper recognition of TD damaged site, formation of DNA-enzyme complex and thus for subsequent repair of DNA. In the case of TG damaged DNA there is major structural distortion at the TG site, mainly the increased distance between TG and the C5' of adjacent nucleotide. This enlarged gap between the neighboring nucleotides may prevent the insertion of complementary base during replication causing the replication process to stop. In which extend this structural feature together with energy properties of TG contributes to the proper recognition of TG by repair enzyme Endonuclease III is subject of further computational MD study. (author)

  1. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  2. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  3. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Science.gov (United States)

    Craig S. Echt; Surya Saha; Konstantin V. Krutovsky; Kokulapalan Wimalanathan; John E. Erpelding; Chun Liang; C Dana Nelson

    2011-01-01

    Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety...

  4. Triple-helix molecular switch-based aptasensors and DNA sensors.

    Science.gov (United States)

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Potential for DNA-based ID of Great Lakes fauna: Species inventories vs. barcode libraries

    Science.gov (United States)

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However the abil...

  6. Capacity for DNA-barcode based taxonomy in support of Great Lakes biological monitoring

    Science.gov (United States)

    Enumerating organisms collected via nets and sediment grabs is a mainstay of aquatic ecology. Since morphological taxonomy can require considerable resources and expertise, DNA barcode-based identification of mixed-organism samples offers a valuable tool in support of biological...

  7. Research Report Non-invasive DNA-based species and sex ...

    Indian Academy of Sciences (India)

    shrushti modi

    Non-invasive DNA-based species and sex identification of Asiatic wild dog (Cuon alpinus) .... We did not find any cross-gender amplification with any of the reference or field-collected samples. Success rate for sex discrimination for all field-.

  8. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  9. Fast parallel DNA-based algorithms for molecular computation: the set-partition problem.

    Science.gov (United States)

    Chang, Weng-Long

    2007-12-01

    This paper demonstrates that basic biological operations can be used to solve the set-partition problem. In order to achieve this, we propose three DNA-based algorithms, a signed parallel adder, a signed parallel subtractor and a signed parallel comparator, that formally verify our designed molecular solutions for solving the set-partition problem.

  10. DNA-based stable isotope probing: a link between community structure and function

    Czech Academy of Sciences Publication Activity Database

    Uhlík, Ondřej; Ječná, K.; Leigh, M. B.; Macková, Martina; Macek, Tomáš

    2009-01-01

    Roč. 407, č. 12 (2009), s. 3611-3619 ISSN 0048-9697 Grant - others:GA MŠk(CZ) 2B08031 Program:2B Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA-based stable isotope probing * microbial diversity * bioremediation Subject RIV: EI - Biotechnology ; Bionics Impact factor: 2.905, year: 2009

  11. DNA-based identification of Armillaria isolates from peach orchards in Mexico state

    Science.gov (United States)

    Ruben Damian Elias Roman; Ned B. Klopfenstein; Dionicio Alvarado Rosales; Mee-Sook Kim; Anna E. Case; Sara M. Ashiglar; John W. Hanna; Amy L. Ross-Davis; Remigio A. Guzman Plazola

    2012-01-01

    A collaborative project between the Programa de Fitopatología, Colegio de Postgraduados, Texcoco, Estado de Mexico and the USDA Forest Service - RMRS, Moscow Forest Pathology Laboratory has begun this year (2011) to assess which species of Armillaria are causing widespread and severe damage to the peach orchards from México state, Mexico. We are employing a DNA-based...

  12. DNA-based identification and phylogeny of North American Armillaria species

    Science.gov (United States)

    Amy L. Ross-Davis; John W. Hanna; Ned B. Klopfenstein

    2011-01-01

    Because Armillaria species display different ecological behaviors across diverse forest ecosystems, it is critical to identify Armillaria species accurately for any assessment of forest health. To further develop DNA-based identification methods, partial sequences of the translation elongation factor-1 alpha (EF-1α) gene were used to examine the phylogenetic...

  13. Structuring polymers for delivery of DNA-based therapeutics: updated insights.

    Science.gov (United States)

    Gupta, Madhu; Tiwari, Shailja; Vyas, Suresh

    2012-01-01

    Gene therapy offers greater opportunities for treating numerous incurable diseases from genetic disorders, infections, and cancer. However, development of appropriate delivery systems could be one of the most important factors to overcome numerous biological barriers for delivery of various therapeutic molecules. A number of nonviral polymer-mediated vectors have been developed for DNA delivery and offer the potential to surmount the associated problems of their viral counterpart. To address the concerns associated with safety issues, a wide range of polymeric vectors are available and have been utilized successfully to deliver their therapeutics in vivo. Today's research is mainly focused on the various natural or synthetic polymer-based delivery carriers that protect the DNA molecule from degradation, which offer specific targeting to the desired cells after systemic administration, have transfection efficiencies equivalent to virus-mediated gene delivery, and have long-term gene expression through sustained-release mechanisms. This review explores an updated overview of different nonviral polymeric delivery system for delivery of DNA-based therapeutics. These polymeric carriers have been evaluated in vitro and in vivo and are being utilized in various stages of clinical evaluation. Continued research and understanding of the principles of polymer-based gene delivery systems will enable us to develop new and efficient delivery systems for the delivery of DNA-based therapeutics to achieve the goal of efficacious and specific gene therapy for a vast array of clinical disorders as the therapeutic solutions of tomorrow.

  14. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Science.gov (United States)

    Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective o...

  15. DNA-based catalytic enantioselective intermolecular oxa-Michael addition reactions

    NARCIS (Netherlands)

    Megens, Rik P.; Roelfes, Gerard

    2012-01-01

    Using the DNA-based catalysis concept, a novel Cu(II) catalyzed enantioselective oxa-Michael addition of alcohols to enones is reported. Enantioselectivities of up to 86% were obtained. The presence of water is important for the reactivity, possibly by reverting unwanted side reactions such as

  16. Assessment of Carbon- and Metal-Based Nanoparticle DNA Damage with Microfluidic Electrophoretic Separation Technology.

    Science.gov (United States)

    Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M

    2015-02-01

    In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.

  17. A DNA Computing Model for the Graph Vertex Coloring Problem Based on a Probe Graph

    Directory of Open Access Journals (Sweden)

    Jin Xu

    2018-02-01

    Full Text Available The biggest bottleneck in DNA computing is exponential explosion, in which the DNA molecules used as data in information processing grow exponentially with an increase of problem size. To overcome this bottleneck and improve the processing speed, we propose a DNA computing model to solve the graph vertex coloring problem. The main points of the model are as follows: ① The exponential explosion problem is solved by dividing subgraphs, reducing the vertex colors without losing the solutions, and ordering the vertices in subgraphs; and ② the bio-operation times are reduced considerably by a designed parallel polymerase chain reaction (PCR technology that dramatically improves the processing speed. In this article, a 3-colorable graph with 61 vertices is used to illustrate the capability of the DNA computing model. The experiment showed that not only are all the solutions of the graph found, but also more than 99% of false solutions are deleted when the initial solution space is constructed. The powerful computational capability of the model was based on specific reactions among the large number of nanoscale oligonucleotide strands. All these tiny strands are operated by DNA self-assembly and parallel PCR. After thousands of accurate PCR operations, the solutions were found by recognizing, splicing, and assembling. We also prove that the searching capability of this model is up to O(359. By means of an exhaustive search, it would take more than 896 000 years for an electronic computer (5 × 1014 s−1 to achieve this enormous task. This searching capability is the largest among both the electronic and non-electronic computers that have been developed since the DNA computing model was proposed by Adleman’s research group in 2002 (with a searching capability of O(220. Keywords: DNA computing, Graph vertex coloring problem, Polymerase chain reaction

  18. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Henriksen, Anders Dahl

    2014-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches....... The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover...

  19. Solving probability reasoning based on DNA strand displacement and probability modules.

    Science.gov (United States)

    Zhang, Qiang; Wang, Xiaobiao; Wang, Xiaojun; Zhou, Changjun

    2017-12-01

    In computation biology, DNA strand displacement technology is used to simulate the computation process and has shown strong computing ability. Most researchers use it to solve logic problems, but it is only rarely used in probabilistic reasoning. To process probabilistic reasoning, a conditional probability derivation model and total probability model based on DNA strand displacement were established in this paper. The models were assessed through the game "read your mind." It has been shown to enable the application of probabilistic reasoning in genetic diagnosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  1. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite

    2010-08-01

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  2. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  3. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    Science.gov (United States)

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  4. Development of a Fluorescence Resonance Energy Transfer (FRET-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    Directory of Open Access Journals (Sweden)

    Noremylia Mohd Bakhori

    2013-12-01

    Full Text Available An optical DNA biosensor based on fluorescence resonance energy transfer (FRET utilizing synthesized quantum dot (QD has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  5. Self-Assembling Molecular Logic Gates Based on DNA Crossover Tiles.

    Science.gov (United States)

    Campbell, Eleanor A; Peterson, Evan; Kolpashchikov, Dmitry M

    2017-07-05

    DNA-based computational hardware has attracted ever-growing attention due to its potential to be useful in the analysis of complex mixtures of biological markers. Here we report the design of self-assembling logic gates that recognize DNA inputs and assemble into crossover tiles when the output signal is high; the crossover structures disassemble to form separate DNA stands when the output is low. The output signal can be conveniently detected by fluorescence using a molecular beacon probe as a reporter. AND, NOT, and OR logic gates were designed. We demonstrate that the gates can connect to each other to produce other logic functions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Satellite DNA-based artificial chromosomes for use in gene therapy.

    Science.gov (United States)

    Hadlaczky, G

    2001-04-01

    Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.

  7. Design, Synthesis, and Evaluation of Novel Tyrosine-Based DNA Gyrase B Inhibitors.

    Science.gov (United States)

    Cotman, Andrej E; Trampuž, Marko; Brvar, Matjaž; Kikelj, Danijel; Ilaš, Janez; Peterlin-Mašič, Lucija; Montalvão, Sofia; Tammela, Päivi; Frlan, Rok

    2017-08-01

    The discovery and synthesis of new tyrosine-based inhibitors of DNA gyrase B (GyrB), which target its ATPase subunit, is reported. Twenty-four compounds were synthesized and evaluated for activity against DNA gyrase and DNA topoisomerase IV. The antibacterial properties of selected GyrB inhibitors were demonstrated by their activity against Staphylococcus aureus and Enterococcus faecalis in the low micromolar range. The most promising compounds, 8a and 13e, inhibited Escherichia coli and S. aureus GyrB with IC 50 values of 40 and 30 µM. The same compound also inhibited the growth of S. aureus and E. faecalis with minimal inhibitory concentrations (MIC 90 ) of 14 and 28 µg/mL, respectively. © 2017 Deutsche Pharmazeutische Gesellschaft.

  8. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features.

    Science.gov (United States)

    Zaman, Rianon; Chowdhury, Shahana Yasmin; Rashid, Mahmood A; Sharma, Alok; Dehzangi, Abdollah; Shatabda, Swakkhar

    2017-01-01

    DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM) as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  9. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features

    Directory of Open Access Journals (Sweden)

    Rianon Zaman

    2017-01-01

    Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  10. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  11. Opinion data mining based on DNA method and ORA software

    Science.gov (United States)

    Tian, Ru-Ya; Wu, Lei; Liang, Xiao-He; Zhang, Xue-Fu

    2018-01-01

    Public opinion, especially the online public opinion is a critical issue when it comes to mining its characteristics. Because it can be formed directly and intensely in a short time, and may lead to the outbreak of online group events, and the formation of online public opinion crisis. This may become the pushing hand of a public crisis event, or even have negative social impacts, which brings great challenges to the government management. Data from the mass media which reveal implicit, previously unknown, and potentially valuable information, can effectively help us to understand the evolution law of public opinion, and provide a useful reference for rumor intervention. Based on the Dynamic Network Analysis method, this paper uses ORA software to mine characteristics of public opinion information, opinion topics, and public opinion agents through a series of indicators, and quantitatively analyzed the relationships between them. The results show that through the analysis of the 8 indexes associating with opinion data mining, we can have a basic understanding of the public opinion characteristics of an opinion event, such as who is important in the opinion spreading process, the information grasping condition, and the opinion topics release situation.

  12. Detection of anthrax lef with DNA-based photonic crystal sensors

    Science.gov (United States)

    Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong

    2011-12-01

    Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

  13. Phosphorescent quantum dots/ethidium bromide nanohybrids based on photoinduced electron transfer for DNA detection.

    Science.gov (United States)

    Bi, Lin; Yu, Yuan-Hua

    2015-04-05

    Mercaptopropionic acid-capped Mn-doped ZnS quantum dots/ethidium bromide (EB) nanohybrids were constructed for photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for DNA detection. EB could quench the RTP of Mn-doped ZnS QDs by PIET, thereby forming Mn-doped ZnS QDs/EB nanohybrids and storing RTP. Meanwhile, EB could be inserted into DNA and EB could be competitively desorbed from the surface of Mn-doped ZnS QDs by DNA, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this mechanism, a RTP sensor for DNA detection was developed. Under optimal conditions, the detection limit for DNA was 0.045 mg L(-1), the relative standard deviation was 1.7%, and the method linear ranged from 0.2 to 20 mg L(-1). The proposed method was applied to biological fluids, in which satisfactory results were obtained. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Identifying the true oysters (Bivalvia: Ostreidae) with mitochondrial phylogeny and distance-based DNA barcoding.

    Science.gov (United States)

    Liu, Jun; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong

    2011-09-01

    Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis. © 2011 Blackwell Publishing Ltd.

  15. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  16. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  17. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. AFFINITY BIOSENSOR BASED ON SCREEN-PRINTED ELECTRODE MODIFIED WITH DNA FOR GENOTOXIC COMPOUNDS DETECTION

    Directory of Open Access Journals (Sweden)

    Bambang Kuswandi

    2010-06-01

    Full Text Available An electrochemical method for the detection of the genotoxic compounds using a DNA-modified electrode was developed. This electrode was successfully used for the electrochemical detection of genotoxic compounds in water samples. The electrochemical results clearly demonstrated that, the development is related to the molecular interaction between the surface-linked DNA obtained from calf thymus and the target compounds, such as pollutants, in order to develop a simple device for rapid screening of genotoxic compounds in environmental samples. The detection of such compounds was measured by their effect on the oxidation signal of the guanine peak of the DNA immobilised on the surface of carbon based Screen-Printed Electrode (SPE in disposable mode, and monitored by square-wave voltametric analysis. The DNA biosensor is able to detect known intercalating and groove-binding genotoxic compounds such as Dioxin, Bisphenol A, PCBs, and Phtalates. Application to real water samples is discussed and reported.   Keywords: electrochemical, screen-printed electrode, DNA biosensor, genotoxic compounds

  19. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    Science.gov (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. A DNA biosensor based on the electrocatalytic oxidation of amine by a threading intercalator

    International Nuclear Information System (INIS)

    Gao Zhiqiang; Tansil, Natalia

    2009-01-01

    An electrochemical biosensor for the detection of DNA based a peptide nucleic acid (PNA) capture probe (CP) modified indium tin oxide electrode (ITO) is described in this report. After hybridization, a threading intercalator, N,N'-bis[(3-propyl)-imidazole]-1,4,5,8-naphthalene diimide (PIND) imidazole complexed with Ru(bpy) 2 Cl (PIND-Ru, bpy = 2,2'-bipyridine), was introduced to the biosensor. PIND-Ru selectively intercalated to double-stranded DNA (ds-DNA) and became immobilized on the biosensor surface. Voltammetric tests showed highly stable and reversible electrochemical oxidation/reduction processes and the peak currents can directly be utilized for DNA quantification. When the tests were conducted in an amine-containing medium, Tris-HCl buffer for example, a remarkable improvement in the voltammetric response and noticeable enhancements of voltammetric and amperometric sensitivities were observed due to the electrocatalytic activity of the [Ru(bpy) 2 Cl] redox moieties. Electrocatalytic current was observed when as little as 3.0 attomoles of DNA was present in the sample solution

  1. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  2. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  3. Ionically conducting Er3+-doped DNA-based biomembranes for electrochromic devices

    International Nuclear Information System (INIS)

    Leones, R.; Fernandes, M.; Sentanin, F.; Cesarino, I.; Lima, J.F.; Zea Bermudez, V. de; Pawlicka, A.; Magon, C.J.; Donoso, J.P.; Silva, M.M.

    2014-01-01

    Biopolymer-based membranes have particular interest due to their biocompatibility, Biodegradability, easy extraction from natural resources and low cost. The incorporation of Er 3+ ions into natural macromolecule hosts with the purpose of producing highly efficient emitting phosphors is of widespread interest in materials science, due to their important roles in display devices. Thus, biomembranes may be viewed as innovative materials for the area of optics. This paper describes studies of luminescent material DNA-based membranes doped with erbium triflate and demonstrates that their potential technological applications may be expanded to electrochromic devices. The sample that exhibits the highest ionic conductivity is DNA 10 Er, (1.17 × 10 −5 and 7.76 × 10 −4 S.cm −1 at 30 and 100 °C, respectively). DSC, XRD and POM showed that the inclusion of the guest salt into DNA does not change significantly its amorphous nature. The overall redox stability was ca. 2.0 V indicating that these materials have an acceptable stability window for applications in solid state electrochemical devices. The EPR analysis suggested that the Er 3+ ions are distributed in various environments. A small ECD comprising a Er 3+ -doped DNA-based membrane was assembled and tested by cyclic voltammetry and chronoamperometry. These electrochemical analyses revealed a pale blue color to transparent color change and a decrease of the charge density from -4.0 to -1.2 mC.cm −2 during 4000 color/bleaching cycles

  4. ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.

    Science.gov (United States)

    Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia

    2017-12-01

    Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.

  5. DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

    Science.gov (United States)

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

    2014-10-15

    An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

    Science.gov (United States)

    Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

    2017-10-15

    Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. DNA bases assembled on the Au(110)/electrolyte interface: A combined experimental and theoretical study

    DEFF Research Database (Denmark)

    Salvatore, Princia; Nazmutdinov, Renat R.; Ulstrup, Jens

    2015-01-01

    Among the low-index single-crystal gold surfaces, the Au(110) surface is the most active toward molecular adsorption and the one with fewest electrochemical adsorption data reported. Cyclic voltammetry (CV), electrochemically controlled scanning tunneling microscopy (EC-STM), and density functional......, accompanied by a pair of strong voltammetry peaks in the double-layer region in acid solutions. Adsorption of the DNA bases gives featureless voltammograms with lower double-layer capacitance, suggesting that all the bases are chemisorbed on the Au(110) surface. Further investigation of the surface structures...... of the adlayers of the four DNA bases by EC-STM disclosed lifting of the Au(110) reconstruction, specific molecular packing in dense monolayers, and pH dependence of the A and G adsorption. DFT computations based on a cluster model for the Au(110) surface were performed to investigate the adsorption energy...

  8. Molecular diversification of Trichuris spp. from Sigmodontinae (Cricetidae) rodents from Argentina based on mitochondrial DNA sequences.

    Science.gov (United States)

    Callejón, Rocío; Robles, María Del Rosario; Panei, Carlos Javier; Cutillas, Cristina

    2016-08-01

    A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob). The taxa consisted of nine populations of whipworm from five species of Sigmodontinae rodents from Argentina. Bayesian Inference, Maximum Parsimony, and Maximum Likelihood methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data and the combined mitochondrial and nuclear dataset. Phylogenetic results based on cox1 and cob mitochondrial DNA (mtDNA) revealed three clades strongly resolved corresponding to three different species (Trichuris navonae, Trichuris bainae, and Trichuris pardinasi) showing phylogeographic variation, but relationships among Trichuris species were poorly resolved. Phylogenetic reconstruction based on concatenated sequences had greater phylogenetic resolution for delimiting species and populations intra-specific of Trichuris than those based on partitioned genes. Thus, populations of T. bainae and T. pardinasi could be affected by geographical factors and co-divergence parasite-host.

  9. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  10. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  11. Integrating DNA-based data into bioassessments improves our understanding of species distributions and species habitat relationships

    Science.gov (United States)

    The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or inv...

  12. Track structure based modelling of light ion radiation effects on nuclear and mitochondrial DNA

    Science.gov (United States)

    Schmitt, Elke; Ottolenghi, Andrea; Dingfelder, Michael; Friedland, Werner; Kundrat, Pavel; Baiocco, Giorgio

    2016-07-01

    Space radiation risk assessment is of great importance for manned spaceflights in order to estimate risks and to develop counter-measures to reduce them. Biophysical simulations with PARTRAC can help greatly to improve the understanding of initial biological response to ionizing radiation. Results from modelling radiation quality dependent DNA damage and repair mechanisms up to chromosomal aberrations (e.g. dicentrics) can be used to predict radiation effects depending on the kind of mixed radiation field exposure. Especially dicentric yields can serve as a biomarker for an increased risk due to radiation and hence as an indicator for the effectiveness of the used shielding. PARTRAC [1] is a multi-scale biophysical research MC code for track structure based initial DNA damage and damage response modelling. It integrates physics, radiochemistry, detailed nuclear DNA structure and molecular biology of DNA repair by NHEJ-pathway to assess radiation effects on cellular level [2]. Ongoing experiments with quasi-homogeneously distributed compared to sub-micrometre focused bunches of protons, lithium and carbon ions allow a separation of effects due to DNA damage complexity on nanometre scale from damage clustering on (sub-) micrometre scale [3, 4]. These data provide an unprecedented benchmark for the DNA damage response model in PARTRAC and help understand the mechanisms leading to cell killing and chromosomal aberrations (e.g. dicentrics) induction. A large part of space radiation is due to a mixed ion field of high energy protons and few heavier ions that can be only partly absorbed by the shielding. Radiation damage induced by low-energy ions significantly contributes to the high relative biological efficiency (RBE) of ion beams around Bragg peak regions. For slow light ions the physical cross section data basis in PARTRAC has been extended to investigate radiation quality effects in the Bragg peak region [5]. The resulting range and LET values agree with ICRU data

  13. Application of capillary gas chromatography-mass spectrometry to chemical characterization of radiation-induced base damage of DNA: implications for assessing DNA repair processes

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    The application of capillary gas chromatography-mass spectrometry (GC-MS) to the chemical characterization of radiation-induced base products of calf thymus DNA is presented. Samples of calf thymus DNA irradiated in N 2 O-saturated aqueous solution were hydrolyzed with HCOOH, trimethylsilylated, and subjected to GC-MS analysis using a fused-silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC properties and easily interpretable mass spectra; an intense molecular ion (M+.) and a characteristic (M-CH 3 )+ ion were observed. The complementary use of t-butyldimethylsilyl derivatives was also demonstrated. These derivatives provided an intense characteristic (M-57)+ ion, which appeared as either the base peak or the second most intense ion in the spectra. All mass spectra obtained are discussed

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.

    Science.gov (United States)

    Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra

    2016-03-01

    Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.

  16. Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.

    Science.gov (United States)

    Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan

    2017-09-26

    Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.

  17. Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.

    Science.gov (United States)

    Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine

    2012-02-01

    Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.

  18. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  19. Hydrogen peroxide biosensor based on DNA-Hb modified gold electrode

    International Nuclear Information System (INIS)

    Kafi, A.K.M.; Fan Yin; Shin, Hoon-Kyu; Kwon, Young-Soo

    2006-01-01

    A hydrogen peroxide (H 2 O 2 ) biosensor based on DNA-hemoglobin (Hb) modified electrode is described in this paper. The sensor was designed by DNA and hemoglobin dropletting onto gold electrode surface layer by layer. The sensor based on the direct electron transfer of iron of hemoglobin showed a well electrocatalytic response to the reduction of the H 2 O 2 . This sensor offered an excellent electrochemical response for H 2 O 2 concentration below micromole level with high sensitivity and selectivity and short response time. Experimental conditions influencing the biosensor performance such as, pH, potential were optimized and assessed. The levels of the RSD's ( 2 O 2 was observed from 10 to 120 μM with the detection limit of 0.4 μM (based on the S/N = 3)

  20. Label-free detection of DNA hybridization using transistors based on CVD grown graphene.

    Science.gov (United States)

    Chen, Tzu-Yin; Loan, Phan Thi Kim; Hsu, Chang-Lung; Lee, Yi-Hsien; Tse-Wei Wang, Jacob; Wei, Kung-Hwa; Lin, Cheng-Te; Li, Lain-Jong

    2013-03-15

    The high transconductance and low noise of graphene-based field-effect transistors based on large-area monolayer graphene produced by chemical vapor deposition are used for label-free electrical detection of DNA hybridization. The gate materials, buffer concentration and surface condition of graphene have been optimized to achieve the DNA detection sensitivity as low as 1 pM (10(-12) M), which is more sensitive than the existing report based on few-layer graphene. The graphene films obtained using conventional PMMA-assisted transfer technique exhibits PMMA residues, which degrade the sensing performance of graphene. We have demonstrated that the sensing performance of the graphene samples prepared by gold-transfer is largely enhanced (by 125%). Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Profiling the miRNAs for Early Cancer Detection using DNA-based Logic Gates

    Directory of Open Access Journals (Sweden)

    Tahereh Yahya

    2017-12-01

    Full Text Available Abstract Background: DNA-based computing is an emerging research aspect that enables the in-vivo computation and decision making with significant correctness. Recent papers show that the expression level of miRNAs are related to the progress status of some diseases such as cancers and DNA computing is introduced as a low cost and concise technique for detection of these biomarkers. In this paper, DNA-based logic gates are implemented in the laboratory to detect the level of miR-21 as the biomarker of cancer. Materials and Methods: At the first, required strands for designing DNA gates are synthesized. Then, double stranded gate is generated in laboratory using a temperature gradient that followed by electrophoresis process. This double strand is the computation engine for detecting the miR-21 biomarker. miR-21 is as input in designed gate. At the end, the expression level of miR-21 is identified by measuring the generated fluorescent. Results: at the first stage, the proposed DNA-based logic gate is evaluated by using the synthesized input strands and then it is experimented on a tumor tissue. Experimental results on synthesized strands show that its detection quality/correctness is 2.5x better than conventional methods. Conclusion: Experimental results on the tumor tissues are successful and are matched with those are extracted from real time PCR results. Also, the results show that this method is significantly more suitable than real time PCR in view of time and cost.

  2. A discriminatory function for prediction of protein-DNA interactions based on alpha shape modeling.

    Science.gov (United States)

    Zhou, Weiqiang; Yan, Hong

    2010-10-15

    Protein-DNA interaction has significant importance in many biological processes. However, the underlying principle of the molecular recognition process is still largely unknown. As more high-resolution 3D structures of protein-DNA complex are becoming available, the surface characteristics of the complex become an important research topic. In our work, we apply an alpha shape model to represent the surface structure of the protein-DNA complex and developed an interface-atom curvature-dependent conditional probability discriminatory function for the prediction of protein-DNA interaction. The interface-atom curvature-dependent formalism captures atomic interaction details better than the atomic distance-based method. The proposed method provides good performance in discriminating the native structures from the docking decoy sets, and outperforms the distance-dependent formalism in terms of the z-score. Computer experiment results show that the curvature-dependent formalism with the optimal parameters can achieve a native z-score of -8.17 in discriminating the native structure from the highest surface-complementarity scored decoy set and a native z-score of -7.38 in discriminating the native structure from the lowest RMSD decoy set. The interface-atom curvature-dependent formalism can also be used to predict apo version of DNA-binding proteins. These results suggest that the interface-atom curvature-dependent formalism has a good prediction capability for protein-DNA interactions. The code and data sets are available for download on http://www.hy8.com/bioinformatics.htm kenandzhou@hotmail.com.

  3. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  4. Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases

    International Nuclear Information System (INIS)

    Ahmed, Towfiq; Haraldsen, Jason T; Balatsky, Alexander V; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan

    2014-01-01

    Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology. (paper)

  5. Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases

    Science.gov (United States)

    Ahmed, Towfiq; Haraldsen, Jason T.; Rehr, John J.; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V.

    2014-03-01

    Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.

  6. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  7. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  8. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    International Nuclear Information System (INIS)

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong

    2013-01-01

    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  9. Implementation options for DNA-based identification into ecological status assessment under the European Water Framework Directive.

    Science.gov (United States)

    Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn

    2018-07-01

    Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification

  10. Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

    Science.gov (United States)

    Lam, Kathy N; Martens, Eric C; Charles, Trevor C

    2018-01-01

    Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be

  11. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production.

    Science.gov (United States)

    Wallenhammar, Ann-Charlotte; Gunnarson, Albin; Hansson, Fredrik; Jonsson, Anders

    2016-04-22

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil(-1)) in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g(-1) soil) in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20%) showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g(-1) soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g(-1) soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of prevention of

  12. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    Directory of Open Access Journals (Sweden)

    Ann-Charlotte Wallenhammar

    2016-04-01

    Full Text Available Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil−1 in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g−1 soil in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20% showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g−1 soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g−1 soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of

  13. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  14. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  15. DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects

    Energy Technology Data Exchange (ETDEWEB)

    Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)

    2014-02-01

    The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular

  16. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  17. DNA-Based Nanobiosensors as an Emerging Platform for Detection of Disease

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2015-06-01

    Full Text Available Detection of disease at an early stage is one of the biggest challenges in medicine. Different disciplines of science are working together in this regard. The goal of nanodiagnostics is to provide more accurate tools for earlier diagnosis, to reduce cost and to simplify healthcare delivery of effective and personalized medicine, especially with regard to chronic diseases (e.g., diabetes and cardiovascular diseases that have high healthcare costs. Up-to-date results suggest that DNA-based nanobiosensors could be used effectively to provide simple, fast, cost-effective, sensitive and specific detection of some genetic, cancer, and infectious diseases. In addition, they could potentially be used as a platform to detect immunodeficiency, and neurological and other diseases. This review examines different types of DNA-based nanobiosensors, the basic principles upon which they are based and their advantages and potential in diagnosis of acute and chronic diseases. We discuss recent trends and applications of new strategies for DNA-based nanobiosensors, and emphasize the challenges in translating basic research to the clinical laboratory.

  18. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    Science.gov (United States)

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  19. Increased humoral immunity by DNA vaccination using an alpha-tocopherol-based adjuvant

    DEFF Research Database (Denmark)

    Karlsson, Ingrid; Borggren, Marie; Nielsen, Jens

    2017-01-01

    approaches. We tested whether the emulsion-based and alpha-tocopherol containing adjuvant Diluvac Forte® has the ability to enhance the immunogenicity of a naked DNA vaccine (i.e., plasmid DNA). As a model vaccine, we used plasmids encoding both a surface-exposed viral glycoprotein (hemagglutinin......) and an internal non-glycosylated nucleoprotein in the Th1/Th2 balanced CB6F1 mouse model. The naked DNA (50 µg) was premixed at a 1:1 volume/volume ratio with Diluvac Forte®, an emulsion containing different concentrations of alpha-tocopherol, the emulsion alone or endotoxin-free phosphate-buffered saline (PBS......). The animals received two intracutaneous immunizations spaced 3 weeks apart. When combined with Diluvac Forte® or the emulsion containing alpha-tocopherol, the DNA vaccine induced a more potent and balanced immunoglobulin G (IgG)1 and IgG2c response, and both IgG subclass responses were significantly enhanced...

  20. The detection of melamine base on a turn-on fluorescence of DNA-Ag nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Peisi [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong (China); Zhan, Yuanjin; Wu, Mei; Guo, Longhua; Lin, Zhenyu [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); Qiu, Bin, E-mail: summer328cn@163.com [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); Chen, Guonan [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); Cai, Zongwei [State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong (China)

    2017-06-15

    A label-free, ultra-sensitive and turn-on fluorescence method to detect melamine has been developed. The strategy uses the DNA-Ag nanoclusters (DNA-AgNCs) as the fluorescence probe. The fluorescence of DNA-AgNCs can be quenched in presence of Hg{sup 2+}. However, When Hg{sup 2+} and melamine were reacted for 15 min at 1000 rmp then introduced into DNA-AgNCs solution, a strong fluorescence recovery could be found. Based on this methodology, the changing fluorescent intensity has a linear relationship with melamine in the range of 0.2 μM to 4 μM (R{sup 2}=0.997). The detection limit down to 0.1 μM was obtained, which is 200 times lower than the melamine safety limit of 20 μM estimated by the US Food and Drug Administration. In addition, we had been successfully applied this method to detect melamine in milk powder and raw milk.

  1. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  2. DNA tetrahedral scaffolds-based platform for the construction of electrochemiluminescence biosensor.

    Science.gov (United States)

    Feng, Qiu-Mei; Zhou, Zhen; Li, Mei-Xing; Zhao, Wei; Xu, Jing-Juan; Chen, Hong-Yuan

    2017-04-15

    Proximal metallic nanoparticles (NPs) could quench the electrochemiluminescence (ECL) emission of semiconductor quantum dots (QDs) due to Förster energy transfer (FRET), but at a certain distance, the coupling of light-emission with surface plasmon resonance (SPR) result in enhanced ECL. Thus, the modification strategies and distances control between QDs and metallic NPs are critical for the ECL intensity of QDs. In this strategy, a SPR enhanced ECL sensor based on DNA tetrahedral scaffolds modified platform was reported for the detection of telomerase activity. Due to the rigid three-dimensional structure, DNA tetrahedral scaffolds grafting on the electrode surface could accurately modulate the distance between CdS QDs and luminol labelled gold nanoparticles (L-Au NPs), meanwhile provide an enhanced spatial dimension and accessibility for the assembly of multiple L-Au NPs. The ECL intensities of both CdS QDs (-1.25V vs. SCE) and luminol (+0.33V vs. SCE) gradually increased along with the formation of multiple L-Au NPs at the vertex of DNA tetrahedral scaffolds induced by telomerase, bringing in a dual-potential ECL analysis. The proposed method showed high sensitivity for the identification of telomerase and was successfully applied for the differentiation of cancer cells from normal cells. This work suggests that DNA tetrahedral scaffolds could serve as an excellent choice for the construction of SPR-ECL system. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Detection of tyrosine hydroxylase in dopaminergic neuron cell using gold nanoparticles-based barcode DNA.

    Science.gov (United States)

    An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo

    2013-04-01

    Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.

  4. Nuclear DNA content and base composition in 28 taxa of Musa.

    Science.gov (United States)

    Kamaté, K; Brown, S; Durand, P; Bureau, J M; De Nay, D; Trinh, T H

    2001-08-01

    The nuclear DNA content of 28 taxa of Musa was assessed by flow cytometry, using line PxPC6 of Petunia hybrida as an internal standard. The 2C DNA value of Musa balbisiana (BB genome) was 1.16 pg, whereas Musa acuminata (AA genome) had an average 2C DNA value of 1.27 pg, with a difference of 11% between its subspecies. The two haploid (IC) genomes, A and B, comprising most of the edible bananas, are therefore of similar size, 0.63 pg (610 million bp) and 0.58 pg (560 million bp), respectively. The genome of diploid Musa is thus threefold that of Arabidopsis thaliana. The genome sizes in a set of triploid Musa cultivars or clones were quite different, with 2C DNA values ranging from 1.61 to 2.23 pg. Likewise, the genome sizes of tetraploid cultivars ranged from 1.94 to 2.37 pg (2C). Apparently, tetraploids (for instance, accession I.C.2) can have a genome size that falls within the range of triploid genome sizes, and vice versa (as in the case of accession Simili Radjah). The 2C values estimated for organs such as leaf, leaf sheath, rhizome, and flower were consistent, whereas root material gave atypical results, owing to browning. The genomic base composition of these Musa taxa had a median value of 40.8% GC (SD = 0.43%).

  5. A Novel Image Encryption Algorithm Based on a Fractional-Order Hyperchaotic System and DNA Computing

    Directory of Open Access Journals (Sweden)

    Taiyong Li

    2017-01-01

    Full Text Available In the era of the Internet, image encryption plays an important role in information security. Chaotic systems and DNA operations have been proven to be powerful for image encryption. To further enhance the security of image, in this paper, we propose a novel algorithm that combines the fractional-order hyperchaotic Lorenz system and DNA computing (FOHCLDNA for image encryption. Specifically, the algorithm consists of four parts: firstly, we use a fractional-order hyperchaotic Lorenz system to generate a pseudorandom sequence that will be utilized during the whole encryption process; secondly, a simple but effective diffusion scheme is performed to spread the little change in one pixel to all the other pixels; thirdly, the plain image is encoded by DNA rules and corresponding DNA operations are performed; finally, global permutation and 2D and 3D permutation are performed on pixels, bits, and acid bases. The extensive experimental results on eight publicly available testing images demonstrate that the encryption algorithm can achieve state-of-the-art performance in terms of security and robustness when compared with some existing methods, showing that the FOHCLDNA is promising for image encryption.

  6. Mung bean nuclease treatment increases capture specificity of microdroplet-PCR based targeted DNA enrichment.

    Directory of Open Access Journals (Sweden)

    Zhenming Yu

    Full Text Available Targeted DNA enrichment coupled with next generation sequencing has been increasingly used for interrogation of select sub-genomic regions at high depth of coverage in a cost effective manner. Specificity measured by on-target efficiency is a key performance metric for target enrichment. Non-specific capture leads to off-target reads, resulting in waste of sequencing throughput on irrelevant regions. Microdroplet-PCR allows simultaneous amplification of up to thousands of regions in the genome and is among the most commonly used strategies for target enrichment. Here we show that carryover of single-stranded template genomic DNA from microdroplet-PCR constitutes a major contributing factor for off-target reads in the resultant libraries. Moreover, treatment of microdroplet-PCR enrichment products with a nuclease specific to single-stranded DNA alleviates off-target load and improves enrichment specificity. We propose that nuclease treatment of enrichment products should be incorporated in the workflow of targeted sequencing using microdroplet-PCR for target capture. These findings may have a broad impact on other PCR based applications for which removal of template DNA is beneficial.

  7. Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

    Energy Technology Data Exchange (ETDEWEB)

    Khadsai, Sudarat; Rutnakornpituk, Boonjira [Naresuan University, Department of Chemistry and Center of Excellence in Biomaterials, Faculty of Science (Thailand); Vilaivan, Tirayut [Chulalongkorn University, Department of Chemistry, Organic Synthesis Research Unit, Faculty of Science (Thailand); Nakkuntod, Maliwan [Naresuan University, Department of Biology, Faculty of Science (Thailand); Rutnakornpituk, Metha, E-mail: methar@nu.ac.th [Naresuan University, Department of Chemistry and Center of Excellence in Biomaterials, Faculty of Science (Thailand)

    2016-09-15

    Magnetite nanoparticles (MNPs) were surface modified with anionic poly(N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size (D{sub h}) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV–visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.Graphical Abstract.

  8. Heterogeneity, histological features and DNA ploidy in oral carcinoma by image-based analysis.

    Science.gov (United States)

    Diwakar, N; Sperandio, M; Sherriff, M; Brown, A; Odell, E W

    2005-04-01

    Oral squamous carcinomas appear heterogeneous on DNA ploidy analysis. However, this may be partly a result of sample dilution or the detection limit of techniques. The aim of this study was to determine whether oral squamous carcinomas are heterogeneous for ploidy status using image-based ploidy analysis and to determine whether ploidy status correlates with histological parameters. Multiple samples from 42 oral squamous carcinomas were analysed for DNA ploidy using an image-based system and scored for histological parameters. 22 were uniformly aneuploid, 1 uniformly tetraploid and 3 uniformly diploid. 16 appeared heterogeneous but only 8 appeared to be genuinely heterogeneous when minor ploidy histogram peaks were taken into account. Ploidy was closely related to nuclear pleomorphism but not differentiation. Sample variation, detection limits and diagnostic criteria account for much of the ploidy heterogeneity observed. Confident diagnosis of diploid status in an oral squamous cell carcinoma requires a minimum of 5 samples.

  9. Nutrigenetics and personalized nutrition: are we ready for DNA-based dietary advice?

    Science.gov (United States)

    Grimaldi, Keith A

    2014-05-01

    Common genetic variation affects individual nutrient requirements and the use of DNA-based dietary advice, derived from nutrigenetics, has been growing. The growth is about to accelerate as the cost of genotyping continues to fall and research results from major nutrigenetics projects are published. There is still some skepticism; some barriers remain including some commercial tests, which make exaggerated, incorrect claims. There is a need for more public resources dedicated to unbiased, objective review and dissemination of nutrigenetics information; however, nutrigenetics evidence should be assessed in the context of standard nutritional evidence and should not require higher standards. This article argues that we are ready for some DNA-based dietary advice in general nutrition and it can be beneficial. Examples of the scientific validity and health utility of gene-diet interactions will be given and the development of guidelines for assessment and validation of benefits will be discussed.

  10. Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

    International Nuclear Information System (INIS)

    Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha

    2016-01-01

    Magnetite nanoparticles (MNPs) were surface modified with anionic poly(N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size (D h ) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV–visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.Graphical Abstract

  11. A collaborative EDNAP exercise on SNaPshot™-based mtDNA control region typing

    DEFF Research Database (Denmark)

    Weiler, NEC; Baca, K; Ballard, D

    2017-01-01

    A collaborative European DNA Profiling (EDNAP) Group exercise was undertaken to assess the performance of an earlier described SNaPshot™-based screening assay (denoted mini-mtSNaPshot) (Weiler et al., 2016) [1] that targets 18 single nucleotide polymorphism (SNP) positions in the mitochondrial (m...... and derived from a subset of the participants, indicating a need for training and guidelines regarding mini-mtSNaPshot data interpretation....

  12. How are base excision DNA repair pathways deployed in vivo? [version 1; referees: 4 approved

    Directory of Open Access Journals (Sweden)

    Upasna Thapar

    2017-03-01

    Full Text Available Since the discovery of the base excision repair (BER system for DNA more than 40 years ago, new branches of the pathway have been revealed at the biochemical level by in vitro studies. Largely for technical reasons, however, the confirmation of these subpathways in vivo has been elusive. We review methods that have been used to explore BER in mammalian cells, indicate where there are important knowledge gaps to fill, and suggest a way to address them.

  13. Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection

    OpenAIRE

    Lau, Han Yih; Botella, Jose R.

    2017-01-01

    Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care di...

  14. Recent advance in DNA-based traceability and authentication of livestock meat PDO and PGI products.

    Science.gov (United States)

    Nicoloso, Letizia; Crepaldi, Paola; Mazza, Raffaele; Ajmone-Marsan, Paolo; Negrini, Riccardo

    2013-04-01

    This review updates the available molecular techniques and technologies and discusses how they can be used for traceability, food control and enforcement activities. The review also provides examples on how molecular techniques succeeded to trace back unknowns to their breeds of origin, to fingerprint single individuals and to generate evidence in court cases. The examples demonstrate the potential of the DNA based traceability techniques and explore possibilities for translating the next generation genomics tools into a food and feed control and enforcement framework.

  15. Alteration of gene conversion patterns in Sordaria fimicola by supplementation with DNA bases.

    Science.gov (United States)

    Kitani, Y; Olive, L S

    1970-08-01

    Supplementation with DNA bases in crosses of Sordaria fimicola heterozygous for spore color markers (g(1), h(2)) within the gray-spore (g) locus has been found to cause significant alterations in patterns of gene conversion at the two mutant sites. Each base had its own characteristic effect in altering the conversion pattern, and responses of the two mutant sites to the four bases were different in several ways. Also, the responses of the two involved chromatids of the meiotic bivalent were different.

  16. A probe-based quantitative PCR assay for detecting Tetracapsuloides bryosalmonae in fish tissue and environmental DNA water samples

    Science.gov (United States)

    Hutchins, Patrick; Sepulveda, Adam; Martin, Renee; Hopper, Lacey

    2017-01-01

    A probe-based quantitative real-time PCR assay was developed to detect Tetracapsuloides bryosalmonae, which causes proliferative kidney disease in salmonid fish, in kidney tissue and environmental DNA (eDNA) water samples. The limits of detection and quantification were 7 and 100 DNA copies for calibration standards and T. bryosalmonae was reliably detected down to 100 copies in tissue and eDNA samples. The assay presented here is a highly sensitive and quantitative tool for detecting T. bryosalmonae with potential applications for tissue diagnostics and environmental detection.

  17. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  18. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  19. A Constant Rate of Spontaneous Mutation in DNA-Based Microbes

    Science.gov (United States)

    Drake, John W.

    1991-08-01

    In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.

  20. Dihydropyridines decrease X-ray-induced DNA base damage in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Wojewodzka, M., E-mail: marylaw@ichtj.waw.pl [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Gradzka, I.; Buraczewska, I.; Brzoska, K.; Sochanowicz, B. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Goncharova, R.; Kuzhir, T. [Institute of Genetics and Cytology, Belarussian National Academy of Sciences, Minsk (Belarus); Szumiel, I. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland)

    2009-12-01

    Compounds with the structural motif of 1,4-dihydropyridine display a broad spectrum of biological activities, often defined as bioprotective. Among them are L-type calcium channel blockers, however, also derivatives which do not block calcium channels exert various effects at the cellular and organismal levels. We examined the effect of sodium 3,5-bis-ethoxycarbonyl-2,6-dimethyl-1,4-dihydropyridine-4-carboxylate (denoted here as DHP and previously also as AV-153) on X-ray-induced DNA damage and mutation frequency at the HGPRT (hypoxanthine-guanine phosphoribosyl transferase) locus in Chinese hamster ovary CHO-K1 cells. Using formamido-pyrimidine glycosylase (FPG) comet assay, we found that 1-h DHP (10 nM) treatment before X-irradiation considerably reduced the initial level of FPG-recognized DNA base damage, which was consistent with decreased 8-oxo-7,8-dihydro-2'-deoxyguanosine content and mutation frequency lowered by about 40%. No effect on single strand break rejoining or on cell survival was observed. Similar base damage-protective effect was observed for two calcium channel blockers: nifedipine (structurally similar to DHP) or verapamil (structurally unrelated). So far, the specificity of the DHP-caused reduction in DNA damage - practically limited to base damage - has no satisfactory explanation.

  1. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  2. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  3. DNA damage due to perfluorooctane sulfonate based on nano-gold embedded in nano-porous poly-pyrrole film

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Liping, E-mail: lipinglu@bjut.edu.cn; Xu, Laihui; Kang, Tianfang; Cheng, Shuiyuan

    2013-11-01

    DNA damage induced from perfluorooctane sulfonate (PFOS) was further developed on a nano-porous bionic interface. The interface was formed by assembling DNA on nano-gold particles which were embedded in a nano-porous overoxidized polypyrrole film (OPPy). Atomic force microscopy, scanning electron microscope and electrochemical investigations indicate that OPPy can be treated to form nano-pore structures. DNA damage due to PFOS was proved using electrochemistry and X-ray photoelectron spectroscopy (XPS) and was investigated by detecting differential pulse voltammetry (DPV) response of methylene blue (MB) which was used as electro-active indicator in the system. The current of MB attenuates obviously after incubation of DNA in PFOS. Moreover, electrochemical impedance spectroscopy (EIS) demonstrates that PFOS weakens DNA charge transport. The tentative binding ratio of PFOS: DNA base pair was obtained by analyzing XPS data of this system.

  4. Protein-based polymers that bond to DNA : design of virus-like particles and supramolecular nanostructures

    NARCIS (Netherlands)

    Hernandez Garcia, A.

    2014-01-01

    In this thesis it is demonstrated that it is possible to use Protein-based Polymers (PbPs) as synthetic binders of DNA (or any other negatively charged polyelectrolyte). The PbPs co-assemble with their DNA templates to form highly organized virus-like particles and supramolecular structures. A

  5. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  6. Highly sensitive "signal-on" electrochemiluminescent biosensor for the detection of DNA based on dual quenching and strand displacement reaction.

    Science.gov (United States)

    Lou, Jing; Wang, Zhaoyin; Wang, Xiao; Bao, Jianchun; Tu, Wenwen; Dai, Zhihui

    2015-10-07

    A "signal-on" electrochemiluminescent DNA biosensing platform was proposed based on the dual quenching and strand displacement reaction. This novel "signal-on" detection strategy revealed its sensitivity in achieving a detection limit of 2.4 aM and its selectivity in distinguishing single nucleotide polymorphism of target DNA.

  7. A sensitive DNA biosensor based on a facile sulfamide coupling reaction for capture probe immobilization

    International Nuclear Information System (INIS)

    Wang, Qingxiang; Ding, Yingtao; Gao, Feng; Jiang, Shulian; Zhang, Bin; Ni, Jiancong; Gao, Fei

    2013-01-01

    Graphical abstract: A novel DNA biosensor was fabricated through a facile sulfamide coupling reaction between probe DNA and the sulfonic dye of 1-amino-2-naphthol-4-sulfonic acid that electrodeposited on a glassy carbon electrode. -- Highlights: •A versatile sulfonic dye of ANS was electrodeposited on a GCE. •A DNA biosensor was fabricated based on a facile sulfamide coupling reaction. •High probe DNA density of 3.18 × 10 13 strands cm −2 was determined. •A wide linear range and a low detection limit were obtained. -- Abstract: A novel DNA biosensor was fabricated through a facile sulfamide coupling reaction. First, the versatile sulfonic dye molecule of 1-amino-2-naphthol-4-sulfonate (AN-SO 3 − ) was electrodeposited on the surface of a glassy carbon electrode (GCE) to form a steady and ordered AN-SO 3 − layer. Then the amino-terminated capture probe was covalently grafted to the surface of SO 3 − -AN deposited GCE through the sulfamide coupling reaction between the amino groups in the probe DNA and the sulfonic groups in the AN-SO 3 − . The step-by-step modification process was characterized by electrochemistry and attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy. Using Ru(NH 3 ) 6 3+ as probe, the probe density and the hybridization efficiency of the biosensor were determined to be 3.18 × 10 13 strands cm −2 and 86.5%, respectively. The hybridization performance of the biosensor was examined by differential pulse voltammetry using Co(phen) 3 3+/2+ (phen = 1,10-phenanthroline) as the indicator. The selectivity experiments showed that the biosensor presented distinguishable response after hybridization with the three-base mismatched, non-complementary and complementary sequences. Under the optimal conditions, the oxidation peak currents of Co(phen) 3 3+/2+ increased linearly with the logarithm values of the concentration of the complementary sequences in the range from 1.0 × 10 −13 M to 1.0 × 10 −8 M with

  8. A simple approach for producing highly efficient DNA carriers with reduced toxicity based on modified polyallylamine

    Energy Technology Data Exchange (ETDEWEB)

    Oskuee, Reza Kazemi [Neurogenic Inflammation Research Center, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Department of Medical Biotechnology, School of Medicine, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Dosti, Fatemeh [School of Pharmacy, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Gholami, Leila [Targeted Drug Delivery Research Center, School of Medicine, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Malaekeh-Nikouei, Bizhan, E-mail: malaekehb@mums.ac.ir [Nanotechnology Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of)

    2015-04-01

    Nowadays gene delivery is a topic in many research studies. Non-viral vectors have many advantages over viral vectors in terms of safety, immunogenicity and gene carrying capacity but they suffer from low transfection efficiency and high toxicity. In this study, polyallylamine (PAA), the cationic polymer, has been modified with hydrophobic branches to increase the transfection efficiency of the polymer. Polyallylamine with molecular weights of 15 and 65 kDa was selected and grafted with butyl, hexyl and decyl acrylate at percentages of 10, 30 and 50. The ability of the modified polymer to condense DNA was examined by ethidium bromide test. The complex of modified polymer and DNA (polyplex) was characterized for size, zeta potential, transfection efficiency and cytotoxicity in Neuro2A cell lines. The results of ethidium bromide test showed that grafting of PAA decreased its ability for DNA condensation but vectors could still condense DNA at moderate and high carrier to DNA ratios. Most of polyplexes had particle size between 150 and 250 nm. The prepared vectors mainly showed positive zeta potential but carriers composed of PAA with high percentage of grafting had negative zeta potential. The best transfection activity was observed in vectors with hexyl acrylate chain. Grafting of polymer reduced its cytotoxicity especially at percentages of 30 and 50. The vectors based of PAA 15 kDa had better transfection efficiency than the vectors made of PAA 65 kDa. In conclusion, results of the present study indicated that grafting PAA 15 kDa with high percentages of hexyl acrylate can help to prepare vectors with better transfection efficiency and less cytotoxicity. - Highlights: • The modified polyallylamine was synthesized as a gene carrier. • Modification of polyallylamine (15 kDa) with high percentages of hexyl acrylate improved transfection activity remarkably. • Grafting of polymer with acrylate derivatives reduced polymer cytotoxicity especially at percentages of

  9. A nonparametric Bayesian approach for clustering bisulfate-based DNA methylation profiles.

    Science.gov (United States)

    Zhang, Lin; Meng, Jia; Liu, Hui; Huang, Yufei

    2012-01-01

    DNA methylation occurs in the context of a CpG dinucleotide. It is an important epigenetic modification, which can be inherited through cell division. The two major types of methylation include hypomethylation and hypermethylation. Unique methylation patterns have been shown to exist in diseases including various types of cancer. DNA methylation analysis promises to become a powerful tool in cancer diagnosis, treatment and prognostication. Large-scale methylation arrays are now available for studying methylation genome-wide. The Illumina methylation platform simultaneously measures cytosine methylation at more than 1500 CpG sites associated with over 800 cancer-related genes. Cluster analysis is often used to identify DNA methylation subgroups for prognosis and diagnosis. However, due to the unique non-Gaussian characteristics, traditional clustering methods may not be appropriate for DNA and methylation data, and the determination of optimal cluster number is still problematic. A Dirichlet process beta mixture model (DPBMM) is proposed that models the DNA methylation expressions as an infinite number of beta mixture distribution. The model allows automatic learning of the relevant parameters such as the cluster mixing proportion, the parameters of beta distribution for each cluster, and especially the number of potential clusters. Since the model is high dimensional and analytically intractable, we proposed a Gibbs sampling "no-gaps" solution for computing the posterior distributions, hence the estimates of the parameters. The proposed algorithm was tested on simulated data as well as methylation data from 55 Glioblastoma multiform (GBM) brain tissue samples. To reduce the computational burden due to the high data dimensionality, a dimension reduction method is adopted. The two GBM clusters yielded by DPBMM are based on data of different number of loci (P-value < 0.1), while hierarchical clustering cannot yield statistically significant clusters.

  10. Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

    Science.gov (United States)

    Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

    2017-06-26

    Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

  11. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  12. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    Science.gov (United States)

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    DEFF Research Database (Denmark)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott

    2014-01-01

    slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I...

  14. Benzofurazane as a New Redox Label for Electrochemical Detection of DNA: Towards Multipotential Redox Coding of DNA Bases

    Czech Academy of Sciences Publication Activity Database

    Balintová, Jana; Plucnara, Medard; Vidláková, Pavlína; Pohl, Radek; Havran, Luděk; Fojta, Miroslav; Hocek, Michal

    2013-01-01

    Roč. 19, č. 38 (2013), s. 12720-12731 ISSN 0947-6539 R&D Projects: GA ČR GBP206/12/G151; GA AV ČR(CZ) IAA400040901 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : DNA polymerase * electrochemistry * nucleoside triphosphates * sequencing * voltammetry Subject RIV: CC - Organic Chemistry Impact factor: 5.696, year: 2013

  15. Development of swine-specific DNA markers for biosensor-based halal authentication.

    Science.gov (United States)

    Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

    2012-06-29

    The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

  16. The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy

    Directory of Open Access Journals (Sweden)

    Suneetha Amara

    2017-03-01

    Full Text Available DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer.

  17. DNA Processing and Reassembly on General Purpose FPGA-based Development Boards

    Directory of Open Access Journals (Sweden)

    SZÁSZ Csaba

    2017-05-01

    Full Text Available The great majority of researchers involved in microelectronics generally agree that many scientific challenges in life sciences have associated with them a powerful computational requirement that must be solved before scientific progress can be made. The current trend in Deoxyribonucleic Acid (DNA computing technologies is to develop special hardware platforms capable to provide the needed processing performance at lower cost. In this endeavor the FPGA-based (Field Programmable Gate Arrays configurations aimed to accelerate genome sequencing and reassembly plays a leading role. This paper emphasizes benefits and advantages using general purpose FPGA-based development boards in DNA reassembly applications beside the special hardware architecture solutions. An original approach is unfolded which outlines the versatility of high performance ready-to-use manufacturer development platforms endowed with powerful hardware resources fully optimized for high speed processing applications. The theoretical arguments are supported via an intuitive implementation example where the designer it is discharged from any hardware development effort and completely assisted in exclusive concentration only on software design issues providing greatly reduced application development cycles. The experiments prove that such boards available on the market are suitable to fulfill in all a wide range of DNA sequencing and reassembly applications.

  18. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  19. Molecular Data for a Biochemical Model of DNA Radiation Damage: Electron Impact Ionization and Dissociative Ionization of DNA Bases and Sugar-Phosphate Backbone

    Science.gov (United States)

    Dateo, Christopher E.; Fletcher, Graham D.

    2004-01-01

    As part of the database for building up a biochemical model of DNA radiation damage, electron impact ionization cross sections of sugar-phosphate backbone and DNA bases have been calculated using the improved binary-encounter dipole (iBED) model. It is found that the total ionization cross sections of C3'- and C5'-deoxyribose-phospate, two conformers of the sugar-phosphate backbone, are close to each other. Furthermore, the sum of the ionization cross sections of the separate deoxyribose and phosphate fragments is in close agreement with the C3'- and C5'-deoxyribose-phospate cross sections, differing by less than 10%. Of the four DNA bases, the ionization cross section of guanine is the largest, then in decreasing order, adenine, thymine, and cytosine. The order is in accordance with the known propensity of oxidation of the bases by ionizing radiation. Dissociative ionization (DI), a process that both ionizes and dissociates a molecule, is investigated for cytosine. The DI cross section for the formation of H and (cytosine-Hl)(+), with the cytosine ion losing H at the 1 position, is also reported. The threshold of this process is calculated to be 17.1 eV. Detailed analysis of ionization products such as in DI is important to trace the sequential steps in the biochemical process of DNA damage.

  20. Molecular data for a biochemical model of DNA damage: Electron impact ionization and dissociative ionization cross sections of DNA bases and sugar-phosphate backbone

    International Nuclear Information System (INIS)

    Huo, Winifred M.; Dateo, Christopher E.; Fletcher, Graham D.

    2006-01-01

    As part of the database for building up a biochemical model of DNA radiation damage, electron impact ionization cross sections of sugar-phosphate backbone and DNA bases have been calculated using the improved binary-encounter dipole (iBED) model. It is found that the total ionization cross sections of C 3 ' - and C 5 ' -deoxyribose-phosphate, two conformers of the sugar-phosphate backbone, are close to each other. Furthermore, the sum of the ionization cross sections of the separate deoxyribose and phosphate fragments is in close agreement with the C 3 ' - and C 5 ' -deoxyribose-phosphate cross sections, differing by less than 10%, an indication that a building-up principle may be applicable. Of the four DNA bases, the ionization cross section of guanine is the largest, then in decreasing order, adenine, thymine, and cytosine. The order is in accordance with the known propensity of oxidation of the bases by ionizing radiation. Dissociative ionization (DI), a process that both ionizes and dissociates a molecule, is investigated for cytosine. The DI cross section for the formation of H and (cytosine-H1) + , with the cytosine ion losing H at the 1 position, is also reported. The threshold of this process is calculated to be 16.9eV. Detailed analysis of ionization products such as in DI is important to trace the sequential steps in the biochemical process of DNA damage

  1. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    Directory of Open Access Journals (Sweden)

    Emmanuelle eFiore

    2015-08-01

    Full Text Available Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  2. A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

    Directory of Open Access Journals (Sweden)

    Alvaro Díaz-Badillo

    2014-04-01

    Full Text Available Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

  3. Base excision repair in Archaea: back to the future in DNA repair.

    Science.gov (United States)

    Grasso, Stefano; Tell, Gianluca

    2014-09-01

    Together with Bacteria and Eukarya, Archaea represents one of the three domain of life. In contrast with the morphological difference existing between Archaea and Eukarya, these two domains are closely related. Phylogenetic analyses confirm this evolutionary relationship showing that most of the proteins involved in DNA transcription and replication are highly conserved. On the contrary, information is scanty about DNA repair pathways and their mechanisms. In the present review the most important proteins involved in base excision repair, namely glycosylases, AP lyases, AP endonucleases, polymerases, sliding clamps, flap endonucleases, and ligases, will be discussed and compared with bacterial and eukaryotic ones. Finally, possible applications and future perspectives derived from studies on Archaea and their repair pathways, will be taken into account. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Sea cucumber species identification of family Caudinidae from Surabaya based on morphological and mitochondrial DNA evidence

    Science.gov (United States)

    Amin, Muhammad Hilman Fu'adil; Pidada, Ida Bagus Rai; Sugiharto, Widyatmoko, Johan Nuari; Irawan, Bambang

    2016-03-01

    Species identification and taxonomy of sea cucumber remains a challenge problem in some taxa. Caudinidae family of sea cucumber was comerciallized in Surabaya, and it was used as sea cucumber chips. Members of Caudinid sea cucumber have similiar morphology, so it is hard to identify this sea cucumber only from morphological appearance. DNA barcoding is useful method to overcome this problem. The aim of this study was to determine Caudinid specimen of sea cucumber in East Java by morphological and molecular approach. Sample was collected from east coast of Surabaya, then preserved in absolute ethanol. After DNA isolation, Cytochrome Oxydase I (COI) gene amplification was performed using Echinoderm universal primer and PCR product was sequenced. Sequencing result was analyzed and identified in NCBI database using BLAST. Results showed that Caudinid specimen in have closely related to Acaudina molpadioides sequence in GenBank with 86% identity. Morphological data, especially based on ossicle, also showed that the specimen is Acaudina molpadioides.

  5. A light weight secure image encryption scheme based on chaos & DNA computing

    Directory of Open Access Journals (Sweden)

    Bhaskar Mondal

    2017-10-01

    Full Text Available This paper proposed a new light weight secure cryptographic scheme for secure image communication. In this scheme the plain image is permuted first using a sequence of pseudo random number (PRN and encrypted by DeoxyriboNucleic Acid (DNA computation. Two PRN sequences are generated by a Pseudo Random Number Generator (PRNG based on cross coupled chaotic logistic map using two sets of keys. The first PRN sequence is used for permuting the plain image whereas the second PRN sequence is used for generating random DNA sequence. The number of rounds of permutation and encryption may be variable to increase security. The scheme is proposed for gray label images but the scheme may be extended for color images and text data. Simulation results exhibit that the proposed scheme can defy any kind of attack.

  6. Detection of DNA oligonucleotides with base mutations by terahertz spectroscopy and microstructures.

    Directory of Open Access Journals (Sweden)

    Mingjie Tang

    Full Text Available DNA oligonucleotides with a 5-base mutation at the 3'-terminus were investigated by terahertz (THz spectroscopy in a marker-free manner. The four single-stranded oligonucleotides with 17nt have been detected with specificity on a microfluidic chip, and corroborated by spectral measurements with split-ring resonators. The number of hydrogen bonds formed between the oligonucleotide and its surrounding water molecules, deemed a key contribution to the THz absorption of biological solutions, was explored by molecular dynamics simulations to explain the experimental findings. Our work underlies the feasibility of THz spectroscopy combined with microstructures for marker-free detection of DNA, which may form the basis of a prospective diagnostic tool for studying genic mutation.

  7. Mono- and Di-Alkylation Processes of DNA Bases by Nitrogen Mustard Mechlorethamine.

    Science.gov (United States)

    Larrañaga, Olatz; de Cózar, Abel; Cossío, Fernando P

    2017-12-06

    The reactivity of nitrogen mustard mechlorethamine (mec) with purine bases towards formation of mono- (G-mec and A-mec) and dialkylated (AA-mec, GG-mec and AG-mec) adducts has been studied using density functional theory (DFT). To gain a complete overview of DNA-alkylation processes, direct chloride substitution and formation through activated aziridinium species were considered as possible reaction paths for adduct formation. Our results confirm that DNA alkylation by mec occurs via aziridine intermediates instead of direct substitution. Consideration of explicit water molecules in conjunction with polarizable continuum model (PCM) was shown as an adequate computational method for a proper representation of the system. Moreover, Runge-Kutta numerical kinetic simulations including the possible bisadducts have been performed. These simulations predicted a product ratio of 83:17 of GG-mec and AG-mec diadducts, respectively. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    DEFF Research Database (Denmark)

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

    2016-01-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

  9. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    Science.gov (United States)

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.

    2016-05-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  10. Extraction, amplification and detection of DNA in microfluidic chip-based assays

    KAUST Repository

    Wu, Jinbo

    2013-12-20

    This review covers three aspects of PCR-based microfluidic chip assays: sample preparation, target amplification, and product detection. We also discuss the challenges related to the miniaturization and integration of each assay and make a comparison between conventional and microfluidic schemes. In order to accomplish these essential assays without human intervention between individual steps, the micro-components for fluid manipulation become critical. We therefore summarize and discuss components such as microvalves (for fluid regulation), pumps (for fluid driving) and mixers (for blending fluids). By combining the above assays and microcomponents, DNA testing of multi-step bio-reactions in microfluidic chips may be achieved with minimal external control. The combination of assay schemes with the use of micro-components also leads to rapid methods for DNA testing via multi-step bioreactions. Contains 259 references.

  11. DNA detection on ultrahigh-density optical fiber-based nanoarrays.

    Science.gov (United States)

    Tam, Jenny M; Song, Linan; Walt, David R

    2009-04-15

    Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

  12. Fast parallel DNA-based algorithms for molecular computation: quadratic congruence and factoring integers.

    Science.gov (United States)

    Chang, Weng-Long

    2012-03-01

    Assume that n is a positive integer. If there is an integer such that M (2) ≡ C (mod n), i.e., the congruence has a solution, then C is said to be a quadratic congruence (mod n). If the congruence does not have a solution, then C is said to be a quadratic noncongruence (mod n). The task of solving the problem is central to many important applications, the most obvious being cryptography. In this article, we describe a DNA-based algorithm for solving quadratic congruence and factoring integers. In additional to this novel contribution, we also show the utility of our encoding scheme, and of the algorithm's submodules. We demonstrate how a variety of arithmetic, shifted and comparative operations, namely bitwise and full addition, subtraction, left shifter and comparison perhaps are performed using strands of DNA.

  13. Ratiometric FRET-based detection of DNA and micro-RNA in solution

    International Nuclear Information System (INIS)

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy

    2009-01-01

    A ratiometric method for detecting DNA oligomers in bulk solution based on Foerster resonance energy transfer (FRET) is described. The two fluorescence signals (green and red), originating from Cy3 (donor, green) and Cy5 (acceptor, red) labels, are simultaneously detected from the pre-hybridized Cy3oligomerY:Cy5oligomerX system. The ratio of red to green intensities is sensitive to the presence of the single-stranded complimentary oligomer, which replaces single-stranded Cy3oligomerY in the donor:acceptor complex and perturbs the FRET. The detection scheme is generally applicable to the detection of DNA and RNA, and particularly micro-RNA. The proposed method is applicable to various double-stranded various lengths targets (manipulation of the sample preparation conditions, such as temperature, incubation time, denaturizing agent, may be needed).

  14. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  15. Glycosylase-mediated repair of radiation-induced DNA bases: substrate specificities and mechanisms

    International Nuclear Information System (INIS)

    D'ham, Cedric

    1998-01-01

    Cellular DNA is subject to permanent damage and repair processes. One way to restore the integrity of DNA involves the base excision repair pathway. Glycosylases are the key-enzymes of this process. The present work deals with the determination of the substrate specificity and the mechanism of action of three glycosylases: endonuclease III and Fpg of Escherichia coli and Ogg1 of Saccharomyces cerevisiae. The present manuscript is divided into four parts: Endonuclease III-mediated excision of 5,6-dihydro-thymine and 5-hydroxy-5,6-dihydro-thymine from γ-irradiated DNA was analyzed by a gas chromatography-mass spectrometry assay, including a liquid chromatography pre-purification step. This was found to be necessary in order to separate the cis and trans isomers of 6-hydroxy-5,6-dihydro-thymine from the 5-hydroxy-5,6-dihydro-thymine. Modified oligonucleotides that contained a unique lesion, including thymine glycol, 5,6-dihydro-thymine and 5-hydroxy-cytosine were synthesized to assess the substrate specificity of endonuclease III and Fpg. The order of preference of the enzymes for the substrates was determined by the measurement of the Michaelis constants of the kinetics. Furthermore, the mechanism of action of endonuclease III has been reconsidered, after analysis using the MALDI mass spectrometry technique. These studies reveal that hydrolysis is the main pathway by which endonuclease III cleaves the DNA backbone. Using a modified oligonucleotide, 8-oxo-7,8-dihydro-adenine was shown to be a product of excision of the Ogg1 enzyme. The role of the complementary base towards the lesion was found to be preponderant in the damage excision. A last chapter concerns the synthesis and the characterization of the four isomers of 5(6)-hydroxy-6(5)-hydroperoxides of thymine. These products may be substrates for endonuclease III or Fpg. (author) [fr

  16. Labelling of the thymidine and deoxyctidine bases of DNA by (2-14C) deoxycytidine in cultured L1210 cells

    International Nuclear Information System (INIS)

    Karle, J.M.; Hoeraut, R.M.; Cysyk, R.L.

    1983-01-01

    Exposure of cultured L1210 cells to (2- 14 C) deoxycytidine and analysis of radioactivity incorporated into DNA-pyrimidines revealed that 2.7-5.5-fold more radioactivity is incorporated into DNA-thymine than into cytosine bases. Thus, the pathway involving deamination of deoxycytidylate to deoxyuridylate and methylation to thymidylate is highly favoured over successive phosphorlation to dCTP. Several modified and endogenous pyrimidines altered the labelling of DNA-thymine and DNA-cytosine with (2- 14 C)-deoxycytidine. 3-deazauridine at 0.1 mM caused a 56% increase in the labelling of DNA-thymine. Both thymidine and 3-deazauridine (>=10 μM) increased the specific activity to DNA-cytosine by 4-fold. Cytosine arabinoside (ara-C) (>= 10 μM) reduced the labelling of both DNA-cytosine and DNA-thymine. Excess cytidine (0.1 mM) reduced the labelling of DNA-cytosine by 40%. Tetrahydrouridine at concentrations up to 1 mM had no effect. (author)

  17. Determination of the level of DNA modification with cisplatin by catalytic hydrogen evolution at mercury-based electrodes.

    Science.gov (United States)

    Horáková, Petra; Tesnohlídková, Lucie; Havran, Ludek; Vidláková, Pavlína; Pivonková, Hana; Fojta, Miroslav

    2010-04-01

    Electrochemical methods proved useful as simple and inexpensive tools for the analysis of natural as well as chemically modified nucleic acids. In particular, covalently attached metal-containing groups usually render the DNA well-pronounced electrochemical activity related to redox processes of the metal moieties, which can in some cases be coupled to catalytic hydrogen evolution at mercury or some types of amalgam electrodes. In this paper we used voltammetry at the mercury-based electrodes for the monitoring of DNA modification with cis-diamminedichloroplatinum (cisplatin), a representative of metallodrugs used in the treatment of various types of cancer or being developed for such purpose. In cyclic voltammetry at the mercury electrode, the cisplatin-modified DNA yielded catalytic currents the intensity of which reflected DNA modification extent. In square-wave voltammetry, during anodic polarization after prereduction of the cisplatinated DNA, a well-developed, symmetrical signal (peak P) was obtained. Intensity of the peak P linearly responded to the extent of DNA modification at levels relevant for biochemical studies (rb = 0.01-0.10, where rb is the number of platinum atoms bound per DNA nucleotide). We demonstrate a correlation between the peak P intensity and a loss of sequence-specific DNA binding by tumor suppressor protein p53, as well as blockage of DNA digestion by a restriction endonuclease Msp I (both caused by the DNA cisplatination). Application of the electrochemical technique in studies of DNA reactivity with various anticancer platinum compounds, as well as for an easy determination of the extent of DNA platination in studies of its biochemical effects, is discussed.

  18. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  19. Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage

    Science.gov (United States)

    Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan

    2012-01-01

    ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876

  20. Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

    Science.gov (United States)

    El-Diasty, Fouad; Abdel-Wahab, Fathy

    2015-10-01

    The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.

  1. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    Science.gov (United States)

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  2. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

    Science.gov (United States)

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

    2017-01-01

    Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

  3. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

    Science.gov (United States)

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

    2017-03-17

    Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  5. Detection of Avian Influenza Virus by Fluorescent DNA Barcode-based Immunoassay with Sensitivity Comparable to PCR

    DEFF Research Database (Denmark)

    Cao, Cuong; Dhumpa, Raghuram; Bang, Dang Duong

    2010-01-01

    involves the sandwiching of the target AIV between magnetic immunoprobes and barcode-carrying immunoprobes. Because each barcode-carrying immunoprobe is functionalized with a multitude of fluorophore-DNA barcode strands, many DNA barcodes are released for each positive binding event resulting......In this paper, a coupling of fluorophore-DNA barcode and bead-based immunoassay for detecting avian influenza virus (AIV) with PCR-like sensitivity is reported. The assay is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representative barcodes. The detection...

  6. Thiomers and thiomer-based nanoparticles in protein and DNA drug delivery.

    Science.gov (United States)

    Hauptstein, Sabine; Bernkop-Schnürch, Andreas

    2012-09-01

    Thanks to advances in biotechnology, more and more highly efficient protein- and DNA-based drugs have been developed. Unfortunately, these kinds of drugs underlie poor non-parental bioavailability. To overcome hindrances like low mucosal permeability and enzymatic degradation polymeric excipients are utilized as drug carrier whereat thiolated excipients showed several promising qualities in comparison to the analogical unmodified polymer. The article deals with the comparatively easy modification of well-established polymers like chitosan or poly(acrylates) to synthesize thiomers. Further, the recently developed "next generation" thiomers e.g. preactivated or S-protected thiomers are introduced. Designative properties like mucoadhesion, uptake and permeation enhancement, efflux pump inhibition and protection against enzymatic degradation will be discussed and differences between first and next generation thiomers will be pointed out. Additionally, nanoparticles prepared with thiomers will be dealt with regarding to protein and DNA drug delivery as thiomers seem to be a promising approach to avoid parenteral application. Properties of thiomers per se and results of in vivo studies carried out so far for peptide and DNA drugs demonstrate their potential as multifunctional excipients. However, further investigations and optimizations have to be done before establishing a carrier system ready for clinical approval.

  7. Direct assay of radiation-induced DNA base lesions in mammalian cells

    International Nuclear Information System (INIS)

    1992-01-01

    Adenine (Ade), 2'-deoxyadenosine (dAdo), 5'-deoxyadenosine monophosphate (dAUT), single stranded poly adenylic acid [poly (dA)], double stranded deoxyadenylic-thymidylic acid [ds poly (dA-T)] and salmon testis DNA were irradiated with 500 Gy under oxic and anoxic conditions. The major damage products were analyzed by BPLC with optical detection and quantitated in terms of the percentage of the adenosine in each model compound found as a specific damage product. Outside of the Ade free base, 8-OH-dAdo was the major oxic damage product from each model compound. The type and quantity of the major damage products depended on the sequence and conformation of the model compounds under anoxic conditions. When dAdo and dAMP were irradiated under anoxic conditions, the major damage product was either the R or S isomer of 8,5'cdAdo and little Ade or α-dAdo was observed. However, when poly(dA), poly(dA-dT), and salmon testis DNA were γ-irradiated under nitrogen, the major deoxyadenosine damage product was identified as the α-anomer of deoxyadenosine. No α-deoxyadenosine was detected after irradiation under oxic conditions. The presence of nucleotides with the α-configuration at the anomeric carbon atom in the DNA chain may have a significant effect on its tertiary structure and possibly modify its biological activity

  8. Argo_CUDA: Exhaustive GPU based approach for motif discovery in large DNA datasets.

    Science.gov (United States)

    Vishnevsky, Oleg V; Bocharnikov, Andrey V; Kolchanov, Nikolay A

    2018-02-01

    The development of chromatin immunoprecipitation sequencing (ChIP-seq) technology has revolutionized the genetic analysis of the basic mechanisms underlying transcription regulation and led to accumulation of information about a huge amount of DNA sequences. There are a lot of web services which are currently available for de novo motif discovery in datasets containing information about DNA/protein binding. An enormous motif diversity makes their finding challenging. In order to avoid the difficulties, researchers use different stochastic approaches. Unfortunately, the efficiency of the motif discovery programs dramatically declines with the query set size increase. This leads to the fact that only a fraction of top "peak" ChIP-Seq segments can be analyzed or the area of analysis should be narrowed. Thus, the motif discovery in massive datasets remains a challenging issue. Argo_Compute Unified Device Architecture (CUDA) web service is designed to process the massive DNA data. It is a program for the detection of degenerate oligonucleotide motifs of fixed length written in 15-letter IUPAC code. Argo_CUDA is a full-exhaustive approach based on the high-performance GPU technologies. Compared with the existing motif discovery web services, Argo_CUDA shows good prediction quality on simulated sets. The analysis of ChIP-Seq sequences revealed the motifs which correspond to known transcription factor binding sites.

  9. Self-assembling of calcium salt of the new DNA base 5-carboxylcytosine

    Energy Technology Data Exchange (ETDEWEB)

    Irrera, Simona [Department of Chemistry, SAPIENZA University of Rome, Piazzale A. Moro 5, 00185 Rome (Italy); Department of Chemistry, University College London, 20 Grodon Street, WC1H0AJ London (United Kingdom); Ruiz-Hernandez, Sergio E. [School of Chemistry, Cardiff University Main Building, Park Place, CF103AT Cardiff (United Kingdom); Reggente, Melania [Department of Basic and Applied Sciences for Engineering, SAPIENZA University of Rome, Via A. Scarpa 16, 00161 Rome (Italy); Passeri, Daniele, E-mail: daniele.passeri@uniroma1.it [Department of Basic and Applied Sciences for Engineering, SAPIENZA University of Rome, Via A. Scarpa 16, 00161 Rome (Italy); Natali, Marco [Department of Basic and Applied Sciences for Engineering, SAPIENZA University of Rome, Via A. Scarpa 16, 00161 Rome (Italy); Gala, Fabrizio [Department of Basic and Applied Sciences for Engineering, SAPIENZA University of Rome, Via A. Scarpa 16, 00161 Rome (Italy); Department of Medical-Surgical, Techno-Biomedical Sciences and Translational Medicine of SAPIENZA University of Rome, Sant’Andrea Hospital, Rome (Italy); Zollo, Giuseppe [Department of Basic and Applied Sciences for Engineering, SAPIENZA University of Rome, Via A. Scarpa 16, 00161 Rome (Italy); Rossi, Marco [Department of Basic and Applied Sciences for Engineering, SAPIENZA University of Rome, Via A. Scarpa 16, 00161 Rome (Italy); Research Center for Nanotechnology applied to Engineering of SAPIENZA University of Rome (CNIS), Piazzale A. Moro 5, 00185 Rome (Italy); Portalone, Gustavo, E-mail: gustavo.portalone@uniroma1.it [Department of Chemistry, SAPIENZA University of Rome, Piazzale A. Moro 5, 00185 Rome (Italy)

    2017-06-15

    Highlights: • Ca salt of 5-carboxylcytosine has been deposited on HOPG substrate. • Molecules self-assembled in monolayers and filaments. • Height of the features were measured by atomic force microscopy. • Ab-initio calculations confirmed the AFM results. - Abstract: Supramolecular architectures involving DNA bases can have a strong impact in several fields such as nanomedicine and nanodevice manufacturing. To date, in addition to the four canonical nucleobases (adenine, thymine, guanine and cytosine), four other forms of cytosine modified at the 5 position have been identified in DNA. Among these four new cytosine derivatives, 5-carboxylcytosine has been recently discovered in mammalian stem cell DNA, and proposed as the final product of the oxidative epigenetic demethylation pathway on the 5 position of cytosine. In this work, a calcium salt of 5-carboxylcytosine has been synthesized and deposited on graphite surface, where it forms self-assembled features as long range monolayers and up to one micron long filaments. These structures have been analyzed in details combining different theoretical and experimental approaches: X-ray single-crystal diffraction data were used to simulate the molecule-graphite interaction, first using molecular dynamics and then refining the results using density functional theory (DFT); finally, data obtained with DFT were used to rationalize atomic force microscopy (AFM) results.

  10. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  11. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Self-assembling of calcium salt of the new DNA base 5-carboxylcytosine

    Science.gov (United States)

    Irrera, Simona; Ruiz-Hernandez, Sergio E.; Reggente, Melania; Passeri, Daniele; Natali, Marco; Gala, Fabrizio; Zollo, Giuseppe; Rossi, Marco; Portalone, Gustavo

    2017-06-01

    Supramolecular architectures involving DNA bases can have a strong impact in several fields such as nanomedicine and nanodevice manufacturing. To date, in addition to the four canonical nucleobases (adenine, thymine, guanine and cytosine), four other forms of cytosine modified at the 5 position have been identified in DNA. Among these four new cytosine derivatives, 5-carboxylcytosine has been recently discovered in mammalian stem cell DNA, and proposed as the final product of the oxidative epigenetic demethylation pathway on the 5 position of cytosine. In this work, a calcium salt of 5-carboxylcytosine has been synthesized and deposited on graphite surface, where it forms self-assembled features as long range monolayers and up to one micron long filaments. These structures have been analyzed in details combining different theoretical and experimental approaches: X-ray single-crystal diffraction data were used to simulate the molecule-graphite interaction, first using molecular dynamics and then refining the results using density functional theory (DFT); finally, data obtained with DFT were used to rationalize atomic force microscopy (AFM) results.

  13. Synthesis, characterization, anti-microbial, DNA binding and cleavage studies of Schiff base metal complexes

    Directory of Open Access Journals (Sweden)

    Poomalai Jayaseelan

    2016-09-01

    Full Text Available A novel Schiff base ligand has been prepared by the condensation between butanedione monoxime with 3,3′-diaminobenzidine. The ligand and metal complexes have been characterized by elemental analysis, UV, IR, 1H NMR, conductivity measurements, EPR and magnetic studies. The molar conductance studies of Cu(II, Ni(II, Co(II and Mn(II complexes showed non-electrolyte in nature. The ligand acts as dibasic with two N4-tetradentate sites and can coordinate with two metal ions to form binuclear complexes. The spectroscopic data of metal complexes indicated that the metal ions are complexed with azomethine nitrogen and oxyimino nitrogen atoms. The binuclear metal complexes exhibit octahedral arrangements. DNA binding properties of copper(II metal complex have been investigated by electronic absorption spectroscopy. Results suggest that the copper(II complex bind to DNA via an intercalation binding mode. The nucleolytic cleavage activities of the ligand and their complexes were assayed on CT-DNA using gel electrophoresis in the presence and absence of H2O2. The ligand showed increased nuclease activity when administered as copper complex and copper(II complex behave as efficient chemical nucleases with hydrogen peroxide activation. The anti-microbial activities and thermal studies have also been studied. In anti-microbial activity all complexes showed good anti-microbial activity higher than ligand against gram positive, gram negative bacteria and fungi.

  14. Fast and automated DNA assays on a compact disc (CD)-based microfluidic platform

    Science.gov (United States)

    Jia, Guangyao

    Nucleic acid-based molecular diagnostics offers enormous potential for the rapid and accurate diagnosis of infectious diseases. However, most of the existing commercial tests are time-consuming and technically complicated, and are thus incompatible with the need for rapid identification of infectious agents. We have successfully developed a CD-based microfluidic platform for fast and automated DNA array hybridization and a low cost, disposable plastic microfluidic platform for polymerase chain reaction (PCR). These platforms have proved to be a promising approach to meet the requirements in terms of detection speed and operational convenience in diagnosis of infectious diseases. In the CD-based microfluidic platform for DNA hybridization, convection is introduced to the system to enhance mass transport so as to accelerate the hybridization rate since DNA hybridization is a diffusion limited reaction. Centrifugal force is utilized for sample propulsion and surface force is used for liquid gating. Standard microscope glass slides are used as the substrates for capture probes owing to their compatibility with commercially available instrumentation (e.g. laser scanners) for detection. Microfabricated polydimethylsiloxane (PDMS) structures are used to accomplish the fluidic functions required by the protocols for DNA hybridization. The assembly of the PDMS structure and the glass slide forms a flow-through hybridization unit that can be accommodated onto the CD platform for reagent manipulation. The above scheme has been validated with oligonucleotides as the targets using commercially available enzyme-labeled fluorescence (ELF 97) for detection of the hybridization events, and tested with amplicons of genomic staphylococcus DNA labeled with Cy dye. In both experiments, significantly higher fluorescence intensities were observed in the flow-through hybridization unit compared to the passive assays. The CD fluidic scheme was also adapted to the immobilization of

  15. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. A DNA based method to detect the grapevine root-rotting fungus Roesleria subterranea in soil and root samples

    Directory of Open Access Journals (Sweden)

    S. Neuhauser

    2009-05-01

    Full Text Available Roesleria subterranea causes root rot in grapevine and fruit trees. The fungus has long been underestimated as a weak parasite, but during the last years it has been reported to cause severe damages in German vineyards. Direct, observation-based detection of the parasite is time consuming and destructive, as large parts of the rootstocks have to be uprooted and screened for the tiny, stipitate, hypogeous ascomata of R. subterranea. To facilitate rapid detection in vineyards, protocols to extract DNA from soil samples and grapevine roots, and R.-subterranea-specific PCR primers were designed. Twelve DNA-extraction protocols for soil samples were tested in small-scale experiments, and selected parameters were optimised. A protocol based on ball-mill homogenization, DNA extraction with SDS, skim milk, chloroform, and isopropanol, and subsequent purifi cation of the raw extracts with PVPP-spin-columns was most effective. This DNA extraction protocol was found to be suitable for a wide range of soil-types including clay, loam and humic-rich soils. For DNA extraction from grapevine roots a CTAB-based protocol was more reliable for various grapevine rootstock varieties. Roesleria-subterranea-specific primers for the ITS1-5.8S-ITS2 rDNA region were developed and tested for their specifi city to DNA extracts from eleven R. subterranea strains isolated from grapevine and fruit trees. No cross reactions were detected with DNA extracts from 44 different species of fungi isolated from vineyard soils. The sensitivity of the species-specifi c primers in combination with the DNA extraction method for soil was high: as little as 100 fg μl-1 R.-subterranea-DNA was suffi cient for a detection in soil samples and plant material. Given that specifi c primers are available, the presented method will also allow quick and large-scale testing for other root pathogens.

  17. Early development and characterization of a DNA-based radiation dosimeter

    Science.gov (United States)

    Avarmaa, Kirsten A.

    It is the priority of first responders to minimize damage to persons and infrastructure in the case of a nuclear emergency due to an accident or deliberate terrorist attack -- if this emergency includes a radioactive hazard, first responders require a simple-to-use, accurate and complete dosimeter for radiation protection purposes in order to minimize the health risk to these individuals and the general population at large. This work consists of the early evaluation of the design and performance of a biologically relevant dosimeter which uses DNA material that can respond to the radiation of any particle type. The construct consists of fluorescently tagged strands of DNA. The signalling components of this dosimeter are also investigated for their sensitivity to radiation damage and light exposure. The dual-labelled dosimeter that is evaluated in this work gave a measurable response to gamma radiation at dose levels of 10 Gy for the given detector design and experimental setup. Further testing outside of this work confirmed this finding and indicated a working range of 100 mGy to 10 Gy using a custom-built fluorimeter as part of a larger CRTI initiative. Characterization of the chromatic components of the dosimeter showed that photobleaching is not expected to have an effect on dosimeter performance, but that radiation can damage the non-DNA signalling components at higher dose levels, although this damage is minimal at lower doses over the expected operating ranges. This work therefore describes the early steps in the quantification of the behaviour of the DNA dosimeter as a potential biologically-based device to measure radiation dose.

  18. Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.

    Science.gov (United States)

    Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R

    2009-07-01

    The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/

  19. Ferrocene-based guanidine derivatives: in vitro antimicrobial, DNA binding and docking supported urease inhibition studies.

    Science.gov (United States)

    Gul, Rukhsana; Rauf, Muhammad Khawar; Badshah, Amin; Azam, Syed Sikander; Tahir, Muhammad Nawaz; Khan, Azim

    2014-10-06

    Some novel ferrocenyl guanidines 1-8 were synthesized and characterized by different spectroscopic methods, elemental analysis and single crystal X-rays diffraction techniques. The crystallographic studies revealed that the existence of the strong non-bonding interactions facilitate these molecules to interact with biological macro-molecules like DNA that described to inherit good biological activities. The DNA interaction studies carried out by cyclic voltammetry (CV) and UV-visible spectroscopy are in close agreement with the binding constants (K) (0.79-5.4) × 10(5) (CV) and (0.72-5.1) × 10(5) (UV-vis). The shift in peak potential, current and absorption maxima of the studied ferrocenyl guanidines in the presence of DNA revealed that CV coupled with UV-vis spectroscopy could provide an opportune to characterize metal-based compounds-DNA interaction mechanism, a prerequisite for the design of new anticancer agents and understanding the molecular basis of their action. The compounds 1-8 have been screened for their antibacterial, antifungal and urease inhibition potency. A concurrent in silico study has also been applied on ferrocene moiety impregnated guanidines 1-8 to identify most active compounds having for inhibiting the activity of urease (pdb id 3LA4). Most of the compounds were found as potent inhibitors of urease and the compound 1 was found to be the most active with an IC50 of 16.83 ± 0.03 μM. The docking scores are in close agreement with the in vitro obtained IC50 values of inhibitors 1-8. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  20. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  1. High Throughput Sample Preparation and Analysis for DNA Sequencing, PCR and Combinatorial Screening of Catalysis Based on Capillary Array Technique

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yonghua [Iowa State Univ., Ames, IA (United States)

    2000-01-01

    Sample preparation has been one of the major bottlenecks for many high throughput analyses. The purpose of this research was to develop new sample preparation and integration approach for DNA sequencing, PCR based DNA analysis and combinatorial screening of homogeneous catalysis based on multiplexed capillary electrophoresis with laser induced fluorescence or imaging UV absorption detection. The author first introduced a method to integrate the front-end tasks to DNA capillary-array sequencers. protocols for directly sequencing the plasmids from a single bacterial colony in fused-silica capillaries were developed. After the colony was picked, lysis was accomplished in situ in the plastic sample tube using either a thermocycler or heating block. Upon heating, the plasmids were released while chromsomal DNA and membrane proteins were denatured and precipitated to the bottom of the tube. After adding enzyme and Sanger reagents, the resulting solution was aspirated into the reaction capillaries by a syringe pump, and cycle sequencing was initiated. No deleterious effect upon the reaction efficiency, the on-line purification system, or the capillary electrophoresis separation was observed, even though the crude lysate was used as the template. Multiplexed on-line DNA sequencing data from 8 parallel channels allowed base calling up to 620 bp with an accuracy of 98%. The entire system can be automatically regenerated for repeated operation. For PCR based DNA analysis, they demonstrated that capillary electrophoresis with UV detection can be used for DNA analysis starting from clinical sample without purification. After PCR reaction using cheek cell, blood or HIV-1 gag DNA, the reaction mixtures was injected into the capillary either on-line or off-line by base stacking. The protocol was also applied to capillary array electrophoresis. The use of cheaper detection, and the elimination of purification of DNA sample before or after PCR reaction, will make this approach an

  2. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  3. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  4. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  5. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation | Center for Cancer Research

    Science.gov (United States)

    Dubbed "Tom's T" by Dhruba Chattoraj, the unusually conserved thymine at position +7 in bacteriophage P1 plasmid RepA DNA binding sites rises above repressor and acceptor sequence logos. The T appears to represent base flipping prior to helix opening in this DNA replication initation protein.

  6. Pseudogenes and DNA-based diet analyses: A cautionary tale from a relatively well sampled predator-prey system

    DEFF Research Database (Denmark)

    Dunshea, G.; Barros, N. B.; Wells, R. S.

    2008-01-01

    Mitochondrial ribosomal DNA is commonly used in DNA-based dietary analyses. In such studies, these sequences are generally assumed to be the only version present in DNA of the organism of interest. However, nuclear pseudogenes that display variable similarity to the mitochondrial versions...... are common in many taxa. The presence of nuclear pseudogenes that co-amplify with their mitochondrial paralogues can lead to several possible confounding interpretations when applied to estimating animal diet. Here, we investigate the occurrence of nuclear pseudogenes in fecal samples taken from bottlenose...... dolphins (Tursiops truncatus) that were assayed for prey DNA with a universal primer technique. We found pseudogenes in 13 of 15 samples and 1-5 pseudogene haplotypes per sample representing 5-100% of all amplicons produced. The proportion of amplicons that were pseudogenes and the diversity of prey DNA...

  7. CCR6+ Th cell distribution differentiates systemic lupus erythematosus patients based on anti-dsDNA antibody status.

    Science.gov (United States)

    Zhong, Wei; Jiang, Zhenyu; Wu, Jiang; Jiang, Yanfang; Zhao, Ling

    2018-01-01

    Systemic lupus erythematosus (SLE) disease has been shown to be associated with the generation of multiple auto-antibodies. Among these, anti-dsDNA antibodies (anti-DNAs) are specific and play a pathogenic role in SLE. Indeed, anti-DNA + SLE patients display a worse disease course. The generation of these pathogenic anti-DNAs has been attributed to the interaction between aberrant T helper (Th) cells and autoimmune B cells. Thus, in this study we have investigated whether CCR6 + Th cells have the ability to differentiate SLE patients based on anti-DNA status, and if their distribution has any correlation with disease activity. We recruited 25 anti-DNA + and 25 anti-DNA - treatment-naive onset SLE patients, matched for various clinical characteristics in our nested matched case-control study. CCR6 + Th cells and their additional subsets were analyzed in each patient by flow cytometry. Anti-DNA + SLE patients specifically had a higher percentage of Th cells expressing CCR6 and CXCR3. Further analysis of CCR6 + Th cell subsets showed that anti-DNA + SLE patients had elevated proportions of Th9, Th17, Th17.1 and CCR4/CXCR3 double-negative (DN) cells. However, the proportions of CCR6 - Th subsets, including Th1 and Th2 cells, did not show any association with anti-DNA status. Finally, we identified a correlation between CCR6 + Th subsets and clinical indicators, specifically in anti-DNA + SLE patients. Our data indicated that CCR6 + Th cells and their subsets were elevated and correlated with disease activity in anti-DNA + SLE patients. We speculated that CCR6 + Th cells may contribute to distinct disease severity in anti-DNA + SLE patients.

  8. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. Multiplex electrochemiluminescence DNA sensor for determination of hepatitis B virus and hepatitis C virus based on multicolor quantum dots and Au nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Linlin; Wang, Xinyan; Ma, Qiang; Lin, Zihan; Chen, Shufan; Li, Yang [Department of Analytical Chemistry, College of Chemistry, Jilin University, Changchun, 130012 (China); Lu, Lehui [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, 130022 (China); Qu, Hongping [Department of Biotechnology, College of Life Science, Jilin Normal University, Siping, 136000 (China); Su, Xingguang, E-mail: suxg@jlu.edu.cn [Department of Analytical Chemistry, College of Chemistry, Jilin University, Changchun, 130012 (China)

    2016-04-15

    In this work, a novel multiplex electrochemiluminescence (ECL) DNA sensor has been developed for determination of hepatitis B virus (HBV) and hepatitis C virus (HCV) based on multicolor CdTe quantum dots (CdTe QDs) and Au nanoparticles (Au NPs). The electrochemically synthesized graphene nanosheets (GNs) were selected as conducting bridge to anchor CdTe QDs{sub 551}-capture DNA{sub HBV} and CdTe QDs{sub 607}-capture DNA{sub HCV} on the glassy carbon electrode (GCE). Then, different concentrations of target DNA{sub HBV} and target DNA{sub HCV} were introduced to hybrid with complementary CdTe QDs-capture DNA. Au NPs-probe DNA{sub HBV} and Au NPs-probe DNA{sub HCV} were modified to the above composite film via hybrid with the unreacted complementary CdTe QDs-capture DNA. Au NPs could quench the electrochemiluminescence (ECL) intensity of CdTe QDs due to the inner filter effect. Therefore, the determination of target DNA{sub HBV} and target DNA{sub HCV} could be achieved by monitoring the ECL DNA sensor based on Au NPs-probe DNA/target DNA/CdTe QDs-capture DNA/GNs/GCE composite film. Under the optimum conditions, the ECL intensity of CdTe QDs{sub 551} and CdTe QDs{sub 607} and the concentration of target DNA{sub HBV} and target DNA{sub HCV} have good linear relationship in the range of 0.0005–0.5 nmol L{sup −1} and 0.001–1.0 nmol L{sup −1} respectively, and the limit of detection were 0.082 pmol L{sup −1} and 0.34 pmol L{sup −1} respectively (S/N = 3). The DNA sensor showed good sensitivity, selectivity, reproducibility and acceptable stability. The proposed DNA sensor has been employed for the determination of target DNA{sub HBV} and target DNA{sub HCV} in human serum samples with satisfactory results. - Highlights: • A novel electrochemiluminescence DNA sensor has been developed for the determination of target DNA{sub HBV} and target DNA{sub HCV}. • The DNA sensor shows good sensitivity, reproducibility and stability. • The ECL provided a

  10. Droplet digital PCR-based EGFR mutation detection with an internal quality control index to determine the quality of DNA.

    Science.gov (United States)

    Kim, Sung-Su; Choi, Hyun-Jeung; Kim, Jin Ju; Kim, M Sun; Lee, In-Seon; Byun, Bohyun; Jia, Lina; Oh, Myung Ryurl; Moon, Youngho; Park, Sarah; Choi, Joon-Seok; Chae, Seoung Wan; Nam, Byung-Ho; Kim, Jin-Soo; Kim, Jihun; Min, Byung Soh; Lee, Jae Seok; Won, Jae-Kyung; Cho, Soo Youn; Choi, Yoon-La; Shin, Young Kee

    2018-01-11

    In clinical translational research and molecular in vitro diagnostics, a major challenge in the detection of genetic mutations is overcoming artefactual results caused by the low-quality of formalin-fixed paraffin-embedded tissue (FFPET)-derived DNA (FFPET-DNA). Here, we propose the use of an 'internal quality control (iQC) index' as a criterion for judging the minimum quality of DNA for PCR-based analyses. In a pre-clinical study comparing the results from droplet digital PCR-based EGFR mutation test (ddEGFR test) and qPCR-based EGFR mutation test (cobas EGFR test), iQC index ≥ 0.5 (iQC copies ≥ 500, using 3.3 ng of FFPET-DNA [1,000 genome equivalents]) was established, indicating that more than half of the input DNA was amplifiable. Using this criterion, we conducted a retrospective comparative clinical study of the ddEGFR and cobas EGFR tests for the detection of EGFR mutations in non-small cell lung cancer (NSCLC) FFPET-DNA samples. Compared with the cobas EGFR test, the ddEGFR test exhibited superior analytical performance and equivalent or higher clinical performance. Furthermore, iQC index is a reliable indicator of the quality of FFPET-DNA and could be used to prevent incorrect diagnoses arising from low-quality samples.

  11. Classification of human cancers based on DNA copy number amplification modeling

    Directory of Open Access Journals (Sweden)

    Knuutila Sakari

    2008-05-01

    Full Text