
Sample records for myopathy translating chemical

  1. Myopathies

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  2. Myopathy

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...


    Dimachkie, Mazen M.; Barohn, Richard J.


    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  4. Axial myopathy

    Witting, Nanna; Andersen, Linda K; Vissing, John


    Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...

  5. Metabolic Myopathies.

    Tarnopolsky, Mark A


    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  6. Mitochondrial myopathies.

    DiMauro, Salvatore


    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  7. [Metabolic myopathies].

    Papazian, Óscar; Rivas-Chacón, Rafael


    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  8. Molecular and Genetic Studies of Congenital Myopathies


    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  9. Myopathy in acute hypothyroidism

    Ma, JTC; Yu, YL; Kung, AWC


    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  10. Myopathy in acute hypothyroidism.

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.


    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  11. Genetics Home Reference: Miyoshi myopathy

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  12. [Descending ocular myopathy].

    de Freitas, M R; Nascimento, O J


    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  13. Mitochondrial disorders in congenital myopathies

    D. A. Kharlamov


    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.


    O. M. Drapkina


    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  15. Genuine myotubular myopathy

    Edstroem, L.; Wroblewski, R.; Mair, W.G.


    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  16. Cerebrovascular Accidents In Myopathies

    Farzad Fatehi


    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  17. Muscle regeneration in mitochondrial myopathies

    Krag, T O; Hauerslev, S; Jeppesen, T D


    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  18. Spectrum of metabolic myopathies.

    Angelini, Corrado


    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  19. Foreign Language Translation of Chemical Nomenclature by Computer


    Chemical compound names remain the primary method for conveying molecular structures between chemists and researchers. In research articles, patents, chemical catalogues, government legislation, and textbooks, the use of IUPAC and traditional compound names is universal, despite efforts to introduce more machine-friendly representations such as identifiers and line notations. Fortunately, advances in computing power now allow chemical names to be parsed and generated (read and written) with almost the same ease as conventional connection tables. A significant complication, however, is that although the vast majority of chemistry uses English nomenclature, a significant fraction is in other languages. This complicates the task of filing and analyzing chemical patents, purchasing from compound vendors, and text mining research articles or Web pages. We describe some issues with manipulating chemical names in various languages, including British, American, German, Japanese, Chinese, Spanish, Swedish, Polish, and Hungarian, and describe the current state-of-the-art in software tools to simplify the process. PMID:19239237

  20. Inherited myopathies and muscular dystrophies

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  1. Translation Effects in Fluorine Doped Tin Oxide Thin Film Properties by Atmospheric Pressure Chemical Vapour Deposition

    Mohammad Afzaal


    Full Text Available In this work, the impact of translation rates in fluorine doped tin oxide (FTO thin films using atmospheric pressure chemical vapour deposition (APCVD were studied. We demonstrated that by adjusting the translation speeds of the susceptor, the growth rates of the FTO films varied and hence many of the film properties were modified. X-ray powder diffraction showed an increased preferred orientation along the (200 plane at higher translation rates, although with no actual change in the particle sizes. A reduction in dopant level resulted in decreased particle sizes and a much greater degree of (200 preferred orientation. For low dopant concentration levels, atomic force microscope (AFM studies showed a reduction in roughness (and lower optical haze with increased translation rate and decreased growth rates. Electrical measurements concluded that the resistivity, carrier concentration, and mobility of films were dependent on the level of fluorine dopant, the translation rate and hence the growth rates of the deposited films.

  2. Stepwise approach to myopathy in systemic disease.

    Chawla, Jasvinder


    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  3. Exercise training in metabolic myopathies

    Vissing, J


    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  4. Genetics Home Reference: nemaline myopathy

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  5. Endocrine myopathy: Case-based review

    Babul Reddy Hanmayyagari


    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  6. Resveratrol and Myopathy

    Bastin, Jean; Djouadi, Fatima


    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  7. Lipid storage myopathies.

    Bruno, Claudio; Dimauro, Salvatore


    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  8. Amyloid myopathy: a diagnostic challenge

    Heli Tuomaala


    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  9. Idiopathic Inflammatory Myopathies: An update

    Bulent KURT


    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  10. Immune-mediated statin myopathy.

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit


    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  11. Localized scleroderma and regional inflammatory myopathy.

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A


    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  12. Evidence-based treatment of metabolic myopathy

    Yan LIN


    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  13. A diagnostic algorithm for metabolic myopathies.

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio


    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  14. Analysis of lipid profile in lipid storage myopathy.

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi


    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  15. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia


    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  16. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)


    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  17. Genetics Home Reference: idiopathic inflammatory myopathy

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  18. Understanding mitochondrial myopathies: a review

    Abhimanyu S. Ahuja


    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  19. An integrated diagnosis strategy for congenital myopathies.

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  20. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.


    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  1. Adult-onset nemaline myopathy presenting as respiratory failure.

    Kelly, Emer


    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  2. ColVI myopathies: where do we stand, where do we go?

    Allamand Valérie


    Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

  3. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Vikas Sharma


    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  4. Acute steroid myopathy: a highly overlooked entity.

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev


    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  5. Centronuclear myopathy in a Border collie dog.

    Eminaga, S; Cherubini, G B; Shelton, G D


    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  6. Aerobic Training in Patients with Congenital Myopathy

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen


    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and H2-2013-066....

  7. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa


    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  8. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Aralikatte Onkarappa Saroja


    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  9. The expanding phenotype of mitochondrial myopathy.

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana


    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  10. Hereditary myopathies with early respiratory insufficiency in adults.

    Naddaf, Elie; Milone, Margherita


    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  11. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  12. Spaceborne Remote Sensing of Aerosol Type: Global Distribution, Model Evaluation and Translation into Chemical Speciation

    Kacenelenbogen, M. S.; Tan, Q.; Johnson, M. S.; Burton, S. P.; Redemann, J.; Hasekamp, O. P.; Dawson, K. W.; Hair, J. W.; Ferrare, R. A.; Butler, C. F.; Holben, B. N.; Beyersdorf, A. J.; Ziemba, L. D.; Froyd, K. D.; Dibb, J. E.; Shingler, T.; Sorooshian, A.; Jimenez, J. L.; Campuzano Jost, P.; Jacob, D.; Kim, P. S.; Travis, K.; Lacagnina, C.


    It is essential to evaluate and refine aerosol classification methods applied to passive satellite remote sensing. We have developed an aerosol classification algorithm (called Specified Clustering and Mahalanobis Classification, SCMC) that assigns an aerosol type to multi-parameter retrievals by spaceborne, airborne or ground-based passive remote sensing instruments [1]. The aerosol types identified by our scheme are pure dust, polluted dust, urban-industrial/developed economy, urban-industrial/developing economy, dark biomass smoke, light biomass smoke and pure marine. We apply the SCMC method to inversions from the ground-based AErosol RObotic NETwork (AERONET [2]) and retrievals from the space-borne Polarization and Directionality of Earth's Reflectances instrument (POLDER, [3]). The POLDER retrievals that we use differ from the standard POLDER retrievals [4] as they make full use of multi-angle, multispectral polarimetric data [5]. We analyze agreement in the aerosol types inferred from both AERONET and POLDER and evaluate GEOS-Chem [6] simulations over the globe. Finally, we use in-situ observations from the SEAC4RS airborne field experiment to bridge the gap between remote sensing-inferred qualitative SCMC aerosol types and their corresponding quantitative chemical speciation. We apply the SCMC method to airborne in-situ observations from the NASA Langley Aerosol Research Group Experiment (LARGE, [7]) and the Differential Aerosol Sizing and Hygroscopicity Spectrometer Probe (DASH-SP, [8]) instruments; we then relate each coarsely defined SCMC type to a sum of percentage of individual aerosol species, using in-situ observations from the Particle Analysis by Laser Mass Spectrometry (PALMS, [9]), the Soluble Acidic Gases and Aerosol (SAGA, [10]), and the High - Resolution Time - of - Flight Aerosol Mass Spectrometer (HR ToF AMS, [11]). [1] Russell P. B., et al., JGR, 119.16 (2014) [2] Holben B. N., et al., RSE, 66.1 (1998) [3] Tanré D., et al., AMT, 4.7 (2011

  13. Hypothyroid myopathy. A clinical and pathologaical study.

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G


    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  14. [Cardiac myopathy due to overt hypothyroidism].

    Harbeck, B; Berndt, M J; Lehnert, H


    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  15. Treatment Opportunities in Patients With Metabolic Myopathies

    Ørngreen, Mette Cathrine; Vissing, John


    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  16. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others


    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  17. [Biologic therapy in idiopathic inflammatory myopathy].

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M


    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  18. Flaccid quadriplegia due to thyrotoxic myopathy.

    Couillard, Philippe; Wijdicks, Eelco F M


    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  19. Atypical presentation of GNE myopathy with asymmetric hand weakness

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria


    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  20. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  1. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Özgül Uçar


    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  2. Congenital myopathy is caused by mutation of HACD1

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti


    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  3. Skeletal muscle repair in a mouse model of nemaline myopathy

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.


    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  4. Aerobic Training in Patients with Congenital Myopathy.

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and H2-2013-066.

  5. ReportSites - A Computational Method to Extract Positional and Physico- Chemical Information from Large-Scale Proteomic Post-Translational Modification Datasets

    Edwards, Alistair; Edwards, Gregory; Larsen, Martin Røssel


    -translational modification data sets, wherein patterns of sequence surrounding processed sites may reveal more about the functional and structural requirements of the modification and the biochemical processes that regulate them. Results: We developed Report Sites using a test set of phosphoproteomic data from rat......-chemical environment (local pI and hydrophobicity). These were then also compared to corresponding values extracted from the full database to allow comparison of phosphorylation trends. Conclusions: Report Sites enabled physico-chemical aspects of protein phosphorylation to be deciphered in a test set of eleven...... thousand phospho sites. Basic properties of modified proteins, such as site location in the context of the complete protein, were also documented. This program can be easily adapted to any post-translational modification (or, indeed, to any defined amino acid sequence), or expanded to include more...

  6. Association between statin-associated myopathy and skeletal muscle damage.

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette


    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  7. Translation Theory 'Translated'

    Wæraas, Arild; Nielsen, Jeppe


    Translation theory has proved to be a versatile analytical lens used by scholars working from different traditions. On the basis of a systematic literature review, this study adds to our understanding of the ‘translations’ of translation theory by identifying the distinguishing features of the most...... common theoretical approaches to translation within the organization and management discipline: actor-network theory, knowledge-based theory, and Scandinavian institutionalism. Although each of these approaches already has borne much fruit in research, the literature is diverse and somewhat fragmented......, but also overlapping. We discuss the ways in which the three versions of translation theory may be combined and enrich each other so as to inform future research, thereby offering a more complete understanding of translation in and across organizational settings....

  8. Translation of Angiotensin-Converting Enzyme 2 upon Liver- and Lung-Targeted Delivery of Optimized Chemically Modified mRNA

    Eva Schrom


    Full Text Available Changes in lifestyle and environmental conditions give rise to an increasing prevalence of liver and lung fibrosis, and both have a poor prognosis. Promising results have been reported for recombinant angiotensin-converting enzyme 2 (ACE2 protein administration in experimental liver and lung fibrosis. However, the full potential of ACE2 may be achieved by localized translation of a membrane-anchored form. For this purpose, we advanced the latest RNA technology for liver- and lung-targeted ACE2 translation. We demonstrated in vitro that transfection with ACE2 chemically modified messenger RNA (cmRNA leads to robust translation of fully matured, membrane-anchored ACE2 protein. In a second step, we designed eight modified ACE2 cmRNA sequences and identified a lead sequence for in vivo application. Finally, formulation of this ACE2 cmRNA in tailor-made lipidoid nanoparticles and in lipid nanoparticles led to liver- and lung-targeted translation of significant amounts of ACE2 protein, respectively. In summary, we provide evidence that RNA transcript therapy (RTT is a promising approach for ACE2-based treatment of liver and lung fibrosis to be tested in fibrotic disease models.

  9. Incorporation of post-translational modified amino acids as an approach to increase both chemical and biological diversity of conotoxins and conopeptides.

    Espiritu, Michael J; Cabalteja, Chino C; Sugai, Christopher K; Bingham, Jon-Paul


    Bioactive peptides from Conus venom contain a natural abundance of post-translational modifications that affect their chemical diversity, structural stability, and neuroactive properties. These modifications have continually presented hurdles in their identification and characterization. Early endeavors in their analysis relied on classical biochemical techniques that have led to the progressive development and use of novel proteomic-based approaches. The critical importance of these post-translationally modified amino acids and their specific assignment cannot be understated, having impact on their folding, pharmacological selectivity, and potency. Such modifications at an amino acid level may also provide additional insight into the advancement of conopeptide drugs in the quest for precise pharmacological targeting. To achieve this end, a concerted effort between the classical and novel approaches is needed to completely elucidate the role of post-translational modifications in conopeptide structure and dynamics. This paper provides a reflection in the advancements observed in dealing with numerous and multiple post-translationally modified amino acids within conotoxins and conopeptides and provides a summary of the current techniques used in their identification.

  10. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  11. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)


    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  12. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.


    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  13. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  14. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  15. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P


    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Myofibrillar myopathies: State of the art, present and future challenges.

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B


    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Abdullah Mishal


    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  18. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.


    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  19. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    Witting, Nanna; Werlauff, Ulla; Duno, Morten


    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  20. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.


    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  1. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Kang Won Lee


    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  2. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    F Binesh


    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  3. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin


    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  4. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun


    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  5. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)


    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  6. Glucocorticoid-induced myopathy in the intensive care unit

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner


    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  7. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn


    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  8. Understanding Translation

    Schjoldager, Anne Gram; Gottlieb, Henrik; Klitgård, Ida

    Understanding Translation is designed as a textbook for courses on the theory and practice of translation in general and of particular types of translation - such as interpreting, screen translation and literary translation. The aim of the book is to help you gain an in-depth understanding...... of the phenomenon of translation and to provide you with a conceptual framework for the analysis of various aspects of professional translation. Intended readers are students of translation and languages, but the book will also be relevant for others who are interested in the theory and practice of translation...... - translators, language teachers, translation users and literary, TV and film critics, for instance. Discussions focus on translation between Danish and English....

  9. Translation Techniques

    Marcia Pinheiro


    In this paper, we discuss three translation techniques: literal, cultural, and artistic. Literal translation is a well-known technique, which means that it is quite easy to find sources on the topic. Cultural and artistic translation may be new terms. Whilst cultural translation focuses on matching contexts, artistic translation focuses on matching reactions. Because literal translation matches only words, it is not hard to find situations in which we should not use this technique.  Because a...

  10. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Alessandra Ruggieri


    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  11. Genetics Home Reference: CAV3-related distal myopathy

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  12. Congenital myopathy is caused by mutation of HACD1.

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti


    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  13. Eosinophilic fasciitis in a child mimicking a myopathy.

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.


    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  14. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip


    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  15. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.


    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  16. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J


    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  17. REV-ERB and ROR: therapeutic targets for treating myopathies

    Welch, Ryan D.; Flaveny, Colin A.


    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  18. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker


    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  19. Translational Creativity

    Nielsen, Sandro


    A long-established approach to legal translation focuses on terminological equivalence making translators strictly follow the words of source texts. Recent research suggests that there is room for some creativity allowing translators to deviate from the source texts. However, little attention...... is given to genre conventions in source texts and the ways in which they can best be translated. I propose that translators of statutes with an informative function in expert-to-expert communication may be allowed limited translational creativity when translating specific types of genre convention....... This creativity is a result of translators adopting either a source-language or a target-language oriented strategy and is limited by the pragmatic principle of co-operation. Examples of translation options are provided illustrating the different results in target texts. The use of a target-language oriented...

  20. Machine Translation

    Research Mt System Example: The 'Janus' Translating Phone Project. The Janus ... based on laptops, and simultaneous translation of two speakers in a dialogue. For more ..... The current focus in MT research is on using machine learning.

  1. Genetics Home Reference: distal myopathy 2

    ... nasal. The weakness can also cause difficulty swallowing (dysphagia). Related Information What does it mean if a ... which is a chemical cousin of DNA. Some studies indicate that matrin 3 binds and stabilizes a ...

  2. The effect of coenzyme Q10 in statin myopathy.

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard


    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  3. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold


    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Miopatia ocular descendente Descending ocular myopathy: a case report

    Marcos R. G. de Freitas


    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  5. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Şenol Kobak


    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  6. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.


    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  7. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.


    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  8. Diagnosis and treatment of the idiopathic inflammatory myopathies

    Gazeley, David J.; Cronin, Mary E.


    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  9. Association between statin-associated myopathy and skeletal muscle damage.

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette


    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  10. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Yamini, B; Schillhorn van Veen, T W


    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  11. Search for Pompe disease among patients with undetermined myopathies.

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A


    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya


    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  13. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)


    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  14. Zidovudine-induced myopathy: A study in Indian patients.

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish


    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  15. Machine translation

    Nagao, M


    Each language has its own structure. In translating one language into another one, language attributes and grammatical interpretation must be defined in an unambiguous form. In order to parse a sentence, it is necessary to recognize its structure. A so-called context-free grammar can help in this respect for machine translation and machine-aided translation. Problems to be solved in studying machine translation are taken up in the paper, which discusses subjects for semantics and for syntactic analysis and translation software. 14 references.

  16. Chemical rescue of the post-translationally carboxylated lysine mutant of allantoinase and dihydroorotase by metal ions and short-chain carboxylic acids.

    Ho, Ya-Yeh; Huang, Yen-Hua; Huang, Cheng-Yang


    Bacterial allantoinase (ALLase) and dihydroorotase (DHOase) are members of the cyclic amidohydrolase family. ALLase and DHOase possess similar binuclear metal centers in the active site in which two metals are bridged by a post-translationally carboxylated lysine. In this study, we determined the effects of carboxylated lysine and metal binding on the activities of ALLase and DHOase. Although DHOase is a metalloenzyme, purified DHOase showed high activity without additional metal supplementation in a reaction mixture or bacterial culture. However, unlike DHOase, ALLase had no activity unless some specific metal ions were added to the reaction mixture or culture. Substituting the metal binding sites H59, H61, K146, H186, H242, or D315 with alanine completely abolished the activity of ALLase. However, the K146C, K146D and K146E mutants of ALLase were still active with about 1-6% activity of the wild-type enzyme. These ALLase K146 mutants were found to have 1.4-1.7 mol metal per mole enzyme subunit, which may indicate that they still contained the binuclear metal center in the active site. The activity of the K146A mutant of the ALLase and the K103A mutant of DHOase can be chemically rescued by short-chain carboxylic acids, such as acetic, propionic, and butyric acids, but not by ethanol, propan-1-ol, and imidazole, in the presence of Co2+ or Mn2+ ions. However, the activity was still ~10-fold less than that of wild-type ALLase. Overall, these results indicated that the 20 natural basic amino acid residues were not sufficiently able to play the role of lysine. Accordingly, we proposed that during evolution, the post-translational modification of carboxylated lysine in the cyclic amidohydrolase family was selected for promoting binuclear metal center self-assembly and increasing the nucleophilicity of the hydroxide at the active site for enzyme catalysis. This kind of chemical rescue combined with site-directed mutagenesis may also be used to identify a binuclear metal

  17. Translating India

    Kothari, Rita


    The cultural universe of urban, English-speaking middle class in India shows signs of growing inclusiveness as far as English is concerned. This phenomenon manifests itself in increasing forms of bilingualism (combination of English and one Indian language) in everyday forms of speech - advertisement jingles, bilingual movies, signboards, and of course conversations. It is also evident in the startling prominence of Indian Writing in English and somewhat less visibly, but steadily rising, activity of English translation from Indian languages. Since the eighties this has led to a frenetic activity around English translation in India's academic and literary circles. Kothari makes this very current phenomenon her chief concern in Translating India.   The study covers aspects such as the production, reception and marketability of English translation. Through an unusually multi-disciplinary approach, this study situates English translation in India amidst local and global debates on translation, representation an...

  18. Translating Inclusion

    Fallov, Mia Arp; Birk, Rasmus


    The purpose of this paper is to explore how practices of translation shape particular paths of inclusion for people living in marginalized residential areas in Denmark. Inclusion, we argue, is not an end-state, but rather something which must be constantly performed. Active citizenship, today......, is not merely a question of participation, but of learning to become active in all spheres of life. The paper draws on empirical examples from a multi-sited field work in 6 different sites of local community work in Denmark, to demonstrate how different dimensions of translation are involved in shaping active...... citizenship. We propose the following different dimensions of translation: translating authority, translating language, translating social problems. The paper takes its theoretical point of departure from assemblage urbanism, arguing that cities are heterogeneous assemblages of socio-material interactions...

  19. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M


    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  20. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John


    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  1. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John


    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  2. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    V. A. Erokhina


    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  3. Compositional translation

    Appelo, Lisette; Janssen, Theo; Jong, de F.M.G.; Landsbergen, S.P.J.


    This book provides an in-depth review of machine translation by discussing in detail a particular method, called compositional translation, and a particular system, Rosetta, which is based on this method. The Rosetta project is a unique combination of fundamental research and large-scale

  4. Muscle structural changes in mitochondrial myopathy relate to genotype

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.


    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  5. Binary translation using peephole translation rules

    Bansal, Sorav; Aiken, Alex


    An efficient binary translator uses peephole translation rules to directly translate executable code from one instruction set to another. In a preferred embodiment, the translation rules are generated using superoptimization techniques that enable the translator to automatically learn translation rules for translating code from the source to target instruction set architecture.

  6. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Váncsa, Andrea


    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  7. Statin-associated myopathy: from genetic predisposition to clinical management.

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R


    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  8. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B


    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  9. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H


    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  10. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Christopher-Stine, Lisa; Basharat, Pari


    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  11. Precision translator

    Reedy, Robert P.; Crawford, Daniel W.


    A precision translator for focusing a beam of light on the end of a glass fiber which includes two turning fork-like members rigidly connected to each other. These members have two prongs each with its separation adjusted by a screw, thereby adjusting the orthogonal positioning of a glass fiber attached to one of the members. This translator is made of simple parts with capability to keep adjustment even in condition of rough handling.

  12. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Zhiyv Niu


    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  13. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita


    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  14. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    R Burnham


    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  15. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W


    The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

  16. Comparison of blood aminotransferase methods for assessment of myopathy and hepatopathy in Florida manatees (Trichechus manatus latirostris).

    Harr, Kendal E; Allison, Kathryn; Bonde, Robert K; Murphy, David; Harvey, John W


    Muscle injury is common in Florida manatees (Trichechus manatus latirostris). Plasma aspartate aminotransferase (AST) is frequently used to assess muscular damage in capture myopathy and traumatic injury. Therefore, accurate measurement of AST and alanine aminotransferase (ALT) is important in managed, free-ranging animals, as well as in those rehabilitating from injury. Activities of these enzymes, however, are usually not increased in manatees with either acute or chronic muscle damage, despite marked increases in plasma creatine kinase activity. It is hypothesized that this absence of response is due to apoenzymes in the blood not detected by commonly used veterinary assays. Addition of coenzyme pyridoxal-5-phosphate (P5P or vitamin B6) should, therefore, result in higher measured enzyme activities. The objective of this study was to determine the most accurate, precise, and diagnostically useful method for aminotransferase measurement in manatees that can be used in veterinary practices and diagnostic laboratories. Additionally, appropriate collection and storage techniques were assessed. The use of an optimized commercial wet chemical assay with 100 micromol P5P resulted in a positive bias of measured enzyme activities in a healthy population of animals. However, AST and ALT were still much lower than that typically observed in domestic animals and should not be used alone in the assessment of capture myopathy and muscular trauma. Additionally, the dry chemistry analyzer, typically used in clinics, reported significantly higher and less precise AST and ALT activities with poor correlation to those measured with wet chemical methods found in diagnostic laboratories. Therefore, these results cannot be clinically compared. Overall, the optimized wet chemical method was the most precise and diagnostically useful measurement of aminotransferase in samples. Additionally, there was a statistically significant difference between paired serum and plasma measurement

  17. Machine Translation and Other Translation Technologies.

    Melby, Alan


    Examines the application of linguistic theory to machine translation and translator tools, discusses the use of machine translation and translator tools in the real world of translation, and addresses the impact of translation technology on conceptions of language and other issues. Findings indicate that the human mind is flexible and linguistic…

  18. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Ting Chen


    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  19. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.


    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  20. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian


    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  1. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van


    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  2. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C


    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  3. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  4. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie


    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  5. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Steven Heireman


    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  6. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Harsh Patel


    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.


    Medical Service


    It is reminded that all persons who use chemicals must inform CERN's Chemistry Service (TIS-GS-GC) and the CERN Medical Service (TIS-ME). Information concerning their toxicity or other hazards as well as the necessary individual and collective protection measures will be provided by these two services. Users must be in possession of a material safety data sheet (MSDS) for each chemical used. These can be obtained by one of several means : the manufacturer of the chemical (legally obliged to supply an MSDS for each chemical delivered) ; CERN's Chemistry Service of the General Safety Group of TIS ; for chemicals and gases available in the CERN Stores the MSDS has been made available via EDH either in pdf format or else via a link to the supplier's web site. Training courses in chemical safety are available for registration via HR-TD. CERN Medical Service : TIS-ME :73186 or Chemistry Service : TIS-GS-GC : 78546

  8. The genetic basis of pectoralis major myopathies in modern broiler chicken lines

    Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago


    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

  9. Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

    de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique


    Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

  10. Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

    Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan


    Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

  11. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron


    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  12. Translation Competence

    Vandepitte, Sonia; Mousten, Birthe; Maylath, Bruce


    After Kiraly (2000) introduced the collaborative form of translation in classrooms, Pavlovic (2007), Kenny (2008), and Huertas Barros (2011) provided empirical evidence that testifies to the impact of collaborative learning. This chapter sets out to describe the collaborative forms of learning at...

  13. Translating Harbourscapes

    Diedrich, Lisa Babette

    -specific design are proposed for all actors involved in harbour transformation. The study ends with an invitation to further investigate translation as a powerful metaphor for the way existing qualities of a site can be transformed, rather than erased or rewritten, and to explore how this metaphor can foster new...

  14. White striping and woody breast myopathies in the modern poultry industry: a review.

    Kuttappan, V A; Hargis, B M; Owens, C M


    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  15. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves


    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  16. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)


    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  17. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  18. Word translation entropy in translation

    Schaeffer, Moritz; Dragsted, Barbara; Hvelplund, Kristian Tangsgaard


    This study reports on an investigation into the relationship between the number of translation alternatives for a single word and eye movements on the source text. In addition, the effect of word order differences between source and target text on eye movements on the source text is studied....... In particular, the current study investigates the effect of these variables on early and late eye movement measures. Early eye movement measures are indicative of processes that are more automatic while late measures are more indicative of conscious processing. Most studies that found evidence of target...... language activation during source text reading in translation, i.e. co-activation of the two linguistic systems, employed late eye movement measures or reaction times. The current study therefore aims to investigate if and to what extent earlier eye movement measures in reading for translation show...

  19. Translational genomics

    Martin Kussmann


    Full Text Available The term “Translational Genomics” reflects both title and mission of this new journal. “Translational” has traditionally been understood as “applied research” or “development”, different from or even opposed to “basic research”. Recent scientific and societal developments have triggered a re-assessment of the connotation that “translational” and “basic” are either/or activities: translational research nowadays aims at feeding the best science into applications and solutions for human society. We therefore argue here basic science to be challenged and leveraged for its relevance to human health and societal benefits. This more recent approach and attitude are catalyzed by four trends or developments: evidence-based solutions; large-scale, high dimensional data; consumer/patient empowerment; and systems-level understanding.

  20. Beyond Translation

    Olwig, Mette Fog


    This article contributes to the growing scholarship on local development practitioners by re-examining conceptualizations of practitioners as ‘brokers’ strategically translating between ‘travelling’ (development institution) rationalities and ‘placed’ (recipient area) rationalities in relation...... and practice spurred by new challenges deriving from climate change anxiety, the study shows how local practitioners often make local activities fit into travelling development rationalities as a matter of habit, rather than as a conscious strategy. They may therefore cease to ‘translate’ between different...... rationalities. This is shown to have important implications for theory, research and practice concerning disaster risk reduction and climate change adaptation in which such translation is often expected....

  1. Revising Translations

    Rasmussen, Kirsten Wølch; Schjoldager, Anne


    The paper explains the theoretical background and findings of an empirical study of revision policies, using Denmark as a case in point. After an overview of important definitions, types and parameters, the paper explains the methods and data gathered from a questionnaire survey and an interview...... survey. Results clearly show that most translation companies regard both unilingual and comparative revisions as essential components of professional quality assurance. Data indicate that revision is rarely fully comparative, as the preferred procedure seems to be a unilingual revision followed by a more...... or less comparative rereading. Though questionnaire data seem to indicate that translation companies use linguistic correctness and presentation as the only revision parameters, interview data reveal that textual and communicative aspects are also considered. Generally speaking, revision is not carried...

  2. c-Kit-positive cardiac stem cells nested in hypoxic niches are activated by stem cell factor reversing the aging myopathy.

    Sanada, Fumihiro; Kim, Junghyun; Czarna, Anna; Chan, Noel Yan-Ki; Signore, Sergio; Ogórek, Barbara; Isobe, Kazuya; Wybieralska, Ewa; Borghetti, Giulia; Pesapane, Ada; Sorrentino, Andrea; Mangano, Emily; Cappetta, Donato; Mangiaracina, Chiara; Ricciardi, Mario; Cimini, Maria; Ifedigbo, Emeka; Perrella, Mark A; Goichberg, Polina; Choi, Augustine M; Kajstura, Jan; Hosoda, Toru; Rota, Marcello; Anversa, Piero; Leri, Annarosa


    Hypoxia favors stem cell quiescence, whereas normoxia is required for stem cell activation, but whether cardiac stem cell (CSC) function is regulated by the hypoxic/normoxic state of the cell is currently unknown. A balance between hypoxic and normoxic CSCs may be present in the young heart, although this homeostatic control may be disrupted with aging. Defects in tissue oxygenation occur in the old myocardium, and this phenomenon may expand the pool of hypoxic CSCs, which are no longer involved in myocyte renewal. Here, we show that the senescent heart is characterized by an increased number of quiescent CSCs with intact telomeres that cannot re-enter the cell cycle and form a differentiated progeny. Conversely, myocyte replacement is controlled only by frequently dividing CSCs with shortened telomeres; these CSCs generate a myocyte population that is chronologically young but phenotypically old. Telomere dysfunction dictates their actual age and mechanical behavior. However, the residual subset of quiescent young CSCs can be stimulated in situ by stem cell factor reversing the aging myopathy. Our findings support the notion that strategies targeting CSC activation and growth interfere with the manifestations of myocardial aging in an animal model. Although caution has to be exercised in the translation of animal studies to human beings, our data strongly suggest that a pool of functionally competent CSCs persists in the senescent heart and that this stem cell compartment can promote myocyte regeneration effectively, partly correcting the aging myopathy.

  3. Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

    O. A. Antelava


    Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

  4. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

    Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L


    To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

  5. Muscle sonography in six patients with hereditary inclusion body myopathy

    Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence


    To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

  6. Myopathy in CRPS-I: disuse or neurogenic?

    Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A


    The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.


    Mallika O. U


    Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

  8. [Statin associated myopathy in clinical practice. Results of DAMA study].

    Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

    Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina


    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  10. Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

    Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.


    Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

  11. Translating democracy

    Doerr, Nicole


    Linguistic barriers may pose problems for politicians trying to communicate delicate decisions to a European-wide public, as well as for citizens wishing to protest at the European level. In this article I present a counter-intuitive position on the language question, one that explores how...... Forum (ESF). I compare deliberative practices in the multilingual ESF preparatory meetings with those in monolingual national Social Forum meetings in three Western European countries. My comparison shows that multilingualism does not reduce the inclusivity of democratic deliberation as compared...... in institutionalized habits and norms of deliberation. Addressing democratic theorists, my findings suggest that translation could be a way to think about difference not as a hindrance but as a resource for democracy in linguistically heterogeneous societies and public spaces, without presupposing a shared language...

  12. Translator's preface.

    Lamiell, James T


    Presents a preface from James T. Lamiell, who translates Wilhelm Wundt's Psychology's Struggle for Existence (Die Psychologie im Kampf ums Dasein), in which Wundt advised against the impending divorce of psychology from philosophy, into English. Lamiell comments that more than a decade into the 21st century, it appears that very few psychologists have any interest at all in work at the interface of psychology and philosophy. He notes that one clear indication of this is that the Society for Theoretical and Philosophical Psychology, which is Division 24 of the American Psychological Association (APA), remains one of the smallest of the APA's nearly 60 divisions. (PsycINFO Database Record (c) 2013 APA, all rights reserved).

  13. Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

    Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A


    The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

  14. Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

    Subasree Ramakrishnan


    Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

  15. Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

    Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro


    Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

  16. A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

    Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio


    Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

  17. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu


    Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

  18. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert


    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  19. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu


    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

  20. Mapping Translation Technology Research in Translation Studies

    Schjoldager, Anne; Christensen, Tina Paulsen; Flanagan, Marian


    section aims to improve this situation by presenting new and innovative research papers that reflect on recent technological advances and their impact on the translation profession and translators from a diversity of perspectives and using a variety of methods. In Section 2, we present translation......Due to the growing uptake of translation technology in the language industry and its documented impact on the translation profession, translation students and scholars need in-depth and empirically founded knowledge of the nature and influences of translation technology (e.g. Christensen....../Schjoldager 2010, 2011; Christensen 2011). Unfortunately, the increasing professional use of translation technology has not been mirrored within translation studies (TS) by a similar increase in research projects on translation technology (Munday 2009: 15; O’Hagan 2013; Doherty 2016: 952). The current thematic...

  1. Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

    Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J


    It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

  2. Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

    Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z


    Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

  3. A study of acute muscle dysfunction with particular reference to dengue myopathy

    Rajesh Verma


    Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3

  4. Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

    Witting, Nanna; Krag, Thomas; Werlauff, Ulla


    INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

  5. Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

    Witting, Nanna; Werlauff, Ulla; Duno, Morten


    .3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

  6. Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

    Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg


    The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

  7. Autophagy, inflammation and innate immunity in inflammatory myopathies.

    Cristina Cappelletti

    Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

  8. Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

    Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew


    Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

  9. The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

    de Visser, M.; de Voogt, W. G.; la Rivière, G. V.


    We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

  10. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    van Galen Verwilghen, Gaby; Votion, D.-M.


    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

  11. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

    Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.


    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

  12. [External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

    Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R


    Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

  13. Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

    Vite, C H; Melniczek, J; Patterson, D; Giger, U


    Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

  14. Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

    Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J


    Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

  15. Atypical myopathy in Denmark confirmed with the aTRAQ assay

    Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie


    Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

  16. Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

    Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.


    Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

  17. Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

    Schaars, C.F.; Stalenhoef, A.F.H.


    PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

  18. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta


    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  19. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)


    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  20. RYR1-related myopathies: a wide spectrum of phenotypes throughout life

    Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.


    BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

  1. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    van Galen Verwilghen, Gaby; Votion, D.-M.


    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

  2. Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

    Lei Tian


    Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

  3. Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

    Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans


    The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

  4. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita


    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

    Werlauff, Ulla; Højberg, A; Firla-Holme, R


    PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

  6. Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

    Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

    Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

  7. Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

    Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))


    The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

  8. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

    Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.


    HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

  9. Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

    Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.


    As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate

  10. Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

    Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony


    Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

  11. Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

    Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J


    Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

  12. Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

    Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo


    Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

  13. Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

    El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S


    Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Mapping Translation Technology Research in Translation Studies

    Schjoldager, Anne; Christensen, Tina Paulsen; Flanagan, Marian


    /Schjoldager 2010, 2011; Christensen 2011). Unfortunately, the increasing professional use of translation technology has not been mirrored within translation studies (TS) by a similar increase in research projects on translation technology (Munday 2009: 15; O’Hagan 2013; Doherty 2016: 952). The current thematic...... section aims to improve this situation by presenting new and innovative research papers that reflect on recent technological advances and their impact on the translation profession and translators from a diversity of perspectives and using a variety of methods. In Section 2, we present translation...... technology research as a subdiscipline of TS, and we define and discuss some basic concepts and models of the field that we use in the rest of the paper. Based on a small-scale study of papers published in TS journals between 2006 and 2016, Section 3 attempts to map relevant developments of translation...

  15. Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

    Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.


    Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

  16. Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

    Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe


    Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

  17. Holography without translational symmetry

    Vegh, David


    We propose massive gravity as a holographic framework for describing a class of strongly interacting quantum field theories with broken translational symmetry. Bulk gravitons are assumed to have a Lorentz-breaking mass term as a substitute for spatial inhomogeneities. This breaks momentum-conservation in the boundary field theory. At finite chemical potential, the gravity duals are charged black holes in asymptotically anti-de Sitter spacetime. The conductivity in these systems generally exhibits a Drude peak that approaches a delta function in the massless gravity limit. Furthermore, the optical conductivity shows an emergent scaling law: $|\\sigma(\\omega)| \\approx {A \\over \\omega^{\\alpha}} + B$. This result is consistent with that found earlier by Horowitz, Santos, and Tong who introduced an explicit inhomogeneous lattice into the system.

  18. On Various Negative Translations

    Gilda Ferreira


    Full Text Available Several proof translations of classical mathematics into intuitionistic mathematics have been proposed in the literature over the past century. These are normally referred to as negative translations or double-negation translations. Among those, the most commonly cited are translations due to Kolmogorov, Godel, Gentzen, Kuroda and Krivine (in chronological order. In this paper we propose a framework for explaining how these different translations are related to each other. More precisely, we define a notion of a (modular simplification starting from Kolmogorov translation, which leads to a partial order between different negative translations. In this derived ordering, Kuroda and Krivine are minimal elements. Two new minimal translations are introduced, with Godel and Gentzen translations sitting in between Kolmogorov and one of these new translations.

  19. Gender issues in translation



    The following research is done regarding gender in translation dealing specifically with the issue of the translators’ gender identity and its effect on their translations, as well as on how gender itself is translated and produced. We will try to clarify what gender is, how gender manifests itself in the system of language, and what problems translators encounter when translating or producing gender-related materials

  20. Cultural Context and Translation



    cultural context plays an important role in translation. Because translation is a cross-culture activity, the culture context that influ-ences translating is consisted of both the culture contexts of source language and target language. This article firstly analyzes the concept of context and cultural context, then according to the procedure of translating classifies cultural context into two stages and talks about how they respectively influence translating.

  1. Enzyme replacement therapy rescues weakness and improves muscle pathology in mice with X-linked myotubular myopathy.

    Lawlor, Michael W; Armstrong, Dustin; Viola, Marissa G; Widrick, Jeffrey J; Meng, Hui; Grange, Robert W; Childers, Martin K; Hsu, Cynthia P; O'Callaghan, Michael; Pierson, Christopher R; Buj-Bello, Anna; Beggs, Alan H


    No effective treatment exists for patients with X-linked myotubular myopathy (XLMTM), a fatal congenital muscle disease caused by deficiency of the lipid phosphatase, myotubularin. The Mtm1δ4 and Mtm1 p.R69C mice model severely and moderately symptomatic XLMTM, respectively, due to differences in the degree of myotubularin deficiency. Contractile function of intact extensor digitorum longus (EDL) and soleus muscles from Mtm1δ4 mice, which produce no myotubularin, is markedly impaired. Contractile forces generated by chemically skinned single fiber preparations from Mtm1δ4 muscle were largely preserved, indicating that weakness was largely due to impaired excitation contraction coupling. Mtm1 p.R69C mice, which produce small amounts of myotubularin, showed impaired contractile function only in EDL muscles. Short-term replacement of myotubularin with a prototypical targeted protein replacement agent (3E10Fv-MTM1) in Mtm1δ4 mice improved contractile function and muscle pathology. These promising findings suggest that even low levels of myotubularin protein replacement can improve the muscle weakness and reverse the pathology that characterizes XLMTM.

  2. Translation-coupling systems

    Pfleger, Brian; Mendez-Perez, Daniel


    Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

  3. Writing Through: Practising Translation

    Joel Scott


    Full Text Available This essay exists as a segment in a line of study and writing practice that moves between a critical theory analysis of translation studies conceptions of language, and the practical questions of what those ideas might mean for contemporary translation and writing practice. Although the underlying preoccupation of this essay, and my more general line of inquiry, is translation studies and practice, in many ways translation is merely a way into a discussion on language. For this essay, translation is the threshold of language. But the two trails of the discussion never manage to elude each other, and these concatenations have informed two experimental translation methods, referred to here as Live Translations and Series Translations. Following the essay are a number of poems in translation, all of which come from Blanco Nuclear by the contemporary Spanish poet, Esteban Pujals Gesalí. The first group, the Live Translations consist of transcriptions I made from audio recordings read in a public setting, in which the texts were translated in situ, either off the page of original Spanish-language poems, or through a process very much like that carried out by simultaneous translators, for which readings of the poems were played back to me through headphones at varying speeds to be translated before the audience. The translations collected are imperfect renderings, attesting to a moment in language practice rather than language objects. The second method involves an iterative translation process, by which three versions of any one poem are rendered, with varying levels of fluency, fidelity and servility. All three translations are presented one after the other as a series, with no version asserting itself as the primary translation. These examples, as well as the translation methods themselves, are intended as preliminary experiments within an endlessly divergent continuum of potential methods and translations, and not as a complete representation of

  4. Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

    Teet Seene


    Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

  5. Free radicals in alcoholic myopathy: indices of damage and preventive studies.

    Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon


    Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

  6. Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.

    Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I


    We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello


    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  8. Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu


    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

  9. Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

    Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt


    inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

  10. Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

    Hina N. Khan


    Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

  11. Toxic myopathy in a dog associated with the presence of monensin in dry food.

    Wilson, J S


    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  12. Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

    Wilson, J. S.


    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  13. Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

    Saleh Saleh Elessawy


    Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

  14. Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

    Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey


    Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

  15. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H


    Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

  16. Mutation-specific effects on thin filament length in thin filament myopathy.

    Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C


    Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

  17. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  18. Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

    Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.


    Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

  19. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu


    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

  20. Why Translation Is Difficult

    Carl, Michael; Schaeffer, Moritz Jonas


    The paper develops a definition of translation literality that is based on the syntactic and semantic similarity of the source and the target texts. We provide theoretical and empirical evidence that absolute literal translations are easy to produce. Based on a multilingual corpus of alternative...... translations we investigate the effects of cross-lingual syntactic and semantic distance on translation production times and find that non-literality makes from-scratch translation and post-editing difficult. We show that statistical machine translation systems encounter even more difficulties with non-literality....

  1. Radiological features of Paget disease of bone associated with VCP myopathy

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)


    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  2. Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

    Rue, Nana; Vissing, John; Galbo, Henrik


    Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

  3. Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

    Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils


    Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

  4. The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

    Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago


    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  5. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra


    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  6. Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

    Brianne E. Phillips


    Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

  7. Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

    Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.


    Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

  8. Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

    Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo


    We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

  9. [Value of MRI in the treatment of Grave's disease orbital myopathy].

    Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H


    In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

  10. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.


    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  11. Determinants of translation ambiguity

    Degani, Tamar; Prior, Anat; Eddington, Chelsea M.; Arêas da Luz Fontes, Ana B.; Tokowicz, Natasha


    Ambiguity in translation is highly prevalent, and has consequences for second-language learning and for bilingual lexical processing. To better understand this phenomenon, the current study compared the determinants of translation ambiguity across four sets of translation norms from English to Spanish, Dutch, German and Hebrew. The number of translations an English word received was correlated across these different languages, and was also correlated with the number of senses the word has in English, demonstrating that translation ambiguity is partially determined by within-language semantic ambiguity. For semantically-ambiguous English words, the probability of the different translations in Spanish and Hebrew was predicted by the meaning-dominance structure in English, beyond the influence of other lexical and semantic factors, for bilinguals translating from their L1, and translating from their L2. These findings are consistent with models postulating direct access to meaning from L2 words for moderately-proficient bilinguals. PMID:27882188

  12. Translation in ESL Classes

    Nagy Imola Katalin


    Full Text Available The problem of translation in foreign language classes cannot be dealt with unless we attempt to make an overview of what translation meant for language teaching in different periods of language pedagogy. From the translation-oriented grammar-translation method through the complete ban on translation and mother tongue during the times of the audio-lingual approaches, we have come today to reconsider the role and status of translation in ESL classes. This article attempts to advocate for translation as a useful ESL class activity, which can completely fulfil the requirements of communicativeness. We also attempt to identify some activities and games, which rely on translation in some books published in the 1990s and the 2000s.

  13. Translation and Quality Management

    Petersen, Margrethe


    theory which would seem likely to be of interest in this connection and section 2. gives a linguist's introduction to the part of the area of quality management which I consider relevant for present purposes. Section 3. is devoted to the case study of a small translation firm which has been certified......The aim of this article is to consider the issue of quality in translation. Specifically, the question under consideration is whether quality assurance in relation to translation is feasible and, if so, what some of the implications for translation theory, translation practice and the teaching...... of translation would be. To provide a backdrop against which the issue may be discussed, I present an overview of the two areas which seem most likely to hold potential answers, viz., that of translation theory and that of quality management. Section 1. gives a brief outline of some contributions to translation...

  14. Memetics and Translation Studies

    Andrew, Chesterman


    Translation Studies is a branch of memetics. This is a claim, a hypothesis. More specifically, it is an interpretive hypothesis: I claim that Translation Studies can be thus interpreted, and that this is a useful thing to do because it offers a new and beneficial way of understanding translation.

  15. Sound Effects in Translation

    Mees, Inger M.; Dragsted, Barbara; Gorm Hansen, Inge


    ), Translog was employed to measure task times. The quality of the products was assessed by three experienced translators, and the number and types of misrecognitions were identified by a phonetician. Results indicate that SR translation provides a potentially useful supplement to written translation...

  16. The Temple Translator's Workstation Project

    Vanni, Michelle; Zajac, Remi


    .... The Temple Translator's Workstation is incorporated into a Tipster document management architecture and it allows both translator/analysts and monolingual analysts to use the machine- translation...

  17. Sound Effects in Translation

    Mees, Inger M.; Dragsted, Barbara; Gorm Hansen, Inge


    On the basis of a pilot study using speech recognition (SR) software, this paper attempts to illustrate the benefits of adopting an interdisciplinary approach in translator training. It shows how the collaboration between phoneticians, translators and interpreters can (1) advance research, (2) have......), Translog was employed to measure task times. The quality of the products was assessed by three experienced translators, and the number and types of misrecognitions were identified by a phonetician. Results indicate that SR translation provides a potentially useful supplement to written translation...

  18. Lost in translation

    Hedegaard, Steffen; Simonsen, Jakob Grue


    of translated texts. Our results suggest (i) that frame-based classifiers are usable for author attribution of both translated and untranslated texts; (ii) that framebased classifiers generally perform worse than the baseline classifiers for untranslated texts, but (iii) perform as well as, or superior...... to the baseline classifiers on translated texts; (iv) that—contrary to current belief—naïve classifiers based on lexical markers may perform tolerably on translated texts if the combination of author and translator is present in the training set of a classifier....

  19. Speaking your Translation

    Dragsted, Barbara; Mees, Inger M.; Gorm Hansen, Inge


    In this article we discuss the translation processes and products of 14 MA students who produced translations from Danish (L1) into English (L2) under different working conditions: (1) written translation, (2) sight translation, and (3) sight translation with a speech recognition (SR) tool. Audio......, since students were dictating in their L2, we looked into the number and types of error that occurred when using the SR software. Items that were misrecognised by the program could be divided into three categories: homophones, hesitations, and incorrectly pronounced words. Well over fifty per cent...

  20. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)


    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  1. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))


    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  2. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.


    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

  3. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

    Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F


    Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

  4. Lost in translation?

    Granas, Anne Gerd; Nørgaard, Lotte Stig; Sporrong, Sofia Kälvemark


    OBJECTIVE: The "Beliefs about Medicines Questionnaire" (BMQ) assess balance of necessity and concern of medicines. The BMQ has been translated from English to many languages. However, the original meaning of statements, such as "My medicine is a mystery to me", may be lost in translation. The aim...... of this study is to compare three Scandinavian translations of the BMQ. (1) How reliable are the translations? (2) Are they still valid after translation? METHODS: Translated Norwegian, Swedish and Danish versions of the BMQ were scrutinized by three native Scandinavian researchers. Linguistic differences...... and ambiguities in the 5-point Likert scale and the BMQ statements were compared. RESULTS: In the Scandinavian translations, the Likert scale expanded beyond the original version at one endpoint (Swedish) or both endpoints (Danish). In the BMQ statements, discrepancies ranged from smaller inaccuracies toward...

  5. What is a translator?

    Martha Pulido


    Full Text Available I copied the title from Foucault’s text, "Qu'est-ce qu'un auteur" in Dits et écrits [1969], Paris, Gallimard, 1994, that I read in French, then in English in Donald F. Bouchard’s and Sherry Simon’s translation, and finally in Spanish in Yturbe Corina’s translation, and applied for the translator some of the analysis that Foucault presents to define the author. Foucault suggests that if we cannot define an author, at least we can see where their function is reflected. My purpose in this paper is to present those surfaces where the function of the translator is reflected or where it can be revealed, and to analyse the categories that could lead us to the elaboration of a suitable definition of a Translator. I dare already give a compound noun for the translator: Translator-Function.

  6. What is a translator?

    Martha Martha Pulido


    Full Text Available I copied the title from Foucault’s text, "Qu'est-ce qu'un auteur" in Dits et écrits [1969], Paris, Gallimard, 1994, that I read in French, then in English in Donald F. Bouchard’s and Sherry Simon’s translation, and finally in Spanish in Yturbe Corina’s translation, and applied for the translator some of the analysis that Foucault presents to define the author. Foucault suggests that if we cannot define an author, at least we can see where their function is reflected. My purpose in this paper is to present those surfaces where the function of the translator is reflected or where it can be revealed, and to analyse the categories that could lead us to the elaboration of a suitable definition of a Translator. I dare already give a compound noun for the translator: Translator-Function.

  7. Alternative splicing of exon 17 and a missense mutation in exon 20 of the insulin receptor gene in two brothers with a novel syndrome of insulin resistance (congenital fiber-type disproportion myopathy)

    Vorwerk, P; Christoffersen, C T; Müller, J


    to be compound heterozygotes for mutations in the IR gene. The maternal allele was alternatively spliced in exon 17 due to a point mutation in the -1 donor splice site of the exon. The abnormal skipping of exon 17 shifts the amino acid reading frame and leads to a truncated IR, missing the entire tyrosine kinase......The insulin receptor (IR) in two brothers with a rare syndrome of congenital muscle fiber type disproportion myopathy (CFTDM) associated with diabetes and severe insulin resistance was studied. By direct sequencing of Epstein-Barr virus-transformed lymphocytes both patients were found...... domain. In the correct spliced variant, the point mutation is silent and results in a normally translated IR. The paternal allele carries a missense mutation in the tyrosine kinase domain. All three cDNA variants were present in the lymphocytes of the patients. Purified IR from 293 cells overexpressing...

  8. Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

    Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi


    HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Discourse Analysis in Translator Training

    Gülfidan Ayvaz


    Translator training enables students to gain experience in both linguistic parameters and translation practice. Discourse Analysis is one of the strategies that lead to a better translation process and quality in translation. In that regard, this study aims to present DA as a translation strategy for translation practice and a useful tool for translator training. The relationship between DA and Translator Training is not widely studied. Therefore this study aims to define DA and how it can be...

  10. Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

    Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R


    The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

  11. Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

    Massimo Vecchiato


    Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

  12. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

    Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H


    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

  13. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Brown, Bradley D; Rais, Theodore


    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  14. Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

    Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T


    Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

  15. BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

    Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta


    BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

  16. Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

    Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R


    Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

  17. Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

    Rosana Herminia Scola


    Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

  18. Struggling with Translations

    Obed Madsen, Søren

    This paper shows empirical how actors have difficulties with translating strategy texts. The paper uses four cases as different examples of what happens, and what might be difficult, when actors translate organizational texts. In order to explore this, it draws on a translation training method from...... translation theory. The study shows that for those who have produced the text, it is difficult to translate a strategy where they have to change the words so others who don’t understand the language in the text can understand it. It also shows that for those who haven’t been a part of the production, it very...... challenge the notion that actors understand all texts and that managers per se can translate a text....

  19. A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

    Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun


    Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

  20. Translational ecology for hydrogeology.

    Schlesinger, William H


    Translational ecology--a special discipline aimed to improve the accessibility of science to policy makers--will help hydrogeologists contribute to the solution of pressing environmental problems. Patterned after translational medicine, translational ecology is a partnership to ensure that the right science gets done in a timely fashion, so that it can be communicated to those who need it. © 2013, National Ground Water Association.

  1. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H


    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  2. Serum and tissue markers of myopathy in patients with colorectal cancer

    Nicoletta Adami


    Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

  3. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Rosana Hermínia Scola


    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  4. Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

    Vestergaard, H; Klein, H H; Hansen, T


    Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

  5. Myosin Binding Protein-C Slow Phosphorylation is Altered in Duchenne Dystrophy and Arthrogryposis Myopathy in Fast-Twitch Skeletal Muscles.

    Ackermann, Maegen A; Ward, Christopher W; Gurnett, Christina; Kontrogianni-Konstantopoulos, Aikaterini


    Myosin Binding Protein-C slow (sMyBP-C), encoded by MYBPC1, comprises a family of regulatory proteins of skeletal muscles that are phosphorylated by PKA and PKC. MYBPC1 missense mutations are linked to the development of Distal Arthrogryposis-1 (DA-1). Although structure-function details for this myopathy are evolving, function is undoubtedly driven by sequence variations and post-translational modifications in sMyBP-C. Herein, we examined the phosphorylation profile of sMyBP-C in mouse and human fast-twitch skeletal muscles. We used Flexor Digitorum Brevis (FDB) isolated from young (~2-months old) and old (~14-months old) wild type and mdx mice, and human Abductor Hallucis (AH) and gastrocnemious muscles carrying the DA-1 mutations. Our results indicate both constitutive and differential phosphorylation of sMyBP-C in aged and diseased muscles. We report a 7-35% reduction in the phosphorylation levels of select sites in old wild type and young or old mdx FDB mouse muscles, compared to young wild type tissue. Similarly, we observe a 30-70% decrease in the phosphorylation levels of all PKA and PKC phospho-sites in the DA-1 AH, but not gastrocnemius, muscle. Overall, our studies show that the phosphorylation pattern of sMyBP-C is differentially regulated in response to age and disease, suggesting that phosphorylation plays important roles in these processes.

  6. Translation and Intertextuality

    Mohammad Rahimi


    Full Text Available This study is intends to describe and Presents a new theory of translation based on the "Intertextuality" unlike the Translation theories that presented to date, what all are based on the principle of "Equivalence". Our theory is based on the examples of Arabic poetry translated into Persian poetry. The major findings of this study show that the Intertextuality can serve as a link between the original text and the target. it can also interact with other texts is the translation result in the target language, Whtich is the book of poetic eloquence is addressed and was mentioned Literary robbery.

  7. Lost in Translation?

    Jonkers, Peter


    Translating sacred scriptures is not only a praxis that is crucial for the fruitful, i.e. non-distorted and unbiased dialogue between different religious traditions, but also raises some fundamental theoretical questions when it comes to translating the sacred texts of the religious other or

  8. Translating VDM to Alloy

    Lausdahl, Kenneth


    specifications. However, to take advantage of the automated analysis of Alloy, the model-oriented VDM specifications must be translated into a constraint-based Alloy specifications. We describe how a sub- set of VDM can be translated into Alloy and how assertions can be expressed in VDM and checked by the Alloy...

  9. Students' Differentiated Translation Processes

    Bossé, Michael J.; Adu-Gyamfi, Kwaku; Chandler, Kayla


    Understanding how students translate between mathematical representations is of both practical and theoretical importance. This study examined students' processes in their generation of symbolic and graphic representations of given polynomial functions. The purpose was to investigate how students perform these translations. The result of the study…

  10. Creativity, Culture and Translation

    Babaee, Siamak; Wan Yahya, Wan Roselezam; Babaee, Ruzbeh


    Some scholars (Bassnett-McGuire, Catford, Brislin) suggest that a good piece of translation should be a strict reflection of the style of the original text while some others (Gui, Newmark, Wilss) consider the original text untranslatable unless it is reproduced. Opposing views by different critics suggest that translation is still a challenging…

  11. Translation as (Global) Writing

    Horner, Bruce; Tetreault, Laura


    This article explores translation as a useful point of departure and framework for taking a translingual approach to writing engaging globalization. Globalization and the knowledge economy are putting renewed emphasis on translation as a key site of contest between a dominant language ideology of monolingualism aligned with fast capitalist…

  12. Measuring Translation Literality

    Carl, Michael; Schaeffer, Moritz


    Tirkkonen-Condit (2005: 407–408) argues that “It looks as if literal translation is [the result of] a default rendering procedure”. As a corollary, more literal translations should be easier to process, and less literal ones should be associated with more cognitive effort. In order to assess this...

  13. Text Coherence in Translation

    Zheng, Yanping


    In the thesis a coherent text is defined as a continuity of senses of the outcome of combining concepts and relations into a network composed of knowledge space centered around main topics. And the author maintains that in order to obtain the coherence of a target language text from a source text during the process of translation, a translator can…


    language. The Application of Technical Service. Prose. To form a good idea of the appl ication .... cost lives. In this particular domain, translators must have a sound technical ... These semantic ... another language and often, in doing so, changing its meaning. The words ..... He will hand out tasks to each translator and after.

  15. Stimulating translational research

    Bentires-Alj, Mohamed; Rajan, Abinaya; van Harten, Wim


    Translational research leaves no-one indifferent and everyone expects a particular benefit. We as EU-LIFE (, an alliance of 13 research institutes in European life sciences, would like to share our experience in an attempt to identify measures to promote translational research with...... without undermining basic exploratory research and academic freedom....

  16. Translation, Quality and Growth

    Petersen, Margrethe

    The paper investigates the feasibility and some of the possible consequences of applying quality management to translation. It first gives an introduction to two different schools of translation and to (total) quality management. It then examines whether quality management may, in theory...

  17. Translation, Interpreting and Lexicography

    Dam, Helle Vrønning; Tarp, Sven


    in the sense that their practice fields are typically ‘about something else’. Translators may, for example, be called upon to translate medical texts, and interpreters may be assigned to work on medical speeches. Similarly, practical lexicography may produce medical dictionaries. In this perspective, the three...

  18. Translation between cultures

    Henrique de Oliveira Lee


    Full Text Available This article will question the pertinence of understanding interculturality in terms of translation between cultures. I shall study this hypothesis in two ways : 1 / the cosmopolitan horizon, which the idea of translation may implicate ; 2 / the critique of the premises of unique origin and homogeneity of cultures which this hypothesis makes possible.

  19. Idioms and Back Translation

    Griffin, Frank


    The challenges of intercultural communication are an integral part of many undergraduate business communication courses. Marketing gaffes clearly illustrate the pitfalls of translation and underscore the importance of a knowledge of the culture with which one is attempting to communicate. A good way to approach the topic of translation pitfalls in…

  20. The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

    Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R


    The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

  1. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Vincent Lepori


    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  2. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu


    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

    Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E


    Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

  4. Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

    Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore


    Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.


    O. M. Drapkina


    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  6. Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

    Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J


    Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion


    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  8. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Muhammad I. Ullah


    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  9. Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

    Antonia eKaltsatou


    Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

  10. Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

    Nowak M


    Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

  11. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M


    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.


    O. M. Drapkina


    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  13. Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

    Pari Basharat


    Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

  14. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Benech Philippe


    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  15. Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

    Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo


    Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

  16. Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

    Santa, Kristin M


    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

  17. Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

    Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo


    In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Translation Ambiguity but Not Word Class Predicts Translation Performance

    Prior, Anat; Kroll, Judith F.; Macwhinney, Brian


    We investigated the influence of word class and translation ambiguity on cross-linguistic representation and processing. Bilingual speakers of English and Spanish performed translation production and translation recognition tasks on nouns and verbs in both languages. Words either had a single translation or more than one translation. Translation…

  19. Examining English-German Translation Ambiguity Using Primed Translation Recognition

    Eddington, Chelsea M.; Tokowicz, Natasha


    Many words have more than one translation across languages. Such "translation-ambiguous" words are translated more slowly and less accurately than their unambiguous counterparts. We examine the extent to which word context and translation dominance influence the processing of translation-ambiguous words. We further examine how these factors…

  20. Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

    Zvaritch, Elena; MacLennan, David H.


    Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

  1. EULAR/ACR classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups: a methodology report

    Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.


    To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for

  2. Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

    Klein, H H; Müller, R; Vestergaard, H


    We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

  3. Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury

    Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H


    , DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...

  4. Characterization of sarcoplasmic reticulum Ca(2+) ATPase pumps in muscle of patients with myotonic dystrophy and with hypothyroid myopathy.

    Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G


    Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Loss-of-function mutations in SCN4A> cause severe foetal hypokinesia or 'classical' congenital myopathy

    Zaharieva, Irina T; Thor, Michael G; Oates, Emily C


    Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...

  6. Lactate disposal via gluconeogenesis is increased during exercise in patients with mitochondrial myopathy due to complex I deficiency

    Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud

    This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at

  7. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and histological characterization in a patient.

    König, P; Ambrose, N S; Scott, N


    Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.

  8. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.

    BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure

  9. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.


    Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To

  10. Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

    Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T


    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

  11. Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients : Effects of stress conditions

    Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E


    We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the

  12. Dietary nitrate does not reduce oxygen cost of exercise or improve muscle mitochondrial function in patients with mitochondrial myopathy

    Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.


    Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We

  13. Theory of Test Translation Error

    Solano-Flores, Guillermo; Backhoff, Eduardo; Contreras-Nino, Luis Angel


    In this article, we present a theory of test translation whose intent is to provide the conceptual foundation for effective, systematic work in the process of test translation and test translation review. According to the theory, translation error is multidimensional; it is not simply the consequence of defective translation but an inevitable fact…

  14. Novel duplication mutation in the patatin domain of adipose triglyceride lipase (PNPLA2) in neutral lipid storage disease with severe myopathy.

    Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi


    Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.

  15. Translational Epidemiology in Psychiatry

    Weissman, Myrna M.; Brown, Alan S.; Talati, Ardesheer


    Translational research generally refers to the application of knowledge generated by advances in basic sciences research translated into new approaches for diagnosis, prevention, and treatment of disease. This direction is called bench-to-bedside. Psychiatry has similarly emphasized the basic sciences as the starting point of translational research. This article introduces the term translational epidemiology for psychiatry research as a bidirectional concept in which the knowledge generated from the bedside or the population can also be translated to the benches of laboratory science. Epidemiologic studies are primarily observational but can generate representative samples, novel designs, and hypotheses that can be translated into more tractable experimental approaches in the clinical and basic sciences. This bedside-to-bench concept has not been explicated in psychiatry, although there are an increasing number of examples in the research literature. This article describes selected epidemiologic designs, providing examples and opportunities for translational research from community surveys and prospective, birth cohort, and family-based designs. Rapid developments in informatics, emphases on large sample collection for genetic and biomarker studies, and interest in personalized medicine—which requires information on relative and absolute risk factors—make this topic timely. The approach described has implications for providing fresh metaphors to communicate complex issues in interdisciplinary collaborations and for training in epidemiology and other sciences in psychiatry. PMID:21646577

  16. Translation, Cultural Translation and the Hegemonic English

    Roman Horak


    Full Text Available This brief chapter problematizes the hegemonic position of the English language in Cultural Studies, which, in the author's view, can be understood as a moment that stands against a true internationalisation of the project. Following an argu-ment referring to the necessary 'translation' process (here seen as 're-articulation', 'transcoding' or 'transculturation' Stuart Hall has put forward almost two decades ago, the essay, firstly, turns to the notion of 'linguistic translations', and deals, secondly, with what has been coined 'cultural translation'. Discussing approaches developed by Walter Benjamin, Umberto Eco and Homi Bhabha, the complex relationship between the two terms is being investigated. Finally, in a modest attempt to throw some light on this hegemonic structure, central aspects of the output of three important journals (European Journal of Cultural Studies, International Journal of Cultural Studies, Cultural Studies, i. e. an analysis of the linguistic and institutional backgrounds of the authors of the ten most-read and most-cited essays, are presented. Based on these findings I argue that it is not simply the addition of the discursive field (language to the academic space (institution that defines the mecha-nism of exclusion and inclusion. Rather, it is the articulation of both moments, i.e. that of language and that of the institution, which - in various contexts (but in their own very definite ways - can help to develop that structure which at present is still hindering a further, more profound internationalisation of the project that is Cultural Studies.

  17. Translation of feminine: Szymborska

    Olga Donata Guerizoli Kempinska


    Full Text Available The paper discusses the problems present in the process of the translation of the feminine, related to the discursive articulations of the gender and to the socio-historical conditions of its construction. The differences between languages make this articulation hard to transpose and such is the case in some of Wisława Szymborska’s poems. An attentive reading of her work and of its translations in different languages reveals that the transposition of its specifically feminine humor is also a challenge for the translator

  18. Perceived radial translation during centrifugation

    Bos, J.E.; Correia Grácio, B.J.


    BACKGROUND: Linear acceleration generally gives rise to translation perception. Centripetal acceleration during centrifugation, however, has never been reported giving rise to a radial, inward translation perception. OBJECTIVE: To study whether centrifugation can induce a radial translation

  19. Russian translations for Cochrane.

    Yudina, E V; Ziganshina, L E


    Cochrane collaboration has made a huge contribution to the development of evidence-based medicine; Cochrane work is the international gold standard of independent, credible and reliable high-quality information in medicine. Over the past 20 years the Cochrane Collaboration helped transforming decision-making in health and reforming it significantly, saving lives and contributing to longevity [1]. Until recently, Cochrane evidence were available only in English, which represents a significant barrier to their wider use in non-English speaking countries. To provide access to evidence, obtained from Cochrane Reviews, for health professionals and general public (from non-English-speaking countries), bypassing language barriers, Cochrane collaboration in 2014 initiated an international project of translating Plain language summaries of Cochrane Reviews into other languages [2, 3]. Russian translations of Plain language summaries were started in May 2014 by the team from Kazan Federal University (Department of Basic and Clinical Pharmacology; 2014-2015 as an Affiliated Centre in Tatarstan of the Nordic Cochrane Centre, since August 2015 as Cochrane Russia, a Russian branch of Cochrane Nordic, Head - Liliya Eugenevna Ziganshina) on a voluntary basis. To assess the quality of Russian translations of Cochrane Plain Language Summaries (PLS) and their potential impact on the Russian speaking community through user feedback with the overarching aim of furthering the translations project. We conducted the continuous online survey via Google Docs. We invited respondents through the electronic Russian language discussion forum on Essential Medicines (E-lek), links to survey on the Russian website, invitations to Cochrane contributors registered in Archie from potential Russian-speaking countries. We set up the survey in Russian and English. The respondents were asked to respond to the questionnaire regarding the relevance and potential impact of the Cochrane Russian

  20. A phased translation function

    Read, R.J.; Schierbeek, A.J.


    A phased translation function, which takes advantage of prior phase information to determine the position of an oriented mulecular replacement model, is examined. The function is the coefficient of correlation between the electron density computed with the prior phases and the electron density of the translated model, evaluated in reciprocal space as a Fourier transform. The correlation coefficient used in this work is closely related to an overlap function devised by Colman, Fehlhammer and Bartels. Tests with two protein structures, one of which was solved with the help of the phased translation function, show that little phase information is required to resolve the translation problem, and that the function is relatively insensitive to misorientation of the model. (orig.)

  1. Translation and Creation

    Paulo Bezerra


    Full Text Available The article begins with the differences betweenscientific and fictional translations, and focus on the second.The fictional translation works with meanings, opens itselfto the plurissignification in the purpose to create a similarity of the dissimilarity; in this process, the translator does nottranslate a language, but what a creative individuality makeswith a language. At last there is an approach to the knowledgeand skills necessaries to a translator of literature: theknowledge of the theories of the literature and of thetranslation, the capacity to preserve the national color ofthe original text and at the same time to respect the arrivallanguage, and the sensibility to his national languagevariations present in the daily and in the literary spheres.

  2. Translation of research outcome



    Jan 3, 2017 ... we must act”1 - Translation of research outcome for health policy, strategy and ... others iron-out existing gaps on Health Policy .... within the broader framework of global call and ... research: defining the terrain; identifying.

  3. Staging Ethnographic Translation

    Lundberg, Pia


    Objectifying the cultural diversity of visual fieldmethods - and the analysis of balancing the cultural known and unknown through anthropological analysis (aided by the analytical concept translation (Edwin Ardener 1989))...

  4. Translation for language purposes

    Schjoldager, Anne


    The paper describes the background, subjects, assumptions, procedure, and preliminary results of a small-scale experimental study of L2 translation (Danish into English) and picture verbalization in L2 (English)....

  5. Lost in Translation

    Lass, Wiebke; Reusswig, Fritz


    Lost in Translation? Introducing Planetary Boundaries into Social Systems. Fritz Reusswig, Wiebke Lass Potsdam Institute for Climate Impact Research, Potsdam, Germany Identifying and quantifying planetary boundaries by interdisciplinary science efforts is a challenging task—and a risky one, as the 1972 Limits to Growth publication has shown. Even if we may be assured that scientific understanding of underlying processes of the Earth system has significantly improved since then, the challenge of translating these findings into the social systems of the planet remains crucial for any kind of action, and in many respects far more challenging. We would like to conceptualize what could also be termed a problem of coupling social and natural systems as a nested set of social translation processes, well aware of the limited applicability of the language-related translation metaphor. Societies must, first, perceive these boundaries, and they have to understand their relevance. This includes, among many other things, the organization of transdisciplinary scientific cooperation. They will then have to translate this understood perception into possible actions, i.e. strategies for different local bodies, actors, and institutional settings. This implies a lot of 'internal' translation processes, e.g. from the scientific subsystem to the mass media, the political and the economic subsystem. And it implies to develop subsystem-specific schemes of evaluation for these alternatives, e.g. convincing narratives, cost-benefit analyses, or ethical legitimacy considerations. And, finally, societies do have to translate chosen action alternatives into monitoring and evaluation schemes, e.g. for agricultural production or renewable energies. This process includes the continuation of observing and re-analyzing the planetary boundary concept itself, as a re-adjustment of these boundaries in the light of new scientific insights cannot be excluded. Taken all together, societies may well

  6. Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.

    Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P


    Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The

  7. A Comprehensive Overview on Myositis-Specific Antibodies: New and Old Biomarkers in Idiopathic Inflammatory Myopathy

    Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.


    Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of

  8. Neurogenic myopathies and imaging of muscle denervation; Neurogene Myopathien und Bildgebung der Muskeldenervation

    Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)


    Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen

  9. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong


    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  10. Are Peripheral Blood Mononuclear Cells Derived from Patients with Certain Myopathies Suitable for Personalized Drug Screening?

    Andriy V. Shatillo


    Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC

  11. Lost in translation?

    Zethsen, Karen Korning; Askehave, Inger


    This article deals with an aspect of patient information that differs somewhat from the traditional scope of this journal; namely the linguistic and translational aspects of Patient Information Leaflets (PILs). During the past decade much work has been dedicated to making the English PILs...... as informative and lay-friendly as possible. However, much of the good work is ruined when the PIL is translated. Why is this so and what can be done about it?...

  12. Machine Translation from Text

    Habash, Nizar; Olive, Joseph; Christianson, Caitlin; McCary, John

    Machine translation (MT) from text, the topic of this chapter, is perhaps the heart of the GALE project. Beyond being a well defined application that stands on its own, MT from text is the link between the automatic speech recognition component and the distillation component. The focus of MT in GALE is on translating from Arabic or Chinese to English. The three languages represent a wide range of linguistic diversity and make the GALE MT task rather challenging and exciting.

  13. Jungmann's translation of Paradise Lost

    Janů, Karel


    This thesis examines Josef Jungmann's translation of John Milton's Paradise Lost. Josef Jungmann was one of the leading figures of the Czech National Revival and translated Milton 's poem between the years 1800 and 1804. The thesis covers Jungmann's theoretical model of translation and presents Jungmann's motives for translation of Milton's epic poem. The paper also describes the aims Jungmann had with his translation and whether he has achieved them. The reception Jungmann's translation rece...

  14. Translating Alcohol Research

    Batman, Angela M.; Miles, Michael F.


    Alcohol use disorder (AUD) and its sequelae impose a major burden on the public health of the United States, and adequate long-term control of this disorder has not been achieved. Molecular and behavioral basic science research findings are providing the groundwork for understanding the mechanisms underlying AUD and have identified multiple candidate targets for ongoing clinical trials. However, the translation of basic research or clinical findings into improved therapeutic approaches for AUD must become more efficient. Translational research is a multistage process of streamlining the movement of basic biomedical research findings into clinical research and then to the clinical target populations. This process demands efficient bidirectional communication across basic, applied, and clinical science as well as with clinical practitioners. Ongoing work suggests rapid progress is being made with an evolving translational framework within the alcohol research field. This is helped by multiple interdisciplinary collaborative research structures that have been developed to advance translational work on AUD. Moreover, the integration of systems biology approaches with collaborative clinical studies may yield novel insights for future translational success. Finally, appreciation of genetic variation in pharmacological or behavioral treatment responses and optimal communication from bench to bedside and back may strengthen the success of translational research applications to AUD. PMID:26259085

  15. Validation and clinical significance of the childhood myositis assessment scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies

    Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.

    Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with

  16. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo


    Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  17. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Kazunari Momma

    Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  18. Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy

    Rue, Nana; Vissing, John; Galbo, Henrik


    CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...

  19. Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.

    Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent


    We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.

  20. X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child

    Chia-Ying Chang


    Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.

  1. Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

    Nakamura, R K; Russell, N J; Shelton, G D


    A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

  2. Myopathy Associated with Acute Hypothyroidism following Radioiodine Therapy for Graves Disease in an Adolescent

    Rivkees ScottA


    Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal

  3. Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

    Naddaf, Elie; Waclawik, Andrew J


    Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

  4. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H


    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

  5. When should MELAS (Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes) be the diagnosis?

    Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia


    Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.

  6. Role of Myofibrillar Protein Catabolism in Development of Glucocorticoid Myopathy: Aging and Functional Activity Aspects

    Teet Seene


    Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.

  7. Masseter muscle myofibrillar protein synthesis and degradation in an experimental critical illness myopathy model.

    Hazem Akkad

    Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.

  8. Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

    Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B


    We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

  9. The Effect of Translators' Emotional Intelligence on Their Translation Quality

    Varzande, Mohsen; Jadidi, Esmaeil


    Translators differ from each other in many ways in terms of their knowledge, professional and psychological conditions that may directly influence their translation. The present study aimed at investigating the impact of translators' Emotional Intelligence on their translation quality. Following a "causal-comparative study," a sample of…

  10. The Impact of Translators' Academic Experience on Their Translation Quality

    Varzande, Mohsen; Jadidi, Esmaeil


    Translators differ from each other in many ways in terms of their knowledge and professional conditions that may directly influence their translation. The present study aimed at investigating the impact of translators' academic experience on their translation quality. Following a "causal-comparative study", a sample of 100 male and…

  11. Translating Signs, Producing Subjects

    Brett Neilson


    Full Text Available This paper moves between two streets: Liverpool Road in the Sydney suburb of Ashfield and Via Sarpi in the Italian city of Milan. What connects these streets is that both have become important sites for businesses in the Chinese diaspora. Moreover, both are streets on which locals have expressed desires for Chinese signs to be translated into the national lingua franca. The paper argues that the cultural politics inherent in this demand for translation cannot be fully understood in the context of national debates about diversity and integration. It is also necessary to consider the emergence of the official Chinese Putonghua as global language, which competes with English but also colonizes dialects and minority languages. In the case of these dual language signs, the space between languages can neither be reduced to a contact zone of minority and majority cultures nor celebrated as a ‘third space’ where the power relations implied by such differences are subverted. At stake is rather a space characterised by what Naoki Sakai calls the schema of co-figuration, which allows the representation of translation as the passage between two equivalents that resemble each other and thus makes possible their determination as conceptually different and comparable. Drawing on arguments about translation and citizenship, the paper critically interrogates the ethos of interchangeability implied by this regime of translation. A closing argument is made for a vision of the common that implies neither civilisational harmony nor the translation of all values into a general equivalent. Primary sources include government reports, internet texts and media stories. These are analyzed using techniques of discourse analysis and interpreted with the help of secondary literature concerning globalisation, language and migration. The disciplinary matrix cuts and mixes between cultural studies, translation studies, citizenship studies, globalization studies and

  12. Metabolic Myopathies

    ... OII) Timed Up & Go (TUG) Western Ontario & McMaster Universities Osteoarthritis Index (WOMAC) Young Investigators Resources for Doctoral Students/Post-Doctoral Fellows Evidence-Based Practice for Academic Researchers Responsible Data Management in Research Career Planning Treatments Patient ...

  13. Mitochondrial Myopathy

    ... these disorders and to find ways to effectively treat, prevent, or potentially cure them. Information from the National Library of Medicine’s MedlinePlus ... neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles ...

  14. Inflammatory Myopathies

    ... National Institutes of Health, the leading supporter of biomedical research in the world. The NINDS, along with other ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  15. Mitochondrial Myopathy

    ... Institutes of Health (NIH), the leading supporter of biomedical research in the world. In conjunction with other NIH ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  16. Mitochondrial Myopathies

    ... noting “soft signs” in unaffected relatives. These include deaf- ness, short stature, migraine headaches and PEO. Muscle ... mitochondrial defects and provide valuable information for family planning. Perhaps most important, knowing the genetic defects that ...

  17. Thyrotoxic Myopathy

    ... potassium levels (known as periodic paralysis). View Full Definition Treatment Treatment involves restoring normal levels of thyroid hormone and may include thyroid drugs, radioactive iodine, and sometimes partial or complete surgical ...

  18. Finite translation surfaces with maximal number of translations

    Schlage-Puchta, Jan-Christoph; Weitze-Schmithuesen, Gabriela


    The natural automorphism group of a translation surface is its group of translations. For finite translation surfaces of genus g > 1 the order of this group is naturally bounded in terms of g due to a Riemann-Hurwitz formula argument. In analogy with classical Hurwitz surfaces, we call surfaces which achieve the maximal bound Hurwitz translation surfaces. We study for which g there exist Hurwitz translation surfaces of genus g.

  19. Automatic Evaluation of Machine Translation

    Martinez, Mercedes Garcia; Koglin, Arlene; Mesa-Lao, Bartolomé


    The availability of systems capable of producing fairly accurate translations has increased the popularity of machine translation (MT). The translation industry is steadily incorporating MT in their workflows engaging the human translator to post-edit the raw MT output in order to comply with a s...

  20. Advertisement Translation under Skopos Theory



    This paper is an analysis of advertisement translation under skopos theory.It is explained that the nature of advertisement translation under skopos theory is reconstructing the information of the source text to persuade target audience.Three translation strategies are put forward in translating advertisements.

  1. Translation: Aids, Robots, and Automation.

    Andreyewsky, Alexander


    Examines electronic aids to translation both as ways to automate it and as an approach to solve problems resulting from shortage of qualified translators. Describes the limitations of robotic MT (Machine Translation) systems, viewing MAT (Machine-Aided Translation) as the only practical solution and the best vehicle for further automation. (MES)

  2. Translational research in medicine

    Bakir Mehić


    Full Text Available Translational medicine is a medical practice based on interventional epidemiology. It is regarded by its proponents as a natural progression from Evidence-Based Medicine. It integrates research from the basic sciences, social sciences and political sciences with the aim of optimizing patient care and preventive measures which may extend beyond healthcare services. In short, it is the process of turning appropriate biological discoveries into drugs and medical devices that can be used in the treatment of patients.[1]Scientific research and the development of modern powerful techniques are crucial for improving patient care in a society that is increasingly demanding the highest quality health services.[2] Indeed, effective patient care requires the continuous improvement of knowledge on the pathophysiology of the diseases, diagnostic procedures and therapeutic tools available. To this end, development of both clinical and basic research in health sciences is required. However, what is most effective in improving medical knowledge, and hence patient care, is the cross-fertilization between basic and clinical science. This has been specifically highlighted in recent years with the coining of the term “translational research”.[3] Translational research is of great importance in all medical specialties.Translational Research is the basis for Translational Medicine. It is the process which leads from evidence based medicine to sustainable solutions for public health problems.[4] It aims to improve the health and longevity of the world’s populations and depends on developing broad-based teams of scientists and scholars who are able to focus their efforts to link basic scientific discoveries with the arena of clinical investigation, and translating the results of clinical trials into changes in clinical practice, informed by evidence from the social and political sciences. Clinical science and ecological support from effective policies can

  3. Translational Educational Research

    Issenberg, S. Barry; Cohen, Elaine R.; Barsuk, Jeffrey H.; Wayne, Diane B.


    Medical education research contributes to translational science (TS) when its outcomes not only impact educational settings, but also downstream results, including better patient-care practices and improved patient outcomes. Simulation-based medical education (SBME) has demonstrated its role in achieving such distal results. Effective TS also encompasses implementation science, the science of health-care delivery. Educational, clinical, quality, and safety goals can only be achieved by thematic, sustained, and cumulative research programs, not isolated studies. Components of an SBME TS research program include motivated learners, curriculum grounded in evidence-based learning theory, educational resources, evaluation of downstream results, a productive research team, rigorous research methods, research resources, and health-care system acceptance and implementation. National research priorities are served from translational educational research. National funding priorities should endorse the contribution and value of translational education research. PMID:23138127

  4. Engineering in translational medicine


    This book covers a broad area of engineering research in translational medicine. Leaders in academic institutions around the world contributed focused chapters on a broad array of topics such as: cell and tissue engineering (6 chapters), genetic and protein engineering (10 chapters), nanoengineering (10 chapters), biomedical instrumentation (4 chapters), and theranostics and other novel approaches (4 chapters). Each chapter is a stand-alone review that summarizes the state-of-the-art of the specific research area. Engineering in Translational Medicine gives readers a comprehensive and in-depth overview of a broad array of related research areas, making this an excellent reference book for scientists and students both new to engineering/translational medicine and currently working in this area.

  5. Data format translation routines

    Burris, R.D.


    To enable the effective connection of several dissimilar computers into a network, modification of the data being passed from one computer to another may become necessary. This document describes a package of routines which permit the translation of data in PDP-8 formats to PDP-11 or DECsystem-10 formats or from PDP-11 format to DECsystem-10 format. Additional routines are described which permit the effective use of the translation routines in the environment of the Fusion Energy Division (FED) network and the Elmo Bumpy Torus (EBT) data base

  6. Translating BPEL to FLOWer

    Lassen, Kristian Bisgaard

    FLOWer is a case handling tool made by Pallas-Athena for process management in the service industry. BPEL on the other hand is a language for web service orchestration, and has become a de facto standard, because of its popularity, for specifying workflow processes even though that was not its...... original purpose. This paper describe an approach translating BPLE to FLOWer, or more precisely form BPEL to CHIP. where CHIP is the interchange language that FLOWer import from and export to. The aim of the translation scheme that I give is to derive a CHIP specification that is behaviorally equivalent...

  7. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana


    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  8. Internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and radiological characterization in a patient.

    Guy, R J; Kamm, M A; Martin, J E


    We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.

  9. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Yatabe, K; Kawai, M


    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  10. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun


    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  11. Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy

    Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.


    Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855

  12. Mild trifunctional protein deficiency is associated with progressive neuropathy and myopathy and suggests a novel genotype-phenotype correlation.

    Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W


    Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...

  13. Performance, meat quality, and pectoral myopathies of broilers fed either corn or sorghum based diets supplemented with guanidinoacetic acid.

    Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U


    One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.

  14. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu


    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  15. Word Translation Entropy

    Schaeffer, Moritz; Dragsted, Barbara; Hvelplund, Kristian Tangsgaard

    This study reports on an investigation into the relationship between the number of translation alternatives for a single word and eye movements on the source text. In addition, the effect of word order differences between source and target text on eye movements on the source text is studied. In p...

  16. George Sigerson: Charcot's translator.

    Lyons, J B


    Senator George Sigerson (1836-1925), Dublin's first neurologist, was also a significant contributor to Anglo-Irish literature. His medical career and literary accomplishments are outlined, the focus of the article being Sigerson's friendly relationship with Charcot (with whom he corresponded), and whose Leçons sur les maladies du système nerveux he translated.

  17. Intermediation, Brokerage and Translation

    Hönke, Jana; Müller, Markus-Michael; Risse, Thomas; Draude, Anke; Börzel, Tanja


    Brokerage, a term prominent in the 1960s and 1970s, has returned. A huge literature analyses how brokers and intermediators— such as government officials, heads of non-governmental organization (NGOs), translators, neo-traditional authorities— strategically negotiate flows of resources and political

  18. Made in translation

    Chaput, John C.


    Evolution of highly functionalized DNA could enable the discovery of artificial nucleic acid sequences with different properties to natural DNA. Now, an artificial translation system has been designed that can support the evolution of non-natural sequence-defined nucleic acid polymers carrying eight different functional groups on 32 codons.

  19. [Fenofibrate--induced myopathy in a patient with undiagnosed hypothyroidism--case report and a review of the literature].

    Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek


    Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.

  20. On Deletion of Sutra Translation

    CHEN Shu-juan


    Dao An's the metaphor of translation "wine diluted with water' ' expressed a view about translation that had been abridged.Later Kumarajiva provided metaphor "rice chewed—tasteless and downright disgusting".Both of them felt regretted at the weakening of taste,sometimes even the complete loss of flavor caused by deletion in translation of Buddhist sutras.In early sutra translation,deletion is unavoidable which made many sutra translators felt confused and drove them to study it further and some even managed to give their understanding to this issue.This thesis will discuss the definition,and what causes deletion and the measures adopted by the sutra translators.

  1. Nemaline myopathy and heart failure: role of ivabradine; a case report.

    Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A


    Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending

  2. The Impact of Machine Translation and Computer-aided Translation on Translators

    Peng, Hao


    Under the context of globalization, communications between countries and cultures are becoming increasingly frequent, which make it imperative to use some techniques to help translate. This paper is to explore the influence of computer-aided translation on translators, which is derived from the field of the computer-aided translation (CAT) and machine translation (MT). Followed by an introduction to the development of machine and computer-aided translation, it then depicts the technologies practicable to translators, which are trying to analyze the demand of designing the computer-aided translation so far in translation practice, and optimize the designation of computer-aided translation techniques, and analyze its operability in translation. The findings underline the advantages and disadvantages of MT and CAT tools, and the serviceability and future development of MT and CAT technologies. Finally, this thesis probes into the impact of these new technologies on translators in hope that more translators and translation researchers can learn to use such tools to improve their productivity.

  3. (Con)figuring gender in Bible translation: Cultural, translational and ...

    The gendered intersection of cultural studies and Bible translation is under acknowledged. Accounting for gender criticism in translation work requires, besides responsible theory and practice of translation, also attention to interwoven gender critical aspects. After a brief investigation of the intersections between biblical, ...

  4. Translation in Language Teaching: Insights from Professional Translator Training

    Carreres, Angeles; Noriega-Sanchez, Maria


    The past three decades have seen vast changes in attitudes towards translation, both as an academic discipline and as a profession. The insights we have gained in recent years, in particular in the area of professional translator training, call for a reassessment of the role of translation in language teaching. Drawing on research and practices in…

  5. Translation and identity: Translation of the Freedom Charter into ...

    A comparative analysis of the Afrikaans translations reveals how the respective translators struggled sporadically through certain ideological constraints in order to provide a satisfactory narrative. Their inability to internalise the principles contained in the Freedom Charter resulted in them presenting a 'framed' translation ...

  6. A Writer's Thoughts on Translation and Always Living in Translation.

    Agosin, Marjorie; Jones, Robin


    Discusses how it feels to be a poet who writes in Spanish and has her work translated, examining the author's immigration experiences and noting the translator's contributions in making her work accessible across languages, borders, and cultures. Explains that writing in Spanish is a gesture of survival, and translation allows her memories to…

  7. 'Inhabiting' the Translator's Habitus – Antjie Krog as Translator ...

    Drawing on the Bourdieusian concept of habitus and its applicability in the field of translation, this article discusses Antjie Krog's profile in the practice of translation in. South Africa. Bourdieu's conceptualisation of the relationship between the initiating activities of translators and the structures which constrain and enable ...

  8. Translating a wicked problem

    Tietjen, Anne; Jørgensen, Gertrud


    , place-based and project-oriented process directed at concrete physical outcomes. We frame strategic planning as a translation process where the interaction between human and non-human actors translates a unique, complex and contested situation into an innovated situation. We find that local physical...... on the case of a Danish planning process which was carried out in collaboration with a charitable trust, this paper discusses an emerging strategic planning approach at the municipal level. We use the concept of wicked problems, strategic planning theory and Actor-Network-Theory to study a collaborative...... projects played a major role in this process. First, they acted as a vehicle that assembled planners, politicians and stakeholders to work towards strategic visions across multiple scales. Second and consequently, they stimulated considerable second and third order effects in the form of shared problem...

  9. Structural Coupling and Translation

    Tække, Jesper

    formations. After presenting the two theories the article put forward Twitter as an example making it possible to compare the two theories. Hereby the article also provides two analysis of how Twitter changes the communication milieu of modern society. In systems theory media can be seen as the mechanisms...... and translations the social medium of Twitter opens for. The second, but most prioritized, aim of the paper is to present, compare and discuss the two theories: How do they understand what becomes visible in their different optics, which observations become possible in the one or the other – and is it possible...... creating networks consisting in both humans and non-humans. Then the two appearing frameworks are used to observe Twitter and discuss which structural couplings and translations are made possible by this medium. In the end of the paper the two theories are discussed and compared....

  10. Translation of Financial Statements

    Dalthan Simas; Otavio De Medeiros


    This paper has the purpose of surveying and critically analyzing the effects of accounting procedures which are closely related to groups of companies operating multinationally. These are the methods for translation of financial statements, e.g. the Temporal and the Closing- rate Methods, as far as those methods are embodied in accounting standards which have been either recommended or adopted by countries such as the UK and US. We conclude that with regard to changing prices, General Price L...

  11. CADAT network translator

    Pitts, E. R.


    Program converts cell-net data into logic-gate models for use in test and simulation programs. Input consists of either Place, Route, and Fold (PRF) or Place-and-Route-in-Two-Dimensions (PR2D) layout data deck. Output consists of either Test Pattern Generator (TPG) or Logic-Simulation (LOGSIM) logic circuitry data deck. Designer needs to build only logic-gate-model circuit description since program acts as translator. Language is FORTRAN IV.

  12. Repetition and Translation Shifts

    Simon Zupan


    Full Text Available Repetition manifests itself in different ways and at different levels of the text. The first basic type of repetition involves complete recurrences; in which a particular textual feature repeats in its entirety. The second type involves partial recurrences; in which the second repetition of the same textual feature includes certain modifications to the first occurrence. In the article; repetitive patterns in Edgar Allan Poe’s short story “The Fall of the House of Usher” and its Slovene translation; “Konec Usherjeve hiše”; are compared. The author examines different kinds of repetitive patterns. Repetitions are compared at both the micro- and macrostructural levels. As detailed analyses have shown; considerable microstructural translation shifts occur in certain types of repetitive patterns. Since these are not only occasional; sporadic phenomena; but are of a relatively high frequency; they reduce the translated text’s potential for achieving some of the gothic effects. The macrostructural textual property particularly affected by these shifts is the narrator’s experience as described by the narrative; which suffers a reduction in intensity.

  13. Translation-Memory (TM) Research

    Schjoldager, Anne Gram; Christensen, Tina Paulsen


    to be representative of the research field as a whole. Our analysis suggests that, while considerable knowledge is available about the technical side of TMs, more research is needed to understand how translators interact with TM technology and how TMs influence translators' cognitive translation processes.......  It is no exaggeration to say that the advent of translation-memory (TM) systems in the translation profession has led to drastic changes in translators' processes and workflow, and yet, though many professional translators nowadays depend on some form of TM system, this has not been the object...... of much research. Our paper attempts to find out what we know about the nature, applications and influences of TM technology, including translators' interaction with TMs, and also how we know it. An essential part of the analysis is based on a selection of empirical TM studies, which we assume...

  14. Machine Translation Effect on Communication

    Jensen, Mika Yasuoka; Bjørn, Pernille


    Intercultural collaboration facilitated by machine translation has gradually spread in various settings. Still, little is known as for the practice of machine-translation mediated communication. This paper investigates how machine translation affects intercultural communication in practice. Based...... on communication in which multilingual communication system is applied, we identify four communication types and its’ influences on stakeholders’ communication process, especially focusing on establishment and maintenance of common ground. Different from our expectation that quality of machine translation results...


    Kobyakova, Iryna; Shvachko, Svitlana


    The article is focused on the set of items: teaching translation, objectives, exercises and assignments (both word-centered and text-centered translation), translation analysis. The choice of the items is motivated by the dominant functions of transatology (nominative and communicative). The latter succeed in identification of adequate, congruent, equivalent translation. The article discusses the problems of professional validity, theoretical insertions, textocentric analysis. Gains, achievem...

  16. Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients

    Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.


    Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.

  17. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves


    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  18. Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models

    James J. Dowling


    Myotubular myopathy (MTM is a severe congenital muscle disease characterized by profound weakness, early respiratory failure and premature lethality. MTM is defined by muscle biopsy findings that include centralized nuclei and disorganization of perinuclear organelles. No treatments currently exist for MTM. We hypothesized that aberrant neuromuscular junction (NMJ transmission is an important and potentially treatable aspect of the disease pathogenesis. We tested this hypothesis in two murine models of MTM. In both models we uncovered evidence of a disorder of NMJ transmission: fatigable weakness, improved strength with neostigmine, and electrodecrement with repetitive nerve stimulation. Histopathological analysis revealed abnormalities in the organization, appearance and size of individual NMJs, abnormalities that correlated with changes in acetylcholine receptor gene expression and subcellular localization. We additionally determined the ability of pyridostigmine, an acetylcholinesterase inhibitor, to ameliorate aspects of the behavioral phenotype related to NMJ dysfunction. Pyridostigmine treatment resulted in significant improvement in fatigable weakness and treadmill endurance. In all, these results describe a newly identified pathological abnormality in MTM, and uncover a potential disease-modifying therapy for this devastating disorder.

  19. Role of TGF-β signaling in inherited and acquired myopathies

    Burks Tyesha N


    Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.

  20. Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy

    Elizabeth Silbermann


    Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.

  1. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Levente Bodoki


    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  2. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    Nishikai, Masahiko; Akiya, Kumiko [National Tokyo Medical Center (Japan)


    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  3. Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

    Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K


    Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

  4. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    Nishikai, Masahiko; Akiya, Kumiko


    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  5. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)


    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  6. Hemolysis, myopathy, and cardiac disease associated with hereditary phosphofructokinase deficiency in two Whippets

    Gerber, Karen; Harvey, John W.; D'Agorne, Sara; Wood, Jonathan; Giger, Urs


    Two male castrated Whippet littermates were presented at 1 year of age for pallor, tachycardia, systolic heart murmur, dark yellow to orange feces, intermittent lethargy, pigmenturia, and muscle shivering or cramping after exercise. Persistent macrocytic hypochromic anemia with marked reticulocytosis and metarubricytosis was found when CBC results were compared with reference values for Whippets. Increased serum creatine kinase activity and hyperkalemia also were sometimes present over the 4-year period of evaluation. Progressively increasing serum concentrations of N-terminal prohormone brain natriuretic peptide suggested cardiac disease. Erythrocytes from the whippets were less osmotically fragile but more alkaline fragile than those from control dogs. Erythrocyte phosphofructokinase (PFK) activities and 2,3-diphosphoglycerate concentrations were decreased. Restriction enzyme-based DNA test screening and DNA sequencing revealed the same mutation in the muscle-PFK gene of the Whippets as seen in English Springer Spaniel dogs with PFK deficiency. This is the first report of PFK deficiency in Whippet dogs. In addition to causing hemolysis and exertional myopathy, heart disease may be a prominent clinical component of PFK deficiency in this breed and has not been previously recognized in PFK-deficient English Springer Spaniels. PMID:19228357

  7. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  8. Mitochondrial myopathy, encephalopathy, lactate acidosis with stroke-like episodes syndrome (MELAS: A case report

    Petrović Igor N.


    Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.

  9. Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells

    Donna M D'Souza


    Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.

  10. MiR-320a as a Potential Novel Circulating Biomarker of Arrhythmogenic CardioMyopathy.

    Sommariva, Elena; D'Alessandra, Yuri; Farina, Floriana Maria; Casella, Michela; Cattaneo, Fabio; Catto, Valentina; Chiesa, Mattia; Stadiotti, Ilaria; Brambilla, Silvia; Dello Russo, Antonio; Carbucicchio, Corrado; Vettor, Giulia; Riggio, Daniela; Sandri, Maria Teresa; Barbuti, Andrea; Vernillo, Gianluca; Muratori, Manuela; Dal Ferro, Matteo; Sinagra, Gianfranco; Moimas, Silvia; Giacca, Mauro; Colombo, Gualtiero Ivanoe; Pompilio, Giulio; Tondo, Claudio


    Diagnosis of Arrhythmogenic CardioMyopathy (ACM) is challenging and often late after disease onset. No circulating biomarkers are available to date. Given their involvement in several cardiovascular diseases, plasma microRNAs warranted investigation as potential non-invasive diagnostic tools in ACM. We sought to identify circulating microRNAs differentially expressed in ACM with respect to Healthy Controls (HC) and Idiopathic Ventricular Tachycardia patients (IVT), often in differential diagnosis. ACM and HC subjects were screened for plasmatic expression of 377 microRNAs and validation was performed in 36 ACM, 53 HC, 21 IVT. Variable importance in data partition was estimated through Random Forest analysis and accuracy by Receiver Operating Curves. Plasmatic miR-320a showed 0.53 ± 0.04 fold expression difference in ACM vs. HC (p ACM (n = 13) and HC (n = 17) with athletic lifestyle, a ACM precipitating factor. Importantly, ACM patients miR-320a showed 0.78 ± 0.05 fold expression change vs. IVT (p = 0.03). When compared to non-invasive ACM diagnostic parameters, miR-320a ranked highly in discriminating ACM vs. IVT and it increased their accuracy. Finally, miR-320a expression did not correlate with ACM severity. Our data suggest that miR-320a may be considered a novel potential biomarker of ACM, specifically useful in ACM vs. IVT differentiation.

  11. Ascending paresis as presentation of an unusual association between necrotizing autoimmune myopathy and systemic lupus erythematosus.

    García-Reynoso, Marco Julio; Veramendi-Espinoza, Liz Eliana; Ruiz-Garcia, Henry Jeison


    A 45 year-old man went to the emergency room due to disease duration of 15 days of insidious onset and progressive course. It began with symmetrical weakness and pain in feet and ankles that extends upward to the knees. Later, this progressed to paraparesis with Creatine phosphokinase levels of 44,270 U/L and respiratory failure that required mechanical ventilation. Electromyography and muscle biopsy of quadriceps were made. The patient responded to corticotherapy in pulses and supporting management. The presentation of ascending paresis suggested the diagnosis of Guillain-Barré syndrome. However, the degree of muscle involvement with rhabdomyolysis explains the neurological damage by itself. The biopsy revealed pathological criteria for necrotizing autoimmune myopathy (NAM), as well as other clinical and laboratory evidence. Patient disease continued and reached criteria for systemic lupus erythematosus (SLE). To our best knowledge, this is the first report of the NAM and SLE association. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  12. Neuropatia na miopatia miotubular ou centronuclear Neuropathy in myotubular or centronuclear myopathy

    Roberto E. P. Sica


    Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.

  13. The spectrum of myopathies in the city of São Paulo

    José A. Levy


    Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.

  14. Mechanisms of Hyperhomocysteinemia Induced Skeletal Muscle Myopathy after Ischemia in the CBS−/+ Mouse Model

    Sudhakar Veeranki


    Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.

  15. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary


    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  16. On Literal Translation of English Idioms

    Chen, Linli


    There are six translation tactics in translating English idioms into Chinese: literal translation, compensatory translation, free translation, explanational translation, borrowing, integrated approach. Each tactic should be reasonably employed in the process of translating, so as to keep the flavor of the original English idioms as well as to…

  17. Translational Implications of Tamil "Hamlets."

    Kanakaraj, S.


    Discusses the use of translation when teaching English as a Second Language in a Tamil context. Singles out the fencing episode in Shakespeare's "Hamlet" to illustrate the difficulties of translating cultural aspects. Concludes that successful translations of Shakespeare into Indian languages should involve collaboration between…


    Bayu Budiharjo


    Full Text Available Technology affects almost all areas, including translation. Many products of technology have made translational works easier, one of which is internet. Despite the wide use of internet, the potentials it has are sometimes unnoticed. While web-based dictionaries or thesaurus often serve as translators’ assistants and online Machine Translation issues become topics of many researches, other uses of internet related to translation may not be known by many. Internet can help disseminate newborn ideas, theories and findings worldwide to enhance translation theories. Besides, the contact between internet and translation generates new areas to examine. Internet also provides helping hand in the area of translation research. Researcher or anyone conducting research in the field of translation can find a range of research gaps as well as reference. Those who need group discussions to collect required data from informants, or researchers of the same interest coming from all over the world can meet and conduct Focus Group Discussion (FGD on virtual world. Furthermore, internet offers various forms of assistance for translation practitioners. The commonly used internet assistance consists of dictionaries, thesaurus and Machine Translations available on the internet. Other forms of aid provided by internet take form of parallel texts, images, and videos, which can be very helpful. Internet provides many things which can be utilized for the purpose of translation. Internet keeps on providing more as it develops from time to time in line with the development of technology. Internet awaits utilization of theorists, researchers, practitioners and those having concern on translation.

  19. Machine Translation for Academic Purposes

    Lin, Grace Hui-chin; Chien, Paul Shih Chieh


    Due to the globalization trend and knowledge boost in the second millennium, multi-lingual translation has become a noteworthy issue. For the purposes of learning knowledge in academic fields, Machine Translation (MT) should be noticed not only academically but also practically. MT should be informed to the translating learners because it is a…

  20. Translational plant proteomics: A perspective

    Agrawal, G.K.; Pedreschi, R.; Barkla, B.J.; Bindschedler, L.V.; Cramer, R.; Sarkar, A.; Renaut, J.; Job, D.; Rakwal, R.


    Translational proteomics is an emerging sub-discipline of the proteomics field in the biological sciences. Translational plant proteomics aims to integrate knowledge from basic sciences to translate it into field applications to solve issues related but not limited to the recreational and economic

  1. Lexical Discourse Analysis in Translation

    Al Khotaba, Eissa; Al Tarawneh, Khaled


    Lexical Discourse very often depend on lexis. Lexical Discourse analysis, however, has not yet been given enough consideration of the phenomenon of translation. This paper investigates lexical discourse analysis in translation from one language to another. This qualitative study comprises 15 text translated by M.A. students at the Department of…

  2. Machine Translation Tools - Tools of The Translator's Trade

    Kastberg, Peter


    In this article three of the more common types of translation tools are presented, discussed and critically evaluated. The types of translation tools dealt with in this article are: Fully Automated Machine Translation (or FAMT), Human Aided Machine Translation (or HAMT) and Machine Aided Human...... Translation (or MAHT). The strengths and weaknesses of the different types of tools are discussed and evaluated by means of a number of examples. The article aims at two things: at presenting a sort of state of the art of what is commonly referred to as “machine translation” as well as at providing the reader...... with a sound basis for considering what translation tool (if any) is the most appropriate in order to meet his or her specific translation needs....

  3. A novel Ile1455Thr variant in the skeletal muscle sodium channel alpha-subunit in a patient with a severe adult-onset proximal myopathy with electrical myotonia and a patient with mild paramyotonia phenotype

    Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.


    In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp

  4. Mamma Mia, A Singable Translation!

    Andrej Stopar


    Full Text Available The article discusses and analyzes approaches to translating singable texts. It presents a linguistic (prosodic, lexical and structural analysis of the Slovenian translation of the musical Mamma Mia! The aim of the qualitative and quantitative study is to investigate the translation strategies used to produce a singable target text. The results of the analysis suggest that producing a prosodic match is a basic requirement, whereas the lexical, structural and/or poetic characteristics of the source text are subject to changes. Overall, the findings show that the function and the purpose of the translation play a crucial role in the prioritization of translation strategies.

  5. The Complexity of Indirect Translation

    Wenjie, L. I.


    its complex nature, and thus determined that many facets of ITr remain to be studied. The present article will try to encompass the complexity of ITr by looking into the reasons for translating indirectly, the challenge of finding out mediating texts (MTs), indirectness in both translation...... of which have been translated and interpreted indirectly through major languages like English, will be employed as examples. Hopefully, this study will offer more insights into the nature of translation as a social activity and raise further interests in studying translation as a complex phenomenon....

  6. Computer-aided translation tools

    Christensen, Tina Paulsen; Schjoldager, Anne


    in Denmark is rather high in general, but limited in the case of machine translation (MT) tools: While most TSPs use translation-memory (TM) software, often in combination with a terminology management system (TMS), only very few have implemented MT, which is criticised for its low quality output, especially......The paper reports on a questionnaire survey from 2013 of the uptake and use of computer-aided translation (CAT) tools by Danish translation service providers (TSPs) and discusses how these tools appear to have impacted on the Danish translation industry. According to our results, the uptake...

  7. Ebola: translational science considerations.

    Chiappelli, Francesco; Bakhordarian, Andre; Thames, April D; Du, Angela M; Jan, Allison L; Nahcivan, Melissa; Nguyen, Mia T; Sama, Nateli; Manfrini, Ercolano; Piva, Francesco; Rocha, Rafael Malagoli; Maida, Carl A


    We are currently in the midst of the most aggressive and fulminating outbreak of Ebola-related disease, commonly referred to as "Ebola", ever recorded. In less than a year, the Ebola virus (EBOV, Zaire ebolavirus species) has infected over 10,000 people, indiscriminately of gender or age, with a fatality rate of about 50%. Whereas at its onset this Ebola outbreak was limited to three countries in West Africa (Guinea, where it was first reported in late March 2014, Liberia, where it has been most rampant in its capital city, Monrovia and other metropolitan cities, and Sierra Leone), cases were later reported in Nigeria, Mali and Senegal, as well as in Western Europe (i.e., Madrid, Spain) and the US (i.e., Dallas, Texas; New York City) by late October 2014. World and US health agencies declared that the current Ebola virus disease (EVD) outbreak has a strong likelihood of growing exponentially across the world before an effective vaccine, treatment or cure can be developed, tested, validated and distributed widely. In the meantime, the spread of the disease may rapidly evolve from an epidemics to a full-blown pandemic. The scientific and healthcare communities actively research and define an emerging kaleidoscope of knowledge about critical translational research parameters, including the virology of EBOV, the molecular biomarkers of the pathological manifestations of EVD, putative central nervous system involvement in EVD, and the cellular immune surveillance to EBOV, patient-centered anthropological and societal parameters of EVD, as well as translational effectiveness about novel putative patient-targeted vaccine and pharmaceutical interventions, which hold strong promise, if not hope, to curb this and future Ebola outbreaks. This work reviews and discusses the principal known facts about EBOV and EVD, and certain among the most interesting ongoing or future avenues of research in the field, including vaccination programs for the wild animal vectors of the virus

  8. Translators: Travellers, Not Tourists

    Veronika Rot Gabrovec


    Full Text Available The article explores various representations of culture(s found in contemporary English children’s literature and discusses how they were rendered into Slovene. In the first part, some introductory definitions of culture and approaches to the translation of children’s literature are presented. In the second part, excerpts from selected literary works (for instance, Mary Poppins, Harry Potter and the Philosopher’s Stone, Matilda, The Curious Incident of the Dog in the Night-Time are examined, both from the source and the target texts, with more attention paid to the cultural contexts, and the social changes that possibly influenced the translator’s decisions.

  9. Translation Analysis on Civil Engineering Text Produced by Machine Translator

    Sutopo Anam


    Full Text Available Translation is extremely needed in communication since people have serious problem in the language used. Translation activity is done by the person in charge for translating the material. Translation activity is also able to be done by machine. It is called machine translation, reflected in the programs developed by programmer. One of them is Transtool. Many people used Transtool for helping them in solving the problem related with translation activities. This paper wants to deliver how important is the Transtool program, how effective is Transtool program and how is the function of Transtool for human business. This study applies qualitative research. The sources of data were document and informant. This study used documentation and in dept-interviewing as the techniques for collecting data. The collected data were analyzed by using interactive analysis. The results of the study show that, first; Transtool program is helpful for people in translating the civil engineering text and it functions as the aid or helper, second; the working of Transtool software program is effective enough and third; the result of translation produced by Transtool is good for short and simple sentences and not readable, not understandable and not accurate for long sentences (compound, complex and compound complex thought the result is informative. The translated material must be edited by the professional translator.


    Reza Shaki


    Full Text Available The study investigated the relationship between the personality typology of a sample of Iranian translation students and their translation quality in terms of expressive, appellative, and informative text types. The study also attempted to identify the personality types that can perform better in English to Persian translation of the three text types. For that purpose, the personality type and the translation quality of the participants was assessed using Myers-Briggs Type Indicator (MBTI personality test and translation quality assessment (TQA, respectively. The analysis of the data revealed that the personality type of the participants seemed relevant to the translation quality of all the text types. The translation quality of the participants with intuitive and thinking types was significantly better than the sensing type counterparts in translating expressive texts. The participants with intuitive and feeling types also performed better than their counterparts with sensing type in translation of the informative text. Moreover, the participants with intuitive, feeling, and thinking personality types performed more successfully than the participants with sensing type in translation of the appellative text. The findings of the study are discussed in light of the existing research literature.

  11. Translation Analysis on Civil Engineering Text Produced by Machine Translator

    Sutopo, Anam


    Translation is extremely needed in communication since people have serious problem in the language used. Translation activity is done by the person in charge for translating the material. Translation activity is also able to be done by machine. It is called machine translation, reflected in the programs developed by programmer. One of them is Transtool. Many people used Transtool for helping them in solving the problem related with translation activities. This paper wants to deliver how important is the Transtool program, how effective is Transtool program and how is the function of Transtool for human business. This study applies qualitative research. The sources of data were document and informant. This study used documentation and in dept-interviewing as the techniques for collecting data. The collected data were analyzed by using interactive analysis. The results of the study show that, first; Transtool program is helpful for people in translating the civil engineering text and it functions as the aid or helper, second; the working of Transtool software program is effective enough and third; the result of translation produced by Transtool is good for short and simple sentences and not readable, not understandable and not accurate for long sentences (compound, complex and compound complex) thought the result is informative. The translated material must be edited by the professional translator.

  12. Magnetic translator bearings

    Hockney, Richard L. (Inventor); Downer, James R. (Inventor); Eisenhaure, David B. (Inventor); Hawkey, Timothy J. (Inventor); Johnson, Bruce G. (Inventor)


    A magnetic bearing system for enabling translational motion includes a carriage and a shaft for movably supporting the carriage; a first magnetic bearing fixed to one of the carriage and shaft and slidably received in a first channel of the other of the carriage and shaft. The first channel is generally U shaped with two side walls and a back wall. The magnetic bearing includes a pair of spaced magnetic pole pieces, each pole piece having a pair of electromagnetic coils mounted on poles on opposite ends of the pole piece proximate the side walls, and a third electromagnetic coil mounted on a pole of the pole piece proximate the backwall; a motion sensor for sensing translational motion along two axes and rotationally about three axes of the carriage and shaft relative to each other; and a correction circuit responsive to the sensor for generating a correction signal to drive the coils to compensate for any misalignment sensed between the carriage and the shaft.

  13. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S


    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  14. Post-Translational Modifications of TRP Channels

    Olaf Voolstra


    Full Text Available Transient receptor potential (TRP channels constitute an ancient family of cation channels that have been found in many eukaryotic organisms from yeast to human. TRP channels exert a multitude of physiological functions ranging from Ca2+ homeostasis in the kidney to pain reception and vision. These channels are activated by a wide range of stimuli and undergo covalent post-translational modifications that affect and modulate their subcellular targeting, their biophysical properties, or channel gating. These modifications include N-linked glycosylation, protein phosphorylation, and covalent attachment of chemicals that reversibly bind to specific cysteine residues. The latter modification represents an unusual activation mechanism of ligand-gated ion channels that is in contrast to the lock-and-key paradigm of receptor activation by its agonists. In this review, we summarize the post-translational modifications identified on TRP channels and, when available, explain their physiological role.

  15. National Center for Advancing Translational Sciences

    ... Models Core Technologies Clinical Innovation Clinical and Translational Science Awards Program Rare Diseases Clinical Research Network Patient ... to our monthly e-newsletter. About Translation Translational Science Spectrum Explore the full spectrum of translational science, ...

  16. Translation goes to the movies

    Cronin, Michael


    This highly accessible introduction to translation theory, written by a leading author in the field, uses the genre of film to bring the main themes in translation to life. Through analyzing films as diverse as the Marx Brothers' A Night at the Opera, The Star Wars Trilogies and Lost in Translation, the reader is encouraged to think about both issues and problems of translation as they are played out on the screen and issues of filmic representation through examining the translation dimension of specific films. In highlighting how translation has featured in both mainstream commercial and arthouse films over the years, Cronin shows how translation has been a concern of filmmakers dealing with questions of culture, identity, conflict and representation. This book is a lively and accessible text for translation theory courses and offers a new and largely unexplored approach to topics of identity and representation on screen. Translation Goes to the Movies will be of interest to those on translation studies...

  17. mtDNA depletion myopathy: elucidation of the tissue specificity in the mitochondrial thymidine kinase (TK2) deficiency.

    Saada, Ann; Shaag, Avraham; Elpeleg, Orly


    Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.

  18. Gyrate atrophy of choroid and retina with myopia, cataract and systemic proximal myopathy: A rare case report from rural India

    Surekha Bangal


    Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.

  19. Pauses by Student and Professional Translators in Translation Process

    Rusdi Noor Rosa


    Full Text Available Translation as a process of meaning making activity requires a cognitive process one of which is realized in a pause, a temporary stop or a break indicating doing other than typing activities in a certain period of translation process. Scholars agree that pauses are an indicator of cognitive process without which there will never be any translation practices. Despite such agreement, pauses are debatable as well, either in terms of their length or in terms of the activities managed by a translator while taking pauses. This study, in particular, aims at finding out how student translators and professional translators managed the pauses in a translation process. This was a descriptive research taking two student translators and two professional translators as the participants who were asked to translate a text from English into bahasa Indonesia. The source text (ST was a historical recount text entitled ‘Early History of Yellowstone National Park’ downloaded from composed of 230-word long from English into bahasa Indonesia. The data were collected using Translog protocols, think aloud protocols (TAPs and screen recording. Based on the data analysis, it was found that student translators took the longest pauses in the drafting phase spent to solve the problems related to finding out the right equivalent for the ST words or terms and to solve the difficulties encountered in encoding their ST understanding in the TL; meanwhile, professional translators took the longest pauses in the pos-drafting phase spent to ensure whether their TT had been natural and whether their TT had corresponded to the prevailing grammatical rules of the TL.

  20. Novel Variants in Individuals with RYR1-Related Congenital Myopathies: Genetic, Laboratory, and Clinical Findings

    Joshua J. Todd


    Full Text Available The ryanodine receptor 1-related congenital myopathies (RYR1-RM comprise a spectrum of slow, rare neuromuscular diseases. Affected individuals present with a mild-to-severe symptomatology ranging from proximal muscle weakness, hypotonia and joint contractures to scoliosis, ophthalmoplegia, and respiratory involvement. Although there is currently no FDA-approved treatment for RYR1-RM, our group recently conducted the first clinical trial in this patient population (NCT02362425. This study aimed to characterize novel RYR1 variants with regard to genetic, laboratory, muscle magnetic resonance imaging (MRI, and clinical findings. Genetic and histopathology reports were obtained from participant’s medical records. Alamut Visual Software was used to determine if participant’s variants had been previously reported and to assess predicted pathogenicity. Physical exams, pulmonary function tests, T1-weighted muscle MRI scans, and blood measures were completed during the abovementioned clinical trial. Six novel variants (two de novo, three dominant, and one recessive were identified in individuals with RYR1-RM. Consistent with established RYR1-RM histopathology, cores were observed in all biopsies, except Case 6 who exhibited fiber-type disproportion. Muscle atrophy and impaired mobility with Trendelenburg gait were the most common clinical symptoms and were identified in all cases. Muscle MRI revealed substantial inter-individual variation in fatty infiltration corroborating the heterogeneity of the disease. Two individuals with dominant RYR1 variants exhibited respiratory insufficiency: a clinical symptom more commonly associated with recessive RYR1-RM cases. This study demonstrates that a genetics-led approach is suitable for the diagnosis of suspected RYR1-RM which can be corroborated through histopathology, muscle MRI and clinical examination.

  1. The occurrence of deep pectoral myopathy in broilers and associated changes in breast meat quality.

    Yalcin, S; Ozkan, S; Acar, M Comert; Meral, O


    1. Two experiments were conducted to determine the effect of slaughter weight on the incidence and intensity of deep pectoral myopathy (DPM) of M. pectoralis minor (p. minor muscle) in commercial conditions in Turkey and to evaluate the impact of DPM on meat quality traits of pectoralis major (p. major) muscle in broilers. 2. In Experiment 1, a total of 116 250 carcasses from 59 Ross-308 broiler flocks, classified according to slaughter weight as 2.0-2.2, 2.2-2.4, 2.4-2.6 and >2.6 kg, were evaluated for occurrence of DPM. In Experiment 2, p. major samples from unaffected broilers and each DPM stage were evaluated for meat quality, oxidant and antioxidant properties, nutritional value and fatty acid profile. DPM was characterised as 1: muscles with coagulative necrosis, 2: muscles with fibrous tissue texture and pink to plumb and 3: muscles with green necrotic area. 3. The average incidence of DPM was found to be 0.73% in Experiment 1 and independent of slaughter weight. 4. In Experiment 2, p. major muscle of broilers with DPM 1 and 2 had higher pH values with higher redness and drip loss. All DPM stages resulted in an increase in lipid content and malondialdehyde activity and lowered ash content of p. major muscle compared with unaffected birds. DPM 2 increased superoxide dismutase and glutathione peroxidase activities in M. p. major. The p. major of broilers with DPM had lower content of C18:2 conjugated linoleic and C20:3n-6 fatty acids than those of unaffected broilers. Lower Δ6 desaturase and thiosterase activities and 18:2n-6 to 18:3n-3 ratio were observed for all DPM stages compared to unaffected. 5. It was concluded that these changes obtained in p. major muscle of broilers with DPM might indicate biochemical characteristics of muscle degenerations.

  2. Biomechanics, diagnosis, and treatment outcome in inflammatory myopathy presenting as oropharyngeal dysphagia

    Williams, R B; Grehan, M J; Hersch, M; Andre, J; Cook, I J


    Aims: In patients with inflammatory myopathy and dysphagia, our aims were to determine: (1) the diagnostic utility of clinical and laboratory indicators; (2) the biomechanical properties of the pharyngo-oesophageal segment; (3) the usefulness of pharyngeal videomanometry in distinguishing neuropathic from myopathic dysphagia; and (4) clinical outcome. Methods: Clinical, laboratory, and videomanometric assessment was performed in 13 patients with myositis and dysphagia, in 17 disease controls with dysphagia (due to proven CNS disease), and in 22 healthy age matched controls. The diagnostic accuracy of creatine kinase (CPK), erythrocyte sedimentation rate, antinuclear antibody, and electromyography (EMG) were compared with the gold standard muscle biopsy. The biomechanical properties of the pharyngo-oesophageal segment were assessed by videomanometry. Results: Mean time from dysphagia onset to the diagnosis of myositis was 55 months (range 1–180). One third had no extrapharyngeal muscle weakness; 25% had normal CPK, and EMG was unhelpful in 28%. Compared with neurogenic controls, myositis patients had more prevalent cricopharyngeal restrictive disorders (69% v 14%; p=0.0003), reduced upper oesophageal sphincter (UOS) opening (p=0.01), and elevated hypopharyngeal intrabolus pressures (p=0.001). Videomanometric features favouring a myopathic over a neuropathic aetiology were: preserved pharyngeal swallow response, complete UOS relaxation, and normal swallow coordination. The 12 month mortality was 31%. Conclusions: The notable lack of supportive clinical signs and significant false negative rates for laboratory tests contribute to the marked delay in diagnosis. The myopathic process is strongly associated with restricted sphincter opening suggesting that cricopharyngeal disruption is a useful adjunct to immunosuppressive therapy. The condition has a poor prognosis. PMID:12631653

  3. Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study

    Dorward Heidi


    Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.

  4. Relationship between work rate and oxygen uptake in mitochondrial myopathy during ramp-incremental exercise

    A.C. Gimenes


    Full Text Available We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ of oxygen consumption ( O2 and the applied power output (work rate = WR during ramp-incremental exercise in patients with mitochondrial myopathy (MM. Fourteen patients (7 males, age 35.4 ± 10.8 years with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT and the gas exchange threshold (GET. The ΔO2/ΔWR slope was calculated up to GET (S1, above GET (S2 and over the entire linear portion of the response (S T. Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P O2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P O2/ΔWR (S T and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P O2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (O2 had lower ΔO2/ΔWR (P O2/ΔWR is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.

  5. Topical Review: Translating Translational Research in Behavioral Science.

    Hommel, Kevin A; Modi, Avani C; Piazza-Waggoner, Carrie; Myers, James D


    To present a model of translational research for behavioral science that communicates the role of behavioral research at each phase of translation. A task force identified gaps in knowledge regarding behavioral translational research processes and made recommendations regarding advancement of knowledge. A comprehensive model of translational behavioral research was developed. This model represents T1, T2, and T3 research activities, as well as Phase 1, 2, 3, and 4 clinical trials. Clinical illustrations of translational processes are also offered as support for the model. Behavioral science has struggled with defining a translational research model that effectively articulates each stage of translation and complements biomedical research. Our model defines key activities at each phase of translation from basic discovery to dissemination/implementation. This should be a starting point for communicating the role of behavioral science in translational research and a catalyst for better integration of biomedical and behavioral research. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail:

  6. An Evergreen Challenge for Translators – The Translation of Idioms

    Kovács Gabriella


    Full Text Available Translating idioms has always been a challenging decision-making process for translators mainly because not all idioms have direct equivalents in the target language. Translators usually and ideally have a solid knowledge of the target language and its cultural aspects, but even so they cannot match the ability of a native speaker in deciding when – i.e. in what context and text type – an idiom would or would not be appropriate. This study aims to explore the main characteristics of idioms and the difficulties which might occur when translating them. A needs analysis will also be presented, where the various solutions which a group of translator trainees chose while translating certain idioms from the novel “A Game of Thrones” by George R. R. Martin into Hungarian are examined. Their strategies and the appropriateness of their choices are analysed and compared with the options of the experienced literary translator (Tamás Pétersz. We consider this an important endeavour because, based on our experience, we believe that the topic of the translation of idioms should be included into the curriculum and appropriate materials and tasks should be designed to develop the translator trainees’ knowledge and skills in this domain. Therefore, the aim of this analysis is to obtain a clearer view of the difficulties they are dealing with and bear them in mind when designing teaching materials for them.

  7. Translating Fashion into Danish

    Riegels Melchior, Marie; Skov, Lise; Csaba, Fabian


    emanate from Denmark and secure growth, jobs and exports even outside the fashion business has taken hold among policymakers, and compelled the government to embrace fashion as a national project. In investigating the emergence and rising stature of Danish fashion, particular at home, we first establish...... a theoretical frame for understanding the cultural economic policy and the motives, principles and strategies behind it. Then – drawing inspiration from Michel Callon’s “sociology of translation” with its moments of translation: problematization, interessement, enrolment and mobilization – we identify...... the actors and analyze their strategic roles and interrelationship through various phases of the development of Danish fashion. Callon’s actor network theory (ANT) is based on the principle of “generalized symmetry” – originally using a single repertoire to analyze both society and nature. We adapt...

  8. Found in translation

    Tietjen, Anne


    activities and uses, and people’s ideas and desires for future development can be a pertinent starting point. Furthermore, a clearly defined programming phase where design problems are formulated by different representational media and collectively assessed by students and teachers proved helpful...... analysis. Second, it presents the applied educational procedure, with a focus on the decisive step from inventory to intervention which is the formulation of a design problem. The teaching experiment shows that onsite studies of spatial controversies in the form of recent physical changes, emerging new...... for the students. Overall, the produced design work and the student evaluations show that translation offers an operational framework for teaching a creative approach to site analysis....


    Sang Ayu Isnu Maharani


    Screen translations involve oral translation known as dubbing and revoicing. Re-voicing consists of lip-sync dubbing, free commentary, narration and voice over. The written version is called subtitle. Dubbing and subtitling are two preferred mode used in the screen translation even though various numbers of current options are available nowadays. Dubbing commenced to be used in larger countries in Europe meanwhile smaller countries apply subtitling because it is more...

  10. Transferring communicative clues in translation

    Navarro Errasti, María Pilar


    In this essay I make use of the category communicative clue, as defined by Gutt (1991/2000), to explain certain differences between an original work and its various translations. Communicative clues are very useful analytical devices that show nuances of meaning and style. In the source texts, they sometimes go unnoticed. But when a translation is done the translator may come across these features and must desirably transfer them. Very frequently, however, they are ignored. Here a particular ...

  11. Strategy Of Translating Gadget Brochure

    Deny Kusuma


    Full Text Available The title of this writing is strategy of translating gadget brochure. There were two problems discussed in this thesis, namely (1 terms found in the gadget manual book and its equivalence in Indonesia, (2 strategies applied in translating gadget brochure. Based on the analysis result, it was found that the terms and its equivalent words found in the gadget brochure were classified based on: 1 simple words or compound words and terminology forming phrase. 2 words category found are: noun and verb. The recommended pattern to determine the equivalent word was pure borrowing strategy, not adaptation borrowing strategy. The adaptation borrowing in this context was related to the spellings, the pronunciation or sound adaptation in the TL rather than adaptation for the cultural substitutes that conceptually mismatches with the standardized terminology in the SL. In addition, the result of the analysis that there were seven strategies found in gadget brochure, they were translation by more general word (Superordinate, translation by a more neutral/expressive word, translation by cultural substitution, translation by using loan word or loan word plus explanation, translation by paraphrase using related word, translation by omission and translation by illustration.

  12. Specialised Translation Dictionaries for Learners

    Nielsen, Sandro


    Specialised translation dictionaries for learners are reference tools that can help users with domain discourse in a foreign language in connection with translation. The most common type is the business dictionary covering several more or less related subject fields. However, business dictionaries...... the needs of learners, it is proposed that specialised translation dictionaries should be designed as augmented reference tools. It is argued that electronic and printed dictionaries should include sections or CD-ROMs with syntactic, translation etc. data as well as exercises and illustrative documents...

  13. Onomastics and Translation: The Case of Igbo→English Translation ...

    The qualitative research method will be used to translate, analyze and explain the data from the anthroponomical, semiotic and linguistic perspectives to show that contrary to the view held in some Western circles that names are obscure and may consist of words that can hardly be interpreted or translated, they, as symbols ...

  14. The Translation and the Translator of the Peshitta of Hosea

    Tully, Eric J.


    This comprehensive examination of the Syriac Peshitta of Hosea (P-Hosea) is the first study of the Peshitta conducted via insights and methods from the discipline of Translation Studies. It uses in particular Andrew Chesterman's Causal Model and Gideon Toury's descriptive approach. Every translator leaves residue of his or her…

  15. The wise translator: reflecting on judgement in translator education ...

    The question of how one goes about teaching students to be translators is a central area of concern for translation teachers. As a reflective practitioner, I have a hunch about how to solve my problem. This paper is therefore in itself part of a reflective practicum, part of my reflection-in-action. I am in the process of restructuring ...

  16. A Study of Translation Institutional Ethics

    LuoXianfeng; ZhouJin


    Traditional translation ethics characterized by translators' ethics cannot provide a strong moral support to the translation practice,or guarantee the moral requirement towards translation activities in the social transformation caused by the market economy,because it does not have the power of punishment.Translation institutional ethics,however,a new form of translation ethics,integrates the translation ethic norm,translation regulations and relative laws together.As an inevitable outcome in the new era,it can escort the orderly and healthy translation activities.Its purpose is to strengthen the translators' moral consciousness,to sublimate their moral notions and to transfer from heteronomy to autonomy.

  17. Experimental studies on the accumulation of /sup 99m/Tc-MDP in the bupivacaine hydrochloride induced myopathy

    Sone, Shinsuke


    It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.

  18. Novel Homozygous Missense Mutation in RYR1 Leads to Severe Congenital Ptosis, Ophthalmoplegia, and Scoliosis in the Absence of Myopathy.

    Dilaver, Nafi; Mazaheri, Neda; Maroofian, Reza; Zeighami, Jawaher; Seifi, Tahere; Zamani, Mina; Sedaghat, Alireza; Shariati, Gholam Reza; Galehdari, Hamid


    Ryanodine receptor 1 ( RYR1 ) is an intracellular calcium receptor primarily expressed in skeletal muscle with a role in excitation contraction. Both dominant and recessive mutations in the RYR1 gene cause a range of RYR1 -related myopathies and/or susceptibility to malignant hyperthermia (MH). Recently, an atypical manifestation of ptosis, variably presenting with ophthalmoplegia, facial paralysis, and scoliosis but without significant muscle weakness, has been reported in 9 cases from 4 families with bialleic variants in RYR1 . Two affected children from a consanguineous family with severe congenital ptosis, ophthalmoplegia, scoliosis, and distinctive long faces but without skeletal myopathy were studied. To identify the cause of the hereditary condition, DNA from the proband was subjected to whole exome sequencing (WES). WES revealed a novel homozygous missense variant in RYR1 (c.14066T>A; p.IIe4689Asn), which segregated within the family. Although the phenotype of the affected siblings in this study was similar to previously described cases, the clinical features were more severely expressed. Our findings contribute to the expansion of phenotypes related to RYR1 dysfunction. Additionally, it supports a new RYR1 -related clinical presentation without musculoskeletal involvement. It is important that individuals with RYR1 mutations are considered susceptible to MH, as 70% of the MH cases are caused by mutations in the RYR1 gene.

  19. Experimental studies on the accumulation of 99mTc-MDP in the bupivacaine hydrochloride induced myopathy

    Sone, Shinsuke


    It has recently been demonstrated that several 99m Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of 99m Tc-methylendiphosphonate ( 99m Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of 99m Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of 99m Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of 99m Tc-MDP reflects the early degenerative changes of skeletal muscle. (author)

  20. Sporadic late-onset nemaline myopathy with MGUS: long-term follow-up after melphalan and SCT.

    Voermans, Nicol C; Benveniste, Olivier; Minnema, Monique C; Lokhorst, Henk; Lammens, Martin; Meersseman, Wouter; Delforge, Michel; Kuntzer, Thierry; Novy, Jan; Pabst, Thomas; Bouhour, Françoise; Romero, Norma; Leblond, Veronique; Bergh, Peter van den; Vekemans, Marie-Christiane; van Engelen, Baziel G; Eymard, Bruno


    Sporadic late-onset nemaline myopathy (SLONM) is a rare, late-onset myopathy that progresses subacutely. If associated with a monoclonal gammopathy of unknown significance (MGUS), the outcome is unfavorable: the majority of these patients die within 1 to 5 years of respiratory failure. This study aims to qualitatively assess the long-term treatment effect of high-dose melphalan (HDM) followed by autologous stem cell transplantation (SCT) in a series of 8 patients with SLONM-MGUS. We performed a retrospective case series study (n = 8) on the long-term (1-8 years) treatment effect of HDM followed by autologous SCT (HDM-SCT) on survival, muscle strength, and functional capacities. Seven patients showed a lasting moderate-good clinical response, 2 of them after the second HDM-SCT. All of them had a complete, a very good partial, or a partial hematologic response. One patient showed no clinical or hematologic response and died. This case series shows the positive effect of HDM-SCT in this rare disorder. Factors that may portend an unfavorable outcome are a long disease course before the hematologic treatment and a poor hematologic response. Age at onset, level and type of M protein (κ vs λ), and severity of muscle weakness were not associated with a specific outcome. This study provides Class IV evidence that for patients with SLONM-MGUS, HDM-SCT increases the probability of survival and functional improvement. © 2014 American Academy of Neurology.

  1. Hypoglycin A concentrations in seeds of Acer pseudoplatanus trees growing on atypical myopathy-affected and control pastures.

    Unger, L; Nicholson, A; Jewitt, E M; Gerber, V; Hegeman, A; Sweetman, L; Valberg, S


    Hypoglycin A, found in seeds of Acer negundo, appears to cause seasonal pasture myopathy (SPM) in North America and is implicated in atypical myopathy (AM) in Europe. Acer negundo is uncommon in Europe. Thus, the potential source of hypoglycin A in Europe is unknown. We hypothesized that seeds of Acer pseudoplatanus were the source of hypoglycin A in Europe. Our objective was to determine the concentration of hypoglycin A in seeds of A. pseudoplatanus trees located in pastures where previous cases of AM had occurred. None. University of Berne records were searched to retrospectively identify 6 farms with 10 AM cases and 11 suspected AM deaths between 2007 and 2011. During October 2012, A. pseudoplatanus seeds were collected from 2 to 6 trees per pasture on 6 AM farms (7 pastures) from trees in or close to 2 pastures on 2 control farms where AM had not been previously reported. Hypoglycin A in seeds was analyzed by GC-MS. Acer pseudoplatanus trees were identified on all AM pastures. Hypoglycin A was detected in all A. pseudoplatanus seeds in highly variable concentrations ranging from 0.04 to 2.81 μg/mg (mean 0.69) on AM farms and 0.10 to 9.12 μg/mg (mean 1.59) on control farms. Preventing horses from grazing pastures containing A. pseudoplatanus seeds during late fall and early spring might be the best means to prevent AM. Copyright © 2014 by the American College of Veterinary Internal Medicine.

  2. Clinical pathological and genetic analysis of 2 cases of mitochondrial myopathy presented as acute motor axonal neuropathy

    Hou-min YIN


    Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected.  Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers.  Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007

  3. A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

    Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G


    Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

  4. Translation Memory and Computer Assisted Translation Tool for Medieval Texts

    Törcsvári Attila


    Full Text Available Translation memories (TMs, as part of Computer Assisted Translation (CAT tools, support translators reusing portions of formerly translated text. Fencing books are good candidates for using TMs due to the high number of repeated terms. Medieval texts suffer a number of drawbacks that make hard even “simple” rewording to the modern version of the same language. The analyzed difficulties are: lack of systematic spelling, unusual word orders and typos in the original. A hypothesis is made and verified that even simple modernization increases legibility and it is feasible, also it is worthwhile to apply translation memories due to the numerous and even extremely long repeated terms. Therefore, methods and algorithms are presented 1. for automated transcription of medieval texts (when a limited training set is available, and 2. collection of repeated patterns. The efficiency of the algorithms is analyzed for recall and precision.

  5. Lipid-storage myopathy and respiratory insufficiency due to ETFQO mutations in a patient with late-onset multiple acyl-CoA dehydrogenation deficiency

    Olsen, Rikke Katrine Jentoft; Pourfarzam, M; Morris, A A M


    response to treatment, she developed respiratory insufficiency at age 14 years and has required long-term overnight ventilation. Thus, MADD is one of the few conditions that can cause a myopathy with weakness of the respiratory muscles out of proportion to the limb muscles. Udgivelsesdato: 2004-null...

  6. Becker muscular dystrophy-like myopathy regarded as so-called "fatty muscular dystrophy" in a pig: a case report and its diagnostic method.

    Horiuchi, Noriyuki; Aihara, Naoyuki; Mizutani, Hiroshi; Kousaka, Shinichi; Nagafuchi, Tsuneyuki; Ochiai, Mariko; Ochiai, Kazuhiko; Kobayashi, Yoshiyasu; Furuoka, Hidefumi; Asai, Tetsuo; Oishi, Koji


    We describe a case of human Becker muscular dystrophy (BMD)-like myopathy that was characterized by the declined stainability of dystrophin at sarcolemma in a pig and the immunostaining for dystrophin on the formalin-fixed, paraffin-embedded (FFPE) tissue. The present case was found in a meat inspection center. The pig looked appeared healthy at the ante-mortem inspection. Muscular abnormalities were detected after carcass dressing as pale, discolored skeletal muscles with prominent fat infiltrations and considered so-called "fatty muscular dystrophy". Microscopic examination revealed following characteristics: diffused fat infiltration into the skeletal muscle and degeneration and regeneration of the remaining skeletal muscle fibers. Any lesions that were suspected of neurogenic atrophy, traumatic muscular degeneration, glycogen storage disease or other porcine muscular disorders were not observed. The immunostaining for dystrophin was conducted and confirmed to be applicable on FFPE porcine muscular tissues and revealed diminished stainability of dystrophin at the sarcolemma in the present case. Based on the histological observations and immunostaining results, the present case was diagnosed with BMD-like myopathy associated with dystrophin abnormality in a pig. Although the genetic properties were not clear, the present BMD-like myopathy implied the occurrence of dystrophinopathy in pigs. To the best of our knowledge, this is the first report of a natural case of myopathy associated with dystrophin abnormalities in a pig.

  7. Deficiency of long-chain 3-hydroxyacyl-CoA dehydrogenase: a cause of lethal myopathy and cardiomyopathy in early childhood

    Rocchiccioli, F.; Wanders, R. J.; Aubourg, P.; Vianey-Liaud, C.; IJlst, L.; Fabre, M.; Cartier, N.; Bougneres, P. F.


    A child presented in early childhood with episodes of coma and hypoglycemia and a rapidly evolutive myopathy and cardiomyopathy leading to death at 9 mo of age. Ketosis was decreased (blood beta-hydroxybutyrate: 0.07 mmol/L) despite normal plasma levels of fatty acids (0.81 mmol/L). The patient's

  8. A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

    Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi


    Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Reconceptualising translation in agricultural innovation

    Ingram, Julie; Dwyer, Janet; Gaskell, Peter; Mills, Jane; Wolf, de Pieter


    Scientific research continues to play a significant role in meeting the multiple innovation challenges in agriculture. If this role is to be fulfilled, provision needs to be made for effective translation of research outputs, where translation is understood to be the process whereby science becomes

  10. PATRAN-STAGS translator (PATSTAGS)

    Otte, Neil


    A a computer program used to translate PATRAN finite element model data into Structural Analysis of General Shells (STAGS) input data is presented. The program supports translation of nodal, nodal constraints, element, force, and pressure data. The subroutine UPRESS required for the readings of live pressure data into STAGS is also presented.

  11. Knowledge Translation in Audiology

    Kothari, Anita; Bagatto, Marlene P.; Seewald, Richard; Miller, Linda T.; Scollie, Susan D.


    The impetus for evidence-based practice (EBP) has grown out of widespread concern with the quality, effectiveness (including cost-effectiveness), and efficiency of medical care received by the public. Although initially focused on medicine, EBP principles have been adopted by many of the health care professions and are often represented in practice through the development and use of clinical practice guidelines (CPGs). Audiology has been working on incorporating EBP principles into its mandate for professional practice since the mid-1990s. Despite widespread efforts to implement EBP and guidelines into audiology practice, gaps still exist between the best evidence based on research and what is being done in clinical practice. A collaborative dynamic and iterative integrated knowledge translation (KT) framework rather than a researcher-driven hierarchical approach to EBP and the development of CPGs has been shown to reduce the knowledge-to-clinical action gaps. This article provides a brief overview of EBP and CPGs, including a discussion of the barriers to implementing CPGs into clinical practice. It then offers a discussion of how an integrated KT process combined with a community of practice (CoP) might facilitate the development and dissemination of evidence for clinical audiology practice. Finally, a project that uses the knowledge-to-action (KTA) framework for the development of outcome measures in pediatric audiology is introduced. PMID:22194314

  12. Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

    Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu


    Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.)

  13. Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

    Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu


    Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.).

  14. Revising and editing for translators

    Mossop, Brian


    Revising and Editing for Translators provides guidance and learning materials for translation students learning to edit texts written by others, and professional translators wishing to improve their self-revision ability or learning to revise the work of others. Editing is understood as making corrections and improvements to texts, with particular attention to tailoring them to the given readership. Revising is this same task applied to draft translations. The linguistic work of editors and revisers is related to the professional situations in which they work. Mossop offers in-depth coverage of a wide range of topics, including copyediting, style editing, structural editing, checking for consistency, revising procedures and principles, and translation quality assessment. This third edition provides extended coverage of computer aids for revisers, and of the different degrees of revision suited to different texts. The inclusion of suggested activities and exercises, numerous real-world examples, a proposed gra...

  15. Biomedical informatics and translational medicine

    Sarkar Indra


    Full Text Available Abstract Biomedical informatics involves a core set of methodologies that can provide a foundation for crossing the "translational barriers" associated with translational medicine. To this end, the fundamental aspects of biomedical informatics (e.g., bioinformatics, imaging informatics, clinical informatics, and public health informatics may be essential in helping improve the ability to bring basic research findings to the bedside, evaluate the efficacy of interventions across communities, and enable the assessment of the eventual impact of translational medicine innovations on health policies. Here, a brief description is provided for a selection of key biomedical informatics topics (Decision Support, Natural Language Processing, Standards, Information Retrieval, and Electronic Health Records and their relevance to translational medicine. Based on contributions and advancements in each of these topic areas, the article proposes that biomedical informatics practitioners ("biomedical informaticians" can be essential members of translational medicine teams.

  16. Translational plant proteomics: a perspective.

    Agrawal, Ganesh Kumar; Pedreschi, Romina; Barkla, Bronwyn J; Bindschedler, Laurence Veronique; Cramer, Rainer; Sarkar, Abhijit; Renaut, Jenny; Job, Dominique; Rakwal, Randeep


    Translational proteomics is an emerging sub-discipline of the proteomics field in the biological sciences. Translational plant proteomics aims to integrate knowledge from basic sciences to translate it into field applications to solve issues related but not limited to the recreational and economic values of plants, food security and safety, and energy sustainability. In this review, we highlight the substantial progress reached in plant proteomics during the past decade which has paved the way for translational plant proteomics. Increasing proteomics knowledge in plants is not limited to model and non-model plants, proteogenomics, crop improvement, and food analysis, safety, and nutrition but to many more potential applications. Given the wealth of information generated and to some extent applied, there is the need for more efficient and broader channels to freely disseminate the information to the scientific community. This article is part of a Special Issue entitled: Translational Proteomics. Copyright © 2012 Elsevier B.V. All rights reserved.


    Maria Aparecida Andrade Salgueiro


    Full Text Available The present article presents aspects of a work in progress about both African-American and Afro-Brazilian Literatures as well as Translation Studies. As it makes observations about how blackness has been translated in different contexts and geographical spaces, it calls the reader’s attention to power relations, processes of colonial and post-colonial identity construction, the rising of literary canons, cultural hegemony and globalization, demystifying spaces and showing translation as an activity that does not take place in a neutral space, but, for sure, inside social and political concrete situations.

  18. Detection of hypoglycin A in the seeds of sycamore (Acer pseudoplatanus) and box elder (A. negundo) in New Zealand; the toxin associated with cases of equine atypical myopathy.

    McKenzie, R K; Hill, F I; Habyarimana, J A; Boemer, F; Votion, D M


    During April and May 2014 four horses aged between 5 months and 9 years, located in the Canterbury, Marlborough and Southland regions, presented with a variety of clinical signs including recumbency, stiffness, lethargy, dehydration, depression, and myoglobinuria suggestive of acute muscle damage. Two horses were subjected to euthanasia and two recovered. In all cases seeds of sycamore maple (Acer pseudoplatanus) or box elder (A. negundo) were present in the area where the horse had been grazing. The samaras (seeds) of some Acer spp. may contain hypoglycin A, that has been associated with cases of atypical myopathy in Europe and North America. To determine if hypoglycin A is present in the samaras of Acer spp. in New Zealand, samples were collected from trees throughout the country that were associated with historical and/or current cases of atypical myopathy, and analysed for hypoglycin A. Serum samples from the four cases and four unaffected horses were analysed for the presence of hypoglycin A, profiles of acylcarnitines (the definitive diagnosis for atypical myopathy) and activities of creatine kinase and aspartate aminotransferase.Markedly elevated serum activities of creatine kinase and aspartate aminotransferase, and increased concentrations of selected acylcarnitines were found in the case horses. Hypoglycin A was detected in the serum of those horses but not in the healthy controls. Hypoglycin A was detected in 10/15 samples of samaras from sycamore maple and box elder from throughout New Zealand. Cases of atypical myopathy were diagnosed on properties where samaras containing hypoglycin A were also found. Sycamore and box elder trees in New Zealand are a source of hypoglycin A associated with the development of atypical myopathy. If pastured horses present with clinical and biochemical signs of severe muscle damage then the environment should be checked for the presence of these trees. Horses should be prevented from grazing samaras from Acer spp. in the

  19. Knowledge translation of research findings

    Grimshaw Jeremy M


    Full Text Available Abstract Background One of the most consistent findings from clinical and health services research is the failure to translate research into practice and policy. As a result of these evidence-practice and policy gaps, patients fail to benefit optimally from advances in healthcare and are exposed to unnecessary risks of iatrogenic harms, and healthcare systems are exposed to unnecessary expenditure resulting in significant opportunity costs. Over the last decade, there has been increasing international policy and research attention on how to reduce the evidence-practice and policy gap. In this paper, we summarise the current concepts and evidence to guide knowledge translation activities, defined as T2 research (the translation of new clinical knowledge into improved health. We structure the article around five key questions: what should be transferred; to whom should research knowledge be transferred; by whom should research knowledge be transferred; how should research knowledge be transferred; and, with what effect should research knowledge be transferred? Discussion We suggest that the basic unit of knowledge translation should usually be up-to-date systematic reviews or other syntheses of research findings. Knowledge translators need to identify the key messages for different target audiences and to fashion these in language and knowledge translation products that are easily assimilated by different audiences. The relative importance of knowledge translation to different target audiences will vary by the type of research and appropriate endpoints of knowledge translation may vary across different stakeholder groups. There are a large number of planned knowledge translation models, derived from different disciplinary, contextual (i.e., setting, and target audience viewpoints. Most of these suggest that planned knowledge translation for healthcare professionals and consumers is more likely to be successful if the choice of knowledge

  20. Knowledge translation of research findings.

    Grimshaw, Jeremy M; Eccles, Martin P; Lavis, John N; Hill, Sophie J; Squires, Janet E


    One of the most consistent findings from clinical and health services research is the failure to translate research into practice and policy. As a result of these evidence-practice and policy gaps, patients fail to benefit optimally from advances in healthcare and are exposed to unnecessary risks of iatrogenic harms, and healthcare systems are exposed to unnecessary expenditure resulting in significant opportunity costs. Over the last decade, there has been increasing international policy and research attention on how to reduce the evidence-practice and policy gap. In this paper, we summarise the current concepts and evidence to guide knowledge translation activities, defined as T2 research (the translation of new clinical knowledge into improved health). We structure the article around five key questions: what should be transferred; to whom should research knowledge be transferred; by whom should research knowledge be transferred; how should research knowledge be transferred; and, with what effect should research knowledge be transferred? We suggest that the basic unit of knowledge translation should usually be up-to-date systematic reviews or other syntheses of research findings. Knowledge translators need to identify the key messages for different target audiences and to fashion these in language and knowledge translation products that are easily assimilated by different audiences. The relative importance of knowledge translation to different target audiences will vary by the type of research and appropriate endpoints of knowledge translation may vary across different stakeholder groups. There are a large number of planned knowledge translation models, derived from different disciplinary, contextual (i.e., setting), and target audience viewpoints. Most of these suggest that planned knowledge translation for healthcare professionals and consumers is more likely to be successful if the choice of knowledge translation strategy is informed by an assessment of the