WorldWideScience

Sample records for na primere splavov

  1. Addition of Na2CO3 Improves the Shelf Life of Experimental 4-META Self-etch Primer.

    Science.gov (United States)

    Matsumoto, Hiro; Yamamoto, Takatsugu; Hanabusa, Masao; Momoi, Yasuko; Hayakawa, Tohru

    2017-01-01

    The objective of this study was to assess the influence of the addition of Na2CO3 on the shelf life and bond strength of 4-META self-etch primer. Two 4-META self-etch primers were experimentally formulated with and without the addition of Na2CO3 (primer A and primer B, respectively). The primers were stored at 37°C for several periods of time after formulation. Clearfil SE Bond Primer (Kuraray Noritake Dental) was used as a control. A composite was bonded to bovine dentin using a combination of the primer and a bonding agent (Clearfil SE Bond), and the shear bond strengths were measured. Changes in the pH of the experimental primers were monitored and macroscopic observations were made as a function of the storage periods. With 0-day storage, the bond strength of primer A was equivalent to that of primer B and significantly lower than that of Clearfil SE Primer. The bond strengths of primer A were stable during 90-day storage; by contrast, the bond strengths of primer B significantly decreased during 7-day storage. primer A exhibited stable pH values during 180-day storage; primer B exhibited significantly lower pH than primer A with 0-day storage and discolored gelation during 7-day storage. By adding Na2CO3, the shelf life of the 4-META self-etch primer was obviously improved without significant deterioration in dentin bond strength. Adjusting the pH to around 4.5 was effective for obtaining sufficient bond strength and hydrolytic stability of the primer.

  2. Avaliação in vitro da microinfiltração na interface selante/esmalte sob a influência de contaminação, emprego de "primer" e tipo de selante In vitro evaluation of sealant microleakage under the influence of contamination, use of primer and type of sealant

    Directory of Open Access Journals (Sweden)

    Ana Lídia CIAMPONI

    1998-04-01

    Full Text Available Este estudo avaliou, in vitro, a microinfiltração na interface selante/esmalte sob a influência de contaminação do meio (saliva, emprego de "primer" (Tenure - Den-Mat e tipo de selante (Concise Light Cured White Sealant - 3M; Fluroshield - Caulk/Dentsply. Os resultados foram obtidos a partir de medidas lineares, utilizando um sistema computadorizado de imagens digitalizadas (IMAGE PLUS. Pôde-se concluir que a contaminação salivar e a utilização de "primer" atuaram de maneira diversa nas diferentes etapas do procedimento clínico; os selantes comportaram-se de maneira semelhante quando submetidos às mesmas condições; o emprego do "primer" favoreceu o escoamento do selante Fluroshield (Caulk/Dentsply nos sulcos e pôde ser observado maior número de bolhas com esse material.This in vitro study investigated the effect of different types of sealants (Concise Light Cured White Sealant - 3M; Fluroshield - Caulk/Dentsply and the use of primer (Tenure - Den-Mat on the microleakage of saliva-contaminated enamel. Sealants were placed on 360 surfaces (occlusal, buccal and lingual of extracted teeth free of caries. After being prepared according to each experimental group, they were thermocycled (5 and 55ºC for 500 and 2.000 cycles. Then they were immersed in a silver nitrate solution (50% and cut in longitudinal slices. The results were described in linear measurements (mm by means of a digital-image analysis system. Contamination and use of primer had different influences when subjected to the different experimental conditions. Both sealants had the same influence on microleakage. Flow of Fluroshield into pit and fissures was improved by use of the primer, and a greater amount of bubbles could be observed in this material.

  3. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  4. K voprosu o roždeniji „tvorčeskoj ikonopisi“ (na primere čechoslovackich rabot J. Rejtlinger)

    Czech Academy of Sciences Publication Activity Database

    Jančárková, Julie

    -, 191/2 (2006), s. 285-294 ISSN 0767-7294. [Pravoslavije i russkoje obščestvo v načalě 3. tysjačeletija. Moskva, 07.12.2005-08.12.2005] Institutional research plan: CEZ:AV0Z90920516 Keywords : icons * Rejtlinger J. Subject RIV: AL - Art, Architecture, Cultural Heritage

  5. „Ritualno” i „struktuirano” odbacivanje u arheološkim interpretacijama: primer sistema za vodosnabdevanje na lokalitetu „Kale” u Krševici

    Directory of Open Access Journals (Sweden)

    Ivan Vranić

    2016-11-01

    Full Text Available Pitanja vezana za rituale, kultove, religiju ili magiju predstavljaju važne ali u značajnoj meri zanemarene i teorijski nedovoljno precizno utemeljene teme u savremenim arheološkim interpretacijama. Cilj rada jeste da na konkretnim primerima potencijalno ritualnih aktivnosti vezanih za izgradnju i moguće „ritualno ubijanje” sistema za vodosnabdevanje na lokalitetu „Kale” u Krševici pokaže kako ovo zanemarivanje nije samo posledica aktuelnosti i trendova o odabiru istraživačkih tema, već se radi o ozbiljnijem problemu koji pokazuje određene nedostatke savremenih pristupa vezanih za arheologiju identiteta i koncepte struktuiranog ili simboličkog odbacivanja.

  6. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  7. Influência das características sociodemográficas e da ocupação dos tempos livres no desempenho na plataforma de treino cognitivo primerCOG

    Directory of Open Access Journals (Sweden)

    José Carlos Teixeira

    2017-05-01

    cognitivas estimulantes destinadas a seniores. Objetivo: Analisar a influência das variáveis escolaridade e idade, e da ocupação dos tempos livres, no desempenho nas atividades do primerCOG. Métodos: Investigação quantitativa não-experimental de carácter transversal. Amostra de 30 seniores cognitivamente saudáveis.  Resultados: Observaram-se associações positivas entre a escolaridade dos participantes e o nível máximo de desempenho em todas as atividades, verificando-se, por outro lado, uma associação negativa do desempenho na maioria das atividades com a idade dos participantes. Adicionalmente, verificou-se que os participantes que praticavam regularmente atividades de tempo livre cognitivamente estimulantes, tiveram melhores desempenhos nas atividades. Conclusões: A confirmação das variáveis com influência no desempenho cognitivo em seniores cognitivamente saudáveis é útil para se compreender o desenvolvimento de demências. Futuramente será importante replicar o estudo com novas variáveis, como o número de horas diárias despendidas nas atividades ou o QI pré-mórbido do participante.

  8. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  11. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  12. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  13. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  14. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  15. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  16. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  17. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  18. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  19. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  20. Influência das características sociodemográficas e da ocupação dos tempos livres no desempenho na plataforma de treino cognitivo primerCOG

    OpenAIRE

    Teixeira, José Carlos; Alecrim, Patrícia; Freitas, Sandra; Silva, Cláudia; Costa, Vanessa

    2017-01-01

    Introdução: A sociedade está a envelhecer rapidamente, consequentemente aumentando a prevalência de demências. Os défices cognitivos relacionam-se com inúmeras variáveis, sendo algumas delas apontadas como possíveis protetoras. Segundo a teoria da reserva cognitiva, a prática de atividades estimulantes ao longo da vida pode ter como efeito a diminuição do risco de demência. Neste contexto, a MediaPrimer está a desenvolver a plataforma de treino cognitivo online primerCOG, com um conjunto de o...

  1. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  2. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  3. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  4. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  5. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  6. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  7. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  8. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  9. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  10. Elektronsko izobraževanje v praksi. Primer programa LOLA

    Directory of Open Access Journals (Sweden)

    Lea Bregar

    2003-12-01

    Full Text Available Slovenija je bila vkljucena v program Phare za studij na da!javo v obdobju od I995 do konca I999 kot ena izmed 11 srednje- in vzhodnoevropskih drzav. Eden od najpomembnejsih cil jev programa Phare je bit razviti človeške vire na podrocju studija na dal javo in odprtega ucenja. v okviru podprojekta Phare Train the Trainers so na Harriot Watt University iz Velike Britanije razvili izobrazevalni program LOLA (ucenje o odprtem ucenju. Leta I999 je bilo organizirano usposab!janje za 400 udeležencev iz 11 drzav Phare. Program LOLAje bit uspdna novost v evropskem izobrazevalnem prostoru ne le zaradi svojih vsebin, temvee tudi zaradi inovativne didaktike, sa} je bit celoten program oblikovan in izvajan kot 'on-line' program. V Clanku je na kratko predstavljen izobrazevalni program LOLA in izkusnje z njegovim izvajanjem kot primer e-izobrazevanja v praksi. Clanek avtorici zakljucujeta s predstavitvijo svojih pogledov na nadaljnje izvajanje programa LOLA in razvoj e-izobrazevanja v Sloveniji ter poudarjata potrebo po kakovostno doloceni in jasni strategiji na podrocju studija na daljavo, odprtega ucenja in e-izobrazevanja v Sloveniji.

  11. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  12. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  13. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  14. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  15. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  16. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  17. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  18. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  19. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  20. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  1. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  2. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  3. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  4. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  5. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  6. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  7. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  8. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  9. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  10. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  11. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  12. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  13. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  14. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  15. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  16. Effect of dentin primers containing N-methylolacrylamide or N-methylolmethacrylamide on dentin pretreatment.

    Science.gov (United States)

    Fukushima, T; Itoh, T; Inoue, Y; Kawaguchi, M; Miyazaki, K

    1999-07-01

    The effect of experimental dentin primers containing N-methylolacrylamide (MEAA) or N-methylolmethacrylamide (MEMA) on the bonding of three commercial light-cured resin composite systems [Restorative Z 100 (Scotchbond), Palfique Estelite (Macbond) and Photo Clearfil A (Clearfil Photobond)] to etched dentin was investigated. Water solutions of 35% hydroxyethyl methacrylate (HEMA). 50% MEAA or 30% MEMA were used as dentin primers. The dentin etched with 10% phosphoric acid solution was pretreated with dentin primers for 30 s. The resin composite systems were applied in a Teflon tube positioned onto pretreated dentin surfaces. After water immersion for 1 day, the shear bond strengths were measured. The thicknesses of hybrid layers at dentin-resin interfaces treated with 6 mol/l HCl and 1% NaOCl were measured by scanning electron microscopy. The dentin primer pretreatment increased the bond strengths of all resin composite systems. For Macbond and Clearfil Photobond, the bond strengths (14.2-26.5 MPa) with MEAA and MEMA were higher than those (10.5 and 17.8 MPa) with HEMA. All hybrid layer thicknesses were 1-1.5 microns after HCl immersion. The hybrid layers after NaOCl immersion become narrower. The main fracture pattern of specimens exhibiting high bond strengths (more than 14.2 MPa) was dentin cohesive fracture after bond test. For Macbond and Clearfil Photobond, the layers of specimens pretreated with MEAA and MEMA were clearly thicker than those pretreated with HEMA after NaOCl immersion. MEAA and MEMA solutions were more effective in improving the bond strength of Macbond and Clearfil Photobond to etched dentin than was HEMA. Macbond and Clearfil Photobond created good hybrid dentin layers which could resist NaOCl-attack when MEAA and MEMA solutions were used as dentin primers.

  17. A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

    Science.gov (United States)

    Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

    2017-08-01

    The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

  18. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  19. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  20. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  1. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, L.S.; Garcia, G. [UASLP, San Luis Potosi (Mexico). Inst. of Metallurgy]|[UNLP, La Plata (Argentina); Lopez, C. [Univ. Autonoma de Campeche (Mexico)

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  2. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  3. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  4. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    International Nuclear Information System (INIS)

    Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

    2011-01-01

    Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

  5. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  6. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  7. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  8. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  9. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  10. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  11. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  12. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  13. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  14. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  15. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  16. Zasebna razveza zakonske zveze - primer Japonska

    OpenAIRE

    Gregorič, Maruša

    2017-01-01

    V diplomskem delu so primerjane razlike oblik razvez zakonske zveze v Sloveniji in razvez zakonske zveze na Japonskem, s posebno osredotočenostjo na zasebno razvezo zakonske zveze na Japonskem. Razveza zakonske zveze je eden izmed načinov prenehanja zakonske zveze. V Sloveniji sta urejeni dve obliki razvez zakonske zveze in sicer sporazumna razveza in razveza na podlagi tožbe. Predlogu za sporazumno razvezo zakonca priložita sporazume o varstvu, vzgoji in preživljanju skupnih otrok, o pr...

  17. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  18. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies

    Directory of Open Access Journals (Sweden)

    Edelheit Oded

    2009-06-01

    Full Text Available Abstract Background In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. Results In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95°C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC subunits. The method has been tested for 1–3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. Conclusion The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  19. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.

    Science.gov (United States)

    Edelheit, Oded; Hanukoglu, Aaron; Hanukoglu, Israel

    2009-06-30

    In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95 degrees C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC) subunits. The method has been tested for 1-3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  20. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  1. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  2. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  3. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  4. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  5. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  6. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  7. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  8. Associação entre ganho de peso no primeiro ano de vida com excesso de peso e adiposidade abdominal na idade pré-escolar Asociación entre ganancia de peso en el primer año de vida con exceso de peso y de adiposidad abdominal en la edad pre-escolar Association between weight gain in the first year of life with excess weight and abdominal adiposity at preschool age

    Directory of Open Access Journals (Sweden)

    Mariane Leite Bertotto

    2012-12-01

    Full Text Available OBJETIVO: Avaliar se a mudança no escore Z do índice de massa corpórea por idade >0,67 no primeiro ano de vida se associou ao excesso de peso na idade pré-escolar. MÉTODOS: Estudo de coorte aninhado a ensaio de campo randomizado realizado na cidade de São Leopoldo, no Rio Grande do Sul. Foram coletados dados de peso e estatura das crianças ao nascimento, dos seis aos oito meses e dos 12 aos 16 meses. Aos três e aos quatro anos, além destes dados aferiu-se a circunferência da cintura. Calculou-se o ganho de peso pela diferença no escore Z do índice de massa corpórea/idade dos 12 até os 16 meses em relação ao índice de massa corpórea/idade ao nascimento, adotando-se ponto de corte >0,67 para ganho de peso excessivo. A relação cintura/estatura foi realizada, considerando-se excesso de adiposidade central se valores >0,5. Utilizou-se a análise multivariada para o teste da associação entre os desfechos e as variáveis independentes. RESULTADOS: A prevalência do ganho de peso excessivo no primeiro ano de vida foi de 29,5% de um total de 338 crianças. Após ajuste para as variáveis sexo, grupo, peso ao nascer, tempo de aleitamento materno exclusivo e índice de massa corpórea da mãe, a mudança no escore Z >0,67 do nascimento até os 12 a 16 meses apresentou-se como fator de risco para o excesso de peso (RR 2,81; IC95% 1,53-5,16 e elevada relação cintura/altura na idade pré-escolar (RR 2,10; IC95% 1,19-3,72. CONCLUSÕES: O ganho de peso excessivo no primeiro ano de vida está associado ao excesso de peso e à elevada adiposidade abdominal na idade pré-escolar.OBJETIVO: Evaluar si el cambio en el escore Z del Índice de Masa Corporal (IMC por edad >0,67 en el primer año de vida se asoció al exceso de peso en la edad pre-escolar. MÉTODOS: Estudio de cohorte aunado a ensayo de campo aleatorio realizado en la ciudad de São Leopoldo (Rio Grande do Sul. Se recogieron datos de peso y estatura de los niños al nacer, 6 a 8 y

  9. An electrochemical study of corrosion protection by primer-topcoat systems on 4130 steel with ac impedance and dc methods

    Science.gov (United States)

    Mendrek, M. J.; Higgins, R. H.; Danford, M. D.

    1988-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac impedance method is applied to six systems of primer coated and primer topcoated 4130 steel. Two primers were used: a zinc-rich epoxy primer and a red lead oxide epoxy primer. The epoxy-polyamine topcoat was used in four of the systems. The EG and G-PARC Model 368 ac impedance measurement system, along with dc measurements with the same system using the polarization resistance method, were used to monitor changing properties of coated 4230 steel disks immersed in 3.5 percent NaCl solutions buffered at pH 5.4 over periods of 40 to 60 days. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for the resistors and capacitors, that can be assigned in the equivalent circuit following a least-squares analysis of the data, describe changes that occur on the corroding metal surface and in the protective coatings. Two equivalent circuits have been determined that predict the correct Bode phase and magnitude of the experimental sample at different immersion times. The dc corrosion current density data are related to equivalent circuit element parameters. Methods for determining corrosion rate with ac impedance parameters are verified by the dc method.

  10. An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

    Science.gov (United States)

    Mendrek, M. J.

    1992-01-01

    A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

  11. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  12. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  14. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  15. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  16. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  17. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  18. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  19. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  20. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  1. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  2. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  3. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  4. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  5. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)

    Badar‑uz‑Zaman

    2012-08-01

    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.

  6. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  7. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  8. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  9. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  10. Mãe adolescente cuidando do filho na primeira semana de vida La madre adolescente cuidando al niño en la primer semana de vida The adolescent mother and the care of her child in the first week of life

    OpenAIRE

    Keli Regiane Tomeleri; Sonia Silva Marcon

    2009-01-01

    Este estudo objetivou compreender a experiência de mães adolescentes no cuidado ao filho na primeira semana de vida. Participaram seis adolescentes, acompanhadas no domicílio, no período de fevereiro a outubro de 2007. Para a coleta de dados foram utilizadas entrevistas semi-estruturadas e observação participante. A Teoria da Diversidade e Universalidade do Cuidado Cultural foi usada como referencial teórico. Os resultados revelaram que a experiência do cuidado é vivenciada de formas diversas...

  11. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  12. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  13. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  14. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  15. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. The effect of phosphoric and phosphonic acid primers on bone cement bond strength to total hip stem alloys.

    Science.gov (United States)

    Jakubowitz, Eike; Liehn, Louisa; Jahnke, Alexander; Wöstmann, Bernd; Rickert, Markus; Niem, Thomas

    2017-05-01

    Aseptic loosening at alloy-cement interfaces constitutes a main failure mechanism of cemented total hip replacements (THR). As a potential solution we investigated the effect of metal primers containing phosphoric and phosphonic acid on shear bond strength (SBS) of bone cement to THR alloys (CoCrMo, TiAlNb) and pure tin (Sn) substrates (20×8×3 mm). Metal surfaces were modified by polishing or Al 2 O 3 blasting and primer application. Substrates without primer treatment served as references. Cylindrical cement pins (Ø 5mm) were polymerised onto substrate surfaces and aging (1, 5, 14 and 150 days) was simulated in aqueous NaCl solution (0.9%) before SBS determination and failure mode evaluation. Regardless of surface roughness and aging time, SBS for THR alloys and Sn was always significantly higher with primer treatment. Compared to untreated reference specimens (≤0.2MPa) SBS values increased even up to 350 fold (TiAlNb, 14 days) or 400 fold (CoCrMo, 5 days). In general, the phosphoric acid containing primer revealed significant higher SBS values on THR alloys compared to the phosphonic acid containing one. Al 2 O 3 blasted specimens showed generally higher SBS values than polished ones with the exception of Sn which showed high SBS values in general. With primer treatment on polished Sn a significant reduction of SBS could not be detected even up to 150 days, whereas THR alloys showed only an SBS improvement in the short term (≤14 days). A NaCl-pitting corrosion probably led to an increasing and durable SBS on polished Sn surfaces over time. Compared to modern THR in clinical practice that shows survival rates of 10, 15, 20 or more years, the receivable bond strength enhancements described in this study appeared to be very short. The improved SBS on THR alloys lasted only a few days before it was lost again. In contrast, the phosphoric acid primer treatment of polished Sn appeared to be very promising and may play a key role in further investigations dealing

  17. Çoklu Primer Tümörler - Tek Merkez Deneyimi

    Directory of Open Access Journals (Sweden)

    Gökşen İnanç İmamoğlu

    2017-12-01

    Full Text Available Amaç: Onkolojik hastalıkların erken tanı ve tedavisinde yeni gelişmeler hayatta kalma oranlarının artmasına neden olsa da, artmış sağ kalım oranlarına bağlı olarak gelişen uzun takipler sırasında ikinci primer maligniteler ortaya çıkabilmektedir. İkincil primer tümörlerin gelişimi için birçok faktör vardır. En önemlisi, yaşlı hastalar ın uzun vadede kanserojenlere maruz kalma olasılıkları daha yüksektir. Çoklu primer tümörler, genellikle iki malignite tanısı arasındaki zaman çizelgesine bağlı olarak metakron veya senkron olarak görülür. Senkron hastalıklar sıklıkla benzer karsinojenlere maruz kalma sonucu oluşsa da, metakron olanlar daha çok primer tümörün tedavisine bağlı advers etkilerle ilişkili olabilir. Bu tek merkezli çalışma, Ocak 2007 ile Aralık 2016 arasında multipl primer tümörlü hastaların klinikopatolojik özelliklerini araştırmayı amaçladı ve bunlardan 20'si senkron, 36'sı metakron olarak toplam 56 hasta dahil edildi. En yaygın kanser çiftlerinin erkeklerde kolon-akciğer ve prostat-mesane, kadınlarda meme-kolon ve meme-tiroid olduğu tespit edilmiştir. Yöntemler: Ocak 2007 ile Aralık 2017 tarihleri arasında merkezimizde takip edilen ÇPT’ lü hastaların dosyaları retrospektif olarak incelendi, 56 hastada multiple primer tümör olduğu tespit edildi. Hastaların cinsiyetler, yaşları tespit edildi. Tümörün hangi organlarda oluştuğu, ne zaman geliştiği, bulunabilen etyolojik veriler, sağ kalım oranları araştırıldı. Tüm istatistiksel analizler Package for Social Sciences (SPSS v 15.0, SPSS Inc., Chicago, IL, USA ile yapıldı. Sonuç: Senkron hastalıklar genellikle benzer kanserojenlere maruz kalmanın bir sonucu olarak ortaya çıkarken, metakronöz hastalıkların primer tümörlerin tedavisinin yan etkileri ile ilişkili olması muhtemeldir

  18. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  19. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  20. Factors that affect large subunit ribosomal DNA amplicon sequencing studies of fungal communities: classification method, primer choice, and error.

    Directory of Open Access Journals (Sweden)

    Teresita M Porter

    Full Text Available Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1 a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN; 2 a composition-based method (Ribosomal Database Project naïve bayesian classifier, NBC; and, 3 a phylogeny-based method (Statistical Assignment Package, SAP. We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50-100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys.

  1. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  2. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  3. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  4. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  5. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  6. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  7. Tensões cotidianas na transição da primeira série: um enfoque de desenvolvimento Tensiones cotidianas en la transición del primer año de la enseñanza primaria: un enfoque de desarrollo Daily hassles during the transition period to the first grade of the primary school: a developmental view

    Directory of Open Access Journals (Sweden)

    Edna Maria Marturano

    2008-03-01

    Full Text Available Tensões cotidianas na transição da 1ª série do ensino fundamental são o foco deste artigo. Seu objetivo é formular, com base no conhecimento disponível sobre estresse psicossocial na infância, um esquema teórico para gerar hipóteses e integrar resultados de pesquisas sobre o estresse da transição, em uma perspectiva de desenvolvimento. O texto está subdividido em três seções. A primeira focaliza o estresse psicossocial na infância, em quatro áreas de pesquisa: relação entre estresse psicossocial e ajustamento; tensões cotidianas; enfoque de desenvolvimento no estudo da relação entre estresse e ajustamento; a escola como fonte de estresse. Na segunda, apresentam-se pesquisas sobre a transição da primeira série que contribuem com achados indiretos sobre o enfrentamento da transição por parte das crianças. Na última seção, apresenta-se o esquema conceitual, articulando tarefas adaptativas da transição e domínios de tensões cotidianas, com previsões sobre o impacto da transição no desenvolvimento. Temas de pesquisa são sugeridos a partir do esquema proposto.Tensiones cotidianas en la transición del 1er año de la Enseñanza Primaria son el foco de este artículo. Su objetivo es formular, con base en el conocimiento disponible sobre estrés psicosocial en la infancia, un esquema teórico para generar hipótesis e integrar resultados de investigaciones sobre el estrés de la transición, en una perspectiva de desarrollo. El texto está subdividido en tres secciones. La primera focaliza el estrés psicosocial en la infancia, en cuatro áreas de investigación: relación entre estrés psicosocial y ajuste; tensiones cotidianas; enfoque de desarrollo en el estudio de la relación entre estrés y ajuste; la escuela como fuente de estrés. En la segunda, se presentan investigaciones sobre la transición del 1er año de la Enseñanza Primaria que contribuyen con hallazgos indirectos sobre el enfrentamiento de la

  8. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  9. Mãe adolescente cuidando do filho na primeira semana de vida La madre adolescente cuidando al niño en la primer semana de vida The adolescent mother and the care of her child in the first week of life

    Directory of Open Access Journals (Sweden)

    Keli Regiane Tomeleri

    2009-06-01

    Full Text Available Este estudo objetivou compreender a experiência de mães adolescentes no cuidado ao filho na primeira semana de vida. Participaram seis adolescentes, acompanhadas no domicílio, no período de fevereiro a outubro de 2007. Para a coleta de dados foram utilizadas entrevistas semi-estruturadas e observação participante. A Teoria da Diversidade e Universalidade do Cuidado Cultural foi usada como referencial teórico. Os resultados revelaram que a experiência do cuidado é vivenciada de formas diversas. Algumas adolescentes desenvolvem os cuidados com segurança, para outras, outras com medo e insegurança, não assumindo os cuidados de imediato. As mães das adolescentes serviram como suporte, desenvolvendo os cuidados e inserindo as filhas gradativamente na prática, fazendo com que as adolescentes assumissem integralmente os cuidados.Este estudio tuvo como objetivo comprender la experiencia de madres adolescentes en el cuidado del hijo en la primera semana de vida, a través del acompañamiento en el domicilio. Participaron seis adolescentes, acompañadas en el período de febrero a abril de 2007. Para la recolección de datos fueron utilizadas entrevistas semi-estructuradas y observación participante. La Teoría de la Diversidad y Universalidad del Cuidado Cultural fue utilizada como referencia teórica. La experiencia del cuidado fue vivenciada de diferentes formas. Para algunas adolescentes los cuidados fueron desarrollados con seguridad, para otras, repletos por miedo e inseguridad, no asumiendo los cuidados de inmediato. Las madres de las adolescentes sirvieron como soporte, desarrollando los cuidados e insiriendo a las hijas gradualmente en la práctica, haciendo con que las adolescentes asumieran integralmente los cuidados.This study aims at understanding the experience of adolescent mothers in taking care of her child in the first week after birth by domiciliary accompaniment. Six adolescents participated, accompanied between February

  10. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  11. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  12. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  13. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  14. Moessbauer spectroscopic study of corrosion products beneath primer coating containing anticorrosive pigments

    International Nuclear Information System (INIS)

    Kumar, A.V.R.; Nigam, R.K.

    1998-01-01

    The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)

  15. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  16. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette

    2014-05-01

    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  17. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  18. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  20. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  1. Onchocercal DNA amplification using beta actin gene primers ...

    African Journals Online (AJOL)

    Onchocercal DNA amplification using beta actin gene primers compared with first internal transcribed spacer sequences for monitoring onchocerciasis eradication strategy. ... Out of the 12 amplicons in agarose gel, there were 6 sharp and 6 faint bands of 100bp molecular weight as documented. The sharp bands included 3 ...

  2. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  3. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  4. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545–549. Table 1.

  5. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  6. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... 500. Figure 1. PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using RAPD primer GLC-07. M = Molecular size marker (100 bp DNA ladder, Gene Link, USA). important crops species including wheat (T. aestivum L.). Among the DNA markers, randomly amplified.

  7. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  8. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  9. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  10. OGLAŠEVANJE NA SOCIALNEM OMREŽJU FACEBOOK, NA PRIMERU SPLETICNA.SI

    OpenAIRE

    Reisman, Nina

    2011-01-01

    Internet je od svojega razvoja dolgo časa obstajal kot prostor za enostransko komunikacijo. Isto se je dogajalo na televiziji, radiu in časopisih, kjer je javnost sprejemala informacije, ki jih je nekdo pripravil. Tradicionalni mediji so hitro doumeli, da takšna vrsta komunikacije ni naravna in ne predstavlja najboljšega ohranjanja gledalcev in poslušalcev. Začela se je uporabljati dvosmerna komunikacija. Trenutno v svetu najbolje poznan primer dvosmerne komunikacije je socialno omrežje F...

  11. Uticaj okruženja na rad karijernih praktičara: primer Srbije

    DEFF Research Database (Denmark)

    Maksimovic, Tijana

    2015-01-01

    Career guidance and counselling (CGC) is increasingly being recognised as an important tool in education and employment policy, one that can support and facilitate lifelong learning. The contemporary environment requires individuals to develop their careers in a more flexible and less predictable...

  12. Poučevanje digitalizacije na Madžarskem: primer

    Directory of Open Access Journals (Sweden)

    Tibor Koltay

    2013-09-01

    Full Text Available ABSTRACTPurpose:  The paper aims to present experience in digitisation education at the Hungarian School of Library and Information Science and to indicate various problematic issues and challenges that have arisen. To overcome a part of these problems it is useful to rely on the experience of similar digitisation projects and education programmes in Hungary and abroad.Methodology/approach:  Besides presenting the digitisation education programmeat the Szent Istvan University in Jaszbereny, a review of digitisation projects and digital libraries is given. Details about Hungarian digital resources are provided.Results:  Seven-year experience in the project-based digitisation education incorporated in the LIS programme at the Szent Istvan University, Hungary shows many similarities with courses and programs offered by other European universities. The most serious challenge is to make the education based on real-life tasks.Research limitation:  The results of one type of course work have been studied.Originality/practical implications:  Building a digital library in a small country encounters the same problems as the one presented in the study which puts digitisation into a context, comparable to other European projects.

  13. Effect of primers containing N-methylolacrylamide or N-methylolmethacrylamide on dentin bond durability of a resin composite after 5 years.

    Science.gov (United States)

    Fukushima, T; Inoue, Y; Miyazaki, K; Itoh, T

    2001-03-01

    The effect of experimental dentin primers containing N-methylolacrylamide (MEAA) or N-methylolmethacrylamide (MEMA) on bond durability of a resin composite (Photo Clearfil A) with a bonding agent (Clearfil Photo Bond) to bovine dentin was investigated. The etching agents were 10% maleic acid (10% MA), 10% phosphoric acid (10% PA) and 10% citric acid-3% ferric chloride (10-3 solution). Water solutions of 35% hydroxyethyl methacrylate (HEMA), 50% MEAA or 30% MEMA were used as dentin primers. The etched dentin was pre-treated with the dentin primers for 30s. The resin composite systems were applied in a Teflon tube positioned onto pre-treated dentin surfaces. After water immersion for 1 day and 5 years, the shear bond strengths were measured. The amounts of calcium dissolved with etching agents were measured using atomic absorption spectrometry. The thicknesses of hybrid layers at the dentin-resin interfaces treated with 6 mol/l HCl and 1% NaOCl were measured using scanning electron microscopy. The bond strengths of the specimens (Controls) without primers to dentin etched with 10% MA and 10-3 solution significantly decreased after immersion in water for 5 years (pMEAA-primed dentin were significantly higher than that of the control after 1 day, regardless of the types of etching agents (pMEAA-primed dentin were significantly higher than that of the control, regardless of the types of etching agents (pMEAA-primed dentin were significantly higher than those of the composites to HEMA-primed dentin, regardless of the types of etching agents (pMEAA solution was more effective in improving the bond strength of the controls to etched dentin than was HEMA after 1 day and 5 years. Clearfil Photo Bond created good hybrid dentin layers which could resist NaOCl-attack and showed good dentin bond durability when dentin primers were used, regardless of the type of etching agent.

  14. Moessbauer spectroscopy and FTIR spectroscopy of corrosion products obtained beneath mild steel coated with different phosphate primers

    International Nuclear Information System (INIS)

    Ramesh Kumar, A.V.; Nigam, R.K.; Monga, S.S.; Srivastava, A.K.

    1999-01-01

    In the present study corrosion products obtained on mild steel beneath coating of five different alkyd base phosphate primers (i) zinc phosphate (ii) manganese phosphate (iii) calcium phosphate (iv) barium phosphate and (v) aluminium phosphate and exposed under; (i) immersed conditions in 3% NaCl and (ii) salt spray by 3% NaCl for one month have been discussed. The Moessbauer and FTIR spectroscopic analysis show the corrosion products mainly consist of γ-FeOOH, β-FeOOH and δ-FeOOH. However, under salt spray conditions the downward bend in Moessbauer spectra may be due to FeO x (OH) 3-2x which is generally precipitated as a precursor for α-FeOOH under alternate wet and dry conditions. The ferrous/ferric phosphate was absent under immersed conditions, however, the asymmetry of central doublet of Moessbauer spectrum under salt sprayed condition could be due to ferric hydrogen phosphate. (author)

  15. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Science.gov (United States)

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  19. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  20. Detection of mutated primers and impact on targeted metagenomics results

    OpenAIRE

    Antoine-Lorquin, Aymeric; Mahé, Frédéric; Dunthorn, Micah; Belleannée, Catherine

    2016-01-01

    International audience; High-throughout sequencing platforms are widely used in metabarcoding studies of environmental microbial diversity as they can quickly produce millions of reads. Resulting reads in these studies are clustered into molecular operational taxonomic units (OTUs) and compared statistically. In order to limit the number of spurious OTUs retrieved from samples, eliminating the reads with mutated primers has become the norm. This process has the advantage of not requiring the ...

  1. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  2. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  3. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    provides a framework for examining spending patterns of the federal government by category of activity, rather than by agency or type of financing ...federal spending. Since federal agencies often have diverse, overlapping responsibilities , it is not uncommon for them to be associated with multiple...agency responsible for approximately 96% of spending within the National Defense Budget (050). Defense Primer: The National Defense Budget Function

  4. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  5. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino

    2006-01-01

    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  6. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  7. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  8. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  9. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  10. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  11. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    Directory of Open Access Journals (Sweden)

    Caty Martínez B

    2009-04-01

    Full Text Available Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC y primer intervalo de parto (PIDP en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de variación. En el análisis se consideraron los efectos de año de parto, época de parto, edad al primer parto (no se consideró para EPP, sexo de la cría, grupo racial y peso a los 24 meses. Resultados. La media para la EPP y PIDP fue de 38.9 ± 3.9 meses y 469.2 ± 9 días, respectivamente, donde el efecto época de parto, fue significativo para la duración del PIDP. Los efectos sexo de la cría, peso a los 24 meses y época, no fueron significativos sobre la EPP. Los efectos año de parto, edad al primer parto, sexo de la cría, peso a los 24 meses no fueron significativos sobre el PIDP. Conclusiones. La EPP y PIDP fueron afectados por el año y la época de parto, respectivamente.

  12. Associação entre ganho de peso no primeiro ano de vida com excesso de peso e adiposidade abdominal na idade pré-escolar Asociación entre ganancia de peso en el primer año de vida con exceso de peso y de adiposidad abdominal en la edad pre-escolar Association between weight gain in the first year of life with excess weight and abdominal adiposity at preschool age

    OpenAIRE

    Mariane Leite Bertotto; Júlia Valmórbida; Mônica Cristina Broilo; Paula Dal B. Campagnolo; Márcia Regina Vitolo

    2012-01-01

    OBJETIVO: Avaliar se a mudança no escore Z do índice de massa corpórea por idade >0,67 no primeiro ano de vida se associou ao excesso de peso na idade pré-escolar. MÉTODOS: Estudo de coorte aninhado a ensaio de campo randomizado realizado na cidade de São Leopoldo, no Rio Grande do Sul. Foram coletados dados de peso e estatura das crianças ao nascimento, dos seis aos oito meses e dos 12 aos 16 meses. Aos três e aos quatro anos, além destes dados aferiu-se a circunferência da cintura. Calculou...

  13. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Status of corrosions protection primers for the automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann-Loeser, P. [Adam Opel AG, Ruesselsheim (Germany); Schnell, A. [DaimlerChrysler, Werk Sindelfingen (Germany); Stellnberger, K.H.; Androsch, F.M. [voestalpine Stahl, Linz (Austria); Reier, T. [SZMF, Salzgitter (Germany); Lewandowski, J. [ThyssenKrupp Stahl, Duisburg (Germany); Filthaut, C. [DOC Dortmunder OberflaechenCentrum, Dortmund (Germany); Besseyrias, A. [Arcelor / R and D LEDEPP, Florange (France); Dane, C. [Corus, Ijmuiden (Netherlands); Steinbeck, G. [Steel Institute VDEh, Duesseldorf (Germany)

    2005-07-01

    In Europe, 2.5 - 4 {mu}m Zn-pigmented corrosion protection primers (CPP) are being used by the automotive industry. A short introduction describing the development steps leading up to the state of the art will be given and also the reasons for using it in practice. For some applications it became necessary to try to achieve a significantly higher level of corrosion resistance than this ''first generation'' type coating can offer. It was also important to lower the curing temperature of the paint considerably in order to be able to supply bake-hardening grade steels. This type of corrosion protection primer is now called the ''second generation''. The Opel-production of the Astra-family started using 2{sup nd} generation CPP (4-6 {mu}m) on chromate-free pre-treatment and EG for hood and crash box in 2004. The newest developments show a high potential to lower the coating thickness even further and thus make cost savings possible. The development process is still ongoing and for effective progress, a good mutual basis for laboratory evaluation of properties is of valuable support. In a Steel Institute VDEh working group (Arcelor, Corus, Salzgitter, ThyssenKrupp, voestalpine), test procedures are being generated in order to be able to correctly assess properties such as corrosion resistance, adhesion, peeling-off behavior, etc. An overview of the procedures will be given together with correlations between laboratory results and reality. To round up the paper, corrosion protection primers have a number of potentials which can be utilized by the automotive industry to justify the additional cost. Examples highlighted with results giving evidence of these potentials will be shown. (orig.)

  15. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  16. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  17. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  18. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. [eds.; Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  19. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  20. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  1. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  2. Primer reporte de la familia Cheiridiidae (Arachnida: Pseudoscorpionida en Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alexander Quirós-Rodríguez

    2015-09-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  3. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  4. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  5. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  7. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  8. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  9. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  10. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  11. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  12. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  13. Effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers.

    Science.gov (United States)

    Chen, Liang; Shen, Hong; Suh, Byoung In

    2013-11-01

    Some silane primers and some zirconia primers contain extra resins such as bisphenol A glycol dimethacrylate (BisGMA) in their formulations for better wetting. No studies exist on the bonding properties of zirconia and silane primers, which contain extra resins. The purpose of this study was to investigate the effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers. Silica-base lithium disilicate was etched and treated with BisGMA-incorporated Porcelain Primer, unmodified Porcelain Primer, or resin-containing Kerr Silane. Zirconia ceramic was airborne-particle abraded and treated with BisGMA-incorporated Monobond Plus, unmodified Monobond Plus, or BisGMA-containing ZPrime Plus. After primer treatment and cleaning with ethanol, the contact angles were measured to determine surface change (n=10). Shear bond strength tests were also performed to measure the adhesion strength between resin cements and ceramic surfaces (n=10). Data were statistically analyzed by 1-way ANOVA followed by the Tukey multiple comparison as a post hoc test (significance level .05). The incorporation of BisGMA resin did not significantly influence the bond strength or contact angle of the zirconia primer (P>.05), but it did significantly reduce those of the silane primer (PSilane (22 degrees, 23 MPa) had a similar contact angle and higher bond strength than the control (21 degrees, 18 MPa), but lower than Porcelain Primer (88 degrees, 34 MPa). Resin-containing ZPrime Plus (75 degrees, 29 MPa) had a similar contact angle and higher bond strength than both Monobond Plus (74 degrees, 18 MPa) and the control (15 degrees, 4 MPa). The addition of BisGMA resin significantly inhibited the efficacy of silane-containing porcelain primers but did not affect that of phosphate-containing zirconia primers. Copyright © 2013 Editorial Council for the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  14. Studi Operasi Resin Penukar Ion Dalam Sistem Purifikasi Air Primer Pwr

    OpenAIRE

    Biyantoro, Dwi; Basuki, Kris Tri; Subagiono, Subagiono

    2006-01-01

    STUDI OPERASI RESIN PENUKAR ION DALAM SISTEM PURIFIKASI AIR PRIMER PWR. Telah dilakukan studioperasi resin penukar ion dalam sistem purifikasi air primer PWR. Air pendingin reaktor yang pada awalnya sesuaidengan persyaratan setelah pengoperasian reaktor sering kualitasnya berubah, sehingga harus dimurnikan. Unsurunsurpengotor dalam air primer PWR diidentifikasi sebagai penyebab pengotor seperti korosi, pelepasan produk fisi(Cs137, Sr90, Co60,C14, Tc99), dan pelepasan kembali unsur oleh resin ...

  15. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    -chain, the immunoglobulin kappa light chain, and the c-myc locus. Whereas none of the mutants were found to revert to tRNAPro primer utilization, in two tumors resulting from the injection of the SL3-3 Lys3 mutant the primer binding site was altered to match that of a new primer species, tRNA1,2Lys. In addition...

  16. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  17. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  18. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Uporaba metod mrežnega planiranja na primeru peke vrtankov

    OpenAIRE

    Madžarič, Karla

    2010-01-01

    Raziskava temelji na uporabi metod mrežnega planiranja za primer peke vrtankov. Uporabljeni sta bili dve metodi, in sicer "Critical Path Method" (CPM metoda) in "Program Evaluation and Rewiew Technique" (PERT metoda). S pomočjo omenjenih metod je bil cilj prikazati organizirano načrtovanje in definiranje časovnega zaporedja dejavnosti, nazorno prikazati medsebojne povezave med dejavnostmi in oceniti čas, potreben za izvedbo celotnega projekta ter posameznih aktivnosti pri peki vrtankov. Rezul...

  20. A Primer on Concepts and Applications of Proteomics in Neuroscience.

    Science.gov (United States)

    Hosp, Fabian; Mann, Matthias

    2017-11-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS)-based proteomics, focusing on the analysis of whole proteomes, protein-based interactions, and post-translational modifications. We also discuss how advanced workflows help to unravel spatial, regulatory, and temporal aspects of neuronal systems. These tools and approaches have already led to detailed and quantitative proteomic maps of the brain and its signaling architecture, generating new insights into health and disease. We predict that these new approaches will also accelerate biomarker discovery and contribute to novel therapeutics for neurodegenerative and other brain-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  2. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  3. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  4. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  5. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  6. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  7. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  8. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic].

    Science.gov (United States)

    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata

    2014-01-01

    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  9. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  10. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  11. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Science.gov (United States)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  12. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  13. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  14. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  15. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  16. Supplementary table 6. Primers used in real-time PCR for relative ...

    Indian Academy of Sciences (India)

    pushpa

    Supplementary table 6. Primers used in real-time PCR for relative expression analysis of osa-miR399i and osa-miR530 and their predicted target genes. Gene Locus. Primer sequence. TTGTTGGACATGCTCGTGACA. LOC_Os05g48390. TGGTGACAAGCTTCGGCAA. CGTGTGGAGGATTGTATGCATG. LOC_Os01g54480.

  17. Comparing the Accuracy Rate of Two Different Universal Primers in Enteric Pathogen Diagnosis From Blood

    Directory of Open Access Journals (Sweden)

    Esmaeil Soleimani

    2014-02-01

    Full Text Available Background: Detecting enteric bacteria in blood by culture is a slow assay with low accuracy rate. PCR might be a suitable alternative assay but as several species can cause bacteremia, it is necessary to use universal primers. Objectives: In this study we evaluated and compared two pairs of universal primers in detecting four enteric bacteria in blood, which are common causes of bacteremia in human. Materials and Methods: Standard strains of E. faecalis, S. typhi, E. coli, and S. Aeruginosa, were used in this study. A serially diluted bacterial suspension of all strains was made for inoculation to four sets of defibrinated sheep blood which were used to prepare blood specimens with different bacterial contents for performing routine assay and PCR. PCR was performed using two different universal primers designed from two ribosomal genes, 16sr RNA and 23sr RNA. Results: PCR with 16sr RNA universal primer showed more accuracy rate than both blood culture and PCR with 23sr RNA universal primer. Mean time for performing PCR assay and blood culture was eight and 48 hours, respectively. Conclusions: Both PCR with 16sr RNA and 23sr RNA universal primers have more accuracy rate than blood culture and are faster in detection of bacteremia. PCR with 16sr RNA universal primer is more accurate than both PCR with 16sr RNA universal primer and blood culture for diagnosis of bacteremia.

  18. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... were used, for the screening of the transformed plants (Pietsch et al., 1997). To verify the amplification of extracted DNAs, a pair of primers CDC(a).F/CDC(a).R targeting the cell division control gene was used (Gimenez et al., 2011). The primers were synthetized using Polyplex machine (Gene machine, ...

  19. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang

    2012-03-01

    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  20. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    Science.gov (United States)

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  1. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  2. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... RNA, no direct evidence of interactions with the U-rich anticodon loop of tRNALys3 has been described to date. Here we address the question of the potential role of the interactions between these highly structured regions in the initiation of viral DNA synthesis. To evaluate this we used an antisense...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...

  3. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  4. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    Science.gov (United States)

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  5. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  6. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    Biofilm production contributes to several human diseases, including oral candidiasis. Among the Candida species, Candida albicans is the most prevalent. The expression of virulence genes is implicated in the pathogenic potential of Candida biofilms. However, the evaluation of microbial gene expression from in vivo biofilm samples is not trivial, specifically, assessment via quantitative PCR (qPCR) can be a challenge because of several species present in clinical samples. Hence, the necessity of primers specificity. The aim of this study was to evaluate through in silico and in vitro analyses the specificity of published primers and newly designed primers for C. albicans virulence genes: ALS1, CAP1, CAT1, EFG1, HWP1, LIP3, PLB1, SAP1, SAP4, SOD1, SOD5 and ACT1 (normalizing gene). In silico analysis was performed through a PubMed search of articles with primer sequences that evaluated gene expression of C. albicans. Then, the sequence similarity of twenty-eight primers was checked through BLASTn and ClustalW2. The analysis of secondary structures was performed using mfold. When the primers did not present satisfactory characteristics (absence of secondary structures, not discrepant Tm of forward and reverse sequences and specificity) following in vitro analysis (i.e., end point PCR), new primers were designed using Beacon Designer™ and sequences obtained from the "Candida Genome Database". The selected primers were tested in vitro by end point PCR using a panel of genomic DNA from five different Candida species (C. albicans, Candida glabrata, Candida dubliniensis, Candida krusei, and Candida tropicalis). The resulting PCR products were visualized on agarose gel. qPCR reactions were performed to determine primers' optimal concentration and PCR efficiency. End point PCR demonstrated that published primers for the SAP1 and HWP1 were specific for C. albicans and the one for SOD1 reacted with C. albicans and C. dubliniensis. The sequence of primers designed for ACT1

  7. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    Science.gov (United States)

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  8. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  9. Review of Attachment, play, and authenticity: A Winnicott primer.

    Science.gov (United States)

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  10. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  11. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  12. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  13. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  14. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  15. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  16. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  17. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  18. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  19. RNA Primer Extension Hinders DNA Synthesis byEscherichia coliMutagenic DNA Polymerase IV.

    Science.gov (United States)

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  20. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  1. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  2. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  3. Effects of primers containing thiouracil and phosphate monomers on bonding of resin to Ag-Pd-Au alloy.

    Science.gov (United States)

    Taira, Yohsuke; Kamada, Kohji; Atsuta, Mitsuru

    2008-01-01

    The purpose of the present study was to evaluate the effects of four experimental primers on bond strength between a self-curing luting agent and silver-palladium-gold alloy. The experimental primers were in mixed solutions of a thiouracil primer (Metaltite) and a phosphate primer (Epricord, PM, PE, or PP), which were designated as Metaltite/Epricord, Metaltite/PM, Metaltite/PE, and Metaltite/PP respectively. Three primers (Metal Primer II, V-Primer, and Alloy Primer) were also prepared as controls. Alumina-blasted metal alloys were bonded with acrylic rods. After 5,000 thermocycles, the maximum shear bond strength was obtained with Metaltite/PE (27.8+/-2.4 MPa) and Metaltite/Epricord (27.6+/-5.9 MPa), followed by Metaltite/PP, Alloy Primer, Metaltite, Metaltite/PM, Metal Primer II, V-Primer, and Epricord. PE, PM, and PP showed the lowest bond strength. Results of this study revealed that the combined use of a thiouracil monomer and a phosphate monomer improved adhesive bonding. In this light, clinicians should pay attention to the types of functional monomers dissolved in a primer when fabricating resin-bonded prostheses.

  4. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  5. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus.

    Science.gov (United States)

    Komorowska, B; Malinowski, T; Michalczuk, L

    2010-09-01

    Detection of Apple stem pitting virus (ASPV) using RT-PCR based methods was studied in infected apple and pear trees. Three virus-specific primers (ASPF1CP, ASPF2CP, ASPR3CP) were designed to target the most conservative regions of the coat protein gene of 10 virus isolates in Poland and 7 other ASPV sequences available in GenBank. The suitability of the primer pairs ASPF1CP-ASPR3CP and ASPF2CP-ASPR3CP for detection of 19 virus isolates was checked. Both new primer pairs initiated amplification of a specific product from all sources tested. From 1 to 11 isolates were not detected with the primer sets published previously. Detection of the virus in the samples collected in March, using ASPF1CP-ASPR3CP primer pair, was possible up to 512 times dilution. For the samples collected in July, virus was detected in the extracts from infected plants diluted eight times. More than 100-fold increase of sensitivity could be obtained by semi-nested PCR with primers ASPF2CP-ASPR3CP following the first round with ASPF1CP-ASPR3CP. Identification of virus isolates with different number of deletions in the coat protein gene was possible using RT-PCR with newly designed reverse primer ASPDEL in combination with the published primer ASPV7956. Besides, the comparative analysis of silicacapture-RT-PCR (SC-RT-PCR) versus immunocapture-RT-PCR (IC-RT-PCR) assays was carried out. Few ASPV isolates escaped detection by IC-RT-PCR, while all isolates tested were detected using the SC-RT-PCR with the new primers. Copyright 2010 Elsevier B.V. All rights reserved.

  6. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  7. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  8. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  9. Odnos horora i humora: primer filmova "Hostel" i "Euro Trip"

    Directory of Open Access Journals (Sweden)

    Vesna Trifunović

    2016-03-01

    Full Text Available U radu je reč o dva žanrovski različita filmska ostvarenja u kojima je identifikovan isti stimulans koji u jednom slučaju pokreće horor, a u drugom humor. Kao analitički okvir za razmatranje ovih filmova iskorišćena je teorija Noela Karola o odnosu horora i humora. Cilj je da se na primeru iz oblasti popularne kulture predstavi ovaj odnos, kao i to da se ukaže na činjenicu da analiza putem pomenute teorije daje mogućnost sagledavanja percepcije i samog stimulansa koji pokreće horor i humor.

  10. Javnost v parkih – med opazovanjem in delovanjem. Primer Pariza

    Directory of Open Access Journals (Sweden)

    Michèle Jolé

    2008-01-01

    Full Text Available Kako naj v načrtovanje ter izgradnjo javnih parkov in vrtov vključimo tudi družbeno dimenzijo? Oziroma natančneje, kako naj uporabnikom in urbanitom določimo vlogo v projektih javnih parkov? Naša hipoteza je, da imajo družbene vede v povezavi s krajani dve vlogi – spoznavno vlogo, ki v civilni družbi opisuje rabo in družbeno dinamiko na delovnem mestu, ter vlogo posrednika (mediatorja med prebivalci in projektanti, predstavniki gradbene industrije ter vzdrževalci parkov. Obe vlogi sta med seboj tesno povezani, in sicer zaradi velike pozornosti, posvečene lokacijam. To pa zahteva empirično obravnavo. Ta je v tem članku etnografska. Metodologijo, ki jo v Parizu uporabljajo že več let, preverjamo z različnimi ameriškimi tehnikami. V članku bomo obravnavali dva primera, in sicer parka Parc Floral de Paris in Les Jardins d’Eole. Sociologijo so vsakič uporabili drugače. Modeli, ki so jih družboslovci uporabili pri obravnavanju parkov, kažejo, da bi morali razmisliti o novi »razdelitvi nalog« med različnimi udeleženci projekta, tudi med prebivalci, ki so hkrati uporabniki in državljani.

  11. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  12. A primer on trace metal-sediment chemistry

    Science.gov (United States)

    Horowitz, Arthur J.

    1985-01-01

    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  13. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  14. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    OpenAIRE

    Mario Antolinez

    2013-01-01

    El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al m...

  15. Oligonucleotide primers for specific detection of actinobacterial laccases from superfamilies I and K.

    Science.gov (United States)

    Fernandes, Tatiana Alves Rigamonte; da Silveira, Wendel Batista; Passos, Flávia Maria Lopes; Zucchi, Tiago Domingues

    2014-08-01

    Although many putative laccase-like genes have been assigned to members of the phylum Actinobacteria, few of the related enzymes have been characterized so far. It is noteworthy, however, that this small number of enzymes has presented properties with industrial relevance. This observation, combined with the recognized biotechnological potential and the capability of this phylum to degrade recalcitrant soil polymers, has attracted attention for bioprospective approaches. In the present work, we have designed and tested primers that were specific for detection of sub-groups of laccase-like genes within actinomycetes, which corresponded to the superfamilies I and K from the classification presented by the laccase and multicopper oxidase engineering database. The designed primers have amplified laccase-like gene fragments from actinomycete isolates that were undetectable by primers available from the literature. Furthermore, phylogenetic alignments suggest that some of these fragments may belong to new laccases-like proteins, and thus emphasize the benefits of designing subgroup-specific primers.

  16. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  17. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  18. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  19. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Directory of Open Access Journals (Sweden)

    Fernando Bastida-González

    2016-01-01

    Full Text Available Nucleoprotein (N gene from rabies virus (RABV is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs via indirect fluorescent antibody (IFA test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers, for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  20. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  1. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  2. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  3. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  4. Self-Etch Environmentally Acceptable Primer Testing (SEEAPT) Deliver Order 0001

    National Research Council Canada - National Science Library

    Joseph, Christopher

    2001-01-01

    .... The focus of the testing was on primer properties. Filiform corrosion, salt fog exposure, pencil hardness, crosshatch adhesion, impact testing, and wet tape adhesion testing were conducted on the 12 candidate systems, along with 4 control systems...

  5. Ceramic bond durability and degradation mechanism of commercial gamma-methacryloxypropyl trimethoxysilane-based ceramic primers.

    Science.gov (United States)

    Aida, Masahiro; Tabei, Naoko; Kimoto, Suguru; Tanimura, Hideki; Takahashi, Haruyoshi; Yaguchi, Takehiro; Nishiyama, Norihiro

    2012-08-01

    To investigate the bond durability and degradation mechanism of various commercial ceramic primers that are based on gamma-methacryloxypropyl trimethoxysilane (gamma-MPTS) and contain various organic additives. The null hypotheses tested were that (1) the type of ceramic primer had no effect on the bond strength after thermocycling and (2) the type of ceramic primer had no effect on the water contact angle after rinsing with THF. The adherent was a silica-based ceramic block used for computer-aided design/computer-aided manufacturing (CAD-CAM). Four commercial ceramic primers, Clearfil Mega Bond Porcelain Bonding kit (CM), Tokuso ceramic primer (TC), GC ceramic primer (CP), and Porcelain Liner M (PL), were compared with a simplified experimental ceramic primer (EP) that comprised gamma-MPTS and an inorganic acid (hydrochloric acid) but no other organic additives. The specimens for the adhesion test were prepared after a dual-curing type resin cement (Link Max) had adhered to the ceramic surfaces treated with each ceramic primer. The bonded specimens were then stored in water at 37 degrees C for 1 day. Then, the bonded specimens were thermocycled between 5 degrees C and 55 degrees C in water baths for 5000 or 10,000 cycles. The dwell time in each water bath and the transfer time were 60 and 7 seconds, respectively. The shear bond strength of resin to the ceramic surface was measured under a crosshead speed of 1.0 mm/minute by a conventional testing machine. Thereafter, the fracture mode for each specimen was determined. In addition, the water contact angle on the treated ceramic surfaces was measured before and after THF using a cotton pellet. As a control, the contact angle on the ground ceramic surface was measured without any ceramic primer. For all samples, thermocycling led to an increase in the frequency of interfacial failure, reflecting reduced mean bond strength of the resin to the treated ceramic surfaces. However, the bond degradation behavior differed

  6. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  7. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...primer alone launches the bullet with a shower of hot particles and gases. Similar attempts with a rifled barrel resulted in just enough force being...performance with novel measurement techniques. Journal of Energetic Materials and Chemical Propulsion. 2013;12(4):361–370. 4. Cup, primer (No. 34

  8. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  10. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  11. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  12. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  13. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  14. GSP: a web-based platform for designing genome-specific primers in polyploids.

    Science.gov (United States)

    Wang, Yi; Tiwari, Vijay K; Rawat, Nidhi; Gill, Bikram S; Huo, Naxin; You, Frank M; Coleman-Derr, Devin; Gu, Yong Q

    2016-08-01

    The sequences among subgenomes in a polyploid species have high similarity, making it difficult to design genome-specific primers for sequence analysis. We present GSP, a web-based platform to design genome-specific primers that distinguish subgenome sequences in a polyploid genome. GSP uses BLAST to extract homeologous sequences of the subgenomes in existing databases, performs a multiple sequence alignment, and design primers based on sequence variants in the alignment. An interactive primers diagram, a sequence alignment viewer and a virtual electrophoresis are displayed as parts of the primer design result. GSP also designs specific primers from multiple sequences uploaded by users. GSP is a user-friendly and efficient web platform freely accessible at http://probes.pw.usda.gov/GSP Source code and command-line application are available at https://github.com/bioinfogenome/GSP CONTACTS: yong.gu@ars.usda.gov or devin.coleman-derr@ars.usda.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  16. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    Science.gov (United States)

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique

    2013-01-01

    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  17. Association of different primers and resin cements for adhesive bonding to zirconia ceramics.

    Science.gov (United States)

    Maeda, Fernando Akio; Bello-Silva, Marina Stella; de Paula Eduardo, Carlos; Miranda Junior, Walter Gomes; Cesar, Paulo Francisco

    2014-06-01

    To evaluate the shear bond strength (SBS) to zirconia ceramics using different associations of primers and resin cements. Two blocks of LAVA zirconia (3Y-TZP) were randomly submitted to an application of three different commercially available primers: Alloy Primer (AP), Z-Prime Plus (ZP), and Signum Zirconia Bond (SZB). Nonprimed specimens were considered controls. After treatment, the 80 specimens (5 mm × 5 mm × 2 mm) were randomly cemented with one of the resin cements: Panavia F, Multilink, seT, and NX3. For cementation, cylinders of resin cement were built on the ceramic surfaces using the SDI SBS apparatus. The specimens were submitted to the SBS test. Fractured surfaces were observed under stereomicroscopy to determine the failure mode, and mean bond strength values were analyzed using the Kruskal-Wallis and Mann-Whitney tests (α = 0.05). Signum Zirconia Bond had the highest SBS compared to all other primers and the control group, regardless of the resin cement used. The highest values were obtained when associating Panavia F with Signum Zirconia Bond. Alloy Primer increased bonding values when associated with seT cement only. When no primer was used, no statistical difference was observed among resin cements. All specimens fractured due to adhesive failure. Signum Zirconia Bond is capable of increasing bonding values of resin cements to zirconia ceramics. Its association with Panavia F shows enhanced results when considering short-term adhesion to zirconia.

  18. Effects of primer containing silane and thiophosphate monomers on bonding resin to a leucite-reinforced ceramic.

    Science.gov (United States)

    Taira, Yohsuke; Sakai, Miyuki; Sawase, Takashi

    2012-05-01

    Silane primers are commonly used for bonding between resin-based luting agents and ceramic restorations. The purpose of the present study was to evaluate the effects of nine silane primers on the bond strength of resin to a leucite-reinforced ceramic. The commercially available dental primers used were five silane primers (GC Ceramic Primer, GP; Clearfil Ceramic Primer, CP; Tokuso Ceramic Primer, TP; Porcelain Liner M, PM; and Monobond Plus, MB). Four experimental primers (MDS, MTS, MDS/MPII, and MTS/MPII) and two control primers (MMA and MMA/MPII) were also prepared. The ceramic specimen was ground with silicon carbide paper, primed, and then bonded to a resin composite disc using a dual-curing luting agent. After a 24-h immersion in water, the shear bond strengths were determined. Shear bond testing revealed that the bond strength was significantly improved with the use of a MTS/MPII primer when compared to MDS, MTS, MMA, MDS/MPII and MMA/MPII. Although no significant differences were detected between GP, CP, PM, and MB, the primers CP, TP, PM, and MTS/MPII exhibited the highest bond strengths, followed by GP and MB, whilst the no-primer control resulted in the lowest values. The maximum bond strengths were obtained with CP, TP, PM, and MTS/MPII. It was suggested that the thiophosphate monomer accelerated the role of the silane monomer. When selecting a primer to bond ceramic restorations, clinicians should be aware that not only the silane monomer but also additional components of the primer considerably affect the bond strength. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  20. A randomised trial comparing the antibacterial effects of dentine primers against bacteria in natural root caries.

    Science.gov (United States)

    Rolland, S L; McCabe, J F; Imazato, S; Walls, A W G

    2011-01-01

    As people are living longer and retaining their teeth into old age, root caries is an increasingly significant problem. A minimally invasive treatment strategy, involving sealing the root caries lesion with an antibacterial resin sealant, could be highly beneficial. The aim of this study was to compare the antibacterial properties of the primers of two proprietary dentine bonding agents, Clearfil SE Bond (SE; Kuraray Medical, Japan) and Clearfil Protect Bond (PB; Kuraray Medical), which contains the antibacterial monomer methacryloyloxydodecylpyridinium bromide. Fifty-two root caries lesions were identified and randomly assigned to a primer. The lesion was cleaned, isolated, sampled with a sharp spoon excavator, a primer applied and a second sample taken. Samples were transported in fastidious anaerobe broth, vortex-dispersed and serial dilutions inoculated onto selective agars. Reduction in colony-forming units (CFU, %) after primer application was calculated for both primers for bacterial growth on each selective agar and compared to a hypothesised mean of 100% (one-sample t test, p < 0.05). No significant differences between primers were seen, indicating efficient bacterial elimination by both materials. Comparing percent reduction between SE and PB for each agar (Mann-Whitney test, p < 0.05), a significantly greater CFU reduction by PB was seen for streptococci but not other bacteria. More lesions exhibited bacterial growth and several lesions demonstrated marked bacterial growth after treatment with SE compared with PB. Therefore, PB appears to exhibit superior antimicrobial properties, particularly against streptococci. Both primers are highly antibacterial towards root caries bacteria and may therefore be suitable for minimally invasive treatment. Copyright © 2011 S. Karger AG, Basel.

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  3. Tensile bond strength of adhesive systems: effects of primer and thermocycling Resistência à tração de sistemas adesivos: efeitos do “ primer” e dos ciclos térmicos

    Directory of Open Access Journals (Sweden)

    Luciana Tibiriçá AGUILAR

    2002-03-01

    Full Text Available The objective of this study was to evaluate the effects of primer and thermocycling on the bond strength of multi-purpose adhesive systems applied to enamel, under tensile stress. The following bonding systems were applied, according to the manufacturers' instructions, on unground enamel buccal surfaces of 96 premolars, with or without the application of primer: Scotchbond MP, OptiBond FL, Amalgambond Plus and OptiBond (dual-cure. A composite resin (Z100, 3M was applied and light-cured in a cast metal hollow cone, which was previously fixed to the enamel surfaces. Half of the sample was subjected to 3,000 thermocycles (5-37ºC; 37-55ºC, dwell time of 60 s, and the other half was stored in water at 37ºC for the same period. The data were treated by means of ANOVA and no significant effects were detected, which indicates that tensile bond strength was not affected by the adhesive systems, application of primer or thermocycling.O objetivo desta pesquisa foi o de verificar o efeito do "primer" e dos ciclos térmicos na resistência da união entre adesivos multiuso e esmalte dental, sob ensaios de tração. Os seguintes sistemas adesivos foram aplicados, de acordo com as instruções dos fabricantes, na superfície vestibular (sem desgaste de 96 pré-molares com ou sem a aplicação prévia do "primer": Scotchbond MP, OptiBond FL, Amalgambond Plus e OptiBond - "dual cure". Após a aplicação do sistema adesivo, foi confeccionado um cone de resina composta (Z100, 3M, e fotoativado dentro de um molde metálico. Metade do total de espécimes foi submetida a 3.000 ciclos térmicos (5-37ºC; 37-55ºC, 60 s de imersão; a outra metade permaneceu imersa em água a 37ºC pelo mesmo tempo dispensado no procedimento anterior. Os dados foram submetidos a uma análise de variância (p = 0,05 e nenhum efeito significante foi detectado, indicando que a resistência de união não foi afetada pelo sistema adesivo, pela aplicação do "primer" ou pelos ciclos térmicos.

  4. Cloning flanking sequence by single-primer PCR in transgenic plants.

    Science.gov (United States)

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  5. Microleakage under metallic and ceramic brackets bonded with orthodontic self-etching primer systems.

    Science.gov (United States)

    Uysal, Tancan; Ulker, Mustafa; Ramoglu, Sabri Ilhan; Ertas, Huseyin

    2008-11-01

    To compare the in vitro microleakage of orthodontic brackets (metal and ceramic) between enamel-adhesive and adhesive-bracket interfaces at the occlusal and gingival sides produced by self-etching primer system with that of conventional acid etching and bonding. Sixty freshly extracted human mandibular premolar teeth were used in this study. The teeth were separated into four groups of 15 teeth each and received the following treatments: Group 1, 37% phosphoric acid gel + Transbond XT liquid primer + stainless steel bracket; Group 2, Transbond Plus Self-Etching Primer (TSEP) + stainless steel bracket; Group 3, 37% phosphoric acid gel + Transbond XT liquid primer + ceramic bracket; Group 4, TSEP + ceramic bracket. After curing, specimens were further sealed with nail varnish, stained with 0.5% basic fuchsine for 24 hours, sectioned and examined under a stereomicroscope, and scored for microleakage for the enamel-adhesive and bracket-adhesive interfaces from both occlusal and gingival margins. Statistical analyses were performed using Kruskal-Wallis and Mann-Whitney U tests. The gingival sides in all groups exhibited higher microleakage scores compared with those observed in occlusal sides for both adhesive interfaces. Enamel-adhesive interfaces exhibited more microleakage than did the adhesive-bracket interfaces. Brackets bonded with self-etching primer system showed significantly higher microleakage at the enamel-adhesive interface of the gingival side. TSEP causes more microleakage between enamel-adhesive interfaces, which may lead to lower bond strength and/or white-spot lesions.

  6. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2017-12-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  7. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  8. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    Science.gov (United States)

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (pzirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  9. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  10. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  11. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin.

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-10-01

    The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (PAg-Pd alloy surfaces presented significantly decreased shear bond strength. Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys.

  12. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  13. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  14. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  15. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  16. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    Science.gov (United States)

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (pcontrol. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  17. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  18. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  19. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  20. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  1. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species

    OpenAIRE

    Sánchez Robles, José Manuel; Talavera Lozano, Salvador; García Castaño, Juan Luis; Terrab Benjelloun, Anass; Navarro Sampedro, Laura; Balao Robles, Francisco J.

    2012-01-01

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other ...

  2. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  3. Primer fármaco antiepiléptico : patrón de uso y efectividad

    OpenAIRE

    Martínez Domeño, Alejandro

    2013-01-01

    Estudiem el primer fàrmac antiepileptic utlitzat en 430 pacients amb epilèpsia, per valorar la seva taxa de retenció, efectivitat i tolerabilitat en el primer any de tractament. El 81% van rebre àcid valproic, carbamazepina o feintoina com primer tractament, tot i que l'ús de la fenitoina ha disminuit significativamen en els últims anys. La taxa de retenció annual és del 87%, sent més altes amb levetiracetam i lamotrigina. Un 40% van presentar recurrències en el primer any, sent major el risc...

  4. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples.

    Science.gov (United States)

    Maheux, Andrée F; Picard, François J; Boissinot, Maurice; Bissonnette, Luc; Paradis, Sonia; Bergeron, Michel G

    2009-07-01

    The analytical performance of 9 different PCR primer sets designed to detect Escherichia coli and Shigella in water has been evaluated in terms of ubiquity, specificity, and analytical detection limit. Of the 9 PCR primer sets tested, only 3 of the 5 primer sets targeting uidA gene and the primer set targeting tuf gene amplified DNA from all E. coli strains tested. However, of those 4 primer sets, only the primer set targeting the tuf gene also amplified DNA from all Shigella strains tested. For the specificity, only the primer sets targeting the uidA gene were 100% specific although the primer sets targeting 16S rRNA, phoE, and tuf genes only amplified Escherichia fergusonii as non-specific target. Finally, the primer set targeting the 16S-ITS-23S gene region, was not specific as it amplified DNA from many other Enterobacteriaceae species. In summary, only the assay targeting the tuf gene detected all E. coli/Shigella strains tested in this study. However, if it becomes important to discriminate between E. coli and E. fergusonii, assays targeting the uidA gene would represent a good choice although none of them were totally ubiquitous to detect of the presence of Shigella strains.

  5. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  6. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  7. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  8. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  9. [Aging effect of one bottle-type ceramic primer on bonding efficacy of resin cement].

    Science.gov (United States)

    Goto, Haruhiko

    2008-04-01

    To understand the degradation mechanisms of commercially available one bottle-type ceramic primer, we prepared one bottle-type experimental ceramic primer consisting of gamma-methacryloxy-propyl-trimethoxysilane, gamma-MPTS, and 90% ethanol solution. The effects of aging of the experimental primer on the hydrolysis and condensation behavior of gamma -MPTS and on the bonding efficacy of gamma-MPTS at the interface between cement and ceramic were studied. We used two lamina bond porcelain primers (LB), that had been aged for 20 months and newly purchased. Experimental primer was aged at 20 degrees C. After aging, we measured 29Si NMR spectrum of the gamma-MPTS and the shear bond strength of the cement to silane-treated ceramic by varying aging periods. When the LB was aged for 20 months, the mean bond strength decreased from 26 to 11 MPa. To understand the degradation mechanism in the bond strength, the effects of aging of experimental primer on molecular species of gamma-MPTS were examined. With prolonging its aging period, the methoxy group of the silicone functional portion in the gamma-MPTS hydrolyzed and the hydrolyzed gamma-MPTS species condensed together. The molecular weight of condensed gamma-MPTS species increased. On the other hand, when the dimer species of gamma-MPTS were produced, a maximum mean bond strength of 28 MPa was observed. Thereafter, the bond strength dropped down and leveled off at 16 MPa. When the LB was aged for 20 months, the bond strength dramatically decreased. This decrease in the mean bond strength was probably attributed to ester exchange reaction of the methoxyl group in the gamma-MPTS by the ethanol used as diluent solvent.

  10. Vpliv organizacije vzgojno-izobraževalnega procesa likovne umetnosti na dosežke učencev

    OpenAIRE

    Zorjan, Marlene

    2016-01-01

    Pri pouku likovne umetnosti ugotavljamo, da so šole premalo fleksibilne pri oblikovanju urnika. Pouk likovne umetnosti lahko poteka v različnih oblikah, na primer posamezno po eno uro na teden ali strnjeno po dve šolski uri, torej v blok uri na štirinajst dni. V praksi ugotavljamo, da so zaradi organizacije učnega procesa razlike v likovnem spominu, saj je začetek reševanja likovne naloge časovno omejen, snovanje idej učencev pa je prekinjeno, zato pri nadaljevanju likovne naloge učitelj potr...

  11. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  12. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...

  13. Razvoj in analiza zmogljivosti rešitev na osnovi ogrodja ASP .NET Core

    OpenAIRE

    Jerenko, Tomi

    2017-01-01

    V diplomskem delu smo spoznali principe in dobre prakse oblačnega računalništva ter lastnosti ogrodij za razvoj spletnih aplikacij. Kot glavno temo diplomskega dela smo predstavili kratko zgodovino ogrodja ASP .NET Core, nato pa še principe delovanja funkcionalnosti in primere uporabe. V praktičnem delu diplomskega dela smo prikazali potek namestitve aplikacije, zgrajene z ogrodjem, na strežnike Apache, Nginx in IIS ter za vsakega izvajali obremenitvene teste, katerih rezultate smo na koncu p...

  14. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  15. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  16. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... A set of ten diverse mulberry accessions was used for screening the primers and standardizing PCR conditions. The PCR amplifications were carried out in 10 µl reaction volume, containing 10 ng template DNA, 1X DreamTaqTM Green Buffer (ThermoFisher. Scientific, Lithuania), 0.1 mM of each dNTPs, ...

  17. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  18. Universal primers for plasmid detection and method for their relative quantification in phytoplasma-infected plants

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Sarkisova, Tatiana; Čurnová, L.

    2011-01-01

    Roč. 64, Suppl. (2011), s. 25-26 ISSN 1721-8861 R&D Projects: GA MZe QH91224 Institutional research plan: CEZ:AV0Z50510513 Keywords : Plasmid * universal primers * rep gene Subject RIV: EE - Microbiology, Virology Impact factor: 0.592, year: 2011

  19. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  20. A Primer on Polymer Nomenclature: Structure-Based, Sourced- Based, and Trade Names

    Science.gov (United States)

    Cheng, H. N.; Howell, Bob A.

    2017-01-01

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structurebased and source-based nomenclatures, together with trivial and trade…

  1. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  2. Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers.

    Science.gov (United States)

    Marincevic-Zuniga, Yanara; Gustavsson, Inger; Gyllensten, Ulf

    2012-10-10

    Multiply-primed rolling circle amplification (RCA) is a suitable technique for amplification of circular templates and has been used to identify novel human papillomaviruses (HPV). In this study we develop an efficient RCA for whole genome amplification of HPV using HPV-specific primers in clinical samples and establish a protocol for whole genome sequencing using the Sanger method. Amplification of cloned HPV-genomes by RCA was compared using specific primers against random hexamers. Using HPV-specific primers increased the effectiveness on average 15.2 times and the enrichment of HPV relative to human gDNA on average 62.2 times, as compared to using random hexamer. RCA products were sequenced without need for cloning, even when using low-input amounts. The technique was successfully used on 4 patient samples from FTA cards, to generate whole HPV-genome sequences. Degenerated HPV-specific primers for RCA produce DNA of sufficient quality and quantity suitable for sequencing and other potential downstream analyses. Copyright © 2012. Published by Elsevier Inc.

  3. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  4. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  5. ANALISIS PRODUCT MAPPING DAYA SAING EKSPOR PRODUK PRIMER INDONESIA DAN CHINA

    Directory of Open Access Journals (Sweden)

    Sulthon Sjahril Sabaruddin

    2015-11-01

    Full Text Available This research attempts to analyze the mapping competition of the Indonesian and Chinese primary products in order to identify and map the strengths and weaknesses of Indonesian products vis-à-vis China. To examine this, the study uses tools such as the SMART Model (Software for Market Analysis and Restrictions on Trade, Social Accounting Matrix 2008 (SAM 2008, Normalized Revealed Comparative Advantage (NRCA and the Product Mapping. The results of the competition analysis found that Indonesia which rely on the export of primary products, in overall it is predicted to win the competition against China as the Indonesian primary products have better competitiveness than China. However, in the future, the competition will be fiercer, therefore, Indonesia should make efforts to improve further the competitiveness of Indonesian exports. Penelitian ini dimaksudkan untuk mengevaluasi peta persaingan produk primer Indonesia dan China guna mengidentifikasi dan memetakan kekuatan dan kelemahan produk Indonesia dalam persaingan dengan produk-produk primer asal China. Guna menelaah studi ini, beberapa perangkat dimanfaatkan yakni SMART Model (Software for Market Analysis and Restrictions on Trade, Sistem Neraca Sosial Ekonomi 2008 (SNSE 2008, Normalized Revealed Comparative Advantage (NRCA dan Product Mapping. Hasil analisis peta persaingan kedua negara, Indonesia yang mengandalkan ekspor produk primer diperkirakan secara keseluruhan unggul dibandingkan produk primer dari China karena Indonesia memiliki daya saing yang lebih baik dibandingkan China. Namun demikian, perlu diperhatikan bahwa persaingan ke depan akan berlangsung semakin ketat, oleh karena itu Indonesia perlu melakukan upaya untuk meningkatkan daya saing ekspor Indonesia.

  6. Book review: Estimation of parameters for animal populations: A primer for the rest of us

    Science.gov (United States)

    Post van der Burg, Max

    2016-01-01

    No abstract available.Estimation of Parameters for Animal Populations: A Primer for the Rest of Us. Larkin A. Powell and George A. Gale. 2015. Caught Napping Publications, Lincoln, Nebraska, USA. 239 pages. (http://larkinpowell.wixsite.com/larkinpowell/estimationof-parameters-for-animal-pop). ISBN: 978-329-06151-4.

  7. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  8. Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries.

    Science.gov (United States)

    Shagin, Dmitriy A; Turchaninova, Maria A; Shagina, Irina A; Shugay, Mikhail; Zaretsky, Andrew R; Zueva, Olga I; Bolotin, Dmitriy A; Lukyanov, Sergey; Chudakov, Dmitriy M

    2017-06-05

    Recently we proposed efficient method to exclude undesirable primers at any stage of amplification reaction, here termed NOPE (NOnsense-mediated Primer Exclusion). According to this method, added oligonucleotide overlapping with the 3'-end of unwanted amplification primer (NOPE oligo) simultaneously provides a template for its elongation. This elongation disrupts specificity of unwanted primer, preventing its further participation in PCR. The suggested approach allows to rationally manage the course of PCR reactions in order to facilitate analysis of complex DNA mixtures as well as to perform multistage PCR bypassing intermediate purification steps. Here we apply NOPE method to DNA library preparation for the high-throughput sequencing (HTS) with the PCR-based introduction of unique molecular identifiers (UMI). We show that NOPE oligo efficiently neutralizes UMI-containing oligonucleotides after introduction of UMI into sample DNA molecules, thus allowing to proceed with further amplification steps without purification and associated loss of starting material. At the same time, NOPE oligo does not affect the efficiency of target PCR amplification. We describe a simple, robust and cheap modification of UMI-labeled HTS libraries preparation procedure, that allows to bypass purification step and thus to preserve starting material which may be limited, e.g. circulating tumor DNA, circulating fetal DNA, or small amounts of isolated cells of interest. Furthermore, demonstrated simplicity and robustness of NOPE method should make it popular in various PCR protocols.

  9. [Respiratory symptoms after the use of a painting primer product spray].

    Science.gov (United States)

    Ebbehøj, Niels E; Bang, John

    2008-09-22

    The use of waterproofing spray has been associated with the development of respiratory symptoms, but the pathogenetic mechanisms are unclear. We describe a case of acute respiratory disease with impaired diffusion developed after the use of a painting primer product spray (stain stop). Further investigation in aerosol-toxicology is needed.

  10. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  11. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  12. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  13. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  14. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    ) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... delayed relative to that of the wild-type virus, molecular tumor analysis indicated that all the primer binding site-modified viruses induce T-cell lymphomas similar to those induced by the wild-type virus in terms of frequencies of genomic rearrangements within the T-cell receptor beta......, recombination with endogenous viruses resulting in the generation of recombinant viruses carrying a glutamine primer binding site was detected in the majority of the tumors induced by the SL3-3 Lys3 mutant as well as in two tumors induced by wild-type SL3-3 and the SL3-3 Arg1,2 mutant....

  15. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  16. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  17. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  18. Ronda: nuevas noticias sobre el primer y antiguo puente del Tajo

    Directory of Open Access Journals (Sweden)

    Inocencio Cadiñanos Bardeci

    2014-01-01

    Full Text Available Sobre este bello y famoso puente ya se ha escrito su proceso de construcción. Sin embargo, al hablar del primer intento de levantarlo, se exponen unas muy breves noticias que pretendo completar con otras halladas recientemente...

  19. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  20. Comparison of primers for the detection of pathogenic Escherichia coli using real-time PCR.

    Science.gov (United States)

    Barak, J D; Sananikone, K; Delwiche, M J

    2005-01-01

    To evaluate PCR primers for the detection of pathogenic Escherichia coli in a real-time PCR assay and determine their utility in produce irrigation water testing. Three previously published PCR primer sets and one set designed for this study were tested for their ability to produce amplification products for several pathogenic E. coli serotypes from whole cells as template. Two of the previously published primer sets were chosen for real-time PCR detection limit determination. The coneaeA and PEH detection limit of E. coli O157:H7 was 10(0) and 10(1) CFU rxn(-1) in sterile water respectively. To detect E. coli O157:H7 in sprout irrigation water, the water required dilution due to PCR inhibitors. The detection limit of the coneaeA and PEH was 10(1) and between 10(2) and 10(3) CFU rxn(-1) in diluted sprout irrigation water respectively. The primer set coneaeA was able to produce an amplification product from each E. coli serotype, except O128:H7 and most sensitive for real-time PCR detection of pathogenic E. coli in diluted sprout irrigation water. The necessity of a dissociation analysis to distinguish positive samples from those with fluorescence of random dsDNA generation for real-time PCR in a complex background was established.

  1. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    Science.gov (United States)

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  2. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  3. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  4. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2017-06-01

    Full Text Available Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata that are processed into one of the most valued traditional Chinese medicines (TCM. The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  5. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  6. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  7. Initiation of HIV-1 reverse transcription is regulated by a primer activation signal

    NARCIS (Netherlands)

    Beerens, N.; Groot, F.; Berkhout, B.

    2001-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome appears to be strictly regulated at the level of initiation. The primer binding site (PBS), at which the tRNA(3)(Lys) molecule anneals and reverse transcription is initiated, is present in a highly structured region

  8. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  9. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers.

    Directory of Open Access Journals (Sweden)

    In-Cheol Baek

    Full Text Available Major histocompatibility complex (MHC class I chain-related gene B (MICB encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI, whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024 present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations.

  10. Primer system for single cell detection of double mutation for Tay-Sachs disease.

    Science.gov (United States)

    Liu, M C; Drury, K C; Kipersztok, S; Zheng, W; Williams, R S

    2000-02-01

    Nearly 100% of infantile Tay-Sachs disease is produced by two mutations occurring in the alpha chain of the lysosomal enzyme beta-N-acetylhexosaminidase (HEXA) in the Ashkenazi Jewish population. Although others have described primer systems used to amplify both sites simultaneously, few discuss the allele dropout problems inherent in this test. Our goal was to construct a more robust test enabling stronger signal generation for single cell preimplantation genetic diagnosis and to investigate the occurrence of allele dropout. New nested primers were designed to optimize detection of both major Tay-Sachs mutations. Four hundred fifty-seven single cells, including normal cells and those carrying mutations of either the 4bp insertion exon 11 or splice-site intron 12 defects, were used to screen a new primer system. Based on PCR amplified product analysis, total efficiency of amplification was 85.3%, (390/457). The allele dropout rate for the 4bp insertion mutation in exon 11 and splice-site mutation in intron 12 was 4.8% and 5.8%, respectively. Multiple mutation detection and analysis within the Tay-Sachs disease gene (HEXA) is possible using single cells for clinical preimplantation genetic diagnosis. Alternative PCR primers and conditions offer various methods for developing systems compatible to specific program requirements.

  11. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  12. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  13. Evaluation of 16S rRNA gene primer pairs for monitoring microbial community structures showed high reproducibility within and low comparability between datasets generated with multiple archaeal and bacterial primer pairs

    Directory of Open Access Journals (Sweden)

    Martin Alexander Fischer

    2016-08-01

    Full Text Available The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community

  14. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  15. A serendipidade na medicina e na anestesiologia

    OpenAIRE

    Vale, Nilton Bezerra do; Delfino, José; Vale, Lúcio Flávio Bezerra do

    2005-01-01

    JUSTIFICATIVA E OBJETIVOS: Neste trabalho foram examinados mais de uma centena dos mais felizes acoplamentos de uma mente brilhante com a sorte benfazeja (serendipidade), através da releitura das mais relevantes histórias sobre invenções e descobertas relacionadas à ciência (n = 46), à Medicina (n = 46) e à Anestesiologia (n = 16). CONTEÚDO: Conceito de serendipidade; exemplos célebres de serendipidade em Ciência e Tecnologia; serendipidade na pesquisa e prática médicas; serendipidade na Anes...

  16. Use of allele-specific sequencing primers is an efficient alternative to PCR subcloning of low-copy nuclear genes.

    Science.gov (United States)

    Scheen, Anne-Cathrine; Pfeil, Bernard E; Petri, Anna; Heidari, Nahid; Nylinder, Stephan; Oxelman, Bengt

    2012-01-01

    Direct Sanger sequencing of polymerase chain reaction (PCR)-amplified nuclear genes leads to polymorphic sequences when allelic variation is present. To overcome this problem, most researchers subclone the PCR products to separate alleles. An alternative is to directly sequence the separate alleles using allele-specific primers. We tested two methods to enhance the specificity of allele-specific primers for use in direct sequencing: using short primers and amplification refractory mutation system (ARMS) technique. By shortening the allele-specific primer to 15-13 nucleotides, the single mismatch in the ultimate base of the primer is enough to hinder the amplification of the nontarget allele in direct sequencing and recover only the targeted allele at high accuracy. The deliberate addition of a second mismatch, as implemented in the ARMS technique, was less successful and seems better suited for allele-specific amplification in regular PCR rather than in direct sequencing. © 2011 Blackwell Publishing Ltd.

  17. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    Science.gov (United States)

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  18. Bond strength of primer/cement systems to zirconia subjected to artificial aging.

    Science.gov (United States)

    Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

    2016-11-01

    Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (Pzirconia. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  19. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  20. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  2. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  3. NA60 Status Report

    CERN Document Server

    Usai, G

    2010-01-01

    This report shortly summarizes the main results obtained from the analysis of the NA60 data during 2010, perspectives for the analysis activity during 2011 and the requests to CERN following from them. In addition, renewed interest is expressed for a possible continuation of NA60, including future running at lower SPS energies.

  4. FACTORES QUE AFECTAN EL INTERVALO PARTO-PRIMER SERVICIO Y PRIMER SERVICIO-CONCEPCIÓN EN VACAS LECHERAS DEL VALLE DEL MANTARO DURANTE LA ÉPOCA LLUVIOSA.

    OpenAIRE

    Arana D., Carlos; Estación Experimental IVITA-El Mantaro, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima Perú.; Echevarría C., Luisa; Laboratorio de Reproducción Animal, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima Perú.; Segura C., Julia; Facultad de Veterinaria y Zootecnia, Universidad Peruana Cayetano Heredia

    2012-01-01

    Se realizó un seguimiento reproductivo en 40 vacas lecheras del valle delMantaro (Junín, Perú), pertenecientes a 6 establos, durante la época lluviosa. Se determinó el intervalo parto-primera ovulación (IPPO), el intervalo parto-primer servicio (IPPS), y el intervalo parto-concepción (IPC), midiendo el efecto de raza, número de parto, producción de leche, establo y nivel tecnológico. El IPPO se determinó a través de niveles de progesterona mediante radioinmunoensayo en muestras de leche descr...

  5. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    Science.gov (United States)

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  6. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  7. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    Directory of Open Access Journals (Sweden)

    Mario Antolinez

    2013-11-01

    Full Text Available El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al mismo tiempo, se distanciaba de manera sustancial del proceso tradicional imperante durante años. Esta iniciativa se vio entorpecida, sin embargo, no solo por los problemas en Gaimusho –la entidad encargada de llevar a la práctica la diplomacia nipona–, sino también por el escenario geopolítico externo y por factores de política interna propios del momento histórico en consideración.

  8. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  9. PRIMEGENS-v2: genome-wide primer design for analyzing DNA methylation patterns of CpG islands.

    Science.gov (United States)

    Srivastava, Gyan P; Guo, Juyuan; Shi, Huidong; Xu, Dong

    2008-09-01

    DNA methylation plays important roles in biological processes and human diseases, especially cancers. High-throughput bisulfite genomic sequencing based on new generation of sequencers, such as the 454-sequencing system provides an efficient method for analyzing DNA methylation patterns. The successful implementation of this approach depends on the use of primer design software capable of performing genome-wide scan for optimal primers from in silico bisulfite-treated genome sequences. We have developed a method, which fulfills this requirement and conduct primer design for sequences including regions of given promoter CpG islands. The developed method has been implemented using the C and JAVA programming languages. The primer design results were tested in the PCR experiments of 96 selected human DNA sequences containing CpG islands in the promoter regions. The results indicate that this method is efficient and reliable for designing sequence-specific primers. The sequence-specific primer design for DNA meth-ylated sequences including CpG islands has been integrated into the second version of PRIMEGENS as one of the primer design features. The software is freely available for academic use at http://digbio.missouri.edu/primegens/.

  10. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification.

    Directory of Open Access Journals (Sweden)

    Junsun Kim

    Full Text Available Real-time PCR, also called quantitative PCR (qPCR, has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN. One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction.

  11. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. [Effect of a chemical primer on the bond strength of a zirconia ceramic with self-adhesive resin cement].

    Science.gov (United States)

    Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng

    2015-10-01

    To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (Presin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.

  13. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.

    Directory of Open Access Journals (Sweden)

    Hideki Shojo

    Full Text Available Polymerase chain reaction-amplified product length polymorphism (PCR-APLP is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  14. On the importance of the primer activation signal for initiation of tRNA(lys3)-primed reverse transcription of the HIV-1 RNA genome

    NARCIS (Netherlands)

    Huthoff, Hendrik; Bugala, Katarzyna; Barciszewski, Jan; Berkhout, Ben

    2003-01-01

    Initiation of reverse transcription is a complex and regulated process in all retroviruses. Several base pairing interactions have been proposed to occur between the HIV-1 RNA genome and the specific tRNA(lys3) primer. The tRNA primer can form up to 21 bp with the primer binding site (PBS), and an

  15. Sequence variation of the human immunodeficiency virus primer-binding site suggests the use of an alternative tRNA(Lys) molecule in reverse transcription

    NARCIS (Netherlands)

    Das, A. T.; Klaver, B.; Berkhout, B.

    1997-01-01

    Retroviruses use a cellular tRNA molecule as primer for reverse transcription. The complementarity between the 3' end of this tRNA and a sequence near the 5' end of the viral RNA, the primer-binding site (PBS), allows the primer to anneal onto the viral RNA. During reverse transcription 18

  16. EVALUACION DE LA RESISTENCIA A LA CORROSION DEL SISTEMA PRIMER EPOXICO RICO EN ZINC/ACABADO POLISILOXANO POR MEDIO DE ESPECTROSCOPIA DE IMPEDANCIA ELECTROQUIMICA

    Directory of Open Access Journals (Sweden)

    ANDRES ALBERTO GUZMAN ROSAS

    2011-01-01

    Full Text Available En este trabajo fue estudiado el sistema primer epoxico rico en zinc / acabado polisiloxano aplicado sobre laminas de acero al carbono laminado en caliente y sometido a camaras de corrosion acelerada (inmersion total, niebla salina, ciclo de corrosion y prohesion por un periodo de hasta 5000 horas. Las probetas bajo estudio se evaluaron cada 20 dias por medio de espectroscopia de impedancia electroquimica y al final de la prueba se realizaron chequeos visuales y microscopia optica para ver la morfologia de la interface metal-recubrimiento y microespectroscopia Raman para identificar la presencia de posibles productos de corrosion. Los resultados de impedancia fueron simulados por medio de circuitos electricos equivalentes. Para el sistema se encontraron modulos de impedancia del orden de 1011 ¿.cm2 en prohesion, 1010 ¿.cm2 en ciclo de corrosion, 109 ¿.cm2 tanto niebla salina como en las inmersiones totales (NaCl 10-2M y Na2SO4 10-2M. Este sistema tuvo durante el tiempo de pruebas un comportamiento excelente con altas resistencias de pelicula y de transferencia de carga y bajas capacitancias de pelicula y de doble capa.

  17. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. © 2015 John Wiley & Sons Ltd.

  18. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  19. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae1

    Science.gov (United States)

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W. Brad; Stacy, Elizabeth A.

    2014-01-01

    • Premise of the study: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Methods and Results: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • Conclusions: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae. PMID:25309837

  20. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae.

    Science.gov (United States)

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W Brad; Stacy, Elizabeth A

    2014-10-01

    Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae.

  1. Development and polymorphism of microsatellite primers in Ficus pumila L. (Moraceae).

    Science.gov (United States)

    Zhang, Jian; Jiang, Kai; Shi, Yi-Su; Liu, Min; Chen, Xiao-Yong

    2011-07-01

    Microsatellite primers were developed in the functionally dioecious Ficus pumila L. to provide polymorphic markers for further population genetic studies and parentage analysis. Eleven polymorphic microsatellite loci were developed in F. pumila. These loci were successfully amplified in four F. pumila populations from eastern China (Fodu, Xiangshan, Xianju, and Hexi). These loci had 3-11 alleles across all 80 F. pumila individuals. At the population level, the number of alleles per locus varied from 1 to 8, and the observed (H(O)) and expected (H(E)) heterozygosities ranged from 0.000 to 0.900 and from 0.000 to 0.830, respectively. Linkage disequilibrium between loci FP213 and FP435 was found in three of the four tested populations. These loci showed high levels of polymorphism, indicating the utility of these primers in population genetic studies as well as parentage analysis of F. pumila.

  2. Optimization of primer specific filter metrics for the assessment of mitochondrial DNA sequence data

    Science.gov (United States)

    CURTIS, PAMELA C.; THOMAS, JENNIFER L.; PHILLIPS, NICOLE R.; ROBY, RHONDA K.

    2011-01-01

    Filter metrics are used as a quick assessment of sequence trace files in order to sort data into different categories, i.e. High Quality, Review, and Low Quality, without human intervention. The filter metrics consist of two numerical parameters for sequence quality assessment: trace score (TS) and contiguous read length (CRL). Primer specific settings for the TS and CRL were established using a calibration dataset of 2817 traces and validated using a concordance dataset of 5617 traces. Prior to optimization, 57% of the traces required manual review before import into a sequence analysis program, whereas after optimization only 28% of the traces required manual review. After optimization of primer specific filter metrics for mitochondrial DNA sequence data, an overall reduction of review of trace files translates into increased throughput of data analysis and decreased time required for manual review. PMID:21171863

  3. Resin adhesion strengths to zirconia ceramics after primer treatment with silane coupling monomer or oligomer.

    Science.gov (United States)

    Okada, Masahiro; Inoue, Kazusa; Irie, Masao; Taketa, Hiroaki; Torii, Yasuhiro; Matsumoto, Takuya

    2017-09-26

    Resin bonding to zirconia ceramics is difficult to achieve using the standard methods for conventional silica-based dental ceramics, which employ silane coupling monomers as primers. The hypothesis in this study was that a silane coupling oligomer -a condensed product of silane coupling monomers- would be a more suitable primer for zirconia. To prove this hypothesis, the shear bond strengths between a composite resin and zirconia were compared after applying either a silane coupling monomer or oligomer. The shear bond strength increased after applying a non-activated ethanol solution of the silane coupling oligomer compared with that achieved when applying the monomer. Thermal treatment of the zirconia at 110°C after application of the silane coupling agents was essential to improve the shear bond strength between the composite resin cement and zirconia.

  4. An In Vitro Single-Primer Site-Directed Mutagenesis Method for Use in Biotechnology.

    Science.gov (United States)

    Huang, Yanchao; Zhang, Likui

    2017-01-01

    Site-directed mutagenesis is a powerful method to introduce mutation(s) into DNA sequences. A number of methods have been developed over the years with a main goal being to create a high number of mutant genes. The single-mutagenic primer method for site-directed mutagenesis is the most direct method that yields mutant genes in about 25-50 % of transformants in a robust, low-cost reaction. The supercompetent XL10-Gold bacteria used in the Stratagene protocol carry a phage, which may be a problem for some applications; however, in our single-mutagenic primer method the supercompetent bacteria are not needed. A thermostable DNA polymerase with high fidelity and processivity, such as Phusion DNA polymerase, is required for our optimized procedure to avoid extra mutation(s) and enhance mutagenic efficiency.

  5. Coupling DNA unwinding activity with primer synthesis in the bacteriophage T4 primosome

    Science.gov (United States)

    Manosas, Maria; Spiering, Michelle M.; Zhuang, Zhihao; Benkovic, Stephen J.; Croquette, Vincent

    2009-01-01

    The unwinding and priming activities of the bacteriophage T4 primosome, which consists of a hexameric helicase (gp41) translocating 5′ to 3′ and an oligomeric primase (gp61) synthesizing primers 5′ to 3′, has been investigated on DNA hairpins manipulated by a magnetic trap. We find that the T4 primosome continuously unwinds the DNA duplex while allowing for primer synthesis through a primosome disassembly mechanism or a novel DNA looping mechanism. A fused gp61-gp41 primosome unwinds and primes DNA exclusively via the DNA looping mechanism. Other proteins within the replisome control the partitioning of these two mechanisms disfavoring primosome disassembly thereby increasing primase processivity. In contrast priming in bacteriophage T7 involves discrete pausing of the primosome and in Escherichia coli appears to be associated primarily with dissociation of the primase from the helicase. Thus nature appears to use several strategies to couple the disparate helicase and primase activities within primosomes. PMID:19838204

  6. Primer registro de Aplectana hylambatis (Nematoda, Cosmocercidae) para anfibios de la provincia de San Juan

    OpenAIRE

    Gonzalez, Cynthya Elizabeth; Quiroga, Lorena Beatriz; Moreno, Daniela; Sanabria, Eduardo Alfredo

    2015-01-01

    El objetivo del presente trabajo fue reportar la presencia del cosmocércido Aplectana hylambatis (Baylis, 1927) Travassos, 1931 parasitando a una población natural de Rhinella arenarum (Hensel, 1867) de la provincia de San Juan. El presente estudio constituye el primer registro de helmintos parásitos para los anfibios de la provincia de San Juan. Aplectana hylambatis es una especie generalista que parasita a una amplia gama de hospedadores. Fil: Gonzalez, Cynthya Elizabeth. Consejo Nacio...

  7. Demonstration of Metastable Intermolecular Composites (MIC) on Small Caliber Cartridges and CAD/PAD Percussion Primers

    Science.gov (United States)

    2009-07-01

    that will include the results of the data analysis of the demonstration. B.9 ISO 14001 5.56mm Environmental concerns for the demonstration will... transition charge or an output charge, depending on the particular application. Figure 1 – No. 41 Small Caliber Percussion...facilitization of Lake City or Indian Head to make primers with a new material will seriously reduce the likelihood that a transition will occur. The current

  8. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  9. PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA

    OpenAIRE

    BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO

    2004-01-01

    Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

  10. Cultural Resources Management in the United States Air Force: Development of a Planning Primer.

    Science.gov (United States)

    1992-09-01

    but one of the final Expert Panel responded with either written or verbal comments. Although the overall reaction to the primer was favorable, each of...directive requires each Air Force insallation to prelpe and adopt a Cultura Resources Management Plan. This plan will incude an inventoy of all cultual...geophysical components of the Legacy program. Specific to cultura resources, the task areas were developed as a general program for improving management of all

  11. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

    2013-01-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  12. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  13. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

    Science.gov (United States)

    Carter-Harris, Lisa

    2016-11-01

    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  15. Perfil del alumnado normalista castellano-leonés del primer tercio del siglo XX

    Directory of Open Access Journals (Sweden)

    Juan Francisco CEREZO MANRIQUE

    2009-11-01

    Full Text Available Nos proponemos en este trabajo dibujar el perfil del alumnado que acudió a los establecimientos normalistas castellano-leoneses durante el primer tercio del siglo XX. El análisis cuantitativo de una serie de variables de tipo clasificatorio nos ayudará a explicitar las características de entrada de un colectivo sobre el que la acción institucional de las Escuelas Normales habría de incidir.

  16. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  17. Primer System for Single Cell Detection of Double Mutation for Tay-Sachs Disease

    OpenAIRE

    Liu, Ming Cheng; Drury, Kenneth C.; Kipersztok, Simon; Zheng, Wenrong; Williams, R. Stan

    2000-01-01

    Purpose: Nearly 100% of infantile Tay-Sachs disease isproduced by two mutations occurring in the alpha chain ofthe lysosomal enzyme beta-N-acetylhexosaminidase (HEXA)in the Ashkenazi Jewish population. Although others havedescribed primer systems used to amplify both sitessimultaneously, few discuss the allele dropout problems inherent inthis test. Our goal was to construct a more robust testenabling stronger signal generation for single cellpreimplantation genetic diagnosis and to investigat...

  18. Detection of genital human papillomaviruses by polymerase chain reaction amplification with degenerate nested primers.

    Science.gov (United States)

    Williamson, A L; Rybicki, E P

    1991-03-01

    Degenerate oligonucleotide primers were designed for in vitro amplification by polymerase chain reaction (PCR) of a relatively well-conserved portion of the L1 capsid protein gene of genital human papillomaviruses. A specific 441bp fragment was amplified by PCR from genomic clones and clinical biopsy specimens containing DNA from HPV types 6, 11, 16, 18, 31, and 33, as well as from a number of other clinical specimens known to contain unclassified HPV isolates. As some HPV non-specific DNA was also often amplified, another set of degenerate primers was designed which amplified a 335 bp sequence contained within the 441 bp sequence. These nested primers could be used in a two-stage PCR reaction to obtain distinct HPV-specific DNA fragments suitable for direct sequencing. Two-stage PCR was used to demonstrate the presence of HPV DNA in 13 out of 16 biopsies, which had been classified histologically as cervical intraepithelial neoplasia (CIN), but which were negative for HPV on Southern blot hybridization. Seven of these amplification products were sequenced, and one proved to be a previously unsequenced HPV type. The results have important implications for the routine detection and typing of genital and other HPV types in clinical samples.

  19. Krait: an ultrafast tool for genome-wide survey of microsatellites and primer design.

    Science.gov (United States)

    Du, Lianming; Zhang, Chi; Liu, Qin; Zhang, Xiuyue; Yue, Bisong; Hancock, John

    2018-02-15

    Microsatellites are found to be related with various diseases and widely used in population genetics as genetic markers. However, it remains a challenge to identify microsatellite from large genome and screen microsatellites for primer design from a huge result dataset. Here, we present Krait, a robust and flexible tool for fast investigation of microsatellites in DNA sequences. Krait is designed to identify all types of perfect or imperfect microsatellites on a whole genomic sequence, and is also applicable to identification of compound microsatellites. Primer3 was seamlessly integrated into Krait so that users can design primer for microsatellite amplification in an efficient way. Additionally, Krait can export microsatellite results in FASTA or GFF3 format for further analysis and generate statistical report as well as plotting. Krait is freely available at https://github.com/lmdu/krait under GPL2 License, implemented in C and Python, and supported on Windows, Linux and Mac operating systems. chizhang_swmu@126.com. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  20. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers.

    Science.gov (United States)

    Takahashi, Hirokazu; Yamamoto, Kimiko; Ohtani, Toshio; Sugiyama, Shigeru

    2009-07-01

    The predominant method for DNA cloning is by propagation in biological hosts, but this method has limitations because certain sequences are difficult to clone using any combination of available hosts or vectors. Recently, multiply-primed rolling circle amplification (MPRCA) has been applied to overcome the problems of the DNA cloning via host cells. However, when MPRCA is used to amplify from minute quantities of DNA template, the products are mostly by-product DNA molecules generated by false priming and primer dimer formation. This study demonstrates that MPRCA using random RNA primers[#x02014]instead of DNA primers[#x02014]blocked the synthesis of by-products and succeeded in amplifying one copy of a circular DNA molecule more than 1012-fold to give microgram quantities of amplification product without using submicroliter reaction volumes. Furthermore, a ligation strategy was elaborated to circularize only the desired DNA sequence and eliminate undesired ligation-products. A combination of these methods was able to amplify and ligate a large construct without undesired DNA sequences and at microgram quantities within one day. Therefore, these methods have the possibility to improve DNA cloning techniques that have been restricted by the limitations of PCR methods or by the host cell.

  1. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  2. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    Science.gov (United States)

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    D. S. Lucas

    2004-01-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

  4. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers.

    Science.gov (United States)

    Amit-Romach, E; Sklan, D; Uni, Z

    2004-07-01

    The microflora in the gastrointestinal tract of broiler chickens influences digestion, health, and wellbeing. Analysis of chicken gut microflora has been mainly by culture-based methods. Studies using these techniques have been useful for identification and analysis of specific groups of bacteria, however, the use of enrichment medium precludes even relative quantitation of bacterial species. Recent advances in ribosomal DNA-based molecular techniques make it possible to identify different bacterial populations in environmental samples without cultivation. In this study, the intestinal microflora was examined using 16S ribosomal DNA (rDNA) targeted probes from bacterial DNA isolated from intestinal and cecal contents of chickens at 4, 14, and 25 d of age. The ribosomal gene sequence was amplified using PCR with universal primers to determine total bacterial DNA and specific primers directed at 6 bacterial species: Lactobacillus, Bifidobacterium, Salmonella, Campylobacter, Escherichia coli, and Clostridium. The use of universal primers extends these methods to allow determination of relative proportions of different bacterial species. The results indicated that in young chicks the major species present in the small intestines and ceca was Lactobacilli, with a Bifidobacteria population becoming more dominant in the ceca at older age. Clostridium was detected in some segments of the small intestine in young chicks. In older chickens, Salmonella, Campylobacter, and E. coli species were found in the ceca. This study has demonstrated the use of molecular techniques for determining relative proportions of bacterial species and monitoring pathogens in the chick gastrointestinal tract.

  5. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  7. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Directory of Open Access Journals (Sweden)

    Nora Scarcelli

    Full Text Available Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC. Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon and non-coding regions (intron and intergenic spacer. They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC and 15 in the Inverted Repeat region (IR. Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae, Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae, Digitaria excilis and Pennisetum glaucum (Poaceae. The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR. We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies.

  8. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  9. At NA2

    CERN Multimedia

    1977-01-01

    One of the NA2 calorimeter sections is moved in. The NA2 calorimeter was divided in two halves, to the left and the right of the beam, each half consisting of sheets of passive high Z material interleaved with blades of plastic scintillators. The photo shows on the right, the upstream 'electron' module with eleven lead plates for a total radiation length of 20.

  10. Polarization dependence of Na* + Na* associative ionization revisited

    NARCIS (Netherlands)

    Meijer, H.A.J.; Meulen, H.P. v.d.; Morgenstern, R.; Hertel, I.V.; Meyer, E.; Witte, R.

    1986-01-01

    The dependence of the associative ionization process Na 3 2P3/2 + Na 3 2P3/2 → Na2+ + e- on the polarization of the laser light used for Na excitation was independently investigated in Utrecht and Berlin. The purpose of this paper is to clarify discrepancies between two other earlier experimental

  11. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo

    2014-10-01

    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  12. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets.

    Science.gov (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S; Kerudi, Veerendra V; Patil, Harshal Ashok; Bonde, Prasad Vasudeo; Jaltare, Pratik; Dolas, Siddhesh G

    2016-12-01

    The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (p<0.001) of bond strength with surface roughness of enamel. All groups might show clinically useful SBS values and Transbond XT can be successfully used

  13. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex

    Directory of Open Access Journals (Sweden)

    Marilena dos Anjos Martins

    2015-01-01

    Conclusions: These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis.

  14. Primer registro de Coccidae (Hemiptera: Coccoidea sobre Duchesnea indica (Rosaceae “frutilla silvestre” en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Patri GONZÁLEZ

    2015-01-01

    Full Text Available Se da a conocer el primer registro de la Argentina y el mundo del Coccidae Saissetia coffeae (Walker sobre Duchesnea indica (Andrews Focke, frutilla silvestre relacionada con frutilla cultivada (Fragaria x ananassa Duch.

  15. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  16. MATLAB Primer

    CERN Document Server

    Davis, Timothy A

    2010-01-01

    The eighth edition of this popular book provides a hands-on introduction to MATLAB[registered] that can be used at the undergraduate level. The new edition features the use of MATLAB 8.0, which will be introduced to the market in March 2010. It covers object-oriented programming in MATLAB and the improvements that have been made to the MATLAB desktop and programming tools. There is a new chapter that discusses MATLAB Central, a supporting website where users can exchange files, blogs, and links. In addition, the appendix of help topics has been updated to reflect only the most frequently used

  17. EZCA primer

    International Nuclear Information System (INIS)

    Karonis, N.T.

    1995-01-01

    This document provides a quick introduction to EZCA, a library that was designed to provide an easy to use interface to Channel Access (CA). As such, this document is not a user's manual, where a more detailed explanation of EZCA can be found. In short, this document is designed to get users to a state where they can be writing EZCA code as quickly as possible. It is not a document that answers all EZCA questions

  18. Telecommunications Primer

    OpenAIRE

    Joseph Becker

    2013-01-01

    A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  19. Telecommunications Primer

    Directory of Open Access Journals (Sweden)

    Joseph Becker

    2013-05-01

    Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  20. Telephone primer

    OpenAIRE

    Hovatter, Patrick J.

    1990-01-01

    Approved for public release; distribution unlimited. The telephone is the most common and widely used electronic communication device in use today. Because of this, the military is heavily reliant on the telephone system and considers it the primary voice communications medium. Furthermore, recent technological advances will dramatically change the telephone as well as we know it today. This thesis will take a comprehensive look at the telephone in today's complex telecommunications enviro...

  1. Hyperelasticity primer

    CERN Document Server

    Hackett, Robert M

    2016-01-01

    This book introduces the subject of hyperelasticity in a concise manner mainly directed to students of solid mechanics who have a familiarity with continuum mechanics.  It focuses on important introductory topics in the field of nonlinear material behavior and presents a number of example problems and solutions to greatly aid the student in mastering the difficulty of the subject and gaining necessary insight.  Professor Hackett delineates the concepts and applications of hyperelasticity in such a way that a new student of the subject can absorb the intricate details without having to wade through excessively complicated formulations.  The book further presents significant review material on intricately related subjects such as tensor calculus and introduces some new formulations.

  2. Through the Lens of Cultural Awareness: A Primer for US Armed Forces Deploying to Arab and Middle Eastern Countries

    Science.gov (United States)

    2006-01-01

    behaviors of Arabs . The conceptual framework and cultural analyses presented are drawn from relevant scholarly literature and personal observations...Through the Lens of Cultural Awareness: A Primer for US Armed Forces Deploying to Arab and Middle Eastern Countries William D. Wunderle Combat...Lens of Cultural Awareness: A Primer for US Armed Forces Deploying to Arab and Middle Eastern Countries 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  3. A Novel Teaching-Learning-Based Optimization for Improved Mutagenic Primer Design in Mismatch PCR-RFLP SNP Genotyping.

    Science.gov (United States)

    Cheng, Yu-Huei

    2016-01-01

    Many single nucleotide polymorphisms (SNPs) for complex genetic diseases are genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in small-scale basic research studies. It is an essential work to design feasible PCR-RFLP primer pair and find out available restriction enzymes to recognize the target SNP for PCR experiments. However, many SNPs are incapable of performing PCR-RFLP makes SNP genotyping become unpractical. A genetic algorithm (GA) had been proposed for designing mutagenic primer and get available restriction enzymes, but it gives an unrefined solution in mutagenic primers. In order to improve the mutagenic primer design, we propose TLBOMPD (TLBO-based Mutagenic Primer Design) a novel computational intelligence-based method that uses the notion of "teaching and learning" to search for more feasible mutagenic primers and provide the latest available restriction enzymes. The original Wallace's formula for the calculation of melting temperature is maintained, and more accurate calculation formulas of GC-based melting temperature and thermodynamic melting temperature are introduced into the proposed method. Mutagenic matrix is also reserved to increase the efficiency of judging a hypothetical mutagenic primer if involve available restriction enzymes for recognizing the target SNP. Furthermore, the core of SNP-RFLPing version 2 is used to enhance the mining work for restriction enzymes based on the latest REBASE. Twenty-five SNPs with mismatch PCR-RFLP screened from 288 SNPs in human SLC6A4 gene are used to appraise the TLBOMPD. Also, the computational results are compared with those of the GAMPD. In the future, the usage of the mutagenic primers in the wet lab needs to been validated carefully to increase the reliability of the method. The TLBOMPD is implemented in JAVA and it is freely available at http://tlbompd.googlecode.com/.

  4. Effect of Metal Primers on Bond Strength of a Composite Resin to Nickel-Chrome Metal Alloy.

    Science.gov (United States)

    Nima, Gabriel; Ferreira, Paulo Vitor Campos; Paula, Andreia Bolzan de; Consani, Simonides; Giannini, Marcelo

    2017-01-01

    This study evaluated the effects of three metal primers and one multi-mode adhesive system on the shear bond strength (SBS) of a flowable composite resin to nickel-chrome metal alloy (Ni-Cr). Ninety plates were cast from Ni-Cr and divided in nine groups (n=10). The surfaces were sandblasted with Al2O3 and primed with three adhesive primers: Alloy Primer (AP), Universal Primer (TP) and RelyX Ceramic Primer (CP), and a multi-mode adhesive (Scotchbond Universal, SU). The Adper Single Bond Plus (SB) and SU adhesives were also combined with adhesive primers. Control group did not have any surface treatment. The groups were: AP, AP+SB, AP+SU, TP+SB, TP+SU, CP+SB, CP+SU and SU. Composite cylinders were built on alloy surface. After 24 h, half the specimens were subjected to SBS and the other half to thermal cycling before testing. Data were analyzed by two-way ANOVA and Tukey's test (a=0.05). Failure modes were assessed by SEM observation. Higher SBS were obtained with AP and TP combined with adhesives at 24 h and the lowest one for control group. Thermocycling reduced SBS for AP, CP+SU and SU. Combination between TP and SU resulted in the highest SBS after the thermocycling. TP groups showed all types of failures and high incidence of mixed failures. The use of AP and UP metal primers before application of SU and SB adhesive systems increased the SBS of composite to Ni-Cr. These combinations between metal primers and adhesives had the highest SBS after thermocycling.

  5. Development of Exon-Primed Intron-Crossing (EPIC) PCR primers for the malaria vector Anopheles pseudopunctipennis (Diptera : Culicidae)

    OpenAIRE

    Lardeux, Frédéric; Aliaga, Claudia; Tejerina, Rosenka; Ursic-Bedoya, Raul

    2012-01-01

    International audience; Using the Anopheles gambiae Giles genome as a template, we designed, screened and identified 14 novel Exon-Primed Intron-Crossing (EPIC) PCR primer pairs for Anopheles pseudopunctipennis Theobald 1901, a major vector of human Plasmodium sp. in South America. These primers were designed to target the conserved regions flanking consecutive exons of different genes and enabled the amplification of 17 loci of which nine were polymorphic. Polymorphisms at these loci ranged ...

  6. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  7. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  8. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  9. Letramento na contemporaneidade

    OpenAIRE

    Kleiman, Angela B.

    2014-01-01

    Neste trabalho examino a relação entre letramento e contemporaneidade, tomando como base para a discussão o letramento no mundo escolar e sua relação com os letramentos de outras instituições do mundo contemporâneo, a fim de determinar as relações entre as finalidades contemporâneas da leitura e da escrita (em outras palavras, o que significa ser letrado na contemporaneidade) e as práticas mobilizadas e as atividades realizadas na escola para atingir essas finalidades. Através de diversos exe...

  10. Nietzsche na moda

    OpenAIRE

    José,João

    2016-01-01

    Resumo Ao resgatar o filósofo alemão do esquecimento, Stefan Zweig seria o principal responsável pela atual "voga Nietzsche". A edição brasileira de seu livro em 1931 e o artigo "L'actualité de Nietzsche", publicado anonimamente na França em 1933, atestariam o crescente interesse pelo autor de Zaratustra . A presença de Nietzsche na cena contemporânea, todavia, dever-se-ia não somente aos ensaios de outros estudiosos como Salomé (1893), Bertram (1918), Andler (1920) e Walz (1932), mas a um fe...

  11. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  12. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  13. Christiaan Barnard: 40 años del primer transplante de corazón humano.

    OpenAIRE

    Jorge Reynolds; Juan Fernando Cediel; César Payán

    2009-01-01

    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  14. Reflexiones sobre el desarrollo de competencias en alumnos de primer curso

    OpenAIRE

    Gómez Adrián, Jon Ander

    2012-01-01

    Voy a presentar para discusión una serie de cuestiones y reflexiones con objeto de suscitar debate. Debate que verse sobre qué competencias y qué habilidades deben intentar desarrollarse y potenciarse en los alumnos de primer curso. Planteo preguntas como ¿qué ventajas ofrece la enseñanza basada en competencias frente a la basada en contenidos? También pongo en cuestión si la carga docente resultante de la adaptación al EEES es sostenible, pues se ha realizado a cos...

  15. The compleat strategyst being a primer on the theory of games of strategy

    CERN Document Server

    Williams, J D

    1986-01-01

    When J. D. Williams wrote this entertaining, witty introduction for the nonscientist, Game Theory was still a somewhat mysterious subject familiar to very few scientists beyond those researchers, like himself, working for the military. Now, over thirty years after its original publication as a Rand Corporation research study, his light-hearted though thoroughly effective primer is the recognized classic introduction to an increasingly applicable discipline. Used by amateurs, professionals, and students throughout the world in the classroom, on the job, and for personal amusement, the book has

  16. Gunshot residue particles formed by using ammunitions that have mercury fulminate based primers.

    Science.gov (United States)

    Zeichner, A; Levin, N; Dvorachek, M

    1992-11-01

    Ammunition having mercury fulminate-based primers are commonly manufactured by Eastern Bloc countries and used extensively in the Middle East. Gunshot residue (GSR) particles formed by firing these types of ammunition were examined. It was observed that much lower percentage of mercury-containing GSR particles were found in samples taken from a shooter as compared to the percentage of such particles in samples from cartridge cases. This fact must therefore be taken into account when interpreting case results. A plausible explanation for the results described is proposed.

  17. Primer aislamiento ambiental de Cryptococcus gattii de serotipo B, en Cúcuta, Colombia

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    2011-04-01

    Conclusiones. Éste es el primer reporte de la recuperación ambiental de C. gattii de serotipo B en Cúcuta. Sin embargo, por la baja tasa de recuperación de aislamientos únicamente en suelo, el nicho ambiental de C. gattii no se pudo establecer, por lo que es necesario realizar posteriores estudios ambientales en Cúcuta, debido a que este serotipo, no sólo está causando criptococosis, sino también muestra una gran virulencia después del brote ocurrido en Vancouver.

  18. Primer caso de canibalismo registrado para el gecko de Lima, Phyllodactylus sentosus (Reptilia, Phyllodactylidae)

    OpenAIRE

    Valdez, Fernando; Cossios, E. Daniel

    2017-01-01

    Se reporta un caso de canibalismo en el gecko de Lima, Phyllodactylus sentosus Dixon & Huey, 1970 donde un macho adulto devoró a un juvenil. Tras una búsqueda de literatura, no se encontró casos reportados en otras especies del mismo género, por lo que se considera que este es el primer reporte de canibalismo en Phyllodactylus. We report a case of cannibalism for the Lima leaf-toed gecko, Phyllodactylus sentosus, in which an adult male devoured a juvenile. No reported cases were found in o...

  19. Aportes para una vida saludable. Proceso socioeducativo con estudiantes de primer ingreso, Universidad Nacional

    OpenAIRE

    Gonzalez-Soto, L.; Orozco-Morales, A.R.

    2017-01-01

    Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...

  20. FACTORES QUE AFECTAN EL INTERVALO PARTO PRIMER SERVICIO EN VACAS LECHERAS DE CRIANZA INTENSIVA

    OpenAIRE

    Evaristo R., Roberto; Práctica privada; Echevarría C., Luisa; Laboratorio de Reproducción, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima.

    2014-01-01

    Se estudiaron 128 vacas lecheras pertenecientes a 5 establos de Lima con un sistema de manejo intensivo. Se determinó los siguientes parámetros reproductivos: Intervalo Parto Primer Servicio (IPPS) e Intervalo Parto Primera Ovulación (IPPO). El IPPO fue obtenido por niveles de progesterona de leche descremada mediante la técnica del Radio Inmuno Análisis (RIA). La frecuencia del muestreo se hizo dos veces por semana desde el quinceavo día postparto hasta la primera inseminación Artificial (IA...

  1. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  2. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    containing 100 μg ml -1 of ampicillin. White colonies were screened for the presence of insert by single colony lysis PCR with M13 forward and reverse primers. PCR protocol included an initial hot start incubation (5 min at 94 o C) followed by 34 cycles... and ambiguously aligned sequences were removed from the further analyses. A phylogenetic analysis was conducted using distance setting maximum likelihood (ML) in MEGA 5.03 (Kumar et al, 2008) with 1000 bootstrap replicates. Individual phylogenetic trees were...

  3. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  4. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  5. Uso de marcadores moleculares na análise da variabilidade genética em acerola (Malpighia emarginata D.C.

    Directory of Open Access Journals (Sweden)

    SALLA MARIA FERNANDA SPEGIORIN

    2002-01-01

    Full Text Available A acerola (Malpighia emarginata é uma frutífera tropical encontrada nativa na América Central e no Norte da América do Sul, sendo de grande importância econômica e social devido ao seu alto conteúdo de vitamina C (ácido ascórbico. Pomares de acerola têm sido preferencialmente estabelecidos por métodos de propagação vegetiva. No entanto, a propagação sexuada por sementes é igualmente utilizada e permite revelar um alto grau de polimorfismo na cultura, possibilitando a identificação de genótipos portadores de características de interesse agronômico. Vinte e quatro acessos de acerola, pertencentes ao Banco Ativo de Germoplasma da Universidade Estadual de Londrina, foram analisados, usando marcadores RAPD (Random amplified Polymorphic DNA e obtidos com iniciadores (primers de seqüência simples repetidas (SSRs. Um total de 164 e 73 marcadores foram obtidos com primers de RAPD e SSR, respectivamente. Os marcadores obtidos foram analisados, usando o método de agrupamentos UPGMA. A análise comparativa dos dendrogramas gerados com os primers de RAPD e com os primers SSR mostrou que, enquanto alguns acessos se associaram em grupos diferentes, outros apresentaram a mesma associação. Entretanto, maior polimorfismo entre acessos foi detectado com os primers de RAPD. A análise dos resultados revelou a alta variabilidade contida na coleção, permitindo associar o grau de similaridade genética, obtido por marcadores de DNA, com caracteres morfológicos compartilhados entre os acessos.

  6. The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

    Science.gov (United States)

    Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

    1996-07-01

    To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

  7. Effect of silica coating combined to a MDP-based primer on the resin bond to Y-TZP ceramic.

    Science.gov (United States)

    May, Liliana Gressler; Passos, Sheila Pestana; Capelli, Diana Barca; Ozcan, Mutlu; Bottino, Marco Antonio; Valandro, Luiz Felipe

    2010-10-01

    The aim of this study was to evaluate the influence of silica coating and 10-methacryloyloxydecyl dihydrogen phosphate (MDP)-based primer applications upon the bonding durability of a MDP-based resin cement to a yttrium stabilized tetragonal zirconia (Y-TZP) ceramic. Ninety-six Y-TZP tabs were embedded in an acrylic resin (free surface for adhesion: 5 × 5 mm(2)), ground finished and randomly divided into four groups (N = 24) according to the ceramic surface conditioning: (1) cleaning with isopropanol (ALC); (2) ALC + phosphoric acid etching + MDP-based primer application (MDP-primer); (3) silica coating + 3-methacryloyloxypropyl trimethoxysilane (MPS)-based coupling agent application (SiO2 + MPS-Sil); and (4) SiO2 + MDP-primer. The MDP-based resin cement was applied on the treated surface using a cylindrical mold (diameter= 3 mm). Half of the specimens from each surface conditioning were stored in distilled water (37 °C, 24 h) before testing. Another half of the specimens were stored (90 days) and thermo-cycled (12,000 x) during this period (90 d/TC) before testing. A shear bond strength (SBS) test was performed at a crosshead speed of 0.5 mm/min. Two factors composed the experimental design: ceramic conditioning strategy (in four levels) and storage condition (in two levels), totaling eight groups. After 90 d/TC (Tukey; p MDP-primer (24.40 MPa) promoted the highest SBS. The ALC and MDP-primer groups debonded spontaneously during 90 d/TC. Bonding values were higher and more stable in the SiO2 groups. The use of MDP-primer after silica coating increased the bond strength.

  8. The influence of experimental silane primers on dentin bond strength and morphology: a laboratory and finite element analysis study.

    Science.gov (United States)

    Mustafa, Ammar A; Matinlinna, Jukka P; Saidin, Syafiqah; Kadir, M R Abdul

    2014-12-01

    The inconsistency of dentin bonding affects retention and microleakage. The purpose of this laboratory and finite element analysis study was to investigate the effects on the formation of a hybrid layer of an experimental silane coupling agent containing primer solutions composed of different percentages of hydroxyethyl methacrylate. A total of 125 sound human premolars were restored in vitro. Simple class I cavities were formed on each tooth, followed by the application of different compositions of experimental silane primers (0%, 5%, 25%, and 50% of hydroxyethyl methacrylate), bonding agents, and dental composite resins. Bond strength tests and scanning electron microscopy analyses were performed. The laboratory experimental results were validated with finite element analysis to determine the pattern of stress distribution. Simulations were conducted by placing the restorative composite resin in a premolar tooth by imitating simple class I cavities. The laboratory and finite element analysis data were significantly different from each other, as determined by 1-way ANOVA. A post hoc analysis was conducted on the bond strength data to further clarify the effects of silane primers. The strongest bond of hybrid layer (16.96 MPa) was found in the primer with 25% hydroxyethyl methacrylate, suggesting a barely visible hybrid layer barrier. The control specimens without the application of the primer and the primer specimens with no hydroxyethyl methacrylate exhibited the lowest strength values (8.30 MPa and 11.78 MPa) with intermittent and low visibility of the hybrid layer. These results were supported by finite element analysis that suggested an evenly distributed stress on the model with 25% hydroxyethyl methacrylate. Different compositions of experimental silane primers affected the formation of the hybrid layer and its resulting bond strength. Copyright © 2014 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  9. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    Science.gov (United States)

    Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

    2012-01-01

    An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to

  10. Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

    Science.gov (United States)

    Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

    2013-01-01

    Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (pcontrol. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

  11. The effect of resin cements and primer on retentive force of zirconia copings bonded to zirconia abutments with insufficient retention.

    Science.gov (United States)

    Kim, Seung-Mi; Yoon, Ji-Young; Lee, Myung-Hyun; Oh, Nam-Sik

    2013-05-01

    The purpose of this study was to investigate the effect of resin cements and primer on the retentive force of zirconia copings bonded to zirconia abutments with insufficient retention. Zirconia blocks (Lava, 3M ESPE, St. Paul, MN, USA) were obtained and forty sets of zirconia abutments and copings were fabricated using CAD/CAM technology. They were grouped into 4 categories as follows, depending on the types of resin cements used, and whether the primer is applied or not:Panavia F2.0 (P), Panavia F2.0 using Primer (PRIME Plus, Bisco Inc, Schaumburg, IL, USA) (PZ), Superbond C&B (S), and Superbond C&B using Primer (SZ). For each of the groups, the cementation was conducted. The specimens were kept in sterilized water (37℃) for 24 hours. Retentive forces were tested and measured, and a statistical analysis was carried out. The nature of failure was recorded. The means and standard deviations of retentive force in Newton for each group were 265.15 ± 35.04 N (P), 318.21 ± 22.24 N (PZ), 445.13 ± 78.54 N (S) and 508.21 ± 79.48 N (SZ). Superbond C&B groups (S & SZ) showed significantly higher retentive force than Panavia F2.0 groups (P & PZ). In Panavia F2.0 groups, the use of primer was found to contribute to the increase of retentive force. On the other hand, in Superbond C&B groups, the use of primer did not influence the retention forces. Adhesive failure was observed in all groups. This study suggests that cementation of the zirconia abutments and zirconia copings with Superbond C&B have a higher retentive force than Panavia F2.0. When using Panavia F2.0, the use of primer increases the retentive force.

  12. Riso na epilepsia

    Directory of Open Access Journals (Sweden)

    Edymar Jardim

    1967-06-01

    Full Text Available São estudados três casos de síndrome convulsiva temporal, com manifestações concomitantes de riso na sua fase inicial. As características principais foram a imotivação e á incoercibilidade do riso. Esses sintomas desapareceram com o uso de anticonvulsivantes.

  13. Biotecnologia na agricultura

    Directory of Open Access Journals (Sweden)

    Helaine Carrer

    2010-01-01

    Full Text Available A expectativa de o crescimento populacional atingir 9 bilhões de habitantes em 2050 em adição às questões da sustentabilidade e do aquecimento global nos desafiam a aumentar a oferta de alimentos. Uma metodologia alternativa que contribua para a redução do impacto desse cenário envolve a biotecnologia, que, nas últimas décadas, trouxe marcantes oportunidades tecnológicas na agricultura, resultando em relevante desenvolvimento na obtenção de novas variedades de plantas, na melhoria da qualidade de diversos alimentos e atualmente também na bioenergia. As técnicas biotecnológicas envolvendo os marcadores moleculares, a genômica e a transformação genética estão transformando a agricultura e são discutidas neste artigo.The expected population growth to reach 9 billion by 2050 in addition to issues of sustainability and global warming challenges us to increase the supply of food. An alternative approach to help reducing the impact of this scenario involves biotechnology which in recent decades has brought remarkable technological opportunities in the agriculture that resulted in relevant development in obtaining new plant varieties, improved quality of different foods, and now also in bioenergy. The biotechnology techniques involving molecular markers, genomics and genetic transformation are transforming agriculture and will be discussed in this article.

  14. Fonts alternatives de proteïna en aqüicultura

    OpenAIRE

    Maura i Rayo, Salvador

    1990-01-01

    Es recullen tot un seguit de primeres matèries, com a font proteica alternativa, per a la fabricació de pinsos per a aqüicultura, amb l'objectiu de substituir totalment o parcialment les farines de peix. Les fonts proteiques alternatives poden provenir de proteïna animal o vegetal, d'organismes unicel•lulars, i de nitrogen no proteic. Dos motius són els que ens porten a intentar aquesta substitució: d'una banda, un abaratiment del cost dels pinsos, i, de l'altra, limitar la ...

  15. AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment

    Directory of Open Access Journals (Sweden)

    Petra Pjevac

    2017-08-01

    Full Text Available Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be catalyzed by the concerted activity of ammonia- and nitrite-oxidizing microorganisms. Only recently, complete ammonia oxidizers (“comammox”, which oxidize ammonia to nitrate on their own, were identified in the bacterial genus Nitrospira, previously assumed to contain only canonical nitrite oxidizers. Nitrospira are widespread in nature, but for assessments of the distribution and functional importance of comammox Nitrospira in ecosystems, cultivation-independent tools to distinguish comammox from strictly nitrite-oxidizing Nitrospira are required. Here we developed new PCR primer sets that specifically target the amoA genes coding for subunit A of the distinct ammonia monooxygenase of comammox Nitrospira. While existing primers capture only a fraction of the known comammox amoA diversity, the new primer sets cover as much as 95% of the comammox amoA clade A and 92% of the clade B sequences in a reference database containing 326 comammox amoA genes with sequence information at the primer binding sites. Application of the primers to 13 samples from engineered systems (a groundwater well, drinking water treatment and wastewater treatment plants and other habitats (rice paddy and forest soils, rice rhizosphere, brackish lake sediment and freshwater biofilm detected comammox Nitrospira in all samples and revealed a considerable diversity of comammox in most habitats. Excellent primer specificity for comammox amoA was achieved by avoiding the use of highly degenerate primer preparations and by using equimolar mixtures of oligonucleotides that match existing comammox amoA genes. Quantitative PCR with these equimolar primer mixtures was highly sensitive and specific, and enabled the efficient quantification of clade A and clade B comammox amoA gene copy numbers in environmental samples. The measured relative abundances of comammox Nitrospira, compared

  16. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo

    2012-12-01

    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.690

  17. [Molecular identification of Mentha haplocalyx and Mentha spicata with specific primers multi-PCR system].

    Science.gov (United States)

    Cao, Liang; Qin, Shuang-shuang; Yuan, Yuan; Zhu, Xiao-qi

    2014-01-01

    To screen specific SNPs loci of Mentha haplocalyx and Mentha spicata,and then specific primers were designed to identify the two species and their mixture rapidly. PsbA-trnH sequences of Mentha haplocalyx and Mentha spicata were obtained by PCR product sequencing and downloading from GenBank. SNPs in the psbA-trnH sequences of Mentha haplocalyx and Mentha spicata were found by ClustulW program and Bioedit software. Primers for authentication of the two species were designed according to the SNP loci, and PCR reaction system was optimized to identify the original plants. Multi-PCR reaction system was constructed. The 181 bp identification band for Mentha haplocalyx or(and) 288 bp identification band for Mentha spicata could be produced by a single PCR reaction,which showed good identification ability to the two species. The multi-PCR reaction system can be applied to identify Mentha haplocalyx and Mentha spicata as well as their mixture.

  18. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  19. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    Science.gov (United States)

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  20. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  1. Simple Heat Treatment of Zirconia Ceramic Pre-Treated with Silane Primer to Improve Resin Bonding.

    Science.gov (United States)

    Ha, Jung-Yun; Son, Jun Sik; Kim, Kyo-Han; Kwon, Tae-Yub

    2015-01-01

    Establishing a strong resin bond to dental zirconia ceramic remains difficult. Previous studies have shown that the conventional application of silane does not work well with zirconia. This paper reports that a silane pre-treatment of dental zirconia ceramic combined with subsequent heat treatment has potential as an adhesive cementation protocol for improving zirconia-resin bonding. Among the various concentrations (0.1 to 16 vol%) of experimental γ-methacryloxypropyltrimethoxysilane (γ-MPTS) primers assessed, the 1% solution was found to be the most effective in terms of the shear bond strength of the resin cement to dental zirconia ceramic. A high shear bond strength (approx. 30 MPa) was obtained when zirconia specimens were pre-treated with this primer and then heat-treated in a furnace for 60 min at 150 degrees C. Heat treatment appeared to remove the hydrophilic constituents from the silane film formed on the zirconia ceramic surface and accelerate the condensation reactions between the silanol groups of the hydrolyzed silane molecules at the zirconia/resin interface, finally making a more desirable surface for bonding with resin. This estimation was supported by Fourier transform infrared spectroscopy of the silanes prepared in this study.

  2. Alanylated lipoteichoic acid primer in Bacillus subtilis [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Yu Luo

    2016-04-01

    Full Text Available Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid.

  3. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  4. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    Science.gov (United States)

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  5. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.

    Science.gov (United States)

    Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B

    2016-04-01

    Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    Science.gov (United States)

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  7. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples.

    Science.gov (United States)

    Chen, Yi-Lin; Lee, Chuan-Chun; Lin, Ya-Lan; Yin, Kai-Min; Ho, Chung-Liang; Liu, Tsunglin

    2015-01-01

    Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry.

  8. Synteny analysis provides a route to design genus-specific PCR primers for rapid identification of all Saccharomyces species.

    Science.gov (United States)

    Sharpe, Ben; Hulin, Michelle; Thorne-Wallis, James; Wheals, Alan

    2014-05-01

    The genus Saccharomyces comprises seven single-genome species (S. arboricola, S. cerevisiae, S. eubayanus, S. kudriavzevii, S. mikatae, S. paradoxus and S. uvarum) and two hybrid species - S. pastorianus (S. cerevisiae plus S. eubayanus) and S. bayanus (mostly S. uvarum plus S. eubayanus). Species-specific primers have already been developed for the identification of each of the single-genome species, and these primers can usually detect both genomes in hybrids. It would be advantageous if a single reaction could detect any member of the clade. We have investigated three potentially generic approaches to design genus-specific primers. Two methods that both use sequence alignment differences for primer design were only partly successful. A third method used synteny data to identify 136 target genes that are potentially present only in all species of the Saccharomyces clade. HSP30 (YCR021C) was fully successful; different primer pairs were developed with high G+C content for use at 63 °C. In genus. This novel approach still uses conventional sequence alignment mismatches but relies principally on the presence of the target gene only within the genus Saccharomyces. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  9. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.

    Science.gov (United States)

    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra

    2007-12-01

    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification.

  10. Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

    Science.gov (United States)

    Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

    2016-01-01

    Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

  11. Evaluation of two thione primers and composite luting agents used for bonding a silver-palladium-copper-gold alloy.

    Science.gov (United States)

    Matsumura, H; Atsuta, M; Tanoue, N

    2002-09-01

    The purpose of the current study was to evaluate the bond strength and durability of two metal adhesive systems bonded to a silver-palladium-copper-gold (Ag-Pd) alloy. Disk specimens were cast from an Ag-Pd alloy (Castwell M.C. 12), air-abraded with 50 micro m grain-sized alumina, and they were bonded with two primer-cement bonding systems (Alloy Primer and Panavia Fluoro Cement; Metaltite and Bistite II). For each cement, unprimed specimens were also prepared as experimental controls. Shear bond strengths were determined both before and after thermocycling (4-60 degrees C, 1 min each, 100 000 cycles). The average post-thermocycling bond strengths in MPa (n=8) were: 39.0 for the Metaltite-Bistite II system, 32.2 for the Alloy Primer-Panavia Fluoro Cement system, 23.1 for the Bistite II material and 21.0 for the Panavia Fluoro Cement material. The use of proprietary primers, both of which contain thione functional monomer, enhanced the post-thermocycling bond strengths of both cements (P 0.05). It is concluded that the combined use of the thione primer and the luting agent is necessary for bonding the Ag-Pd alloy examined.

  12. Effect of thione primers on adhesive bonding between an indirect composite material and Ag-Pd-Cu-Au alloy.

    Science.gov (United States)

    Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki

    2014-01-01

    The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.

  13. Evaluation of five primers and two opaque resins for bonding ceria-stabilized zirconia/alumina nanocomposite

    Directory of Open Access Journals (Sweden)

    Kohji Kamada

    2017-03-01

    Full Text Available The purpose of this study was to evaluate the effect of five primers [Super-Bond C&B Monomer (SB, Clearfil Ceramic Primer, Alloy Primer, M.L. Primer, and AZ Primer] and two undercoating opaque resins [Super-Bond C&B (S-opaque and Ceramage Pre-opaque (C-opaque] on the bonding of a resin composite veneering material to a ceria-stabilized tetragonal zirconia polycrystals/alumina nanocomposite (Ce-TZP/Al2O3. Disk-shaped specimens of Ce-TZP/Al2O3 were sandblasted with alumina and primed. The undercoating opaque resins and resin composites were subsequently applied to the specimen, and then light cured. After 5000 thermocycles at 4°C and 60°C, shear bond strengths were determined. Data were analyzed using analysis of variance, Tukey–Kramer honest significant difference test, and Student t test (n = 10, α = 0.05. With the exception of SB/S-opaque, all S-opaque groups exhibited significantly higher bond strengths than C-opaque groups. The use of S-opaque resin is recommended when veneering frameworks made of Ce-TZP/Al2O3.

  14. APLIKASI ANIMASI INTERAKTIF PENCAMPURAN TIGA WARNA PRIMER DAN PENGENALAN BENTUK GEOMETRI PADA PAUD AL-MUSLIMUN

    Directory of Open Access Journals (Sweden)

    Mayya Nurbayanti Shobary

    2016-03-01

    Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

  15. PERKEMBANGAN KOLONI PRIMER EMBRYONIC STEM CELL (ESC MENCIT PASCA VITRIFIKASI INNER CELL MASS (ICM

    Directory of Open Access Journals (Sweden)

    Ratih Rinendyaputri

    2013-11-01

    Full Text Available Abstract Application or the basic research of the stem cells is continously conducted to explore their potential, particularly the use of stem cells in health. Cryopreservation technology is needed to maintain availability of stem cell. This study was  aimed to observe the development of murine embryonic stem cell (ESC primary colonies post-vitrified inner cell mass (ICM. Inner cell mass (ICM was derived from blastocysts of murine embryos of female Swiss webster mice using pregnant mare’s serum gonadotropin (PMSG and human chorionic gonadotropin (hCG. Inner Cell Mass (ICM was isolated  from blastocysts by immunosurgery. Inner Cell Mass (ICM were divided into two groups: the control and vitrified ICM. Both groups were cultured and observed on the ICM attachment (attachment rate/AR, the primary formation of ESC colonies (primary colony/PC and  diameter of primary colony ESC which grouped into small, medium and large. The results showed that AR and medium diameter’s group of primary colony ESC were lower (p<0.05 in vitrified ICM than control ICM. However the percentage of PC and diameter of primary colonies ESC in small and large groups were not different compared with control (p>0.05. This study shows that vitrification for cryopreserving ICM can be used as an alternative source of ESC. Key words: blastocyst, inner cell mass, ICM, vitrification Abstrak  Submit : 30-01-2013  Review : 08-02-2013 Review : 11-03-2013 revisi : 26–03-2013 Aplikasi maupun penelitian dasar untuk menggali potensi sel punca khususnya pemanfaatan sel punca di bidang kesehatan terus dilakukan. Teknologi kriopreservasi dibutuhkan untuk menjaga ketersediaan sel punca. Penelitian ini bertujuan mengamati perkembangan koloni primer embryonic stem cell (ESC mencit pasca vitrifikasi inner cell mass (ICM. Inner Cell Mass (ICM diperoleh dari embrio blastosis mencit betina Swis webster menggunakan pregnant mare’s serum gonadotropin (PMSG dan human chorionic gonadotropin (h

  16. Electrochemical performance of a localized repair. Effect of applying a primer and a bonding membrane

    Directory of Open Access Journals (Sweden)

    Castro-Borges, P.

    2003-12-01

    Full Text Available It is customary, in the constructions at the North of Yucatán, to employ primers to the rebars as a repair method in reinforced concrete, it has been observed in the literature that using primers alone presents an electrochemical behaviour still under discussion. Under these circumstances, several investigations have focused on the evaluation of the factor against or in favour of using primers as a repair method in a tropical marine environment. In this paper, the effects of applying a bonding membrane and the galvanic effect generated by the repair are also discussed. Small reinforced concrete columns were prepared and exposed under accelerated degradation cycles. After the activation of the rebars, the columns were repaired applying three types of primers, leaving one bar as control. After curing, the columns were exposed again to the same environment and their electrochemical behaviour was monitored. Corrosion potentials, polarization resistance, carbonation and chloride content were measured as a function of time. Conclusions suggest that the bonding membrane reduces the corrosion rates for the conditions and exposure time studied. The galvanic effect was observed after repairing the columns with and without bonding membrane, but with a tendency to reduce with time. The primers applied helped to reduce the galvanic effect of the repair, and to increase the polarization resistance.

    En las construcciones del norte de Yucatán se emplean, por costumbre, las imprimaciones al refuerzo como método de reparación al hormigón armado. Se ha observado en la literatura que la utilización sólo de imprimaciones presenta un comportamiento electroquímico, motivo éste, aún, de amplia discusión. Ante estas situaciones se llevaron a cabo varias investigaciones que tienen como objetivo la evaluación de las situaciones que favorezcan o no la utilización de las imprimaciones como método de reparación en un ambiente tropical marino. En este

  17. Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions

    Directory of Open Access Journals (Sweden)

    Retno Asti Werdhani

    2017-04-01

    Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer     Family Acts in Cases Management In Primary Care through The Five Family Oriented Question   Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were

  18. Producción del primer lote de conjugado antirrábico de origen caprino en el Perú

    Directory of Open Access Journals (Sweden)

    Ricardo Lopez I

    1997-01-01

    Full Text Available El objetivo del presente trabajo fue la producción y evaluación del primer lote de conjugado antirrábico de origen caprino producido en el Perú. La globulina antirrábica conjugada con fluoresceína fue preparada en el Laboratorio de Referencia de Rabia y la vacuna utilizada para la inmunización de los animales fue producida en el Laboratorio de Rabia del Centro Nacional de Producción de Biológicos del Instituto Nacional de Salud (Lima, Perú. Para la inmunización se utilizó una vacuna hecha a base de cultivo de células VERO con los adyuvantes de Freundt completo e incompleto. La vacunación se hizo semanalmente por cuatro semanas con descarga de virus vivo a la quinta y dos revacunaciones más posteriormente. El conjugado producido en el laboratorio obtuvo una intensidad (4+ en tinción especifica, (3+ en calidad de inclusiones y (1+ de fluorescencia no especifica. Sin embargo, el conjugado comercial obtuvo una intensidad más baja (3+ en tinción específica, mayor cantidad de inclusiones (4+ y menos tinción inespecífica (0+.

  19. Locus-specific EPIC-PCR primers for four distinct calmodulin genes of the Pacific bluefin tuna Thunnus orientalis (Temminck & Schlegel, 1844

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2017-01-01

    Full Text Available Abstract Nucleotide sequences of four distinct calmodulin genes (designated as CaM-A to -D of the Pacific bluefin tuna (Thunnus orientalis were compared. Nucleotide sequence divergence between the coding regions of four genes ranged from 16.0 to 21.6%, and locus-specific eight primer pairs targeting introns were designed. These primer pairs amplified expected size of fragments in five congeneric tuna species, and utility of these primer pairs was investigated using distant fish species.

  20. Menedžment projektov in finančna dodana vrednost

    Directory of Open Access Journals (Sweden)

    Marko Brcar

    2017-03-01

    Full Text Available Raziskovalno vprašanje (RV: Ali obstajajo statistično značilne povezave med dejavniki planiranja, organiziranja, vodenja in kontroliranja in finančno dodano vrednostjo gradbenih projektov. Namen: Namen raziskave je bil opraviti empirično raziskavo o vplivu dejavnikov menedžment projektov na finančno dodano vrednost v izbranih slovenskih gradbenih podjetjih ter podati predloge za izboljšanje stanja. Metoda: V kvantitativni raziskavi je sodelovalo 77 anketirancev iz slovenskih gradbenih podjetij, med katerimi je bila večina menedžerjev projektov. Rezultati: Na podlagi raziskave je razvidno, da imajo natančneje planirani gradbeni projekti statistično značilen vpliv na finančno dodano vrednost projektov, pri čemer imata največji vpliv ustrezno planiranje in preverjanje ciljev ter obvladovanje sprememb na projektu. Organizacija: Izidi raziskave bodo lahko v praktično pomoč vsem tistim, ki se ukvarjajo s področjem gradbenih projektov in njihovo uspešnostjo. Empirične ugotovitve iz raziskave naj bi spodbudile podjetja in druge organizacije, da bodo več časa namenila planiranju projekta. Originalnost: Prispevek raziskave k menedžerski znanosti in stroki je opravljena empirična raziskava in analiza vpliva dejavnikov menedžmenta na finančno dodano vrednost projekta, saj v zadnjih desetih letih v gradbeništvu ni bilo podobne raziskave. Omejitve: V raziskavi smo se omejili le na finančno dodano vrednost projektov, nismo se osredotočali na ostale dejavnike učinkovitosti projektov, na primer kakovost proizvoda ali procesa, zadovoljstvo uporabnika, zadovoljstvo odjemalcev in podobno.

  1. Hidroma subdural na fossa posterior

    Directory of Open Access Journals (Sweden)

    José Carlos Vasques

    1970-03-01

    Full Text Available Os autores relatam um caso de hidroma subdural na fossa craniana posterior conseqüente a traumatismo na região occipital. O paciente foi operado com pleno sucesso. A raridade da localização de hidroma na fossa posterior é salientada, sendo discutidos os possíveis mecanismos etio-patogênicos.

  2. OBNAŠANJE ŽVIŽGAČEV V RAČUNOVODSTVU - PRIMER SLOVENIJE

    OpenAIRE

    Koprivnik, Tamara

    2016-01-01

    Še vedno živimo v času slabega gospodarskega stanja, katerega posledice se kažejo tudi v porastu gospodarskega kriminala. Glede na to, da je gospodarski kriminal vedno težje odkrivati, so lahko žvižgači ključnega pomena pri odkrivanju in preprečevanju le-tega. V podjetjih so pogosto priča gospodarskemu kriminalu ravno računovodje, zato smo se v magistrskem delu osredotočili na njih. Problem, ki smo si ga zastavili v magistrskem delu je, da ni znano, kateri demografski dejavniki vplivajo na ob...

  3. Uporaba simulacijskega modeliranja in metod mrežnega programiranja za primer peke kruha

    OpenAIRE

    Duh, Mojca

    2010-01-01

    Diplomsko delo temelji na razvoju simulacijskega modela za pridelavo pšenice in nadaljnjo peko kruha ter aplikaciji metod mrežnega programiranja projekta peko kruha. Simulacijski model bo temeljil na tehnološki karti, katera bo osnova za ekonomsko analizo te dopolnilne dejavnosti. Vzporedno se bo na istem primeru aplicirala metoda mrežnega programiranja in sicer metoda CPM in PERT metoda. Pri metodi CPM bodo prikazani podatki o najzgodnejših in najpoznejših rokih dogodkov. Pri metodi PERT pri...

  4. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas.

    Science.gov (United States)

    Baay, M F; Quint, W G; Koudstaal, J; Hollema, H; Duk, J M; Burger, M P; Stolz, E; Herbrink, P

    1996-03-01

    We have compared the efficacies of three general primer pairs for the detection of human papillomavirus (HPV) DNA in formaldehyde-fixed paraffin-embedded carcinomas. The use of these primer pairs leads to underestimates of the HPV prevalence (GP5/6, 61.1%; CPI/IIG, 57.4%; MY09/11, 46.9%; combined, 72.8%). The efficacy of each primer pair seemed to be inversely correlated to the length of the amplimer produced. By using newly developed type-specific primer pairs (amplimer length, approximately 100 bp), an increase in HPV DNA detection (87.6%) was found.

  5. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    Science.gov (United States)

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  6. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro

    2012-11-01

    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  7. Nuclear microsatellite primers for the endangered relict fir, Abies pinsapo (Pinaceae) and cross-amplification in related Mediterranean Species.

    Science.gov (United States)

    Sánchez-Robles, Jose M; Balao, Francisco; García-Castaño, Juan L; Terrab, Anass; Navarro-Sampedro, Laura; Talavera, Salvador

    2012-11-05

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  8. Introducing a primer for career development and promotion: succeeding as a psychologist in an academic health center.

    Science.gov (United States)

    Christophersen, Edward; Butt, Zeeshan

    2012-12-01

    Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.

  9. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    Science.gov (United States)

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Methicillin-resistant Staphylococcus aureus Screening PCR adapted to locally emerging variants-Evaluation of novel SCCmec primers.

    Science.gov (United States)

    Herma, Miriam; Petersdorf, Sabine; Henrich, Birgit

    2017-06-01

    Infections with multi-resistant bacteria, such as Methicillin-resistant Staphylococcus aureus (MRSA), represent a world-wide health-care problem. The original MRSA Screening TaqMan PCR was based on the detection of the SCCmec-orfX-junction as described by the group of Huletsky in 2004. In the recent years, this assay increasingly failed to detect new MRSA variants in swab specimens. In this work, we analyzed the usefulness of 17 additional SCCmec primers to increase PCR sensitivity by testing 290 collected samples with negative PCR results and positive MRSA culture in a retrospective analysis, and 380 samples of the daily routine diagnostics. Sequencing of the PCR products revealed that locally new MRSA variants became detectable by nine of these forward primers. Four primers were solely responsible for the detection of 85.4% (117/123) of the PCR products: F13 (n=76), F11 (n=6), F14 (n=15) and F25 (n=8). These four primers were integrated in the Screening PCR and the novel primer collection was validated by testing 71 MRSA isolates, which covered SCCmec types I to VI, 50 MSSA isolates and 100 swab specimens. The sensitivity of MRSA Screening PCR increased from 93% to 98.6% without affecting the detection of the common MRSA strains. Phylogenetic analysis of the PCR products suggests that the adapted MRSA Screening PCR is able to detect SCCmec types I-X, including CA- and LA-MRSA variants by the SCCmec primers F11 and F25. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  12. Affinity and sequence specificity of DNA binding and site selection for primer synthesis by Escherichia coli primase.

    Science.gov (United States)

    Khopde, Sujata; Biswas, Esther E; Biswas, Subhasis B

    2002-12-17

    Primase is an essential DNA replication enzyme in Escherichia coli and responsible for primer synthesis during lagging strand DNA replication. Although the interaction of primase with single-stranded DNA plays an important role in primer RNA and Okazaki fragment synthesis, the mechanism of DNA binding and site selection for primer synthesis remains unknown. We have analyzed the energetics of DNA binding and the mechanism of site selection for the initiation of primer RNA synthesis on the lagging strand of the replication fork. Quantitative analysis of DNA binding by primase was carried out using a number of oligonucleotide sequences: oligo(dT)(25) and a 30 bp oligonucleotide derived from bacteriophage G4 origin (G4ori-wt). Primase bound both sequences with moderate affinity (K(d) = 1.2-1.4 x 10(-)(7) M); however, binding was stronger for G4ori-wt. G4ori-wt contained a CTG trinucleotide, which is a preferred site for initiation of primer synthesis. Analysis of DNA binding isotherms derived from primase binding to the oligonucleotide sequences by fluorescence anisotropy indicated that primase bound to DNA as a dimer, and this finding was further substantiated by electrophoretic mobility shift assays (EMSAs) and UV cross-linking of the primase-DNA complex. Dissection of the energetics involved in the primase-DNA interaction revealed a higher affinity of primase for DNA sequences containing the CTG triplet. This sequence preference of primase may likely be responsible for the initiation of primer synthesis in the CTG triplet sites in the E. coli lagging strand as well as in the origin of replication of bacteriophage G4.

  13. Lactancia materna, alimentación artificial y el primer contacto con azúcar

    Directory of Open Access Journals (Sweden)

    Fabian Calixto Fraiz

    2013-01-01

    Full Text Available Objetivo: Este estudio evaluó los cambios en el patrón de lactancia materna, alimentación artificial y en la introducción de azúcar en la dieta de niños de 0 a 36 meses, a través de dos estudios, con un intervalo de 13 años en la ciudad de Curitiba, Paraná, Brasil. Material y métodos: Poblaciones semejantes de una misma región geográfica fueron evaluadas a través de un cuestionario, en los años de 1993 y 2006, envolviendo, respectivamente, las madres de 180 y 94 niños. Introducción de azúcar en la dieta fue considerada precoz cuando ocurrió antes del 6º mes completo de vida. Los datos fueron analizados estadísticamente a través del test de qui-cuadrado y test exacto de Fisher (α= 0,05. Resultados: Hubo diferencias en la frecuencia del primer contacto con azúcar (p <0,001, que ocurrió en el primer mes de vida en 61,7% de los niños del primer estudio y en sólo 3,2% de los niños del segundo estudio. Hubo diferencias en el patrón de lactancia materna (p = 0,02, siendo la prevalencia de niños amamantados mayor en el segundo estudio. No fueron encontradas diferencias estadísticamente significativas en la prevalencia de uso de biberón, uso de biberón durante la noche y lactancia materna durante la noche, así como en el uso de biberón conteniendo azúcar. Conclusiones: Estos resultados indican que la lactancia materna puede, además de sus varias ventajas, también promover el aplazamiento de la introducción de azúcar en la dieta infantil. Nuevas investigaciones son necesarias para confirmar esta hipótesis.

  14. A socio-structural approach to preventing injection drug use initiation: rationale for the PRIMER study.

    Science.gov (United States)

    Werb, Daniel; Garfein, Richard; Kerr, Thomas; Davidson, Peter; Roux, Perrine; Jauffret-Roustide, Marie; Auriacombe, Marc; Small, Will; Strathdee, Steffanie A

    2016-09-15

    Injection drug use remains a primary driver of HIV and HCV-related harms globally. However, there is a gap in efforts to prevent individuals from transitioning into injecting. People who inject drugs (PWID) play a key role in the transition of others into injecting, and while behavioral interventions have been developed to address this phenomenon, socio-structural approaches remain unexplored. To that end, we hypothesize that certain interventions designed to reduce injecting-related risk behaviors may also reduce the risk that PWID expose and introduce others into injecting. Identifying the preventive potential of existing interventions will inform broader efforts to prevent injecting and related harms. The Preventing Injecting by Modifying Existing Responses (PRIMER) study is a multi-country mixed methods study with an aim to investigate whether specific interventions (e.g., opioid substitution therapy, supervised injection facilities, stable housing, incarceration environments) and related factors (e.g., public injecting and gender) influence the likelihood that PWID initiate others into injecting. This study will (1) investigate the PWID participation in injection initiation; (2) identify factors influencing the risk that PWID expose others to or facilitate injection initiation; (3) describe drug scene roles that increase the risk of PWID facilitating injection initiation; and (4) evaluate the impact of structural, social, or biomedical interventions on the risk that PWID facilitate injection initiation. It does so by pooling observational data from cohort studies of PWID in six cities: Vancouver, Canada; San Diego, USA; Tijuana, Mexico; Paris, Marseille, and Bordeaux, France. Team members are conducting a prospective, multi-site study of PWID (n = 3050) in North America and France that includes quantitative and qualitative data collection through four separate cohort studies of PWID (San Diego, STAHR II; Tijuana, El Cuete IV; Vancouver, V-DUS; Bordeaux

  15. Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

    Science.gov (United States)

    Pitta, João; Branco, Teresa C; Portugal, Jaime

    2017-09-27

    Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermal cycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

  16. A epilepsia na neurocisticercose

    Directory of Open Access Journals (Sweden)

    Luís Marques-Assis

    1972-12-01

    Full Text Available Foram estudados 131 casos de epilepsia com etiologia cisticercótica comprovada. A idade variou de 2 a 68 anos; 75 pacientes eram de sexo masculino e 56 de sexo feminino; 117 eram brancos, 10 pardos, três pretos e um amarelo. A idade de início da doença predominou na primeira década. O estudo foi feito em relação ao tipo de epilepsia, ao tempo decorrido após a primeira crise, à freqüência das crises e ao eletrencefalograma relativamente às epilepsias em geral. Investigação foi feita também em relação à cefaléia, aos achados neurológicos, liquóricos, radiológicos simples e contrastados e anátomo-patológicos. A análise dos resultados permitiu aos autores as seguintes conclusões: 1 No grupo de neurocisticercose o início da doença predominou na primeira e a partir da quarta década em relação às epilepsias em geral. 2 Dentre as manifestações clínicas predominaram as formas convulsivas da doença (61%, sendo as crises bravas-jacksonianas as menos freqüentes (4%; quando comparadas com as epilepsias em geral, verifica-se incidência menor das convulsões generalizadas na neurocisticercose. 3 Quanto ao tempo de doença, verifica-se predomínio das formas de duração mais curta (um ano ou menos na neurocisticercose. 4 A severidade da epilepsia, traduzida pela freqüência das crises, foi menor no grupo com neurocisticercose. 5 Excluídos os casos com anormalidades eletrencefalográficas contínuas, foram encontrados maiores índices percentuais de EEG normal na neurocisticercose que nas epilepsias em geral. 6 A cefaléia estava presente em 68% dos casos, assumindo caráter paroxístico na maior parte (78%; em 67% dos casos com cefaléia paroxística não havia concomitantemente sinais de hipertensão intracraniana; nos casos com cefaléia contínua, em apenas dois (13% esses sinais não estavam presentes. 7 Na maior parte dos casos (62% as manifestações epilépticas se apresentaram isoladamente, sem sinais neurol

  17. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  18. Fortalecimiento de la autoestima mediante la psicoterapia Gestalt en estudiantes del primer ciclo de una universidad privada de Lima metropolitana

    OpenAIRE

    Alva Sánchez, Carlos Marcelino

    2016-01-01

    Comprueba el fortalecimiento de la autoestima mediante la psicoterapia Gestalt en estudiantes del primer ciclo de una Universidad de Lima Metropolitana. La hipótesis central sustenta que el programa basado en la psicoterapia Gestalt fortalece significativamente la autoestima de estudiantes del primer ciclo de una universidad privada de Lima Metropolitana. La muestra está conformada por 10 estudiantes entre 16 – 23 años, de sexo masculino y femenino, con grado de instrucción superior que estud...

  19. The CERES / NA45 experiment

    CERN Multimedia

    Laurent Guiraud

    2000-01-01

    Ceres is one of the second generation heavy ion experiments at CERN's SPS. It is dedicated to the study of electron-positron pairs in relativistic nuclear collisions. NA45 is one of the seven experiments (NA44, NA45, NA49, NA50, NA52, WA97/NA57 and WA98) involved in CERN's Heavy Ion programme which provided evidence for the existence of a new state of matter, the quark-gluon plasma. In this state, quarks, instead of being bound up into more complex particles such as protons and neutrons, are liberated and roam freely. Theory predicts that this state must have existed at about 10 microseconds after the Big Bang, before the formation of matter as we know it today.

  20. Genetics on the Fly: A Primer on the Drosophila Model System

    Science.gov (United States)

    Hales, Karen G.; Korey, Christopher A.; Larracuente, Amanda M.; Roberts, David M.

    2015-01-01

    Fruit flies of the genus Drosophila have been an attractive and effective genetic model organism since Thomas Hunt Morgan and colleagues made seminal discoveries with them a century ago. Work with Drosophila has enabled dramatic advances in cell and developmental biology, neurobiology and behavior, molecular biology, evolutionary and population genetics, and other fields. With more tissue types and observable behaviors than in other short-generation model organisms, and with vast genome data available for many species within the genus, the fly’s tractable complexity will continue to enable exciting opportunities to explore mechanisms of complex developmental programs, behaviors, and broader evolutionary questions. This primer describes the organism’s natural history, the features of sequenced genomes within the genus, the wide range of available genetic tools and online resources, the types of biological questions Drosophila can help address, and historical milestones. PMID:26564900