Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
Establishment of screening technique for mutant cell and analysis of base sequence in the mutation
International Nuclear Information System (INIS)
Sofuni, Toshio; Nomi, Takehiko; Yamada, Masami; Masumura, Kenichi
2000-01-01
This research project aimed to establish an easy and quick detection method for radiation-induced mutation using molecular-biological techniques and an effective analyzing method for the molecular changes in base sequence. In this year, Spi mutants derived from γ-radiation exposed mouse were analyzed by PCR method and DNA sequence method. Male transgenic mice were exposed to γ-ray at 5,10, 50 Gy and the transgene was taken out from the genome DNA from the spleen in vivo packaging method. Spi mutant plaques were obtained by infecting the recovered phage to E. coli. Sequence analysis for the mutants was made using ALFred DNA sequencer and SequiTherm TM Long-Red Cycle sequencing kit. Sequence analysis was carried out for 41 of 50 independent Spi mutants obtained. The deletions were classified into 4 groups; Group 1 included 15 mutants that were characterized with a large deletion (43 bp-10 kb) with a short homologous sequence. Group 2 included 11 mutants of a large deletion having no homologous sequence at the connecting region. Group 3 included 11 mutants having a short deletion of less than 20 bp, which occurred in the non-repetitive sequence of gam gene and possibly caused by oxidative breakage of DNA or recombination of DNA fragment produced by the breakage. Group 4 included 4 mutants having deletions as short as 20 bp or less in the repetitive sequence of gam gene, resulting in an alteration of the reading frame. Thus, the synthesis of Gam protein was terminated by the appearance of TGA between code 13 and 14 of redB gene, leading to inactivation of gam gene and redBA gene. These results indicated that most of Spi mutants had a deletion in red/gam region and the deletions in more than half mutants occurred in homologous sequences as short as 8 bp. (M.N.)
Directory of Open Access Journals (Sweden)
Melissa K Boles
2009-12-01
Full Text Available An accurate and precisely annotated genome assembly is a fundamental requirement for functional genomic analysis. Here, the complete DNA sequence and gene annotation of mouse Chromosome 11 was used to test the efficacy of large-scale sequencing for mutation identification. We re-sequenced the 14,000 annotated exons and boundaries from over 900 genes in 41 recessive mutant mouse lines that were isolated in an N-ethyl-N-nitrosourea (ENU mutation screen targeted to mouse Chromosome 11. Fifty-nine sequence variants were identified in 55 genes from 31 mutant lines. 39% of the lesions lie in coding sequences and create primarily missense mutations. The other 61% lie in noncoding regions, many of them in highly conserved sequences. A lesion in the perinatal lethal line l11Jus13 alters a consensus splice site of nucleoredoxin (Nxn, inserting 10 amino acids into the resulting protein. We conclude that point mutations can be accurately and sensitively recovered by large-scale sequencing, and that conserved noncoding regions should be included for disease mutation identification. Only seven of the candidate genes we report have been previously targeted by mutation in mice or rats, showing that despite ongoing efforts to functionally annotate genes in the mammalian genome, an enormous gap remains between phenotype and function. Our data show that the classical positional mapping approach of disease mutation identification can be extended to large target regions using high-throughput sequencing.
Genetic analysis and gene mapping of a low stigma exposed mutant gene by high-throughput sequencing.
Directory of Open Access Journals (Sweden)
Xiao Ma
Full Text Available Rice is one of the main food crops and several studies have examined the molecular mechanism of the exposure of the rice plant stigma. The improvement in the exposure of the stigma in female parent hybrid combinations can enhance the efficiency of hybrid breeding. In the present study, a mutant plant with low exposed stigma (lesr was discovered among the descendants of the indica thermo-sensitive sterile line 115S. The ES% rate of the mutant decreased by 70.64% compared with the wild type variety. The F2 population was established by genetic analysis considering the mutant as the female parent and the restorer line 93S as the male parent. The results indicated a normal F1 population, while a clear division was noted for the high and low exposed stigma groups, respectively. This process was possible only by a ES of 25% in the F2 population. This was in agreement with the ratio of 3:1, which indicated that the mutant was controlled by a recessive main-effect QTL locus, temporarily named as LESR. Genome-wide comparison of the SNP profiles between the early, high and low production bulks were constructed from F2 plants using bulked segregant analysis in combination with high-throughput sequencing technology. The results demonstrated that the candidate loci was located on the chromosome 10 of the rice. Following screening of the recombinant rice plants with newly developed molecular markers, the genetic region was narrowed down to 0.25 Mb. This region was flanked by InDel-2 and InDel-2 at the physical location from 13.69 to 13.94 Mb. Within this region, 7 genes indicated base differences between parents. A total of 2 genes exhibited differences at the coding region and upstream of the coding region, respectively. The present study aimed to further clone the LESR gene, verify its function and identify the stigma variation.
Li, Guotian; Jain, Rashmi; Chern, Mawsheng; Pham, Nikki T; Martin, Joel A; Wei, Tong; Schackwitz, Wendy S; Lipzen, Anna M; Duong, Phat Q; Jones, Kyle C; Jiang, Liangrong; Ruan, Deling; Bauer, Diane; Peng, Yi; Barry, Kerrie W; Schmutz, Jeremy; Ronald, Pamela C
2017-06-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake ( Oryza sativa ssp japonica ), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. © 2017 American Society of Plant Biologists. All rights reserved.
Huo, Heqiang; Henry, Isabelle M; Coppoolse, Eric R; Verhoef-Post, Miriam; Schut, Johan W; de Rooij, Han; Vogelaar, Aat; Joosen, Ronny V L; Woudenberg, Leo; Comai, Luca; Bradford, Kent J
2016-11-01
Lettuce (Lactuca sativa) seeds exhibit thermoinhibition, or failure to complete germination when imbibed at warm temperatures. Chemical mutagenesis was employed to develop lettuce lines that exhibit germination thermotolerance. Two independent thermotolerant lettuce seed mutant lines, TG01 and TG10, were generated through ethyl methanesulfonate mutagenesis. Genetic and physiological analyses indicated that these two mutations were allelic and recessive. To identify the causal gene(s), we applied bulked segregant analysis by whole genome sequencing. For each mutant, bulked DNA samples of segregating thermotolerant (mutant) seeds were sequenced and analyzed for homozygous single-nucleotide polymorphisms. Two independent candidate mutations were identified at different physical positions in the zeaxanthin epoxidase gene (ABSCISIC ACID DEFICIENT 1/ZEAXANTHIN EPOXIDASE, or ABA1/ZEP) in TG01 and TG10. The mutation in TG01 caused an amino acid replacement, whereas the mutation in TG10 resulted in alternative mRNA splicing. Endogenous abscisic acid contents were reduced in both mutants, and expression of the ABA1 gene from wild-type lettuce under its own promoter fully complemented the TG01 mutant. Conventional genetic mapping confirmed that the causal mutations were located near the ZEP/ABA1 gene, but the bulked segregant whole genome sequencing approach more efficiently identified the specific gene responsible for the phenotype. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Gene mining a marama bean expressed sequence tags (ESTs ...
African Journals Online (AJOL)
The authors reported the identification of genes associated with embryonic development and microsatellite sequences. The future direction will entail characterization of these genes using gene over-expression and mutant assays. Key words: Namibia, simple sequence repeats (SSR), data mining, homology searches, ...
Ueshima, Junichi; Shoji, Mikio; Ratnayake, Dinath B; Abe, Kihachiro; Yoshida, Shinichi; Yamamoto, Kenji; Nakayama, Koji
2003-03-01
The periodontopathogen Porphyromonas gingivalis is an obligate anaerobe that is devoid of catalase but exhibits a relatively high degree of resistance to peroxide stress. In the present study, we demonstrate that P. gingivalis contains a Dps homologue that plays an important role in the protection of cells from peroxide stress. The Dps protein isolated from P. gingivalis displayed a ferritin-like spherical polymer consisting of 19-kDa subunits. Molecular cloning and sequencing of the gene encoding this protein revealed that it had a high similarity in nucleotide and amino acid sequences to Dps proteins from other species. The expression of Dps was significantly increased by exposure of P. gingivalis to atmospheric oxygen in an OxyR-dependent manner, indicating that it is regulated by the reactive oxygen species-regulating gene oxyR. The Dps-deficient mutants, including the dps single mutant and the ftn dps double mutant, showed no viability loss upon exposure to atmospheric oxygen for 6 h. In contrast to the wild type, however, these mutants exhibited the high susceptibility to hydrogen peroxide, thereby disrupting the viability. On the other hand, no significant difference in sensitivity to mitomycin C and metronidazole was observed between the wild type and the mutants. Furthermore, the dps single mutant, compared with the wild type, showed a lower viability in infected human umbilical vein endothelial cells.
Chen, H T; Alexander, C B; Mage, R G
1995-06-15
Normal rabbits preferentially rearrange the 3'-most VH gene, VH1, to encode Igs with VHa allotypes, which constitute the majority of rabbit serum Igs. A gene conversion-like mechanism is employed to diversify the primary Ab repertoire. In mutant Alicia rabbits that derived from a rabbit with VHa2 allotype, the VH1 gene was deleted. Our previous studies showed that the first functional gene (VH4) or VH4-like genes were rearranged in 2- to 8-wk-old homozygous Alicia. The VH1a2-like sequences that were found in splenic mRNA from 6-wk and older Alicia rabbits still had some residues that were typical of VH4. The appearances of sequences resembling that of VH1a2 may have been caused by gene conversions that altered the sequences of the rearranged VH or there may have been rearrangement of upstream VH1a2-like genes later in development. To investigate this further, we constructed a cosmid library and isolated a VH1a2-like gene, VH12-1-6, with a sequence almost identical to VH1a2. This gene had a deleted base in the heptamer of its recombination signal sequence. However, even if this defect diminished or eliminated its ability to rearrange, the a2-like gene could have acted as a donor for gene-conversion-like alteration of rearranged VH genes. Sequence comparisons suggested that this gene or a gene like it could have acted as a donor for gene conversion in mutant Alicia and in normal rabbits.
Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang
2014-02-10
Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Jett, J. [Lawrence Livermore National Lab., CA (United States)
1994-12-01
While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.
VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.
Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G
1993-04-01
Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.
Fine Mapping and Cloning of Leafy Head Mutant Gene pla1-5 in Rice
Directory of Open Access Journals (Sweden)
Gong-neng FENG
2013-09-01
Full Text Available We identified a leafy head mutant pla1-5 (plastochron 1-5 from the progeny of japonica rice cultivar Taipei 309 treated with 60Co-γ ray irradiation. The pla1-5 mutant has a dwarf phenotype and small leaves. Compared with its wild type, pla1-5 has more leaves and fewer tillers, and it fails to produce normal panicles at the maturity stage. Genetic analysis showed that the pla1-5 phenotype is controlled by a single recessive nuclear gene. Using the map-based cloning strategy, we narrowed down the location of the target gene to a 58-kb region between simple sequence repeat markers CHR1027 and CHR1030 on the long arm of chromosome 10. The target gene cosegregated with molecular markers CHR1028 and CHR1029. There were five predicted genes in the mapped region. The results from sequencing analysis revealed that there was one base deletion in the first exon of LOC_Os10g26340 encoding cytochrome P450 CYP78A11 in the pla1-5 mutant, which might result in a downstream frame shift and premature termination. These results suggest that the P450 CYP78A11 gene is the candidate gene of PLA1-5.
International Nuclear Information System (INIS)
I Ishak
2016-01-01
The BADH2 gene acts as suppressor of 2-acetyl-1-pyrolline (2AP) biosynthesis in plants. 2AP is the volatile compound which provides fragrance in rice. Biosynthesis of 2AP occurs when BADH2 loses its function as suppressor gene. Aromatic rice cultivars naturally incur mutation of BADH2 gene at 8 bp. In this experiment, aromatic mutant rice lines derived from irradiation of Sintanur cultivar by gamma rays with dose of 100 Gy were studied in molecular level. These mutant lines were characterized at the M10 plantgeneration under the assumption that genetically these aromatic mutant rice lines were homozygotic. Several primers related to aroma in rice have been used for polymerase chain reaction (PCR) in a thermal cycler instrument. Gel electrophoreses were carried out using 1.5% agarose in TAE buffer. DNA fragments at 254 bp and 355 bp (base pair) were taken and amplified by primer for nucleotide sequencing of these fragments. Molecular identification and characterization after electrophoresis showed that the mutant line from AR1020 can be differentiated from AR.1080 at 254 bp. Nucleotide sequence data from of these DNA fragments showed that point mutations (deletions and substitutions) occurred at the BADH2 gene in exon 7; those are called second mutation and were caused by gamma rays effects. The Sintanur variety was used as check cultivar and its DNA sequence was compared to that of the AR.1020 mutant line. The results from both DNA sequences (from cv. Sintanur and AR.1020) derived from fragments at 254 bp show that point mutations occurred within exon 7 and earlier stop codon occurred in the AR.1020 mutant rice line. Further, the use of EA primer in PCR resulted in detection of deletion and substitution of nucleotides in the AR.1020 mutant line. (author)
International Nuclear Information System (INIS)
Swiecicki, W.K.
1990-01-01
Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Directory of Open Access Journals (Sweden)
Yinping Jiao
2018-01-01
Full Text Available Sorghum (Sorghum bicolor Moench, L. plant accumulates copious layers of epi-cuticular wax (EW on its aerial surfaces, to a greater extent than most other crops. EW provides a vapor barrier that reduces water loss, and is therefore considered to be a major determinant of sorghum's drought tolerance. However, little is known about the genes responsible for wax accumulation in sorghum. We isolated two allelic mutants, bloomless40-1 (bm40-1 and bm40-2, from a mutant library constructed from ethyl methane sulfonate (EMS treated seeds of an inbred, BTx623. Both mutants were nearly devoid of the EW layer. Each bm mutant was crossed to the un-mutated BTx623 to generated F2 populations that segregated for the bm phenotype. Genomic DNA from 20 bm F2 plants from each population was bulked for whole genome sequencing. A single gene, Sobic.001G228100, encoding a GDSL-like lipase/acylhydrolase, had unique homozygous mutations in each bulked F2 population. Mutant bm40-1 harbored a missense mutation in the gene, whereas bm40-2 had a splice donor site mutation. Our findings thus provide strong evidence that mutation in this GDSL-like lipase gene causes the bm phenotype, and further demonstrate that this approach of sequencing two independent allelic mutant populations is an efficient method for identifying causal mutations. Combined with allelic mutants, MutMap provides powerful method to identify all causal genes for the large collection of bm mutants in sorghum, which will provide insight into how sorghum plants accumulate such abundant EW on their aerial surface. This knowledge may facilitate the development of tools for engineering drought-tolerant crops with reduced water loss.
Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants.
Pourahmad Jaktaji, Razieh; Pasand, Shirin
2016-01-15
Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.
Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.).
Hanzawa, Eiko; Sasaki, Kazuhiro; Nagai, Shinsei; Obara, Mitsuhiro; Fukuta, Yoshimichi; Uga, Yusaku; Miyao, Akio; Hirochika, Hirohiko; Higashitani, Atsushi; Maekawa, Masahiko; Sato, Tadashi
2013-11-20
Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Li, M; Zhang, H Y; Liang, B
2013-01-01
Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.
Genetic Analysis and Mapping of TWH Gene in Rice Twisted Hull Mutant
Directory of Open Access Journals (Sweden)
Jin-bo LI
2009-03-01
Full Text Available A mutant with twisted hulls was found in a breeding population of rice (Oryza sativa L.. The mutant shows less grain weight and inferior grain quality in addition to twisted hulls. Genetic analysis indicated that the phenotype of mutant was controlled by a single recessive gene (temporarily designated as TWH. To map the TWH gene, an F2 population was generated by crossing the twh mutant to R725, an indica rice variety with normal hulls. For bulked segregant analysis, the bulk of mutant plants was prepared by mixing equal amount of plant tissue from 10 twisted-hull plants and the bulk of normal plants was obtained by pooling equal amount tissue of 10 normal-hull plants. Two hundred and seven pairs of simple sequence repeat (SSR primers, which are distributed on 12 rice chromosomes, were used for polymorphism analysis of the parents and the two bulks. The TWH locus was initially mapped close to the SSR marker RM526 on chromosome 2. Therefore, further mapping was performed using 50 pairs of SSR primers around the marker RM526. The TWH was delimited between the SSR markers RM14128 and RM208 on the long arm of chromosome 2 at the genetic distances of 1.4 cM and 2.7 cM, respectively. These results provide the foundation for further fine mapping, cloning and functional analysis of the TWH gene.
Vicente-Dólera, Nelly; Troadec, Christelle; Moya, Manuel; del Río-Celestino, Mercedes; Pomares-Viciana, Teresa; Bendahmane, Abdelhafid; Picó, Belén; Román, Belén; Gómez, Pedro
2014-01-01
Although the availability of genetic and genomic resources for Cucurbita pepo has increased significantly, functional genomic resources are still limited for this crop. In this direction, we have developed a high throughput reverse genetic tool: the first TILLING (Targeting Induced Local Lesions IN Genomes) resource for this species. Additionally, we have used this resource to demonstrate that the previous EMS mutant population we developed has the highest mutation density compared with other cucurbits mutant populations. The overall mutation density in this first C. pepo TILLING platform was estimated to be 1/133 Kb by screening five additional genes. In total, 58 mutations confirmed by sequencing were identified in the five targeted genes, thirteen of which were predicted to have an impact on the function of the protein. The genotype/phenotype correlation was studied in a peroxidase gene, revealing that the phenotype of seedling homozygous for one of the isolated mutant alleles was albino. These results indicate that the TILLING approach in this species was successful at providing new mutations and can address the major challenge of linking sequence information to biological function and also the identification of novel variation for crop breeding.
Zhang, Silai; Ban, Akihiko; Ebara, Naoki; Mizutani, Osamu; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya
2017-04-01
In this study, we developed a self-excising Cre/loxP-mediated marker recycling system with mutated lox sequences to introduce a number of biosynthetic genes into Aspergillus oryzae. To construct the self-excising marker cassette, both the selectable marker, the Aspergillus nidulans adeA gene, and the Cre recombinase gene (cre), conditionally expressed by the xylanase-encoding gene promoter, were designed to be located between the mutant lox sequences, lox66 and lox71. However, construction of the plasmid failed, possibly owing to a slight expression of cre downstream of the fungal gene promoter in Escherichia coli. Hence, to avoid the excision of the cassette in E. coli, a 71-bp intron of the A. oryzae xynG2 gene was inserted into the cre gene. The A. oryzae adeA deletion mutant was transformed with the resulting plasmid in the presence of glucose, and the transformants were cultured in medium containing xylose as the sole carbon source. PCR analysis of genomic DNA from resultant colonies revealed the excision of both the marker and Cre expression construct, indicating that the self-excising marker cassette was efficient at removing the selectable marker. Using the marker recycling system, hyperproduction of kojic acid could be achieved in A. oryzae by the introduction of two genes that encode oxidoreductase and transporter. Furthermore, we also constructed an alternative marker recycling cassette bearing the A. nidulans pyrithiamine resistant gene (ptrA) as a dominant selectable marker. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Robert Silas Allen
2013-09-01
Full Text Available Forward genetic screens have identified numerous genes involved in development and metabolism, and remain a cornerstone of biological research. However to locate a causal mutation, the practice of crossing to a polymorphic background to generate a mapping population can be problematic if the mutant phenotype is difficult to recognise in the hybrid F2 progeny, or dependent on parental specific traits. Here in a screen for leaf hyponasty mutants, we have performed a single backcross of an Ethane Methyl Sulphonate (EMS generated hyponastic mutant to its parent. Whole genome deep sequencing of a bulked homozygous F2 population and analysis via the Next Generation EMS mutation mapping pipeline (NGM unambiguously determined the causal mutation to be a single nucleotide polymorphisim (SNP residing in HASTY, a previously characterised gene involved in microRNA biogenesis. We have evaluated the feasibility of this backcross approach using three additional SNP mapping pipelines; SHOREmap, the GATK pipeline, and the samtools pipeline. Although there was variance in the identification of EMS SNPs, all returned the same outcome in clearly identifying the causal mutation in HASTY. The simplicity of performing a single parental backcross and genome sequencing a small pool of segregating mutants has great promise for identifying mutations that may be difficult to map using conventional approaches.
Energy Technology Data Exchange (ETDEWEB)
Thacker, J
1986-05-01
DNA from 58 independent HPRT-deficient mutants of V79 hamster cells induced by ionizing radiation was analysed by Southern blot hybridization to a full-length hamster hprt cDNA. About half of the ..gamma..-ray-induced mutants (20/43) were apparently total gene deletions, because they lacked all functional hprt gene sequences hybridizing to the cDNA probe. Another 10 mutants showed various partial deletions and/or rearrangements of the hprt gene. The remaining 13 mutants showed no detectable change in comparison to the structure of the normal gene, which correlated well with previous characterization of these mutants indicating that most carry point mutations in the hprt gene. Thus, 70% or more of radiation-induced HPRT-deficient mutants arise through large genetic changes, especially deletions of all or part of the hprt gene. 16 references, 4 figures, 1 table.
Determining mutant spectra of three RNA viral samples using ultra-deep sequencing
Energy Technology Data Exchange (ETDEWEB)
Chen, H
2012-06-06
RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.
Mapping of a rice thermosensitive genic male sterility gene from a TGMS mutant line
Energy Technology Data Exchange (ETDEWEB)
Vu Duc Quang; Nguyen Van Dong; Pham Ngoc Luong; Tran Duy Quy [Argicultural Genetics Institute, Hanoi (Viet Nam); Nguyen, Henry T. [Texas Tech Univ., Department of Plant and Soil Science, Lubbock TX (United States)
2001-03-01
At the Agricultural Genetics Institute (AGI), Hanoi, Vietnam, a number of thermo-sensitive genic male sterility (TGMS) homozygous rice lines have been developed by means of experimental mutagenesis followed by anther culture techniques. One of them (TGMS-1 indica mutant line) was used in this research. The critical temperature (at the period from pollen mother cell formation to the beginning of meiotic division) for TGMS-1 sterility was 24-25degC, below which the plants were fertile and above which the plants became sterile. Segregation analysis showed that the TGMS trait of the TGMS-1 mutant line was controlled by a single recessive gene. An F{sub 2} mapping population from a cross between TGMS-1 mutant line and CH1 (a fertile indica line) was developed for tagging and mapping the TGMS gene. From survey of 200 AFLP primer combinations in a bulked segregant analysis, 4 AFLP markers (E2/M5-200, E3/M16-400, E5/M12-600 and E5/M12-200) linked to TGMS-1 gene were identified and cloned. All except E2/M5-200 were found to be low-copy number sequences. The marker E5/M12-600 showed polymorphism in RFLP analysis and was closely linked to the TGMS gene at a distance of 3.3cM. This marker was subsequently mapped on chromosome 2 using doubled-haploid mapping populations derived from the crosses IR64xAzucena and CT9993xIR62666. Linkage of microsatellite marker RM27 with the TGMS gene further confirmed its location on chromosome 2. The closest marker, E5/M12-600, was sequenced so that a PCR marker can be developed for the use in marker-assisted breeding. The application of TGMS genes to the commercial two-line hybrid rice breeding system was discussed. (author)
Mapping of a rice thermosensitive genic male sterility gene from a TGMS mutant line
International Nuclear Information System (INIS)
Vu Duc Quang; Nguyen Van Dong; Pham Ngoc Luong; Tran Duy Quy; Nguyen, Henry T.
2001-01-01
At the Agricultural Genetics Institute (AGI), Hanoi, Vietnam, a number of thermo-sensitive genic male sterility (TGMS) homozygous rice lines have been developed by means of experimental mutagenesis followed by anther culture techniques. One of them (TGMS-1 indica mutant line) was used in this research. The critical temperature (at the period from pollen mother cell formation to the beginning of meiotic division) for TGMS-1 sterility was 24-25degC, below which the plants were fertile and above which the plants became sterile. Segregation analysis showed that the TGMS trait of the TGMS-1 mutant line was controlled by a single recessive gene. An F 2 mapping population from a cross between TGMS-1 mutant line and CH1 (a fertile indica line) was developed for tagging and mapping the TGMS gene. From survey of 200 AFLP primer combinations in a bulked segregant analysis, 4 AFLP markers (E2/M5-200, E3/M16-400, E5/M12-600 and E5/M12-200) linked to TGMS-1 gene were identified and cloned. All except E2/M5-200 were found to be low-copy number sequences. The marker E5/M12-600 showed polymorphism in RFLP analysis and was closely linked to the TGMS gene at a distance of 3.3cM. This marker was subsequently mapped on chromosome 2 using doubled-haploid mapping populations derived from the crosses IR64xAzucena and CT9993xIR62666. Linkage of microsatellite marker RM27 with the TGMS gene further confirmed its location on chromosome 2. The closest marker, E5/M12-600, was sequenced so that a PCR marker can be developed for the use in marker-assisted breeding. The application of TGMS genes to the commercial two-line hybrid rice breeding system was discussed. (author)
Isolating human DNA repair genes using rodent-cell mutants
International Nuclear Information System (INIS)
Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.
1987-01-01
The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab
Li, Shu-Shun; Li, Qian-Zhong; Rong, Li-Ping; Tang, Ling; Zhang, Bo
2015-01-01
Acer palmatum Thunb., like other maples, is a widely ornamental-use small woody tree for leaf shapes and colors. Interestingly, we found a yellow-leaves mutant "Jingling Huangfeng" turned to green when grown in shade or low-density light condition. In order to study the potential mechanism, we performed high-throughput sequencing and obtained 1,082 DEGs in leaves grown in different light conditions that result in A. palmatum significant morphological and physiological changes. A total of 989 DEGs were annotated and clustered, of which many DEGs were found associating with the photosynthesis activity and pigment synthesis. The expression of CHS and FDR gene was higher while the expression of FLS gene was lower in full-sunlight condition; this may cause more colorful substance like chalcone and anthocyanin that were produced in full-light condition, thus turning the foliage to yellow. Moreover, this is the first available miRNA collection which contains 67 miRNAs of A. palmatum, including 46 conserved miRNAs and 21 novel miRNAs. To get better understanding of which pathways these miRNAs involved, 102 Unigenes were found to be potential targets of them. These results will provide valuable genetic resources for further study on the molecular mechanisms of Acer palmatum leaf coloration.
Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR
Energy Technology Data Exchange (ETDEWEB)
Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)
1994-09-01
Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David
2016-01-01
To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000
Ito, Hiroya; Takahashi, Sayaka; Asai, Tetsuo; Tamura, Yutaka; Yamamoto, Koshi
2018-01-01
An atypical urease-negative mutant of Actinobacillus pleuropneumoniae serovar 2 was isolated in Japan. Nucleotide sequence analysis of the urease gene cluster revealed that the insertion of a short DNA sequence into the cbiM gene was responsible for the urease-negative activity of the mutant. Veterinary diagnostic laboratories should be watchful for the presence of aberrant urease-negative A. pleuropneumoniae isolates.
Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.
Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad
2016-09-01
Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.
Genes and Alcohol Consumption: Studies with Mutant Mice
Mayfield, Jody; Arends, Michael A.; Harris, R. Adron; Blednov, Yuri A.
2017-01-01
In this chapter, we review the effects of global null mutant and overexpressing transgenic mouse lines on voluntary self-administration of alcohol. We examine approximately 200 publications pertaining to the effects of 155 mouse genes on alcohol consumption in different drinking models. The targeted genes vary in function and include neurotransmitter, ion channel, neuroimmune, and neuropeptide signaling systems. The alcohol self-administration models include operant conditioning, two- and four-bottle choice continuous and intermittent access, drinking in the dark limited access, chronic intermittent ethanol, and scheduled high alcohol consumption tests. Comparisons of different drinking models using the same mutant mice are potentially the most informative, and we will highlight those examples. More mutants have been tested for continuous two-bottle choice consumption than any other test; of the 137 mouse genes examined using this model, 97 (72%) altered drinking in at least one sex. Overall, the effects of genetic manipulations on alcohol drinking often depend on the sex of the mice, alcohol concentration and time of access, genetic background, as well as the drinking test. PMID:27055617
Deep Sequencing of Porphyromonas gingivalis and comparative transcriptome analysis of a LuxS mutant
Directory of Open Access Journals (Sweden)
Takanoi eHirano
2012-06-01
Full Text Available Porphyromonas gingivalis is a major etiological agent and chronic and aggressive forms of periodontal disease. The organism is an assacharolytic anaerobe and is a constituent of mixed species biofilms in a variety of microenvironments in the oral cavity. P. gingivalis expresses a range of virulence factors over which it exerts tight control. High-throughput sequencing technologies provide the opportunity to relate functional genomics to basic biology. In this study we report qualitative and quantitative RNA-Seq analysis of the transcriptome of P. gingivalis. We have also applied RNA-Seq to the transcriptome of a ΔluxS mutant of P. gingivalis deficient in AI-2-mediated bacterial communication. The transcriptome analysis confirmed the expression of all predicted ORFs for strain ATCC 33277, including 854 hypothetical proteins, and allowed the identification of hitherto unknown transcriptional units. Twelve noncoding RNAs were identified, including 11 small RNAs and one cobalamine riboswitch. Fifty seven genes were differentially regulated in the LuxS mutant. Addition of exogenous synthetic 4,5-dihydroxy-2,3-pentanedione (DPD, AI-2 precursor to the ΔluxS mutant culture complemented expression of a subset of genes, indicating that LuxS is involved in both AI-2 signaling and non-signaling dependent systems in P. gingivalis. This work provides an important dataset for future study of P. gingivalis pathophysiology and further defines the LuxS regulon in this oral pathogen.
Neurophysiological defects and neuronal gene deregulation in Drosophila mir-124 mutants.
Directory of Open Access Journals (Sweden)
Kailiang Sun
2012-02-01
Full Text Available miR-124 is conserved in sequence and neuronal expression across the animal kingdom and is predicted to have hundreds of mRNA targets. Diverse defects in neural development and function were reported from miR-124 antisense studies in vertebrates, but a nematode knockout of mir-124 surprisingly lacked detectable phenotypes. To provide genetic insight from Drosophila, we deleted its single mir-124 locus and found that it is dispensable for gross aspects of neural specification and differentiation. On the other hand, we detected a variety of mutant phenotypes that were rescuable by a mir-124 genomic transgene, including short lifespan, increased dendrite variation, impaired larval locomotion, and aberrant synaptic release at the NMJ. These phenotypes reflect extensive requirements of miR-124 even under optimal culture conditions. Comparison of the transcriptomes of cells from wild-type and mir-124 mutant animals, purified on the basis of mir-124 promoter activity, revealed broad upregulation of direct miR-124 targets. However, in contrast to the proposed mutual exclusion model for miR-124 function, its functional targets were relatively highly expressed in miR-124-expressing cells and were not enriched in genes annotated with epidermal expression. A notable aspect of the direct miR-124 network was coordinate targeting of five positive components in the retrograde BMP signaling pathway, whose activation in neurons increases synaptic release at the NMJ, similar to mir-124 mutants. Derepression of the direct miR-124 target network also had many secondary effects, including over-activity of other post-transcriptional repressors and a net incomplete transition from a neuroblast to a neuronal gene expression signature. Altogether, these studies demonstrate complex consequences of miR-124 loss on neural gene expression and neurophysiology.
Mutants of Agrobacterium tumefaciens with elevated vir gene expression
International Nuclear Information System (INIS)
Pazour, G.J.; Ta, C.N.; Das, A.
1991-01-01
Expression of Agrobacterium tumefaciens virulence (vir) genes requires virA, virG, and a plant-derived inducing compound such as acetosyringone. To identify the critical functional domains of virA and virG, a mutational approach was used. Agrobacterium A136 harboring plasmid pGP159, which contains virA, virG, and a reporter virB:lacZ gene fusion, was mutagenized with UV light or nitrosoguanidine. Survivors that formed blue colonies on a plate containing 5-bromo-4-chloro-3-indolyl beta-D-galactoside were isolated and analyzed. Quantification of beta-galactosidase activity in liquid assays identified nine mutant strains. By plasmid reconstruction and other procedures, all mutations mapped to the virA locus. These mutations caused an 11- to 560-fold increase in the vegetative level of virB:lacZ reporter gene expression. DNA sequence analysis showed that the mutations are located in four regions of VirA: transmembrane domain one, the active site, a glycine-rich region with homology to ATP-binding sites, and a region at the C terminus that has homology to the N terminus of VirG
Cloning a T-DNA-Linked Phosphate Gene that mediates Salt Tolerance on Mutant of Arabidopsis thaliana
International Nuclear Information System (INIS)
Njoroge, N.C; Tremblay, L.; Lefebvre, D.D.
2006-01-01
T-DNA insertionally mutagenized seeds of Arabidopsis thaliana were used to unravel genetic mechanisms underlying salt tolerance in plants. Over a period of two weeks, kanamycin homozygous (KK) seeds of the mutant NN143 attain germination levels of 65% and 77% on 175mM Nacl and 300mM mannitol respectively. Under these conditions of osmotic stress, the wild type seeds were incapable of germination. The mutant was also capable of germination on a medium containing 2μM abscisic acid (ABA). After two weeks on 2μM ABA, it attained 100% germination and the wild type did not germinate. The ABA level in the mutant was 40% higher than the wild type. Segregation analysis indicated that salt tolerance in the mutant is T-DNA linked. Genetic analysis of the F1 and F2 generations indicated that the salt tolerance trait in the mutant is dominant. The putative salt tolerance gene of mutant NN143 was cloned by plasmid rescue and sequence data indicated involvement of a protein phosphatase. The possible mechanism underlying salt tolerance in the mutant is discussed.(author)
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
A wheat cold resistance mutant derived from space mutagenesis
International Nuclear Information System (INIS)
Li Peng; Sun Mingzhu; Zhang Fengyun; Gao Guoqiang; Qiu Denglin; Li Xinhua
2012-01-01
A cold resistance mutant, obtained by spaceflight mutagenesis on the seeds of wheat variety Han6172, and the DNA of cold resistance mutant and contrast Han6172 were compared by SRAP technique. 380 pairs of primers were screened, 6 pairs of them had polymorphisms between mutant and contrast, the rate was 1.58%, and this data indicated that there are no obvious DNA differences between mutant and contrast Six specific fragments were obtained, 3 fragments of them were amplified in mutant. Homology analysis in GenBank showed that Me3-Em7-Mt, Me4-Em11-CK, Me7-Em19-CK and Me6-Em9-Mt all had homologous sequences with wheat chromosome 3B-specific BAC library, and this result indicated that the gene and regulator sequences associated with mutant cold resistance might locate on 3B chromosome. It was speculated that space mutation induced the mutation of 3B chromosome primary structure, and influenced the expressions of cold resistance genes, which resulted in the mutation of cold resistance ability. (authors)
A wheat cold resistance mutant derived from space mutagenesis
International Nuclear Information System (INIS)
Li Peng; Sun Mingzhu; Zhang Fengyun; Gao Guoqiang; Qiu Denglin; Li Xinhua
2011-01-01
A cold resistance mutant, obtained by spaceflight mutagenesis on the seeds of wheat variety Han6172, and the DNA of cold resistance mutant and contrast Han6172 were compared by SRAP technique. 380 pairs of primers were screened, 6 pairs of them had polymorphisms between mutant and contrast, the rate was 1.58%, and this data indicated that there are no obvious DNA differences between mutant and contrast. Six specific fragments were obtained, 3 fragments of them were amplified in mutant. Homology analysis in GenBank showed that Me3-Em7-Mt, Me4-Em11-CK, Me7-Em19-CK and Me6-Em9-Mt all had homologous sequences with wheat chromosome 3B-specific BAC library, and this result indicated that the gene and regulator sequences associated with mutant cold resistance might locate on 3B chromosome. It was speculated that space mutation induced the mutation of 3B chromosome primary structure, and influenced the expressions of cold resistance genes, which resulted in the mutation of cold resistance ability. (authors)
Directory of Open Access Journals (Sweden)
Chris Curtin
2016-04-01
Full Text Available While once de-rigueur for identification of genes involved in biological processes, screening of chemically induced mutant populations is an approach that has largely been superseded for model organisms such as Saccharomyces cerevisiae. Availability of single gene deletion/overexpression libraries and combinatorial synthetic genetic arrays provide yeast researchers more structured ways to probe genetic networks. Furthermore, in the age of inexpensive DNA sequencing, methodologies such as mapping of quantitative trait loci (QTL by pooled segregant analysis and genome-wide association enable the identification of multiple naturally occurring allelic variants that contribute to polygenic phenotypes of interest. This is, however, contingent on the capacity to screen large numbers of individuals and existence of sufficient natural phenotypic variation within the available population. The latter cannot be guaranteed and non-selectable, industrially relevant phenotypes, such as production of volatile aroma compounds, pose severe limitations on the use of modern genetic techniques due to expensive and time-consuming downstream analyses. An interesting approach to overcome these issues can be found in Den Abt et al.[1] (this issue of Microbial Cell, where a combination of repeated rounds of chemical mutagenesis and pooled segregant analysis by whole genome sequencing was applied to identify genes involved in ethyl acetate formation, demonstrating a new path for industrial yeast strain development and bringing classical mutant screens into the 21st century.
Targeted Disruption of V600E-Mutant BRAF Gene by CRISPR-Cpf1
Directory of Open Access Journals (Sweden)
Meijia Yang
2017-09-01
Full Text Available BRAF-V600E (1799T > A is one of the most frequently reported driver mutations in multiple types of cancers, and patients with such mutations could benefit from selectively inactivating the mutant allele. Near this mutation site, there are two TTTN and one NGG protospacer-adjacent motifs (PAMs for Cpf1 and Cas9 CRISPR nucleases, respectively. The 1799T > A substitution also leads to the occurrence of a novel NGNG PAM for the EQR variant of Cas9. We examined the editing efficacy and selectivity of Cpf1, Cas9, and EQR variant to this mutation site. Only Cpf1 demonstrated robust activity to induce specific disruption of only mutant BRAF, not wild-type sequence. Cas9 recognized and cut both normal and mutant alleles, and no obvious gene editing events were observed using EQR variant. Our results support the potential applicability of Cpf1 in precision medicine through highly specific inactivation of many other gain-of-function mutations. Keywords: Cpf1, targeted therapy, BRAF V600E
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.
Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio
2008-09-18
Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.
Botes, D P; Qobose, M D; Corfield, V A
1991-09-15
A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.
Laia, Marcelo L; Moreira, Leandro M; Dezajacomo, Juliana; Brigati, Joice B; Ferreira, Cristiano B; Ferro, Maria I T; Silva, Ana C R; Ferro, Jesus A; Oliveira, Julio C F
2009-01-16
Citrus canker is a disease caused by the phytopathogens Xanthomonas citri subsp. citri, Xanthomonas fuscans subsp. aurantifolli and Xanthomonas alfalfae subsp. citrumelonis. The first of the three species, which causes citrus bacterial canker type A, is the most widely spread and severe, attacking all citrus species. In Brazil, this species is the most important, being found in practically all areas where citrus canker has been detected. Like most phytobacterioses, there is no efficient way to control citrus canker. Considering the importance of the disease worldwide, investigation is needed to accurately detect which genes are related to the pathogen-host adaptation process and which are associated with pathogenesis. Through transposon insertion mutagenesis, 10,000 mutants of Xanthomonas citri subsp. citri strain 306 (Xcc) were obtained, and 3,300 were inoculated in Rangpur lime (Citrus limonia) leaves. Their ability to cause citrus canker was analyzed every 3 days until 21 days after inoculation; a set of 44 mutants showed altered virulence, with 8 presenting a complete loss of causing citrus canker symptoms. Sequencing of the insertion site in all 44 mutants revealed that 35 different ORFs were hit, since some ORFs were hit in more than one mutant, with mutants for the same ORF presenting the same phenotype. An analysis of these ORFs showed that some encoded genes were previously known as related to pathogenicity in phytobacteria and, more interestingly, revealed new genes never implicated with Xanthomonas pathogenicity before, including hypothetical ORFs. Among the 8 mutants with no canker symptoms are the hrpB4 and hrpX genes, two genes that belong to type III secretion system (TTSS), two hypothetical ORFS and, surprisingly, the htrA gene, a gene reported as involved with the virulence process in animal-pathogenic bacteria but not described as involved in phytobacteria virulence. Nucleic acid hybridization using labeled cDNA probes showed that some of the
Directory of Open Access Journals (Sweden)
Gustavo Bravo-Ruiz
2017-09-01
Full Text Available Penicillium occitanis is a model system for enzymatic regulation. A mutant strain exhibiting constitutive overproduction of different pectinolytic enzymes both under inducing (pectin or repressing conditions (glucose was previously isolated after chemical mutagenesis. In order to identify the molecular basis of this regulatory mechanism, the genomes of the wild type and the derived mutant strain were sequenced and compared, providing the first reference genome for this species. We used a phylogenomic approach to compare P. occitanis with other pectinolytic fungi and to trace expansions of gene families involved in carbohydrate degradation. Genome comparison between wild type and mutant identified seven mutations associated with predicted proteins. The most likely candidate was a mutation in a highly conserved serine residue of a conserved fungal protein containing a GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain and a fungus-specific transcription factor regulatory middle homology region. To functionally characterize the role of this candidate gene, the mutation was recapitulated in the predicted orthologue Fusarium oxysporum, a vascular wilt pathogen which secretes a wide array of plant cell wall degrading enzymes, including polygalacturonases, pectate lyases, xylanases and proteases, all of which contribute to infection. However, neither the null mutant nor a mutant carrying the analogous point mutation exhibited a deregulation of pectinolytic enzymes. The availability, annotation and phylogenomic analysis of the P. occitanis genome sequence represents an important resource for understanding the evolution and biology of this species, and sets the basis for the discovery of new genes of biotechnological interest for the degradation of complex polysaccharides.
Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A
1995-01-01
Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694
Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A
1995-04-01
Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.
International Nuclear Information System (INIS)
Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai; Hu, Ji-Wei; Ouyang, Pin
2014-01-01
Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB +/− mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species. The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity
Energy Technology Data Exchange (ETDEWEB)
Wu, Hsu-Pin; Hsu, Shu-Yuan [Department of Anatomy, Chang Gung University Medical College, Taiwan (China); Wu, Wen-Ai; Hu, Ji-Wei [Transgenic Mouse Core Laboratory, Chang Gung University, Taiwan (China); Ouyang, Pin, E-mail: ouyang@mail.cgu.edu.tw [Department of Anatomy, Chang Gung University Medical College, Taiwan (China); Transgenic Mouse Core Laboratory, Chang Gung University, Taiwan (China); Molecular Medicine Research Center, Chang Gung University, Taiwan (China)
2014-01-03
Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species. The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.
Directory of Open Access Journals (Sweden)
Wanlada Klangnurak
Full Text Available We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm, were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.
Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.
Directory of Open Access Journals (Sweden)
Elizabeth A. Robb
Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.
cis sequence effects on gene expression
Directory of Open Access Journals (Sweden)
Jacobs Kevin
2007-08-01
Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.
Milla, M. E.; Brown, B. M.; Sauer, R. T.
1993-01-01
Many mutant variants of the P22 Arc repressor are subject to intracellular proteolysis in Escherichia coli, which precludes their expression at levels sufficient for purification and subsequent biochemical characterization. Here we examine the effects of several different C-terminal extension sequences on the expression and activity of a set of Arc mutants. We show that two tail sequences, KNQHE (st5) and H6KNQHE (st11), increase the expression levels of most mutants from 10- to 20-fold and, ...
Su, Shih-Heng; Krysan, Patrick J
2016-12-01
Mitogen-activated protein kinase cascades are conserved in all eukaryotes. In Arabidopsis thaliana there are approximately 80 genes encoding MAP kinase kinase kinases (MAP3K), 10 genes encoding MAP kinase kinases (MAP2K), and 20 genes encoding MAP kinases (MAPK). Reverse genetic analysis has failed to reveal abnormal phenotypes for a majority of these genes. One strategy for uncovering gene function when single-mutant lines do not produce an informative phenotype is to perform a systematic genetic interaction screen whereby double-mutants are created from a large library of single-mutant lines. Here we describe a new collection of 275 double-mutant lines derived from a library of single-mutants targeting genes related to MAP kinase signaling. To facilitate this study, we developed a high-throughput double-mutant generating pipeline using a system for growing Arabidopsis seedlings in 96-well plates. A quantitative root growth assay was used to screen for evidence of genetic interactions in this double-mutant collection. Our screen revealed four genetic interactions, all of which caused synthetic enhancement of the root growth defects observed in a MAP kinase 4 (MPK4) single-mutant line. Seeds for this double-mutant collection are publicly available through the Arabidopsis Biological Resource Center. Scientists interested in diverse biological processes can now screen this double-mutant collection under a wide range of growth conditions in order to search for additional genetic interactions that may provide new insights into MAP kinase signaling. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Molecular Diagnostics of Gliomas Using Next Generation Sequencing of a Glioma-Tailored Gene Panel.
Zacher, Angela; Kaulich, Kerstin; Stepanow, Stefanie; Wolter, Marietta; Köhrer, Karl; Felsberg, Jörg; Malzkorn, Bastian; Reifenberger, Guido
2017-03-01
Current classification of gliomas is based on histological criteria according to the World Health Organization (WHO) classification of tumors of the central nervous system. Over the past years, characteristic genetic profiles have been identified in various glioma types. These can refine tumor diagnostics and provide important prognostic and predictive information. We report on the establishment and validation of gene panel next generation sequencing (NGS) for the molecular diagnostics of gliomas. We designed a glioma-tailored gene panel covering 660 amplicons derived from 20 genes frequently aberrant in different glioma types. Sensitivity and specificity of glioma gene panel NGS for detection of DNA sequence variants and copy number changes were validated by single gene analyses. NGS-based mutation detection was optimized for application on formalin-fixed paraffin-embedded tissue specimens including small stereotactic biopsy samples. NGS data obtained in a retrospective analysis of 121 gliomas allowed for their molecular classification into distinct biological groups, including (i) isocitrate dehydrogenase gene (IDH) 1 or 2 mutant astrocytic gliomas with frequent α-thalassemia/mental retardation syndrome X-linked (ATRX) and tumor protein p53 (TP53) gene mutations, (ii) IDH mutant oligodendroglial tumors with 1p/19q codeletion, telomerase reverse transcriptase (TERT) promoter mutation and frequent Drosophila homolog of capicua (CIC) gene mutation, as well as (iii) IDH wildtype glioblastomas with frequent TERT promoter mutation, phosphatase and tensin homolog (PTEN) mutation and/or epidermal growth factor receptor (EGFR) amplification. Oligoastrocytic gliomas were genetically assigned to either of these groups. Our findings implicate gene panel NGS as a promising diagnostic technique that may facilitate integrated histological and molecular glioma classification. © 2016 International Society of Neuropathology.
International Nuclear Information System (INIS)
Black, C.G.; Fyfe, J.A.M.; Davies, J.K.
1997-01-01
A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)
Human liver cell trafficking mutants: characterization and whole exome sequencing.
Directory of Open Access Journals (Sweden)
Fei Yuan
Full Text Available The HuH7 liver cell mutant Trf1 is defective in membrane trafficking and is complemented by the casein kinase 2α subunit CK2α''. Here we identify characteristic morphologies, trafficking and mutational changes in six additional HuH7 mutants Trf2-Trf7. Trf1 cells were previously shown to be severely defective in gap junction functions. Using a Lucifer yellow transfer assay, remarkable attenuation of gap junction communication was revealed in each of the mutants Trf2-Trf7. Electron microscopy and light microscopy of thiamine pyrophosphatase showed that several mutants exhibited fragmented Golgi apparatus cisternae compared to parental HuH7 cells. Intracellular trafficking was investigated using assays of transferrin endocytosis and recycling and VSV G secretion. Surface binding of transferrin was reduced in all six Trf2-Trf7 mutants, which generally correlated with the degree of reduced expression of the transferrin receptor at the cell surface. The mutants displayed the same transferrin influx rates as HuH7, and for efflux rate, only Trf6 differed, having a slower transferrin efflux rate than HuH7. The kinetics of VSV G transport along the exocytic pathway were altered in Trf2 and Trf5 mutants. Genetic changes unique to particular Trf mutants were identified by exome sequencing, and one was investigated in depth. The novel mutation Ile34Phe in the GTPase RAB22A was identified in Trf4. RNA interference knockdown of RAB22A or overexpression of RAB22AI34F in HuH7 cells caused phenotypic changes characteristic of the Trf4 mutant. In addition, the Ile34Phe mutation reduced both guanine nucleotide binding and hydrolysis activities of RAB22A. Thus, the RAB22A Ile34Phe mutation appears to contribute to the Trf4 mutant phenotype.
Characterizing visible and invisible cell wall mutant phenotypes
Energy Technology Data Exchange (ETDEWEB)
Carpita, Nicholas C.; McCann, Maureen C.
2015-04-06
About 10% of a plant's genome is devoted to generating the protein machinery to synthesize, remodel, and deconstruct the cell wall. High-throughput genome sequencing technologies have enabled a reasonably complete inventory of wall-related genes that can be assembled into families of common evolutionary origin. Assigning function to each gene family member has been aided immensely by identification of mutants with visible phenotypes or by chemical and spectroscopic analysis of mutants with ‘invisible’ phenotypes of modified cell wall composition and architecture that do not otherwise affect plant growth or development. This review connects the inference of gene function on the basis of deviation from the wild type in genetic functional analyses to insights provided by modern analytical techniques that have brought us ever closer to elucidating the sequence structures of the major polysaccharide components of the plant cell wall.
International Nuclear Information System (INIS)
Phillips, G.J.
1987-01-01
The nucleotide sequence for the structural gene for exonuclease I (sbcB) from Escherichia coli was determined. Two putative promotes for this gene were identified and were predicted to have weak transcription initiation activity. In addition, the sbcB coding region contains many non-optimal codons. These observations are consistent with the suggestions that sbcB is a poorly expressed gene. Several mutant exonuclease I genes were cloned onto pBR322 plasmids. These genes represented both sbcB and xonA mutation. One of the xonA mutation (xonA6) was associated with a 1.2-kb insertion of an IS-30 related mobile genetic element in the 3'-region of the gene. Two of the mutations (xonA2 and xonA6) encode unstable polypeptides. Determination of exonucleolytic activity on single-stranded DNA from cell extracts containing each of the cloned mutant genes revealed no correlation between residual exonucleolytic activity and the pheno-types of sbcB and xonA mutants. A proposal that the exonuclease I protein contains an additional activity besides its ability to degrade single-stranded DNA is presented. Characterization of E. coli strains which overproduce exonuclease I showed increased sensitivity to UV irradiation
Transgenic mice display hair loss and regrowth overexpressing mutant Hr gene.
Zhu, Kuicheng; Xu, Cunshuan; Zhang, Jintao; Chen, Yingying; Liu, Mengduan
2017-10-30
Mutations in the hairless (Hr) gene in both mice and humans have been implicated in the development of congenital atrichia, but the role of Hr in skin and hair follicle (HF) biology remains unknown. Here, we established transgenic mice (TG) overexpressing mutant Hr to investigate its specific role in the development of HF. Three transgenic lines were successfully constructed, and two of them (TG3 and TG8) displayed a pattern of hair loss and regrowth with alternation in the expression of HR protein. The mutant Hr gene inhibited the expression of the endogenous gene in transgenic individuals, which led to the development of alopecia. Interestingly, the hair regrew with the increase in the endogenous expression levels resulting from decreased mutant Hr expression. The findings of our study indicate that the changes in the expression of Hr result in hair loss or regrowth.
Energy Technology Data Exchange (ETDEWEB)
Romac, S; Leong, P; Sockett, H; Hutchinson, F [Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry
1989-09-20
The DNA base sequence changes induced by mutagenesis with ultraviolet light have been determined in a gene on a chromosome of cultured Chinese hamster ovary (CHO) cells. The gene was the Excherichia coli gpt gene, of which a single copy was stably incorporated and expressed in the CHO cell genome. The cells were irradiated with ultraviolet light and gpt{sup -} colonies were selected by resistance to 6-thioguanine. The gpt gene was amplified from chromosomal DNA by use of the polymerase chain reaction (PCR) and the amplified DNA sequenced directly by the dideoxy method. Of the 58 sequenced mutants of independent origin 53 were base change mutations. Forty-one base substitutions were single base changes, ten had two adjacent (or tandem) base changes, and one had two base changes separated by a single base-pair. Only one mutant had a multiple base change mutation with two or more well separated base changes. In contrast much higher levels of such mutations were reported in ultraviolet mutagenesis of genes on a shuttle vector in primate cells. Two deletions of a single base-pair were observed and three deletions ranging from 6 to 37 base-pairs. The mutation spectrum in the gpt gene had similarities to the ultraviolet mutation spectra for several genes in prokaryotes, which suggests similarities in mutational mechanisms in prokaryotes and eukaryotes. (author).
Genetic Analysis and Molecular Mapping of a Novel Chlorophyll-Deficit Mutant Gene in Rice
Directory of Open Access Journals (Sweden)
Xiao-qun HUANG
2008-03-01
Full Text Available A rice etiolation mutant 824ys featured with chlorophyll deficiency was identified from a normal green rice variety 824B. It showed whole green-yellow plant from the seedling stage, reduced number of tillers and longer growth duration. The contents of chlorophyll, chlorophyll a, chlorophyll b and net photosynthetic rate in leaves of the mutant obviously decreased, as well as the number of spikelets per panicle, seed setting rate and 1000-grain weight compared with its wild-type parent. Genetic analyses on F1 and F2 generations of 824ys crossed with three normal green varieties showed that the chlorophyll-deficit mutant character was controlled by a pair of recessive nuclear gene. Genetic mapping of the mutant gene was conducted by using microsatellite markers and F2 mapping population of 495R/824ys, and the mutant gene of 824ys was mapped on the short arm of rice chromosome 3. The genetic distances from the target gene to the markers RM218, RM282 and RM6959 were 25.6 cM, 5.2 cM and 21.8 cM, respectively. It was considered to be a new chlorophyll-deficit mutant gene and tentatively named as chl11(t.
BRED: a simple and powerful tool for constructing mutant and recombinant bacteriophage genomes.
Directory of Open Access Journals (Sweden)
Laura J Marinelli
Full Text Available Advances in DNA sequencing technology have facilitated the determination of hundreds of complete genome sequences both for bacteria and their bacteriophages. Some of these bacteria have well-developed and facile genetic systems for constructing mutants to determine gene function, and recombineering is a particularly effective tool. However, generally applicable methods for constructing defined mutants of bacteriophages are poorly developed, in part because of the inability to use selectable markers such as drug resistance genes during viral lytic growth. Here we describe a method for simple and effective directed mutagenesis of bacteriophage genomes using Bacteriophage Recombineering of Electroporated DNA (BRED, in which a highly efficient recombineering system is utilized directly on electroporated phage DNA; no selection is required and mutants can be readily detected by PCR. We describe the use of BRED to construct unmarked gene deletions, in-frame internal deletions, base substitutions, precise gene replacements, and the addition of gene tags.
Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali
2010-07-01
Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.
Directed mutagenesis in Candida albicans: one-step gene disruption to isolate ura3 mutants
International Nuclear Information System (INIS)
Kelly, R.; Miller, S.M.; Kurtz, M.B.; Kirsch, D.R.
1987-01-01
A method for introducing specific mutations into the diploid Candida albicans by one-step gene disruption and subsequent UV-induced recombination was developed. The cloned C. albicans URA3 gene was disrupted with the C. albicans ADE2 gene, and the linearized DNA was used for transformation of two ade2 mutants, SGY-129 and A81-Pu. Both an insertional inactivation of the URA3 gene and a disruption which results in a 4.0-kilobase deletion were made. Southern hybridization analyses demonstrated that the URA3 gene was disrupted on one of the chromosomal homologs in 15 of the 18 transformants analyzed. These analyses also revealed restriction site dimorphism of EcoRI at the URA3 locus which provides a unique marker to distinguish between chromosomal homologs. This enabled us to show that either homolog could be disrupted and that disrupted transformants of SGY-129 contained more than two copies of the URA3 locus. The A81-Pu transformants heterozygous for the ura3 mutations were rendered homozygous and Ura- by UV-induced recombination. The homozygosity of a deletion mutant and an insertion mutant was confirmed by Southern hybridization. Both mutants were transformed to Ura+ with plasmids containing the URA3 gene and in addition, were resistant to 5-fluoro-orotic acid, a characteristic of Saccharomyces cerevisiae ura3 mutants as well as of orotidine-5'-phosphate decarboxylase mutants of other organisms
Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming
2012-05-01
Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Filges, Isabel; Friedman, Jan M
2015-10-01
Massively parallel sequencing has revolutionized our understanding of Mendelian disorders, and many novel genes have been discovered to cause disease phenotypes when mutant. At the same time, next-generation sequencing approaches have enabled non-invasive prenatal testing of free fetal DNA in maternal blood. However, little attention has been paid to using whole exome and genome sequencing strategies for gene identification in fetal disorders that are lethal in utero, because they can appear to be sporadic and Mendelian inheritance may be missed. We present challenges and advantages of applying next-generation sequencing approaches to gene discovery in fetal malformation phenotypes and review recent successful discovery approaches. We discuss the implication and significance of recessive inheritance and cross-species phenotyping in fetal lethal conditions. Whole exome sequencing can be used in individual families with undiagnosed lethal congenital anomaly syndromes to discover causal mutations, provided that prior to data analysis, the fetal phenotype can be correlated to a particular developmental pathway in embryogenesis. Cross-species phenotyping allows providing further evidence for causality of discovered variants in genes involved in those extremely rare phenotypes and will increase our knowledge about normal and abnormal human developmental processes. Ultimately, families will benefit from the option of early prenatal diagnosis. © 2014 John Wiley & Sons, Ltd.
Michiels, J; Van Soom, T; D'hooghe, I; Dombrecht, B; Benhassine, T; de Wilde, P; Vanderleyden, J
1998-04-01
The rpoN region of Rhizobium etli was isolated by using the Bradyrhizobium japonicum rpoN1 gene as a probe. Nucleotide sequence analysis of a 5,600-bp DNA fragment of this region revealed the presence of four complete open reading frames (ORFs), ORF258, rpoN, ORF191, and ptsN, coding for proteins of 258, 520, 191, and 154 amino acids, respectively. The gene product of ORF258 is homologous to members of the ATP-binding cassette-type permeases. ORF191 and ptsN are homologous to conserved ORFs found downstream from rpoN genes in other bacterial species. Unlike in most other microorganisms, rpoN and ORF191 are separated by approximately 1.6 kb. The R. etli rpoN gene was shown to control in free-living conditions the production of melanin, the activation of nifH, and the metabolism of C4-dicarboxylic acids and several nitrogen sources (ammonium, nitrate, alanine, and serine). Expression of the rpoN gene was negatively autoregulated and occurred independently of the nitrogen source. Inactivation of the ptsN gene resulted in a decrease of melanin synthesis and nifH expression. In a search for additional genes controlling the synthesis of melanin, an R. etli mutant carrying a Tn5 insertion in ptsA, a gene homologous to the Escherichia coli gene coding for enzyme I of the phosphoenolpyruvate:sugar phosphotransferase system, was obtained. The R. etli ptsA mutant also displayed reduced expression of nifH. The ptsN and ptsA mutants also displayed increased sensitivity to the toxic effects of malate and succinate. Growth of both mutants was inhibited by these C4-dicarboxylates at 20 mM at pH 7.0, while wild-type cells grow normally under these conditions. The effect of malate occurred independently of the nitrogen source used. Growth inhibition was decreased by lowering the pH of the growth medium. These results suggest that ptsN and ptsA are part of the same regulatory cascade, the inactivation of which renders the cells sensitive to toxic effects of elevated concentrations of
International Nuclear Information System (INIS)
Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha
2012-01-01
KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.
A new type of gene-disruption cassette with a rescue gene for Pichia pastoris.
Shibui, Tatsuro; Hara, Hiroyoshi
2017-09-01
Pichia pastoris has been used for the production of many recombinant proteins, and many useful mutant strains have been created. However, the efficiency of mutant isolation by gene-targeting is usually low and the procedure is difficult for those inexperienced in yeast genetics. In order to overcome these issues, we developed a new gene-disruption system with a rescue gene using an inducible Cre/mutant-loxP system. With only short homology regions, the gene-disruption cassette of the system replaces its target-gene locus containing a mutation with a compensatory rescue gene. As the cassette contains the AOX1 promoter-driven Cre gene, when targeted strains are grown on media containing methanol, the DNA fragment, i.e., the marker, rescue and Cre genes, between the mutant-loxP sequences in the cassette is excised, leaving only the remaining mutant-loxP sequence in the genome, and consequently a target gene-disrupted mutant can be isolated. The system was initially validated on ADE2 gene disruption, where the disruption can easily be detected by color-change of the colonies. Then, the system was applied for knocking-out URA3 and OCH1 genes, reported to be difficult to accomplish by conventional gene-targeting methods. All three gene-disruption cassettes with their rescue genes replaced their target genes, and the Cre/mutant-loxP system worked well to successfully isolate their knock-out mutants. This study identified a new gene-disruption system that could be used to effectively and strategically knock out genes of interest, especially whose deletion is detrimental to growth, without using special strains, e.g., deficient in nonhomologous end-joining, in P. pastoris. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1201-1208, 2017. © 2017 American Institute of Chemical Engineers.
Shen, W C; Wieser, J; Adams, T H; Ebbole, D J
1998-01-01
The Aspergillus nidulans flbD gene encodes a protein with a Myb-like DNA-binding domain that is proposed to act in concert with other developmental regulators to control initiation of conidiophore development. We have identified a Neurospora crassa gene called rca-1 (regulator of conidiation in Aspergillus) based on its sequence similarity to flbD. We found that N. crassa rca-1 can complement the conidiation defect of an A. nidulans flbD mutant and that induced expression of rca-1 caused coni...
International Nuclear Information System (INIS)
Liu, Y.; Savinov, A.Yu.; McMinimy, D.L.; Kremlev, S.G.; Chapoval, A.I.; Egorov, I.K.
2000-01-01
The Aβ6 w302 gene and molecular mechanisms of resistance to the spread of lymphoma induced by γ-radiation ( 60 Co) in a mouse mutant, survivor-27 were studied. Metastatic tumors escape from immune response and spread in the body; survivors are very rare. Novel single exon genes Aβ4-7 and a pseudogene Aβ8Ψ have been cloned from survivors. Their protein coding sequences are similar major histocompatibility complex (MHC) class II β H2-Ab cDNA while their promoter is different from MHC promoters. The Aβ4 protein was demonstrated on macrophages (antigen presenting cells). The Aβ gene family is genetically unstable in germ line and somatic cells of survivors. Mutants S-27 and S-87/1 lost the Aβ5 s5 and acquired the Aβ6 w302 gene; the Ab gene mutated in S-27. The proposed mechanism of resistance is molecular instability of the Aβ gene family resulting in somatic mutations and wandering immune responses that destroy the tumor in the survivor [ru
DEFF Research Database (Denmark)
Brown, S; Brickman, E R; Beckwith, J
1981-01-01
We describe a technique which permits an easy screening for amber mutants defective in essential genes of Escherichia coli. Using this approach, we have isolated three amber mutants defective in the rho gene. An extension of the technique allows the detection of ochre mutants and transposon inser...
Genetic analysis and molecular detection of the corn endosperm mutants induced by space flight
International Nuclear Information System (INIS)
Zhang Caibo; Zhou Yuanyuan; Wang Hanyu; Wang Hongwei; Wang Shengqing; Rong Tingzhao; Cao Moju
2013-01-01
In this study, two maize inbred lines 08-641 and 18-599 were carried into cosmic space by recoverable satellite 'Shijian 8', grain shrunken transparently and opaquely mutants were selected as experimental materials and their soluble sugar content in kernel were measured by annthrone colorimetry. The content of soluble sugar in mutant st1 kernels began to rise in 10 days after pollination, to reach the peak in 25 days and significantly higher than the contrast 08-641, while in mutant sol kernels it began to rise in 10 days after pollination, to reach the peak in 20 days and significantly higher than the contrast 18-599. The results of genetic analysis and allelism test showed that the trait in both mutants was all controlled by a single recessive gene, the mutant st1 was allelic to the su1 and the mutant sol was allelic to the sh2. DNA sequence alignment found 2 single-base mutations in 2 and 13 exon of su1 gene in the mutant st1 and 3 single-base mutations in 2, 5 and 16 exon of sh2 gene in mutant so1 leading to the change in amino acid sequences. So it is inferred that starch biosynthesis in the mutants may be blocked by these mutations, which lead to the increase of soluble sugar content in kernel. (authors)
2012-01-01
Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201
Directory of Open Access Journals (Sweden)
Chen Bo-Ruei
2012-05-01
Full Text Available Abstract Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning
Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines
Directory of Open Access Journals (Sweden)
Charles Addo-Quaye
2017-02-01
Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.
Inheritance and gene expression of a root-growth inhibiting mutant in rice (Oryza sativa L.)
International Nuclear Information System (INIS)
Kitano, H.; Futsuhara, Y.
1990-01-01
Full text: A root-growth inhibiting mutant was induced in the dwarf mutant line, 'Fukei 71', through ethylene-imine. The mutant is characterised by the excessive inhibition of both seminal and crown roots elongation just after germination, although its shoots grow nearly normal. To study the genetics, the mutant was crossed with its original line 'Fukei 71' and some other normal cultivars. Results show that the root-growth inhibition is controlled by a recessive gene (rt), independent of the dwarf gene, d-50(t) locus in Fukei 71. For elucidating the gene action on root morphogenesis, histological and cytological experiments were carried out using a longitudinal and transverse thin section of seminal and/or crown root tips. Observations suggest that the rt gene affects the normal formation of the epidermal system which is differentiated from the protoderm of the root apical meristem. (author)
Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K
2012-08-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.
Wang, Bin; Lv, Yangyong; Li, Xuejie; Lin, Yiying; Deng, Hai; Pan, Li
The global regulator LaeA controls the production of many fungal secondary metabolites, possibly via chromatin remodeling. Here we aimed to survey the secondary metabolite profile regulated by LaeA in Aspergillus niger FGSC A1279 by genome sequencing and comparative transcriptomics between the laeA deletion (ΔlaeA) and overexpressing (OE-laeA) mutants. Genome sequencing revealed four putative polyketide synthase genes specific to FGSC A1279, suggesting that the corresponding polyketide compounds might be unique to FGSC A1279. RNA-seq data revealed 281 putative secondary metabolite genes upregulated in the OE-laeA mutants, including 22 secondary metabolite backbone genes. LC-MS chemical profiling illustrated that many secondary metabolites were produced in OE-laeA mutants compared to wild type and ΔlaeA mutants, providing potential resources for drug discovery. KEGG analysis annotated 16 secondary metabolite clusters putatively linked to metabolic pathways. Furthermore, 34 of 61 Zn 2 Cys 6 transcription factors located in secondary metabolite clusters were differentially expressed between ΔlaeA and OE-laeA mutants. Three secondary metabolite clusters (cluster 18, 30 and 33) containing Zn 2 Cys 6 transcription factors that were upregulated in OE-laeA mutants were putatively linked to KEGG pathways, suggesting that Zn 2 Cys 6 transcription factors might play an important role in synthesizing secondary metabolites regulated by LaeA. Taken together, LaeA dramatically influences the secondary metabolite profile in FGSC A1279. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.
Baba, Tomoya; Ara, Takeshi; Hasegawa, Miki; Takai, Yuki; Okumura, Yoshiko; Baba, Miki; Datsenko, Kirill A; Tomita, Masaru; Wanner, Barry L; Mori, Hirotada
2006-01-01
We have systematically made a set of precisely defined, single-gene deletions of all nonessential genes in Escherichia coli K-12. Open-reading frame coding regions were replaced with a kanamycin cassette flanked by FLP recognition target sites by using a one-step method for inactivation of chromosomal genes and primers designed to create in-frame deletions upon excision of the resistance cassette. Of 4288 genes targeted, mutants were obtained for 3985. To alleviate problems encountered in high-throughput studies, two independent mutants were saved for every deleted gene. These mutants-the 'Keio collection'-provide a new resource not only for systematic analyses of unknown gene functions and gene regulatory networks but also for genome-wide testing of mutational effects in a common strain background, E. coli K-12 BW25113. We were unable to disrupt 303 genes, including 37 of unknown function, which are candidates for essential genes. Distribution is being handled via GenoBase (http://ecoli.aist-nara.ac.jp/).
Arjunan, P; El-Awady, A; Dannebaum, R O; Kunde-Ramamoorthy, G; Cutler, C W
2016-02-01
The human microbiome consists of highly diverse microbial communities that colonize our skin and mucosal surfaces, aiding in maintenance of immune homeostasis. The keystone pathogen Porphyromonas gingivalis induces a dysbiosis and disrupts immune homeostasis through as yet unclear mechanisms. The fimbrial adhesins of P. gingivalis facilitate biofilm formation, invasion of and dissemination by blood dendritic cells; hence, fimbriae may be key factors in disruption of immune homeostasis. In this study we employed RNA-sequencing transcriptome profiling to identify differentially expressed genes (DEGs) in human monocyte-derived dendritic cells (MoDCs) in response to in vitro infection/exposure by Pg381 or its isogenic mutant strains that solely express minor-Mfa1 fimbriae (DPG3), major-FimA fimbriae (MFI) or are deficient in both fimbriae (MFB) relative to uninfected control. Our results yielded a total of 479 DEGs that were at least two-fold upregulated and downregulated in MoDCs significantly (P ≤ 0.05) by all four strains and certain DEGs that were strain-specific. Interestingly, the gene ontology biological and functional analysis shows that the upregulated genes in DPG3-induced MoDCs were more significant than other strains and associated with inflammation, immune response, anti-apoptosis, cell proliferation, and other homeostatic functions. Both transcriptome and quantitative polymerase chain reaction results show that DPG3, which solely expresses Mfa1, increased ZNF366, CD209, LOX1, IDO1, IL-10, CCL2, SOCS3, STAT3 and FOXO1 gene expression. In conclusion, we have identified key DC-mediated immune homeostatic pathways that could contribute to dysbiosis in periodontal infection with P. gingivalis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Benomyl-resistant mutant strain of Trichoderma sp. with increased mycoparasitic activity.
Olejníková, P; Ondrusová, Z; Krystofová, S; Hudecová, D
2010-01-01
Application of UV radiation to the strain Trichoderma sp. T-bt (isolated from lignite) resulted in the T-brm mutant which was resistant to the systemic fungicide benomyl. The tub2 gene sequence in the T-brm mutant differed from the parent as well as the collection strain (replacing tyrosine with histidine in the TUB2 protein). Under in vitro conditions this mutant exhibited a higher mycoparasitic activity toward phytopathogenic fungi.
Institute of Scientific and Technical Information of China (English)
郭涛; 韩诗曼; 夏斌; 王慧; 刘永柱; 张建国; 陈志强
2011-01-01
根据粳型水稻Wx基因全序列设计引物,扩增2个空间诱变低直链淀粉突变体XLA-1和XLA-2的Wx等位基因.序列分析结果表明:XLA-1、XLA-2与原种籼小占在Wx基因DNA序列上存在较多碱基差异,这种差异以碱基改变为主;XLA-1、XLA-2在第10外显子(+1 208 bp)处存在一个单核苷酸突变(籼小占为碱基T,突变体为碱基C),编码子由TCT突变为CCT,导致丝氨酸突变成脯氨酸,氨基酸的改变可能改变了Wx蛋白的空间结构,致使它不能充分结合在淀粉颗粒上,进而导致直链淀粉含量下降.本研究初步证明在2个籼稻突变体中存在Wx的复等位基因影响直链淀粉含量.%Based on the Wx gene sequence of japonica rice, the Wx gene sequences of the two low-amy-lose mutants XLA-1 and XLA-2 of Oryza indica were detected by PCR and sequencing analysis. The main results showed that: There were many mutant sites among XLA-1, XLA- 2 and Xianxiaozhan (the wild type) , most of them were base change. There was a sigle nucleotide polymorphisms(SNP) in the 10th exon( +1 208 bp) of XLA-1 and XLA-2(Xianxiaozhan for the T, mutant for the C), codon TCT changed into CCT, which resulted in the substitution of a proline residue for serine. The substitution could alter the spatial structure of Wx protein, which may not be fully integrated on the starch granules, leading to the decreased of amylose content. The preliminary results indicated that the existence of Wx allelles affected amylose content in the two mutants.
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G
2016-04-05
Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.
Arabidopsis mutant sk156 reveals complex regulation of SPL15 in a miR156-controlled gene network.
Wei, Shu; Gruber, Margaret Y; Yu, Bianyun; Gao, Ming-Jun; Khachatourians, George G; Hegedus, Dwayne D; Parkin, Isobel A P; Hannoufa, Abdelali
2012-09-18
The Arabidopsis microRNA156 (miR156) regulates 11 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) family by base pairing to complementary target mRNAs. Each SPL gene further regulates a set of other genes; thus, miR156 controls numerous genes through a complex gene regulation network. Increased axillary branching occurs in transgenic Arabidopsis overexpressing miR156b, similar to that observed in loss-of-function max3 and max4 mutants with lesions in carotenoid cleavage dioxygenases. Arabidopsis miR156b was found to enhance carotenoid levels and reproductive shoot branching when expressed in Brassica napus, suggesting a link between miR156b expression and carotenoid metabolism. However, details of the miR156 regulatory network of SPL genes related to carotenoid metabolism are not known. In this study, an Arabidopsis T-DNA enhancer mutant, sk156, was identified due to its altered branching and trichome morphology and increased seed carotenoid levels compared to wild type (WT) ecovar Columbia. Enhanced miR156b expression due to the 35S enhancers present on the T-DNA insert was responsible for these phenotypes. Constitutive and leaf primodium-specific expression of a miR156-insensitive (mutated) SPL15 (SPL15m) largely restored WT seed carotenoid levels and plant morphology when expressed in sk156. The Arabidopsis native miR156-sensitive SPL15 (SPL15n) and SPL15m driven by a native SPL15 promoter did not restore the WT phenotype in sk156. Our findings suggest that SPL15 function is somewhat redundant with other SPL family members, which collectively affect plant phenotypes. Moreover, substantially decreased miR156b transcript levels in sk156 expressing SPL15m, together with the presence of multiple repeats of SPL-binding GTAC core sequence close to the miR156b transcription start site, suggested feedback regulation of miR156b expression by SPL15. This was supported by the demonstration of specific in vitro interaction between DNA-binding SBP domain of SPL15
Kamili, Saleem; Sozzi, Vitini; Thompson, Geoff; Campbell, Katie; Walker, Christopher M; Locarnini, Stephen; Krawczynski, Krzysztof
2009-05-01
Hepatitis B virus (HBV) mutants resistant to treatment with nucleoside or nucleotide analogs and those with the ability to escape from HBV-neutralizing antibody have the potential to infect HBV-vaccinated individuals. To address this potential serious public health challenge, we tested the efficacy of immunity induced by a commercial hepatitis B vaccine against a tissue culture-derived, clonal HBV polymerase mutant in HBV seronegative chimpanzees. The polymerase gene mutant contained a combination of three mutations (rtV173L, rtL180M, rtM204V), two of which resulted in changes to the overlapping viral envelope of the hepatitis B surface antigen (sE164D, sI195M). Prior to the HBV mutant challenge of vaccinated chimpanzees, we established virologic, serologic, and pathologic characteristics of infections resulting from intravenous inoculation of the HBV polymerase gene mutant and the sG145R vaccine-escape surface gene mutant. Cloning and sequencing experiments determined that the three mutations in the polymerase gene mutant remained stable and that the single mutation in the surface gene mutant reverted to the wild-type sequence. Immunological evidence of HBV replication was observed in the vaccinated chimpanzees after challenge with the polymerase gene mutant as well as after rechallenge with serum-derived wild-type HBV (5,000 chimpanzee infectious doses administered intravenously), despite robust humoral and cellular anti-HBV immune responses after hepatitis B vaccination. Our data showing successful experimental infection by HBV mutants despite the presence of high anti-HBs levels considered protective in the vaccinated host are consistent with clinical reports on breakthrough infection in anti-HBs-positive patients infected with HBV mutants. In the absence of a protective humoral immunity, adaptive cellular immune responses elicited by infection may limit HBV replication and persistence.
Directory of Open Access Journals (Sweden)
Wright Anthony PH
2010-01-01
Full Text Available Abstract Background Histone acetyltransferase enzymes (HATs are implicated in regulation of transcription. HATs from different families may overlap in target and substrate specificity. Results We isolated the elp3+ gene encoding the histone acetyltransferase subunit of the Elongator complex in fission yeast and characterized the phenotype of an Δelp3 mutant. We examined genetic interactions between Δelp3 and two other HAT mutants, Δmst2 and Δgcn5 and used whole genome microarray analysis to analyze their effects on gene expression. Conclusions Comparison of phenotypes and expression profiles in single, double and triple mutants indicate that these HAT enzymes have overlapping functions. Consistent with this, overlapping specificity in histone H3 acetylation is observed. However, there is no evidence for overlap with another HAT enzyme, encoded by the essential mst1+ gene.
Directory of Open Access Journals (Sweden)
M.P. Nobrega
1998-03-01
Full Text Available The mutants of Saccharomyces cerevisiae assigned to complementation group G199 are deficient in mitochondrial respiration and lack a functional cytochrome oxidase complex. Recombinant plasmids capable of restoring respiration were cloned by transformation of mutants of this group with a yeast genomic library. Sequencing indicated that a 2.1-kb subclone encompasses the very end (last 11 amino acids of the PET111 gene, the COX7 gene and a new gene (YMR255W of unknown function that potentially codes for a polypeptide of 188 amino acids (about 21.5 kDa without significant homology to any known protein. We have shown that the respiratory defect corresponding to group G199 is complemented by plasmids carrying only the COX7 gene. The gene YMR255W was inactivated by one-step gene replacement and the disrupted strain was viable and unaffected in its ability to grow in a variety of different test media such as minimal or complete media using eight distinct carbon sources at three pH values and temperatures. Inactivation of this gene also did not affect mating or sporulation
Synaptotagmin gene content of the sequenced genomes
Directory of Open Access Journals (Sweden)
Craxton Molly
2004-07-01
Full Text Available Abstract Background Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. Results I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. Conclusions I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their
Directory of Open Access Journals (Sweden)
Takao Sasado
Full Text Available Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68. CPSF6 is a component of the Cleavage Factor Im complex (CFIm which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.
Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi
2017-01-01
Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.
Tesei, Donatella; Tafer, Hakim; Poyntner, Caroline; Piñar, Guadalupe; Lopandic, Ksenija; Sterflinger, Katja
2017-01-01
ABSTRACT The fungal genus Knufia mostly comprises extremotolerant species from environmental sources, especially rock surfaces. The draft genome sequence of the rock fungus Knufia petricola presented here is the first whole-genome sequence of the only species among black fungi known to have a nonmelanized spontaneous mutant.
Metts, J; West, J; Doares, S H; Matthysse, A G
1991-02-01
Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.
Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D
2003-07-30
Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.
A comprehensive dataset of genes with a loss-of-function mutant phenotype in Arabidopsis.
Lloyd, Johnny; Meinke, David
2012-03-01
Despite the widespread use of Arabidopsis (Arabidopsis thaliana) as a model plant, a curated dataset of Arabidopsis genes with mutant phenotypes remains to be established. A preliminary list published nine years ago in Plant Physiology is outdated, and genome-wide phenotype information remains difficult to obtain. We describe here a comprehensive dataset of 2,400 genes with a loss-of-function mutant phenotype in Arabidopsis. Phenotype descriptions were gathered primarily from manual curation of the scientific literature. Genes were placed into prioritized groups (essential, morphological, cellular-biochemical, and conditional) based on the documented phenotypes of putative knockout alleles. Phenotype classes (e.g. vegetative, reproductive, and timing, for the morphological group) and subsets (e.g. flowering time, senescence, circadian rhythms, and miscellaneous, for the timing class) were also established. Gene identities were classified as confirmed (through molecular complementation or multiple alleles) or not confirmed. Relationships between mutant phenotype and protein function, genetic redundancy, protein connectivity, and subcellular protein localization were explored. A complementary dataset of 401 genes that exhibit a mutant phenotype only when disrupted in combination with a putative paralog was also compiled. The importance of these genes in confirming functional redundancy and enhancing the value of single gene datasets is discussed. With further input and curation from the Arabidopsis community, these datasets should help to address a variety of important biological questions, provide a foundation for exploring the relationship between genotype and phenotype in angiosperms, enhance the utility of Arabidopsis as a reference plant, and facilitate comparative studies with model genetic organisms.
Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion.
Ivanov, E L; Kovaltzova, S V; Korolev, V G
1989-08-01
We have developed a method to isolate yeast (Saccharomyces cerevisiae) mutants with enhanced induced mutagenesis based on nitrous acid-induced reversion of the ade2-42 allele. Six mutants have been isolated and designated him (high induced mutagenesis), and 4 of them were studied in more detail. The him mutants displayed enhanced reversion of the ade2-42 allele, either spontaneous or induced by nitrous acid, UV light, and the base analog 6-N-hydroxylaminopurine, but not by gamma-irradiation. It is worth noting that the him mutants turned out not to be sensitive to the lethal effects of the mutagens used. The enhancement in mutation induced by nitrous acid, UV light, and 6-N-hydroxylaminopurine has been confirmed in a forward-mutation assay (induction of mutations in the ADE1, ADE2 genes). The latter agent revealed the most apparent differences between the him mutants and the wild-type strain and was, therefore, chosen for the genetic analysis of mutants, him mutations analyzed behaved as a single Mendelian trait; complementation tests indicated 3 complementation groups (HIM1, HIM2, and HIM3), each containing 1 mutant allele. Uracil-DNA glycosylase activity was determined in crude cell extracts, and no significant differences between the wild-type and him strains were detected. Spontaneous mitotic gene conversion at the ADE2 locus is altered in him1 strains, either increased or decreased, depending on the particular heteroallelic combination. Genetic evidence strongly suggests him mutations to be involved in a process of mismatch correction of molecular heteroduplexes.
Directory of Open Access Journals (Sweden)
Carlos A Santiviago
2009-07-01
Full Text Available Pools of mutants of minimal complexity but maximal coverage of genes of interest facilitate screening for genes under selection in a particular environment. We constructed individual deletion mutants in 1,023 Salmonella enterica serovar Typhimurium genes, including almost all genes found in Salmonella but not in related genera. All mutations were confirmed simultaneously using a novel amplification strategy to produce labeled RNA from a T7 RNA polymerase promoter, introduced during the construction of each mutant, followed by hybridization of this labeled RNA to a Typhimurium genome tiling array. To demonstrate the ability to identify fitness phenotypes using our pool of mutants, the pool was subjected to selection by intraperitoneal injection into BALB/c mice and subsequent recovery from spleens. Changes in the representation of each mutant were monitored using T7 transcripts hybridized to a novel inexpensive minimal microarray. Among the top 120 statistically significant spleen colonization phenotypes, more than 40 were mutations in genes with no previously known role in this model. Fifteen phenotypes were tested using individual mutants in competitive assays of intraperitoneal infection in mice and eleven were confirmed, including the first two examples of attenuation for sRNA mutants in Salmonella. We refer to the method as Array-based analysis of cistrons under selection (ABACUS.
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
Hepatitis B surface gene 145 mutant as a minor population in hepatitis B virus carriers
Directory of Open Access Journals (Sweden)
Komatsu Haruki
2012-01-01
Full Text Available Abstract Background Hepatitis B virus (HBV can have mutations that include the a determinant, which causes breakthrough infection. In particular, a single mutation at amino acid 145 of the surface protein (G145 is frequently reported in the failure of prophylactic treatment. The aim of this study was to evaluate the frequency of the a determinant mutants, especially the G145 variant, in Japan, where universal vaccination has not been adopted. Methods The present study was a retrospective study. The study cohorts were defined as follows: group 1, children with failure to prevent mother-to-child transmission despite immunoprophylaxis (n = 18, male/female = 8/10, age 1-14 years; median 6 years; group 2, HBV carriers who had not received vaccination or hepatitis B immunoglobulin (n = 107, male/female = 107, age 1-52 years; median 16 years. To detect the G145R and G145A mutants in patients, we designed 3 probes for real-time PCR. We also performed direct sequencing and cloning of PCR products. Results By mutant-specific real-time PCR, one subject (5.6% was positive for the G145R mutant in group 1, while the G145 mutant was undetectable in group 2. The a determinant mutants were detected in one (5.6% of the group 1 subjects and 10 (9.3% of the group 2 subjects using direct sequencing, but direct sequencing did not reveal the G145 mutant as a predominant strain in the two groups. However, the subject who was positive according to the mutant-specific real-time PCR in group 1 had overlapped peaks at nt 587 in the electropherogram. In group 2, 11 patients had overlapped peaks at nt 587 in the electropherogram. Cloning of PCR products allowed detection of the G145R mutant as a minor strain in 7 (group 1: 1 subject, group 2: 6 subjects of 12 subjects who had overlapped peaks at nt 587 in the electropherogram. Conclusions The frequency of the a determinant mutants was not high in Japan. However, the G145R mutant was often present as a minor population in
Pham, Anh-Tung; Shannon, J Grover; Bilyeu, Kristin D
2012-08-01
High oleic acid soybeans were produced by combining mutant FAD2-1A and FAD2-1B genes. Despite having a high oleic acid content, the linolenic acid content of these soybeans was in the range of 4-6 %, which may be high enough to cause oxidative instability of the oil. Therefore, a study was conducted to incorporate one or two mutant FAD3 genes into the high oleic acid background to further reduce the linolenic acid content. As a result, soybean lines with high oleic acid and low linolenic acid (HOLL) content were produced using different sources of mutant FAD2-1A genes. While oleic acid content of these HOLL lines was stable across two testing environments, the reduction of linolenic acid content varied depending on the number of mutant FAD3 genes combined with mutant FAD2-1 genes, on the severity of mutation in the FAD2-1A gene, and on the testing environment. Combination of two mutant FAD2-1 genes and one mutant FAD3 gene resulted in less than 2 % linolenic acid content in Portageville, Missouri (MO) while four mutant genes were needed to achieve the same linolenic acid in Columbia, MO. This study generated non-transgenic soybeans with the highest oleic acid content and lowest linolenic acid content reported to date, offering a unique alternative to produce a fatty acid profile similar to olive oil.
Arabidopsis mutant sk156 reveals complex regulation of SPL15 in a miR156-controlled gene network
Directory of Open Access Journals (Sweden)
Wei Shu
2012-09-01
Full Text Available Abstract Background The Arabidopsis microRNA156 (miR156 regulates 11 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL family by base pairing to complementary target mRNAs. Each SPL gene further regulates a set of other genes; thus, miR156 controls numerous genes through a complex gene regulation network. Increased axillary branching occurs in transgenic Arabidopsis overexpressing miR156b, similar to that observed in loss-of-function max3 and max4 mutants with lesions in carotenoid cleavage dioxygenases. Arabidopsis miR156b was found to enhance carotenoid levels and reproductive shoot branching when expressed in Brassica napus, suggesting a link between miR156b expression and carotenoid metabolism. However, details of the miR156 regulatory network of SPL genes related to carotenoid metabolism are not known. Results In this study, an Arabidopsis T-DNA enhancer mutant, sk156, was identified due to its altered branching and trichome morphology and increased seed carotenoid levels compared to wild type (WT ecovar Columbia. Enhanced miR156b expression due to the 35S enhancers present on the T-DNA insert was responsible for these phenotypes. Constitutive and leaf primodium-specific expression of a miR156-insensitive (mutated SPL15 (SPL15m largely restored WT seed carotenoid levels and plant morphology when expressed in sk156. The Arabidopsis native miR156-sensitive SPL15 (SPL15n and SPL15m driven by a native SPL15 promoter did not restore the WT phenotype in sk156. Our findings suggest that SPL15 function is somewhat redundant with other SPL family members, which collectively affect plant phenotypes. Moreover, substantially decreased miR156b transcript levels in sk156 expressing SPL15m, together with the presence of multiple repeats of SPL-binding GTAC core sequence close to the miR156b transcription start site, suggested feedback regulation of miR156b expression by SPL15. This was supported by the demonstration of specific in vitro
Directory of Open Access Journals (Sweden)
Tao Lin
Full Text Available The identification of genes important in the pathogenesis of Lyme disease Borrelia has been hampered by exceedingly low transformation rates in low-passage, infectious organisms. Using the infectious, moderately transformable B. burgdorferi derivative 5A18NP1 and signature-tagged versions of the Himar1 transposon vector pGKT, we have constructed a defined transposon library for the efficient genome-wide investigation of genes required for wild-type pathogenesis, in vitro growth, physiology, morphology, and plasmid replication. To facilitate analysis, the insertion sites of 4,479 transposon mutants were determined by sequencing. The transposon insertions were widely distributed across the entire B. burgdorferi genome, with an average of 2.68 unique insertion sites per kb DNA. The 10 linear plasmids and 9 circular plasmids had insertions in 33 to 100 percent of their predicted genes. In contrast, only 35% of genes in the 910 kb linear chromosome had incapacitating insertions; therefore, the remaining 601 chromosomal genes may represent essential gene candidates. In initial signature-tagged mutagenesis (STM analyses, 434 mutants were examined at multiple tissue sites for infectivity in mice using a semi-quantitative, Luminex-based DNA detection method. Examples of genes found to be important in mouse infectivity included those involved in motility, chemotaxis, the phosphoenolpyruvate phosphotransferase system, and other transporters, as well as putative plasmid maintenance genes. Availability of this ordered STM library and a high-throughput screening method is expected to lead to efficient assessment of the roles of B. burgdorferi genes in the infectious cycle and pathogenesis of Lyme disease.
Woodcock, M Ryan; Vaughn-Wolfe, Jennifer; Elias, Alexandra; Kump, D Kevin; Kendall, Katharina Denise; Timoshevskaya, Nataliya; Timoshevskiy, Vladimir; Perry, Dustin W; Smith, Jeramiah J; Spiewak, Jessica E; Parichy, David M; Voss, S Randal
2017-01-31
The molecular genetic toolkit of the Mexican axolotl, a classic model organism, has matured to the point where it is now possible to identify genes for mutant phenotypes. We used a positional cloning-candidate gene approach to identify molecular bases for two historic axolotl pigment phenotypes: white and albino. White (d/d) mutants have defects in pigment cell morphogenesis and differentiation, whereas albino (a/a) mutants lack melanin. We identified in white mutants a transcriptional defect in endothelin 3 (edn3), encoding a peptide factor that promotes pigment cell migration and differentiation in other vertebrates. Transgenic restoration of Edn3 expression rescued the homozygous white mutant phenotype. We mapped the albino locus to tyrosinase (tyr) and identified polymorphisms shared between the albino allele (tyr a ) and tyr alleles in a Minnesota population of tiger salamanders from which the albino trait was introgressed. tyr a has a 142 bp deletion and similar engineered alleles recapitulated the albino phenotype. Finally, we show that historical introgression of tyr a significantly altered genomic composition of the laboratory axolotl, yielding a distinct, hybrid strain of ambystomatid salamander. Our results demonstrate the feasibility of identifying genes for traits in the laboratory Mexican axolotl.
Nonsense mutants in the bacteriophage T4D v gene
Energy Technology Data Exchange (ETDEWEB)
Minderhout, L van; Grimbergen, J; Groot, B de [Rijksuniversiteit Leiden (Netherlands). Lab. voor Stralengenetica en Chemische Mutagenese; Cohen (J.A.) Instituut voor Radiopathologie en Stralenbescherming, Leiden (Netherlands))
1975-09-01
Ten UV-sensitive mutants of T4D with the v phenotype were isolated. Of these ten mutants, two are amber and two opal. In UV curves and in photoreactivation and multiplicity reactivation experiments the nonsense mutants show the v phenotype in su/sup -/ hosts and almost the T4/sup +/ phenotype in su/sup +/ hosts. The mutations are located between rl and e and are alleles of v/sub 1/. In crosses with irradiated and non-irradiated phages the recombinant frequency is not reduced by uvs5. Amber uvs5 propagated in CR63 su/sup +/ is with B su/sup -/ just as sensitive to UV as uvs5 propagated in B su/sup -/, which permits the conclusion that the capsid of T4 phage particles does not contain the v gene product.
Litwin, Christine M.; Byrne, Burke L.
1998-01-01
Vibrio vulnificus is a halophilic, marine pathogen that has been associated with septicemia and serious wound infections in patients with iron overload and preexisting liver disease. For V. vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. V. vulnificus is able to use host iron sources such as hemoglobin and heme. We previously constructed a fur mutant of V. vulnificus which constitutively expresses at least two iron-regulated outer membrane proteins, of 72 and 77 kDa. The N-terminal amino acid sequence of the 77-kDa protein purified from the V. vulnificus fur mutant had 67% homology with the first 15 amino acids of the mature protein of the Vibrio cholerae heme receptor, HutA. In this report, we describe the cloning, DNA sequence, mutagenesis, and analysis of transcriptional regulation of the structural gene for HupA, the heme receptor of V. vulnificus. DNA sequencing of hupA demonstrated a single open reading frame of 712 amino acids that was 50% identical and 66% similar to the sequence of V. cholerae HutA and similar to those of other TonB-dependent outer membrane receptors. Primer extension analysis localized one promoter for the V. vulnificus hupA gene. Analysis of the promoter region of V. vulnificus hupA showed a sequence homologous to the consensus Fur box. Northern blot analysis showed that the transcript was strongly regulated by iron. An internal deletion in the V. vulnificus hupA gene, done by using marker exchange, resulted in the loss of expression of the 77-kDa protein and the loss of the ability to use hemin or hemoglobin as a source of iron. The hupA deletion mutant of V. vulnificus will be helpful in future studies of the role of heme iron in V. vulnificus pathogenesis. PMID:9632577
Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.
2012-01-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222
Wang, Ge; Rahman, M. Sayeedur; Humayun, M. Zafri; Taylor, Diane E.
1999-01-01
Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates.
Wang, G; Rahman, M S; Humayun, M Z; Taylor, D E
1999-03-01
Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates.
Culture adaptation of malaria parasites selects for convergent loss-of-function mutants.
Claessens, Antoine; Affara, Muna; Assefa, Samuel A; Kwiatkowski, Dominic P; Conway, David J
2017-01-24
Cultured human pathogens may differ significantly from source populations. To investigate the genetic basis of laboratory adaptation in malaria parasites, clinical Plasmodium falciparum isolates were sampled from patients and cultured in vitro for up to three months. Genome sequence analysis was performed on multiple culture time point samples from six monoclonal isolates, and single nucleotide polymorphism (SNP) variants emerging over time were detected. Out of a total of five positively selected SNPs, four represented nonsense mutations resulting in stop codons, three of these in a single ApiAP2 transcription factor gene, and one in SRPK1. To survey further for nonsense mutants associated with culture, genome sequences of eleven long-term laboratory-adapted parasite strains were examined, revealing four independently acquired nonsense mutations in two other ApiAP2 genes, and five in Epac. No mutants of these genes exist in a large database of parasite sequences from uncultured clinical samples. This implicates putative master regulator genes in which multiple independent stop codon mutations have convergently led to culture adaptation, affecting most laboratory lines of P. falciparum. Understanding the adaptive processes should guide development of experimental models, which could include targeted gene disruption to adapt fastidious malaria parasite species to culture.
A new mutant gene su-1 in corn obtained by irradiation with low doses of gamma rays
International Nuclear Information System (INIS)
Diaconu, P.
1993-01-01
This paper provides a description of a sugar corn mutant obtained by irradiation of wetted kernels of Romanesc de Studina variety with low doses of gamma rays (300 R). This mutant influences the structure of the endosperm similarly to the su-1 genes developed spontaneously which resulted in the corn variety Zea mays saccharata thousands of years ago. Although the mutant is a multiple allele of the su-1 locus in chromosome IV it differs widely from the spontaneous mutant. The length of the ears is much reduced, varying between 4 and 6 cm, with numbers of kernels per ear varying between 45 and 72. Attempts to improve the cob size and the number of kernels by breeding and propagation in an insulated area led to no result. Crossing the mutants with the sugar hybrid Delicious resulted in sugar type progeny which confirms the common position of the mutant gene induced by irradiation and the spontaneous su-1 gene. The progenies of sugar mutant x Delicious are 38-43 % lower in cob vigor and 36-46% lower in kernel number. (author). 2 figs, 2 tab., 16 refs
Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.
Directory of Open Access Journals (Sweden)
Annalaura Torella
Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Characterization of a Thermo-Inducible Chlorophyll-Deficient Mutant in Barley
Directory of Open Access Journals (Sweden)
Rong Wang
2017-11-01
Full Text Available Leaf color is an important trait for not only controlling crop yield but also monitoring plant status under temperature stress. In this study, a thermo-inducible chlorophyll-deficient mutant, named V-V-Y, was identified from a gamma-radiated population of the barley variety Vlamingh. The leaves of the mutant were green under normal growing temperature but turned yellowish under high temperature in the glasshouse experiment. The ratio of chlorophyll a and chlorophyll b in the mutant declined much faster in the first 7–9 days under heat treatment. The leaves of V-V-Y turned yellowish but took longer to senesce under heat stress in the field experiment. Genetic analysis indicated that a single nuclear gene controlled the mutant trait. The mutant gene (vvy was mapped to the long arm of chromosome 4H between SNP markers 1_0269 and 1_1531 with a genetic distance of 2.2 cM and a physical interval of 9.85 Mb. A QTL for grain yield was mapped to the same interval and explained 10.4% of the yield variation with a LOD score of 4. This QTL is coincident with the vvy gene interval that is responsible for the thermo-inducible chlorophyll-deficient trait. Fine mapping, based on the barley reference genome sequence, further narrowed the vvy gene to a physical interval of 0.428 Mb with 11 annotated genes. This is the first report of fine mapping a thermo-inducible chlorophyll-deficient gene in barley.
International Nuclear Information System (INIS)
Kono, Akira
1999-01-01
Base sequence analysis of CCKAR gene (a gene of A-type receptor for cholecystokinin) from OLETF rat, a model rat for insulin-independent diabetes was made based on the base sequence of wild CCKAR gene, which had been clarified in the previous year. From the pancreas of OLETF rat, DNA was extracted and transduced into λphage after fragmentation to construct the gene library of OLETF. Then, λphage DNA clone bound with labelled cDNA of CCKAR gene was analyzed and the gene structure was compared with that of the wild gene. It was demonstrated that CCKAR gene of OLETF had a deletion (6800 b.p.) ranging from the promoter region to the Exon 2, suggesting that CCKAR gene is not functional in OLETF rat. The whole sequence of this mutant gene was registered into Japan DNA Bank (D 50610). Then, F 2 offspring rats were obtained through crossing OLETF (female) and F344 (male) and the time course-changes in the blood glucose level after glucose loading were compared among them. The blood glucose level after glucose loading was significantly higher in the homo-mutant F 2 (CCKAR,-/-) as well as the parent OLETF rat than hetero-mutant F 2 (CCKARm-/+) or the wild rat (CCKAR,+/+). This suggests that CCKAR gene might be involved in the control of blood glucose level and an alteration of the expression level or the functions of CCKAR gene might affect the blood glucose level. (M.N.)
Directory of Open Access Journals (Sweden)
Lei-Ming Sun
Full Text Available MicroRNAs (miRNAs are a new class of small, endogenous RNAs that play a regulatory role in various biological and metabolic processes by negatively affecting gene expression at the post-transcriptional level. While the number of known Arabidopsis and rice miRNAs is continuously increasing, information regarding miRNAs from woody plants such as citrus remains limited. Solexa sequencing was performed at different developmental stages on both an early flowering mutant of trifoliate orange (precocious trifoliate orange, Poncirus trifoliata L. Raf. and its wild-type in this study, resulting in the obtainment of 141 known miRNAs belonging to 99 families and 75 novel miRNAs in four libraries. A total of 317 potential target genes were predicted based on the 51 novel miRNAs families, GO and KEGG annotation revealed that high ranked miRNA-target genes are those implicated in diverse cellular processes in plants, including development, transcription, protein degradation and cross adaptation. To characterize those miRNAs expressed at the juvenile and adult development stages of the mutant and its wild-type, further analysis on the expression profiles of several miRNAs through real-time PCR was performed. The results revealed that most miRNAs were down-regulated at adult stage compared with juvenile stage for both the mutant and its wild-type. These results indicate that both conserved and novel miRNAs may play important roles in citrus growth and development, stress responses and other physiological processes.
Recent progress with the DNA repair mutants of Chinese hamster ovary cells
International Nuclear Information System (INIS)
Thompson, L.H.; Salazar, E.P.; Brookman, K.W.; Collins, C.C.; Stewart, S.A.; Busch, D.B.; Weber, C.A.
1986-01-01
Repair deficient mutants of Chinese hamster ovary (CHO) cells are being used to identify human genes that correct the repair defects and to study mechanisms of DNA repair and mutagenesis. Five independent tertiary DNA transformants were obtained from the EM9 mutant. In these clones a human DNA sequence was identified that correlated with the resistance of the cells to CldUrd. After Eco RI digestion, Southern transfer, and hybridization of transformant DNAs with the BLUR-8 Alu family sequence, a common fragment of 25 to 30 kb was present. 37 refs., 4 figs., 3 tabs
Directory of Open Access Journals (Sweden)
Qi Jia
2012-01-01
Full Text Available In order to study the role of AtKu70 and AtKu80 in Agrobacterium-mediated transformation and gene targeting, plant lines with a T-DNA insertion in AtKu80 or AtKu70 genes were functionally characterized. Such plant lines lacked both subunits, indicating that heterodimer formation between AtKu70 and AtKu80 is needed for the stability of the proteins. Homozygous mutants were phenotypically indistinguishable from wild-type plants and were fertile. However, they were hypersensitive to the genotoxic agent bleomycin, resulting in more DSBs as quantified in comet assays. They had lower end-joining efficiency, suggesting that NHEJ is a critical pathway for DSB repair in plants. Both Atku mutants and a previously isolated Atmre11 mutant were impaired in Agrobacterium T-DNA integration via floral dip transformation, indicating that AtKu70, AtKu80, and AtMre11 play an important role in T-DNA integration in Arabidopsis. The frequency of gene targeting was not significantly increased in the Atku80 and Atku70 mutants, but it was increased at least 10-fold in the Atmre11 mutant compared with the wild type.
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Rosconi, Federico; de Vries, Stefan P W; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J
2016-11-15
The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we
Zhou, Yuping; Zhang, Qi
2018-04-01
In the information environment, digital and information processing to Li brocade patterns reveals an important means of Li ethnic style and inheriting the national culture. Adobe Illustrator CS3 and Java language were used in the paper to make "variation" processing to Li brocade patterns, and generate "Li brocade pattern mutant genes". The generation of pattern mutant genes includes color mutation, shape mutation, adding and missing transform, and twisted transform, etc. Research shows that Li brocade pattern mutant genes can be generated by using the Adobe Illustrator CS3 and the image processing tools of Java language edit, etc.
Establishing gene models from the Pinus pinaster genome using gene capture and BAC sequencing.
Seoane-Zonjic, Pedro; Cañas, Rafael A; Bautista, Rocío; Gómez-Maldonado, Josefa; Arrillaga, Isabel; Fernández-Pozo, Noé; Claros, M Gonzalo; Cánovas, Francisco M; Ávila, Concepción
2016-02-27
In the era of DNA throughput sequencing, assembling and understanding gymnosperm mega-genomes remains a challenge. Although drafts of three conifer genomes have recently been published, this number is too low to understand the full complexity of conifer genomes. Using techniques focused on specific genes, gene models can be established that can aid in the assembly of gene-rich regions, and this information can be used to compare genomes and understand functional evolution. In this study, gene capture technology combined with BAC isolation and sequencing was used as an experimental approach to establish de novo gene structures without a reference genome. Probes were designed for 866 maritime pine transcripts to sequence genes captured from genomic DNA. The gene models were constructed using GeneAssembler, a new bioinformatic pipeline, which reconstructed over 82% of the gene structures, and a high proportion (85%) of the captured gene models contained sequences from the promoter regulatory region. In a parallel experiment, the P. pinaster BAC library was screened to isolate clones containing genes whose cDNA sequence were already available. BAC clones containing the asparagine synthetase, sucrose synthase and xyloglucan endotransglycosylase gene sequences were isolated and used in this study. The gene models derived from the gene capture approach were compared with the genomic sequences derived from the BAC clones. This combined approach is a particularly efficient way to capture the genomic structures of gene families with a small number of members. The experimental approach used in this study is a valuable combined technique to study genomic gene structures in species for which a reference genome is unavailable. It can be used to establish exon/intron boundaries in unknown gene structures, to reconstruct incomplete genes and to obtain promoter sequences that can be used for transcriptional studies. A bioinformatics algorithm (GeneAssembler) is also provided as a
Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C
2002-05-01
Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.
Endo, Masaki; Kumagai, Masahiko; Motoyama, Ritsuko; Sasaki-Yamagata, Harumi; Mori-Hosokawa, Satomi; Hamada, Masao; Kanamori, Hiroyuki; Nagamura, Yoshiaki; Katayose, Yuichi; Itoh, Takeshi; Toki, Seiichi
2015-01-01
Gene targeting (GT) is a technique used to modify endogenous genes in target genomes precisely via homologous recombination (HR). Although GT plants are produced using genetic transformation techniques, if the difference between the endogenous and the modified gene is limited to point mutations, GT crops can be considered equivalent to non-genetically modified mutant crops generated by conventional mutagenesis techniques. However, it is difficult to guarantee the non-incorporation of DNA fragments from Agrobacterium in GT plants created by Agrobacterium-mediated GT despite screening with conventional Southern blot and/or PCR techniques. Here, we report a comprehensive analysis of herbicide-tolerant rice plants generated by inducing point mutations in the rice ALS gene via Agrobacterium-mediated GT. We performed genome comparative genomic hybridization (CGH) array analysis and whole-genome sequencing to evaluate the molecular composition of GT rice plants. Thus far, no integration of Agrobacterium-derived DNA fragments has been detected in GT rice plants. However, >1,000 single nucleotide polymorphisms (SNPs) and insertion/deletion (InDels) were found in GT plants. Among these mutations, 20-100 variants might have some effect on expression levels and/or protein function. Information about additive mutations should be useful in clearing out unwanted mutations by backcrossing. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
Identification and Map-Based Cloning of the Light-Induced Lesion Mimic Mutant 1 (LIL1) Gene in Rice.
Zhou, Qian; Zhang, Zhifei; Liu, Tiantian; Gao, Bida; Xiong, Xingyao
2017-01-01
The hypersensitive response (HR) is a mechanism by which plants prevent the spread of pathogen. Despite extensive study, the molecular mechanisms underlying HR remain poorly understood. Lesion mimic mutants (LMMs), such as LIL1 that was identified in an ethylmethane sulfonate mutagenized population of Indica rice ( Oryza sativa L. ssp. Indica ) 93-11, can be used to study the HR. Under natural field conditions, the leaves of LIL1 mutant plants exhibited light-induced, small, rust-red lesions that first appeared at the leaf tips and subsequently expanded throughout the entire leaf blade to the leaf sheath. Histochemical staining indicated that LIL1 lesions displayed an abnormal accumulation of reactive oxygen species (ROS) and resulted from programmed cell death (PCD). The LIL1 mutants also displayed increased expression of defense-related genes and enhanced resistance to rice blast fungus ( Magnaporthe grisea ). Genetic analysis showed that mutation of LIL1 created a semi-dominant allele. Using 1,758 individuals in the F 2 population, LIL1 was mapped in a 222.3 kb region on the long arm of chromosome 7. That contains 12 predicted open reading frames (ORFs). Sequence analysis of these 12 candidate genes revealed a G to A base substitution in the fourth exon of LOC_Os07g30510, a putative cysteine-rich receptor-like kinase (CRK), which led to an amino acid change (Val 429 to Ile) in the LIL1 protein. Comparison of the transcript accumulation of the 12 candidate genes between LIL1 and 93-11 revealed that LOC_Os07g30510 was up-regulated significantly in LIL1 . Overexpression of the LOC_Os07g30510 gene from LIL1 induced a LIL1 -like lesion phenotype in Nipponbare. Thus, LIL1 is a novel LMM in rice that will facilitate the further study of the molecular mechanisms of HR and the rice blast resistance.
Energy Technology Data Exchange (ETDEWEB)
McCluskey, Kevin; Wiest, Aric E.; Grigoriev, Igor V.; Lipzen, Anna; Martin, Joel; Schackwitz, Wendy; Baker, Scott E.
2011-06-02
Classical forward genetics has been foundational to modern biology, and has been the paradigm for characterizing the role of genes in shaping phenotypes for decades. In recent years, reverse genetics has been used to identify the functions of genes, via the intentional introduction of variation and subsequent evaluation in physiological, molecular, and even population contexts. These approaches are complementary and whole genome analysis serves as a bridge between the two. We report in this article the whole genome sequencing of eighteen classical mutant strains of Neurospora crassa and the putative identification of the mutations associated with corresponding mutant phenotypes. Although some strains carry multiple unique nonsynonymous, nonsense, or frameshift mutations, the combined power of limiting the scope of the search based on genetic markers and of using a comparative analysis among the eighteen genomes provides strong support for the association between mutation and phenotype. For ten of the mutants, the mutant phenotype is recapitulated in classical or gene deletion mutants in Neurospora or other filamentous fungi. From thirteen to 137 nonsense mutations are present in each strain and indel sizes are shown to be highly skewed in gene coding sequence. Significant additional genetic variation was found in the eighteen mutant strains, and this variability defines multiple alleles of many genes. These alleles may be useful in further genetic and molecular analysis of known and yet-to-be-discovered functions and they invite new interpretations of molecular and genetic interactions in classical mutant strains.
van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C
1997-05-01
We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.
Directory of Open Access Journals (Sweden)
Edith eCoronado
2014-11-01
Full Text Available The term water stress refers to the effects of low water availability on microbial growth and physiology. Water availability has been proposed as a major constraint for the use of microorganisms in contaminated sites with the purpose of bioremediation. Sphingomonas wittichii RW1 is a bacterium capable of degrading the xenobiotic compounds dibenzofuran and dibenzo-p-dioxin, and has potential to be used for targeted bioremediation. The aim of the current work was to identify genes implicated in water stress in RW1 by means of transposon mutagenesis and mutant growth experiments. Conditions of low water potential were mimicked by adding NaCl to the growth media. Three different mutant selection or separation method were tested, which, however recovered different mutants. Recovered transposon mutants with poorer growth under salt-induced water stress carried insertions in genes involved in proline and glutamate biosynthesis, and further in a gene putatively involved in aromatic compound catabolism. Transposon mutants growing poorer on medium with lowered water potential also included ones that had insertions in genes involved in more general functions such as transcriptional regulation, elongation factor, cell division protein, RNA polymerase β or an aconitase.
International Nuclear Information System (INIS)
Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.
2005-01-01
Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ
Multi-source and ontology-based retrieval engine for maize mutant phenotypes
In the midst of this genomics era, major plant genome databases are collecting massive amounts of heterogeneous information, including sequence data, gene product information, images of mutant phenotypes, etc., as well as textual descriptions of many of these entities. While basic browsing and sear...
Xiong, Hongchun; Guo, Huijun; Xie, Yongdun; Zhao, Linshu; Gu, Jiayu; Zhao, Shirong; Li, Junhui; Liu, Luxiang
2017-06-02
Salinity stress has become an increasing threat to food security worldwide and elucidation of the mechanism for salinity tolerance is of great significance. Induced mutation, especially spaceflight mutagenesis, is one important method for crop breeding. In this study, we show that a spaceflight-induced wheat mutant, named salinity tolerance 1 (st1), is a salinity-tolerant line. We report the characteristics of transcriptomic sequence variation induced by spaceflight, and show that mutations in genes associated with sodium ion transport may directly contribute to salinity tolerance in st1. Furthermore, GO and KEGG enrichment analysis of differentially expressed genes (DEGs) between salinity-treated st1 and wild type suggested that the homeostasis of oxidation-reduction process is important for salt tolerance in st1. Through KEGG pathway analysis, "Butanoate metabolism" was identified as a new pathway for salinity responses. Additionally, key genes for salinity tolerance, such as genes encoding arginine decarboxylase, polyamine oxidase, hormones-related, were not only salt-induced in st1 but also showed higher expression in salt-treated st1 compared with salt-treated WT, indicating that these genes may play important roles in salinity tolerance in st1. This study presents valuable genetic resources for studies on transcriptome variation caused by induced mutation and the identification of salt tolerance genes in crops.
Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.
Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M
1997-10-01
We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.
Identification of a Gravitropism-Deficient Mutant in Rice
Directory of Open Access Journals (Sweden)
He Yan
2017-03-01
Full Text Available A gravitropism-deficient mutant M96 was isolated from a mutant bank, generated by ethyl methane sulfonate (EMS mutagenesis of indica rice accession ZJ100. The mutant was characterized as prostrate growth at the beginning of germination, and the prostrate growth phenotype ran through the whole life duration. Tiller angle and tiller number of M96 increased significantly in comparison with the wild type. Tissue section observation analysis indicated that asymmetric stem growth around the second node occurred in M96. Genetic analysis and gene mapping showed that M96 was controlled by a single recessive nuclear gene, tentatively termed as gravitropism-deficient M96 (gdM96, which was mapped to a region of 506 kb flanked by markers RM5960 and InDel8 on the long arm of chromosome 11. Sequencing analysis of the open reading frames in this region revealed a nucleotide substitution from G to T in the third exon of LOC_Os11g29840. Additionally, real-time fluorescence quantitative PCR analysis showed that the expression level of LOC_Os11g29840 in the stems was much higher than in the roots and leaves in M96. Furthermore, the expression level was more than four times in M96 stem than in the wild type stem. Our results suggested that the mutant gene was likely a new allele to the reported gene LAZY1. Isolation of this new allele would facilitate the further characterization of LAZY1.
Soppe, W.J.J.; Jacobsen, S.E.; Alonso-Blanco, C.; Jackson, J.P.; Kakutani, T.; Koornneef, M.; Peeters, A.J.M.
2000-01-01
The transition to flowering in Arabidopsis thaliana is delayed in fwa mutant plants. FWA was identified by loss-of-function mutations in normally flowering revertants of the fwa mutant, and it encodes a homeodomain-containing transcription factor. The DNA sequence of wild-type and fwa mutant alleles
An Updated Collection of Sequence Barcoded Temperature-Sensitive Alleles of Yeast Essential Genes.
Kofoed, Megan; Milbury, Karissa L; Chiang, Jennifer H; Sinha, Sunita; Ben-Aroya, Shay; Giaever, Guri; Nislow, Corey; Hieter, Philip; Stirling, Peter C
2015-07-14
Systematic analyses of essential gene function using mutant collections in Saccharomyces cerevisiae have been conducted using collections of heterozygous diploids, promoter shut-off alleles, through alleles with destabilized mRNA, destabilized protein, or bearing mutations that lead to a temperature-sensitive (ts) phenotype. We previously described a method for construction of barcoded ts alleles in a systematic fashion. Here we report the completion of this collection of alleles covering 600 essential yeast genes. This resource covers a larger gene repertoire than previous collections and provides a complementary set of strains suitable for single gene and genomic analyses. We use deep sequencing to characterize the amino acid changes leading to the ts phenotype in half of the alleles. We also use high-throughput approaches to describe the relative ts behavior of the alleles. Finally, we demonstrate the experimental usefulness of the collection in a high-content, functional genomic screen for ts alleles that increase spontaneous P-body formation. By increasing the number of alleles and improving the annotation, this ts collection will serve as a community resource for probing new aspects of biology for essential yeast genes. Copyright © 2015 Kofoed et al.
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
Construction of a large-scale Burkholderia cenocepacia J2315 transposon mutant library
Wong, Yee-Chin; Pain, Arnab; Nathan, Sheila
2014-09-01
Burkholderia cenocepacia, a pathogenic member of the Burkholderia cepacia complex (Bcc), has emerged as a significant threat towards cystic fibrosis patients, where infection often leads to the fatal clinical manifestation known as cepacia syndrome. Many studies have investigated the pathogenicity of B. cenocepacia as well as its ability to become highly resistant towards many of the antibiotics currently in use. In addition, studies have also been undertaken to understand the pathogen's capacity to adapt and survive in a broad range of environments. Transposon based mutagenesis has been widely used in creating insertional knock-out mutants and coupled with recent advances in sequencing technology, robust tools to study gene function in a genome-wide manner have been developed based on the assembly of saturated transposon mutant libraries. In this study, we describe the construction of a large-scale library of B. cenocepacia transposon mutants. To create transposon mutants of B. cenocepacia strain J2315, electrocompetent bacteria were electrotransformed with the EZ-Tn5 transposome. Tetracyline resistant colonies were harvested off selective agar and pooled. Mutants were generated in multiple batches with each batch consisting of ˜20,000 to 40,000 mutants. Transposon insertion was validated by PCR amplification of the transposon region. In conclusion, a saturated B. cenocepacia J2315 transposon mutant library with an estimated total number of 500,000 mutants was successfully constructed. This mutant library can now be further exploited as a genetic tool to assess the function of every gene in the genome, facilitating the discovery of genes important for bacterial survival and adaptation, as well as virulence.
Kück, Ulrich
2005-10-01
Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.
Non-linked inhibitory gene controls a disease mimicking mutant in rice [Oryza sativa L.
International Nuclear Information System (INIS)
Jambhulkar, S.J.; Joshua, D.C.; Goswamy, D.G.
2001-01-01
A gamma ray induced disease mimicking mutant called luchai lesion was isolated in the rice variety White Luchai 112. The appearance of small light red lesions and their development continued from seedling to flowering. The lesions appeared gradually on older leaves and their uncontrolled spread eventually lead to leaf senescence. They resembled the disease spots caused by Magnaporthe grisea. However, pathological studies ruled out the possibility of pathogen mediated disease symptoms. Genetic studies revealed that lesions were governed by a dominant gene; however, their expression was suppressed in presence of a non-linked inhibitory gene. It is hypothesised that the plant cells of the mutant are able to sense inbuilt spontaneous signals leading to lesion development, but in presence of an inhibitory gene the signals are suppressed by perturbation in the signal transduction pathway [it
International Nuclear Information System (INIS)
Affrida Abu Hassan; Ahmad Syazni Kamarudin; Nurul Nadia Aminuddin; Mohd Nazir Basiran
2004-01-01
In vitro mutagenesis on Dendrobium Sonia in MINT has produced mutants with wide range of flower form and colour variations. Among the mutants are plants with different flower size and shape. These changes could be caused by alterations to the expression level of the genes responsible for the characteristics. In this studies, Differential Display technique was used to identify and analyse altered gene expression at the mRNA level. Total RNA of the control and mutants were reversed transcribed using three anchored oligo-d T primers. Subsequently, these cDNAs were Pcr amplified in combination with 16 arbitrary primers. The amplified products were electrophoresed side by side on agarose gel. Differentially expressed bands are isolated for further analysis. (Author)
A Comprehensive Dataset of Genes with a Loss-of-Function Mutant Phenotype in Arabidopsis1[W][OA
Lloyd, Johnny; Meinke, David
2012-01-01
Despite the widespread use of Arabidopsis (Arabidopsis thaliana) as a model plant, a curated dataset of Arabidopsis genes with mutant phenotypes remains to be established. A preliminary list published nine years ago in Plant Physiology is outdated, and genome-wide phenotype information remains difficult to obtain. We describe here a comprehensive dataset of 2,400 genes with a loss-of-function mutant phenotype in Arabidopsis. Phenotype descriptions were gathered primarily from manual curation of the scientific literature. Genes were placed into prioritized groups (essential, morphological, cellular-biochemical, and conditional) based on the documented phenotypes of putative knockout alleles. Phenotype classes (e.g. vegetative, reproductive, and timing, for the morphological group) and subsets (e.g. flowering time, senescence, circadian rhythms, and miscellaneous, for the timing class) were also established. Gene identities were classified as confirmed (through molecular complementation or multiple alleles) or not confirmed. Relationships between mutant phenotype and protein function, genetic redundancy, protein connectivity, and subcellular protein localization were explored. A complementary dataset of 401 genes that exhibit a mutant phenotype only when disrupted in combination with a putative paralog was also compiled. The importance of these genes in confirming functional redundancy and enhancing the value of single gene datasets is discussed. With further input and curation from the Arabidopsis community, these datasets should help to address a variety of important biological questions, provide a foundation for exploring the relationship between genotype and phenotype in angiosperms, enhance the utility of Arabidopsis as a reference plant, and facilitate comparative studies with model genetic organisms. PMID:22247268
Ji, S H; Gururani, M A; Lee, J W; Ahn, B-O; Chun, S-C
2014-03-01
We have isolated a severe dwarf mutant derived from a Ds (Dissociation) insertion mutant rice (Oryza sativa var. japonica c.v. Dongjin). This severe dwarf phenotype, has short and dark green leaves, reduced shoot growth early in the seedling stage, and later severe dwarfism with failure to initiate flowering. When treated with bioactive GA3 , mutants are restored to the normal wild-type phenotype. Reverse transcription PCR analyses of 22 candidate genes related to the gibberellin (GA) biosynthesis pathway revealed that among 22 candidate genes tested, a dwarf mutant transcript was not expressed only in one OsKS2 gene. Genetic analysis revealed that the severe dwarf phenotype was controlled by recessive mutation of a single nuclear gene. The putative OsKS2 gene was a chromosome 4-located ent-kaurene synthase (KS), encoding the enzyme that catalyses an early step of the GA biosynthesis pathway. Sequence analysis revealed that osks2 carried a 1-bp deletion in the ORF region of OsKS2, which led to a loss-of-function mutation. The expression pattern of OsKS2 in wild-type cv Dongjin, showed that it is expressed in all organs, most prominently in the stem and floral organs. Morphological characteristics of the dwarf mutant showed dramatic modifications in internal structure and external morphology. We propose that dwarfism in this mutant is caused by a point mutation in OsKS2, which plays a significant role in growth and development of higher plants. Further investigation on OsKS2 and other OsKS-like proteins is underway and may yield better understanding of the putative role of OsKS in severe dwarf mutants. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Johnson, Jeremiah G; Livny, Jonathan; Dirita, Victor J
2014-06-01
Campylobacter jejuni is a leading cause of gastrointestinal infections worldwide, due primarily to its ability to asymptomatically colonize the gastrointestinal tracts of agriculturally relevant animals, including chickens. Infection often occurs following consumption of meat that was contaminated by C. jejuni during harvest. Because of this, much interest lies in understanding the mechanisms that allow C. jejuni to colonize the chicken gastrointestinal tract. To address this, we generated a C. jejuni transposon mutant library that is amenable to insertion sequencing and introduced this mutant pool into day-of-hatch chicks. Following deep sequencing of C. jejuni mutants in the cecal outputs, several novel factors required for efficient colonization of the chicken gastrointestinal tract were identified, including the predicted outer membrane protein MapA. A mutant strain lacking mapA was constructed and found to be significantly reduced for chicken colonization in both competitive infections and monoinfections. Further, we found that mapA is required for in vitro competition with wild-type C. jejuni but is dispensable for growth in monoculture.
Generation of a glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis.
Iwakuma, Hidekazu; Koyama, Yoshiyuki; Miyachi, Ayako; Nasukawa, Masashi; Matsumoto, Hitoshi; Yano, Shuntaro; Ogihara, Jun; Kasumi, Takafumi
2016-01-01
We obtained a novel glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis. A plasmid containing DNA polymerase δ lacking proofreading activity, and AMAI, an autonomously replicating sequence was introduced into T. reesei ATCC66589. The rate of mutation evaluated with 5-fluoroorotic acid resistance was approximately 30-fold higher than that obtained by UV irradiation. The transformants harboring incompetent DNA polymerase δ were then selected on 2-deoxyglucose agar plates with hygromycin B. The pNP-lactoside hydrolyzing activities of mutants were 2 to 5-fold higher than the parent in liquid medium containing glucose. Notably, the amino acid sequence of cre1, a key gene involved in glucose repression, was identical in the mutant and parent strains, and further, the cre1 expression levels was not abolished in the mutant. Taken together, these results demonstrate that the strains of T. reesei generated by disparity mutagenesis are glucose de-repressed variants that contain mutations in yet-unidentified factors other than cre1.
Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.
Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li
2014-10-01
This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.
[Carcinogenesis and its mechanism of mutant-type[12Asp]K-ras4B gene].
Gui, Li-ming; Wei, Li-hui; Zhang, Ying-mei; Wang, Jian-liu; Wang, Ying; Chen, Ying; Ma, Da-long
2002-01-01
Ras gene plays an important role in the extra- and intra-cellular signal transduction pathway. It mediates series cascade reactions, and eventually actives transcriptional factors in nucleus. It is unknown on the mechanism of carcinogenesis of Ras gene in endometrial carcinoma, though K-ras mutant is very common in endometrial atypical hyperplasia and carcinoma. On basis of discovering the mutation in 12th codon of K-ras in endometrial carcinoma cell line, HEC-1A, we explored the carcinogenesis and molecular mechanism of mutant-type [12Asp] K-ras4B gene. (1) Full-length [12Asp]K-ras4B cDNA was amplified with RT-PCR, then inserted into pcDI eukaryotic expressive vector. (2) Morphological change, growth kinetics in vitro and tumorigencity in nude mice in vivo after-before transfection were observed. (3) To test the cell growth kinetics by methyl thiazolium tetrazolium (MTT) and [3H]thymidine incorporation method. (1) The authors have successfully constructed eukaryotic expression plasmid pcDI-[12Asp] K-ras4B; (2) To confirm that [12Asp] K-ras4B mutant can trigger the neoplastic transformation of NIH3T3 cells by test in vitro and in vivo. (3) After pMCV-RasN17 plasmid, a Ras mutant were transfected into pcDI-[12Asp] K-ras4B cells, the growth of this cell were restrained significantly in comparison with control group. (4) These findings indicate the expression of RafS621A resulted in remarkable inhibition in proliferation of pcDI-[12Asp]K-ras4B cell (P ras4B cell growth (P ras4B gene alone is able to cause neoplastic transformation in NIH3T3 cells in vitro and in vivo. (2) [12Asp]K-ras4B-induced NIH3T3 cells neoplastic transformation required Raf signaling pathway.
International Nuclear Information System (INIS)
Du Zeji; Kong Xianrong
1999-01-01
Deinococcus radiodurans (Dr) possesses a prominent ability to repair the DNA injury induced by various DNA- damaging agents including mitomycin C(MC), ultraviolet light (UV) and ionizing radiation. DNA damage resistance was restored in MC sensitive (MC s ) mutants 2621 and 3021 by transforming with DNAs of four cosmids clones derived from the gene library of strain KD8301 which showed the property of wild type phenotype to DNA-damaging agents. Gene affected by mutation (mtcA or mtcB) in both mutants was cloned and its nucleotide sequence was determined. The deduced amino acid (aa) sequence of Dr uvrA gene product consists of 1016 aa and shares homology with many bacterial UvrA proteins. The mutation sites in both mutants were identified by analyzing the polymerase chain reaction (PCR) fragments derived from the genomic DNA of the mutants. A 144-base pairs (bp) deletion including the start codon for the uvr A gene was observed in DNA of the mutant 3021, causing a defect in the gene. On the other hand, an insertion sequence (IS) element intervened in the uvrA gene of the mutant 2621, suggesting the insertional inactivation of the gene. The IS element comprise 1322-bp long, flanked by 19-bp inverted terminal repeats (ITR), and generated a 6-bp target duplication (TD). Two open reading frames (ORF) were found in the IS element. The deduced aa sequences of large and small ORF show homology to a putative transposes found in IS4 of Escherichia coli (E. coli) and to a resolvent found in IS Xc5 of Xanthomonas campestris (Xc), respectively. This is the first discovery of IS element in deino-bacteria, and the IS element was designated IS2621
Guidelines for the naming of genes, gene products, and mutants in the opportunistic protists.
Limper, Andrew H; Weiss, Louis M
2011-01-01
The opportunistic protists encompass a wide diversity of organisms including Pneumocystis, Toxoplasma, cryptosporidia, microsporidia, and related genera. Recent advances in the molecular biology and cellular biochemistry of these organisms have led to the identification of an ever growing numbers of key genes and their cognate proteins. Until now, these molecules have not been designated using any consistent nomenclature system, leading to considerable confusion. The participants of the 11th International Workshop on Opportunistic Protists met on August 3, 2010 to reach consensus of a nomenclature system for genes, gene products, and mutants in the opportunistic protists. The following summary reports the consensus agreement to move toward a unified nomenclature system for these organisms. The system is adapted from that used for Saccharomyces cerevisiae. © 2011 The Author(s). Journal of Eukaryotic Microbiology © 2011 International Society of Protistologists.
Molecular analysis of waxy mutants in rice
International Nuclear Information System (INIS)
Yatou, O.; Amano, E.
1990-01-01
Full text: The 'waxy' gene is a structural gene coding a glycosyl transferase which synthesises amylose in the endosperm tissue. 'Non-waxy' rice cultivars have an active gene and their amylose content is 18-25% depending upon gene performance and modifier genes. In 'waxy' rice, no amylose is found because the enzyme is absent. In mutants induced by gamma rays, neutrons, EI or EMS, amylose content ranged from 0 to 20%, i.e. there are intermediate phenotypes as well. Some of them had the same amount of the enzyme as a 'non-waxy' cultivar, even fully 'waxy' mutants showed a certain amount of the enzyme. This suggests that in mutants there may be no structural change in the enzyme gene but the enzyme produced might be less active. By molecular analysis of the mutants' genes it was found that only two mutants induced by thermal neutrons show structural alterations, the changes in other mutants are either too small to be detected by Southern analysis or are outside the structural gene in question. (author)
Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang
2007-07-01
To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.
International Nuclear Information System (INIS)
Depto, A.S.; Stenberg, R.M.
1989-01-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene
Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li
2008-10-01
To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
International Nuclear Information System (INIS)
Banga, S.S.; Boyd, J.B.; Valerie, K.; Harris, P.V.; Kurz, E.M.; de Riel, J.K.
1989-01-01
The denV gene of bacteriophage T4 was fused to a Drosophila hsp70 (70-kDa heat shock protein) promoter and introduced into the germ line of Drosophila by P-element-mediated transformation. The protein product of that gene (endonuclease V) was detected in extracts of heat-shocked transformants with both enzymological and immunoblotting procedures. That protein restores both excision repair and UV resistance to mei-9 and mus201 mutants of this organism. These results reveal that the denV gene can compensate for excision-repair defects in two very different eukayotic mutants, in that the mus201 mutants are typical of excision-deficient mutants in other organisms, whereas the mei-9 mutants exhibit a broad pleiotropism that includes a strong meiotic deficiency. This study permits an extension of the molecular analysis of DNA repair to the germ line of higher eukaryotes. It also provides a model system for future investigations of other well-characterized microbial repair genes on DNA damage in the germ line of this metazoan organism
Khang, Chang Hyun; Park, Sook-Young; Lee, Yong-Hwan; Kang, Seogchan
2005-06-01
Rapid progress in fungal genome sequencing presents many new opportunities for functional genomic analysis of fungal biology through the systematic mutagenesis of the genes identified through sequencing. However, the lack of efficient tools for targeted gene replacement is a limiting factor for fungal functional genomics, as it often necessitates the screening of a large number of transformants to identify the desired mutant. We developed an efficient method of gene replacement and evaluated factors affecting the efficiency of this method using two plant pathogenic fungi, Magnaporthe grisea and Fusarium oxysporum. This method is based on Agrobacterium tumefaciens-mediated transformation with a mutant allele of the target gene flanked by the herpes simplex virus thymidine kinase (HSVtk) gene as a conditional negative selection marker against ectopic transformants. The HSVtk gene product converts 5-fluoro-2'-deoxyuridine to a compound toxic to diverse fungi. Because ectopic transformants express HSVtk, while gene replacement mutants lack HSVtk, growing transformants on a medium amended with 5-fluoro-2'-deoxyuridine facilitates the identification of targeted mutants by counter-selecting against ectopic transformants. In addition to M. grisea and F. oxysporum, the method and associated vectors are likely to be applicable to manipulating genes in a broad spectrum of fungi, thus potentially serving as an efficient, universal functional genomic tool for harnessing the growing body of fungal genome sequence data to study fungal biology.
Ghezelbash, Gholam Reza; Nahvi, Iraj; Emamzadeh, Rahman
2014-08-01
The purpose of the present investigation was to produce erythritol by Yarrowia lipolytica mutant without any by-products. Mutants of Y. lipolytica were generated by ultra-violet for enhancing erythrose reductase (ER) activity and erythritol production. The mutants showing the highest ER activity were screened by triphenyl tetrazolium chloride agar plate assay. Productivity of samples was analyzed by thin-layer chromatography and high-performance liquid chromatography equipped with the refractive index detector. One of the mutants named as mutant 49 gave maximum erythritol production without any other by-products (particularly glycerol). Erythritol production and specific ER activity in mutant 49 increased to 1.65 and 1.47 times, respectively, in comparison with wild-type strain. The ER gene of wild and mutant strains was sequenced and analyzed. A general comparison of wild and mutant gene sequences showed the replacement of Asp(270) with Glu(270) in ER protein. In order to enhance erythritol production, we used a three component-three level-one response Box-Behnken of response surface methodology model. The optimum medium composition for erythritol production was found to be (g/l) glucose 279.49, ammonium sulfate 9.28, and pH 5.41 with 39.76 erythritol production.
Jiménez, Sergio; Li, Zhigang; Reighard, Gregory L; Bielenberg, Douglas G
2010-02-09
In many tree species the perception of short days (SD) can trigger growth cessation, dormancy entrance, and the establishment of a chilling requirement for bud break. The molecular mechanisms connecting photoperiod perception, growth cessation and dormancy entrance in perennials are not clearly understood. The peach [Prunus persica (L.) Batsch] evergrowing (evg) mutant fails to cease growth and therefore cannot enter dormancy under SD. We used the evg mutant to filter gene expression associated with growth cessation after exposure to SD. Wild-type and evg plants were grown under controlled conditions of long days (16 h/8 h) followed by transfer to SD (8 h/16 h) for eight weeks. Apical tissues were sampled at zero, one, two, four, and eight weeks of SD and suppression subtractive hybridization was performed between genotypes at the same time points. We identified 23 up-regulated genes in the wild-type with respect to the mutant during SD exposure. We used quantitative real-time PCR to verify the expression of the differentially expressed genes in wild-type tissues following the transition to SD treatment. Three general expression patterns were evident: one group of genes decreased at the time of growth cessation (after 2 weeks in SD), another that increased immediately after the SD exposure and then remained steady, and another that increased throughout SD exposure. The use of the dormancy-incapable mutant evg has allowed us to reduce the number of genes typically detected by differential display techniques for SD experiments. These genes are candidates for involvement in the signalling pathway leading from photoperiod perception to growth cessation and dormancy entrance and will be the target of future investigations.
Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing
DEFF Research Database (Denmark)
Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan
2004-01-01
an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...
Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N
2017-12-01
We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.
Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi
2016-01-01
Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for
Yuan, Fengjie; Yu, Xiaomin; Dong, Dekun; Yang, Qinghua; Fu, Xujun; Zhu, Shenlong; Zhu, Danhua
2017-01-18
Seed germination is important to soybean (Glycine max) growth and development, ultimately affecting soybean yield. A lower seed field emergence has been the main hindrance for breeding soybeans low in phytate. Although this reduction could be overcome by additional breeding and selection, the mechanisms of seed germination in different low phytate mutants remain unknown. In this study, we performed a comparative transcript analysis of two low phytate soybean mutants (TW-1 and TW-1-M), which have the same mutation, a 2 bp deletion in GmMIPS1, but show a significant difference in seed field emergence, TW-1-M was higher than that of TW-1 . Numerous genes analyzed by RNA-Seq showed markedly different expression levels between TW-1-M and TW-1 mutants. Approximately 30,000-35,000 read-mapped genes and ~21000-25000 expressed genes were identified for each library. There were ~3900-9200 differentially expressed genes (DEGs) in each contrast library, the number of up-regulated genes was similar with down-regulated genes in the mutant TW-1and TW-1-M. Gene ontology functional categories of DEGs indicated that the ethylene-mediated signaling pathway, the abscisic acid-mediated signaling pathway, response to hormone, ethylene biosynthetic process, ethylene metabolic process, regulation of hormone levels, and oxidation-reduction process, regulation of flavonoid biosynthetic process and regulation of abscisic acid-activated signaling pathway had high correlations with seed germination. In total, 2457 DEGs involved in the above functional categories were identified. Twenty-two genes with 20 biological functions were the most highly up/down- regulated (absolute value Log2FC >5) in the high field emergence mutant TW-1-M and were related to metabolic or signaling pathways. Fifty-seven genes with 36 biological functions had the greatest expression abundance (FRPM >100) in germination-related pathways. Seed germination in the soybean low phytate mutants is a very complex process
A Probabilistic Genome-Wide Gene Reading Frame Sequence Model
DEFF Research Database (Denmark)
Have, Christian Theil; Mørk, Søren
We introduce a new type of probabilistic sequence model, that model the sequential composition of reading frames of genes in a genome. Our approach extends gene finders with a model of the sequential composition of genes at the genome-level -- effectively producing a sequential genome annotation...... as output. The model can be used to obtain the most probable genome annotation based on a combination of i: a gene finder score of each gene candidate and ii: the sequence of the reading frames of gene candidates through a genome. The model --- as well as a higher order variant --- is developed and tested...... and are evaluated by the effect on prediction performance. Since bacterial gene finding to a large extent is a solved problem it forms an ideal proving ground for evaluating the explicit modeling of larger scale gene sequence composition of genomes. We conclude that the sequential composition of gene reading frames...
Saitoh, Aya; Takase, Tomoyuki; Kitaki, Hiroyuki; Miyazaki, Yuji; Kiyosue, Tomohiro
2015-01-01
Elongation of hypocotyl cells has been studied as a model for elucidating the contribution of cellular expansion to plant organ growth. ZEITLUPE (ZTL) or LOV KELCH PROTEIN1 (LKP1) is a positive regulator of warmth-induced hypocotyl elongation under white light in Arabidopsis, although the molecular mechanisms by which it promotes hypocotyl cell elongation remain unknown. Microarray analysis showed that 134 genes were upregulated and 204 genes including 15 auxin-inducible genes were downregulated in the seedlings of 2 ztl T-DNA insertion mutants grown under warm conditions with continuous white light. Application of a polar auxin transport inhibitor, an auxin antagonist or an auxin biosynthesis inhibitor inhibited hypocotyl elongation of control seedlings to the level observed with the ztl mutant. Our data suggest the involvement of auxin and auxin-inducible genes in ZTL-mediated hypocotyl elongation.
Directory of Open Access Journals (Sweden)
Erin J Gilchrist
Full Text Available We have generated a Brassica napus (canola population of 3,158 EMS-mutagenised lines and used TILLING to demonstrate that the population has a high enough mutation density that it will be useful for identification of mutations in genes of interest in this important crop species. TILLING is a reverse genetics technique that has been successfully used in many plant and animal species. Classical TILLING involves the generation of a mutagenised population, followed by screening of DNA samples using a mismatch-specific endonuclease that cleaves only those PCR products that carry a mutation. Polyacrylamide gel detection is then used to visualise the mutations in any gene of interest. We have used this TILLING technique to identify 432 unique mutations in 26 different genes in B. napus (canola cv. DH12075. This reflects a mutation density ranging from 1/56 kb to 1/308 kb (depending on the locus with an average of 1/109 kb. We have also successfully verified the utility of next generation sequencing technology as a powerful approach for the identification of rare mutations in a population of plants, even in polyploid species such as B. napus. Most of the mutants we have identified are publically available.
International Nuclear Information System (INIS)
Geller, A.I.; Keyomarsi, K.; Bryan, J.; Pardee, A.B.
1990-01-01
The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli β-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; ts mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses β-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
International Nuclear Information System (INIS)
Feng Hongqing; Wang Ruixue; Sun Peng; Wu Haiyan; Liu Qi; Li Fangting; Fang Jing; Zhang Jue; Zhu Weidong
2010-01-01
The mechanisms of eukaryotic cell response to cold plasma are studied. A series of single gene mutants of eukaryotic model organism Saccharomyces cerevisiae are used to compare their sensitivity to plasma treatment with the wild type. We examined 12 mutants in the oxidative stress pathway and the cell cycle pathway, in which 8 are found to be hypersensitive to plasma processing. The mutated genes' roles in the two pathways are analyzed to understand the biological response mechanisms of plasma treatment. The results demonstrate that genes from both pathways are needed for the eukaryotic cells to survive the complex plasma treatment.
DEFF Research Database (Denmark)
Rasmussen, M; Sunde, L; Nielsen, M L
2018-01-01
Identification of fetal kidney anomalies invites questions about underlying causes and recurrence risk in future pregnancies. We therefore investigated the diagnostic yield of next-generation sequencing in fetuses with bilateral kidney anomalies and the correlation between disrupted genes and fetal...... phenotypes. Fetuses with bilateral kidney anomalies were screened using an in-house-designed kidney-gene panel. In families where candidate variants were not identified, whole-exome sequencing was performed. Genes uncovered by this analysis were added to our kidney-panel. We identified likely deleterious...... of nephronophthisis. Exome sequencing identified ROBO1 variants in one family and a GREB1L variant in another family. GREB1L and ROBO1 were added to our kidney-gene panel and additional variants were identified. Next-generation sequencing substantially contributes to identifying causes of fetal kidney anomalies...
Mutant matrix metalloproteinase-9 reduces postoperative peritoneal adhesions in rats.
Atta, Hussein; El-Rehany, Mahmoud; Roeb, Elke; Abdel-Ghany, Hend; Ramzy, Maggie; Gaber, Shereen
2016-02-01
Postoperative peritoneal adhesions continue to be a major source of morbidity and occasional mortality. Studies have shown that matrix metalloproteinase-9 (MMP-9) levels are decreased postoperatively which may limits matrix degradation and participate in the development of peritoneal adhesions. In this proof-of-principle study, we evaluated the effect of gene therapy with catalytically inactive mutant MMP-9 on postoperative peritoneal adhesions in rats. Adenovirus encoding mutant MMP-9 (Ad-mMMP-9) or saline was instilled in the peritoneal cavity after cecal and parietal peritoneal injury in rats. Expression of mutant MMP-9 transcript was verified by sequencing. Adenovirus E4 gene expression, adhesion scores, MMP-9, tissue plasminogen activator (tPA), plasminogen activator inhibitor-1 (PAI-1) and transforming growth factor-β1 (TGF-β1) expression were evaluated at sacrifice one week after treatment. Both mutant MMP-9 transcripts and adenovirus E4 gene were expressed in Ad-mMMP-9 treated adhesions. Adhesions severity decreased significantly (p = 0.036) in the Ad-mMMP-9-treated compared with saline-treated adhesions. Expression of MMP-9 mRNA and protein were elevated (p = 0.001 and p = 0.029, respectively) in the Ad-mMMP-9-treated adhesions compared with saline-treated adhesions. While tPA levels were increased (p = 0.02) in Ad-mMMP-9 treated adhesions compared with saline-treated adhesions, TGF-β1 and PAI-1 levels were decreased (p = 0.017 and p = 0.042, respectively). No difference in mortality were found between groups (p = 0.64). Mutant MMP-9 gene therapy effectively transduced peritoneal adhesions resulting in reduction of severity of primary peritoneal adhesions. Copyright © 2016 IJS Publishing Group Limited. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Fiona R Savory
Full Text Available In Caenorhabditis elegans, mutants of the conserved insulin/IGF-1 signalling (IIS pathway are long-lived and stress resistant due to the altered expression of DAF-16 target genes such as those involved in cellular defence and metabolism. The three Δ(9 desaturase genes, fat-5, fat-6 and fat-7, are included amongst these DAF-16 targets, and it is well established that Δ(9 desaturase enzymes play an important role in survival at low temperatures. However, no assessment of cold tolerance has previously been reported for IIS mutants. We demonstrate that long-lived age-1(hx546 mutants are remarkably resilient to low temperature stress relative to wild type worms, and that this is dependent upon daf-16. We also show that cold tolerance following direct transfer to low temperatures is increased in wild type worms during the facultative, daf-16 dependent, dauer stage. Although the cold tolerant phenotype of age-1(hx546 mutants is predominantly due to the Δ(9 desaturase genes, additional transcriptional targets of DAF-16 are also involved. Surprisingly, survival of wild type adults following a rapid temperature decline is not dependent upon functional daf-16, and cellular distributions of a DAF-16::GFP fusion protein indicate that DAF-16 is not activated during low temperature stress. This suggests that cold-induced physiological defences are not specifically regulated by the IIS pathway and DAF-16, but expression of DAF-16 target genes in IIS mutants and dauers is sufficient to promote cross tolerance to low temperatures in addition to other forms of stress.
Isolation of New Gravitropic Mutants under Hypergravity Conditions.
Mori, Akiko; Toyota, Masatsugu; Shimada, Masayoshi; Mekata, Mika; Kurata, Tetsuya; Tasaka, Masao; Morita, Miyo T
2016-01-01
Forward genetics is a powerful approach used to link genotypes and phenotypes, and mutant screening/analysis has provided deep insights into many aspects of plant physiology. Gravitropism is a tropistic response in plants, in which hypocotyls and stems sense the direction of gravity and grow upward. Previous studies of gravitropic mutants have suggested that shoot endodermal cells in Arabidopsis stems and hypocotyls are capable of sensing gravity (i.e., statocytes). In the present study, we report a new screening system using hypergravity conditions to isolate enhancers of gravitropism mutants, and we also describe a rapid and efficient genome mapping method, using next-generation sequencing (NGS) and single nucleotide polymorphism (SNP)-based markers. Using the endodermal-amyloplast less 1 ( eal1 ) mutant, which exhibits defective development of endodermal cells and gravitropism, we found that hypergravity (10 g) restored the reduced gravity responsiveness in eal1 hypocotyls and could, therefore, be used to obtain mutants with further reduction in gravitropism in the eal1 background. Using the new screening system, we successfully isolated six ene ( enhancer of eal1 ) mutants that exhibited little or no gravitropism under hypergravity conditions, and using NGS and map-based cloning with SNP markers, we narrowed down the potential causative genes, which revealed a new genetic network for shoot gravitropism in Arabidopsis .
Search for methylation-sensitive amplification polymorphisms in mutant figs
Rodrigues, M. G F; Martins, A. B G [UNESP; Bertoni, B. W.; Figueira, A.; Giuliatti, S.
2013-01-01
Fig (Ficus carica) breeding programs that use conventional approaches to develop new cultivars are rare, owing to limited genetic variability and the difficulty in obtaining plants via gamete fusion. Cytosine methylation in plants leads to gene repression, thereby affecting transcription without changing the DNA sequence. Previous studies using random amplification of polymorphic DNA and amplified fragment length polymorphism markers revealed no polymorphisms among select fig mutants that ori...
Bose, Baundauna; Reed, Sydney E; Besprozvannaya, Marina; Burton, Briana M
2016-01-01
SpoIIIE directionally pumps DNA across membranes during Bacillus subtilis sporulation and vegetative growth. The sequence-reading domain (γ domain) is required for directional DNA transport, and its deletion severely impairs sporulation. We selected suppressors of the spoIIIEΔγ sporulation defect. Unexpectedly, many suppressors were intragenic missense mutants, and some restore sporulation to near-wild-type levels. The mutant proteins are likely not more abundant, faster at translocating DNA, or sequence-sensitive, and rescue does not involve the SpoIIIE homolog SftA. Some mutants behave differently when co-expressed with spoIIIEΔγ, consistent with the idea that some, but not all, variants may form mixed oligomers. In full-length spoIIIE, these mutations do not affect sporulation, and yet the corresponding residues are rarely found in other SpoIIIE/FtsK family members. The suppressors do not rescue chromosome translocation defects during vegetative growth, indicating that the role of the γ domain cannot be fully replaced by these mutations. We present two models consistent with our findings: that the suppressors commit to transport in one arbitrarily-determined direction or delay spore development. It is surprising that missense mutations somehow rescue loss of an entire domain with a complex function, and this raises new questions about the mechanism by which SpoIIIE pumps DNA and the roles SpoIIIE plays in vivo.
Directory of Open Access Journals (Sweden)
Baundauna Bose
Full Text Available SpoIIIE directionally pumps DNA across membranes during Bacillus subtilis sporulation and vegetative growth. The sequence-reading domain (γ domain is required for directional DNA transport, and its deletion severely impairs sporulation. We selected suppressors of the spoIIIEΔγ sporulation defect. Unexpectedly, many suppressors were intragenic missense mutants, and some restore sporulation to near-wild-type levels. The mutant proteins are likely not more abundant, faster at translocating DNA, or sequence-sensitive, and rescue does not involve the SpoIIIE homolog SftA. Some mutants behave differently when co-expressed with spoIIIEΔγ, consistent with the idea that some, but not all, variants may form mixed oligomers. In full-length spoIIIE, these mutations do not affect sporulation, and yet the corresponding residues are rarely found in other SpoIIIE/FtsK family members. The suppressors do not rescue chromosome translocation defects during vegetative growth, indicating that the role of the γ domain cannot be fully replaced by these mutations. We present two models consistent with our findings: that the suppressors commit to transport in one arbitrarily-determined direction or delay spore development. It is surprising that missense mutations somehow rescue loss of an entire domain with a complex function, and this raises new questions about the mechanism by which SpoIIIE pumps DNA and the roles SpoIIIE plays in vivo.
Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice
Directory of Open Access Journals (Sweden)
Postina Rolf
2009-02-01
Full Text Available Abstract Background In a transgenic mouse model of Alzheimer disease (AD, cleavage of the amyloid precursor protein (APP by the α-secretase ADAM10 prevented amyloid plaque formation, and alleviated cognitive deficits. Furthermore, ADAM10 overexpression increased the cortical synaptogenesis. These results suggest that upregulation of ADAM10 in the brain has beneficial effects on AD pathology. Results To assess the influence of ADAM10 on the gene expression profile in the brain, we performed a microarray analysis using RNA isolated from brains of five months old mice overexpressing either the α-secretase ADAM10, or a dominant-negative mutant (dn of this enzyme. As compared to non-transgenic wild-type mice, in ADAM10 transgenic mice 355 genes, and in dnADAM10 mice 143 genes were found to be differentially expressed. A higher number of genes was differentially regulated in double-transgenic mouse strains additionally expressing the human APP[V717I] mutant. Overexpression of proteolytically active ADAM10 affected several physiological pathways, such as cell communication, nervous system development, neuron projection as well as synaptic transmission. Although ADAM10 has been implicated in Notch and β-catenin signaling, no significant changes in the respective target genes were observed in adult ADAM10 transgenic mice. Real-time RT-PCR confirmed a downregulation of genes coding for the inflammation-associated proteins S100a8 and S100a9 induced by moderate ADAM10 overexpression. Overexpression of the dominant-negative form dnADAM10 led to a significant increase in the expression of the fatty acid-binding protein Fabp7, which also has been found in higher amounts in brains of Down syndrome patients. Conclusion In general, there was only a moderate alteration of gene expression in ADAM10 overexpressing mice. Genes coding for pro-inflammatory or pro-apoptotic proteins were not over-represented among differentially regulated genes. Even a decrease of
Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke
2009-11-01
Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.
Young, Douglas; Mayer, Franziska; Vidotto, Nella; Schweizer, Tatjana; Berth, Ramon; Abramowski, Dorothee; Shimshek, Derya R.; van der Putten, P. Herman; Schmid, Peter
2013-01-01
Huntington's disease (HD) is an autosomal dominant, progressive and fatal neurological disorder caused by an expansion of CAG repeats in exon-1 of the huntingtin gene. The encoded poly-glutamine stretch renders mutant huntingtin prone to aggregation. HdhQ150 mice genocopy a pathogenic repeat (∼150 CAGs) in the endogenous mouse huntingtin gene and model predominantly pre-manifest HD. Treating early is likely important to prevent or delay HD, and HdhQ150 mice may be useful to assess therapeutic strategies targeting pre-manifest HD. This requires appropriate markers and here we demonstrate, that pre-symptomatic HdhQ150 mice show several dramatic mutant huntingtin gene-dose dependent pathological changes including: (i) an increase of neuronal intra-nuclear inclusions (NIIs) in brain, (ii) an increase of extra-nuclear aggregates in dentate gyrus, (iii) a decrease of DARPP32 protein and (iv) an increase in glial markers of neuroinflammation, which curiously did not correlate with local neuronal mutant huntingtin inclusion-burden. HdhQ150 mice developed NIIs also in all retinal neuron cell-types, demonstrating that retinal NIIs are not specific to human exon-1 R6 HD mouse models. Taken together, the striking and robust mutant huntingtin gene-dose related changes in aggregate-load, DARPP32 levels and glial activation markers should greatly facilitate future testing of therapeutic strategies in the HdhQ150 HD mouse model. PMID:24086450
Willson, T A; Nagley, P
1987-09-01
This work concerns a biochemical genetic study of subunit 9 of the mitochondrial ATPase complex of Saccharomyces cerevisiae. Subunit 9, encoded by the mitochondrial oli1 gene, contains a hydrophilic loop connecting two transmembrane stems. In one particular oli1 mit- mutant 2422, the substitution of a positively charged amino acid in this loop (Arg39----Met) renders the ATPase complex non-functional. A series of 20 revertants, selected for their ability to grow on nonfermentable substrates, has been isolated from mutant 2422. The results of DNA sequence analysis of the oli1 gene in each revertant have led to the recognition of three groups of revertants. Class I revertants have undergone a same-site reversion event: the mutant Met39 is replaced either by arginine (as in wild-type) or lysine. Class II revertants maintain the mutant Met39 residue, but have undergone a second-site reversion event (Asn35----Lys). Two revertants showing an oligomycin-resistant phenotype carry this same second-site reversion in the loop region together with a further amino acid substitution in either of the two membrane-spanning segments of subunit 9 (either Gly23----Ser or Leu53----Phe). Class III revertants contain subunit 9 with the original mutant 2422 sequence, and additionally carry a recessive nuclear suppressor, demonstrated to represent a single gene. The results on the revertants in classes I and II indicate that there is a strict requirement for a positively charged residue in the hydrophilic loop close to the boundary of the lipid bilayer. The precise location of this positive charge is less stringent; in functional ATPase complexes it can be found at either residue 39 or 35. This charged residue is possibly required to interact with some other component of the mitochondrial ATPase complex. These findings, together with hydropathy plots of subunit 9 polypeptides from normal, mutant and revertant strains, led to the conclusion that the hydrophilic loop in normal subunit 9
Specific gene mutations induced by heavy ions
International Nuclear Information System (INIS)
Freeling, M.; Karoly, C.W.; Cheng, D.S.K.
1980-01-01
This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens
Use of targeted exome sequencing in genetic diagnosis of Chinese familial hypercholesterolemia.
Directory of Open Access Journals (Sweden)
Wen-Feng Wu
Full Text Available Familial hypercholesterolemia is an autosomal dominant inherited disease characterized by elevated plasma low-density lipoprotein cholesterol (LDL-C. It is mainly caused by mutations of the low-density lipoprotein receptor (LDLR gene. Currently, the methods of whole genome sequencing or whole exome sequencing for screening mutations in familial hypercholesterolemia are not applicable in China due to high cost. We performed targeted exome sequencing of 167 genes implicated in the homozygous phenotype of a proband pedigree to identify candidate mutations, validated them in the family of the proband, studied the functions of the mutant protein, and followed up serum lipid levels after treatment. We discovered that exon 9 c.1268 T>C and exon 8 c.1129 T>G compound heterozygous mutations in the LDLR gene in the proband derived from the mother and father, respectively, in which the mutation of c.1129 T>G has not been reported previously. The mutant LDL-R protein had 57% and 52% binding and internalization functions, respectively, compared with that of the wild type. After 6 months of therapy, the LDL-C level of the proband decreased by more than 50% and the LDL-C of the other family members with heterozygous mutation also reduced to normal. Targeted exome sequencing is an effective method for screening mutation genes in familial hypercholesterolemia. The exon 8 and 9 mutations of the LDLR gene were pedigree mutations. The functions of the mutant LDL-R protein were decreased significantly compared with that of the wild type. Simvastatin plus ezetimibe was proven safe and effective in this preschool-age child.
Comparison of methods for genomic localization of gene trap sequences
Directory of Open Access Journals (Sweden)
Ferrin Thomas E
2006-09-01
Full Text Available Abstract Background Gene knockouts in a model organism such as mouse provide a valuable resource for the study of basic biology and human disease. Determining which gene has been inactivated by an untargeted gene trapping event poses a challenging annotation problem because gene trap sequence tags, which represent sequence near the vector insertion site of a trapped gene, are typically short and often contain unresolved residues. To understand better the localization of these sequences on the mouse genome, we compared stand-alone versions of the alignment programs BLAT, SSAHA, and MegaBLAST. A set of 3,369 sequence tags was aligned to build 34 of the mouse genome using default parameters for each algorithm. Known genome coordinates for the cognate set of full-length genes (1,659 sequences were used to evaluate localization results. Results In general, all three programs performed well in terms of localizing sequences to a general region of the genome, with only relatively subtle errors identified for a small proportion of the sequence tags. However, large differences in performance were noted with regard to correctly identifying exon boundaries. BLAT correctly identified the vast majority of exon boundaries, while SSAHA and MegaBLAST missed the majority of exon boundaries. SSAHA consistently reported the fewest false positives and is the fastest algorithm. MegaBLAST was comparable to BLAT in speed, but was the most susceptible to localizing sequence tags incorrectly to pseudogenes. Conclusion The differences in performance for sequence tags and full-length reference sequences were surprisingly small. Characteristic variations in localization results for each program were noted that affect the localization of sequence at exon boundaries, in particular.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Isoenzymes performance of some rice varieties and their mutants
International Nuclear Information System (INIS)
Winarno, Ermin; Suliwarno, Ambyah; Ismachin, M.
1992-01-01
Isoenzymes performance of some rice varieties and their mutants. Genetics studies on alcohol dehydrogenase, malic enzyme, peroxidase, acid phosphase, and aminopeptidase isoenzymes were carried out on several groups of rice varieties and their mutant lines. The first groups consisted of Atomita I, Pelita I/1, A227/5, Mudgo, TN-1, and IR-26. The second group was Cisadane variety and its five mutants, namely OBS 18, OBS 208, OBS 297, OBS 306, and OBS 330. The third group was mutants line 627-10-3 and its mutants, namely 1063, 1066, 1067, 1076, and 1090. Isoenzymes extracts of the rice leaves were fractionated using polyacrylamide gel disc electrophoresis. The pattern of acid phosphate isoenzyme shows the specific character of rice mutants susceptible to brown plant hopper biotype 1. The gene(s) controlling malic enzyme in Cisadane's mutants is (are) estimated more resistant toward gamma irradiation than gene(s) responsible for controlling the other enzymes. Generally, the isoenzymes zymograms show that gene(s) controlling the mutants enzyme have undergone mutation. This case is shown by the changes of Rm value, as well as the amount and intensity of mutants bands. (authors). 7 refs., 7 figs
[Sequencing technology in gene diagnosis and its application].
Yibin, Guo
2014-11-01
The study of gene mutation is one of the hot topics in the field of life science nowadays, and the related detection methods and diagnostic technology have been developed rapidly. Sequencing technology plays an indispensable role in the definite diagnosis and classification of genetic diseases. In this review, we summarize the research progress in sequencing technology, evaluate the advantages and disadvantages of 1(st) ~3(rd) generation of sequencing technology, and describe its application in gene diagnosis. Also we made forecasts and prospects on its development trend.
Directory of Open Access Journals (Sweden)
Houchard Kimberly R
2005-02-01
Full Text Available Abstract Background Excessive sequential stereotypy of behavioral patterns (sequential super-stereotypy in Tourette's syndrome and obsessive compulsive disorder (OCD is thought to involve dysfunction in nigrostriatal dopamine systems. In sequential super-stereotypy, patients become trapped in overly rigid sequential patterns of action, language, or thought. Some instinctive behavioral patterns of animals, such as the syntactic grooming chain pattern of rodents, have sufficiently complex and stereotyped serial structure to detect potential production of overly-rigid sequential patterns. A syntactic grooming chain is a fixed action pattern that serially links up to 25 grooming movements into 4 predictable phases that follow 1 syntactic rule. New mutant mouse models allow gene-based manipulation of brain function relevant to sequential patterns, but no current animal model of spontaneous OCD-like behaviors has so far been reported to exhibit sequential super-stereotypy in the sense of a whole complex serial pattern that becomes stronger and excessively rigid. Here we used a hyper-dopaminergic mutant mouse to examine whether an OCD-like behavioral sequence in animals shows sequential super-stereotypy. Knockdown mutation of the dopamine transporter gene (DAT causes extracellular dopamine levels in the neostriatum of these adult mutant mice to rise to 170% of wild-type control levels. Results We found that the serial pattern of this instinctive behavioral sequence becomes strengthened as an entire entity in hyper-dopaminergic mutants, and more resistant to interruption. Hyper-dopaminergic mutant mice have stronger and more rigid syntactic grooming chain patterns than wild-type control mice. Mutants showed sequential super-stereotypy in the sense of having more stereotyped and predictable syntactic grooming sequences, and were also more likely to resist disruption of the pattern en route, by returning after a disruption to complete the pattern from the
Kiljunen, Saija; Pajunen, Maria I; Dilks, Kieran; Storf, Stefanie; Pohlschroder, Mechthild; Savilahti, Harri
2014-12-09
Archaea share fundamental properties with bacteria and eukaryotes. Yet, they also possess unique attributes, which largely remain poorly characterized. Haloferax volcanii is an aerobic, moderately halophilic archaeon that can be grown in defined media. It serves as an excellent archaeal model organism to study the molecular mechanisms of biological processes and cellular responses to changes in the environment. Studies on haloarchaea have been impeded by the lack of efficient genetic screens that would facilitate the identification of protein functions and respective metabolic pathways. Here, we devised an insertion mutagenesis strategy that combined Mu in vitro DNA transposition and homologous-recombination-based gene targeting in H. volcanii. We generated an insertion mutant library, in which the clones contained a single genomic insertion. From the library, we isolated pigmentation-defective and auxotrophic mutants, and the respective insertions pinpointed a number of genes previously known to be involved in carotenoid and amino acid biosynthesis pathways, thus validating the performance of the methodologies used. We also identified mutants that had a transposon insertion in a gene encoding a protein of unknown or putative function, demonstrating that novel roles for non-annotated genes could be assigned. We have generated, for the first time, a random genomic insertion mutant library for a halophilic archaeon and used it for efficient gene discovery. The library will facilitate the identification of non-essential genes behind any specific biochemical pathway. It represents a significant step towards achieving a more complete understanding of the unique characteristics of halophilic archaea.
Directory of Open Access Journals (Sweden)
Pingyang Wang
Full Text Available Molting is an important physiological process in the larval stage of Bombyx mori and is controlled by various hormones and peptides. The silkworm mutant that exhibits the phenotype of non-molting in the 2nd instar (nm2 is incapable of molting in the 2nd instar and dies after seven or more days. The ecdysone titer in the nm2 mutant is lower than that in the wildtype, and the mutant can be rescued by feeding with 20E and cholesterol. The results of positional cloning indicated that structural alteration of BmCPG10 is responsible for the phenotype of the nm2 mutant. To explore the possible relationship between BmCPG10 and the ecdysone titer as well as the genes affected by BmCPG10, digital gene expression (DGE profile analysis was conducted in the nm2 mutant, with the wildtype strain C603 serving as the control. The results revealed 1727 differentially expressed genes, among which 651 genes were upregulated and 1076 were downregulated in nm2. BLASTGO analysis showed that these differentially expressed genes were involved in various biological processes, cellular components and molecular functions. KEGG analysis indicated an enrichment of these differentially expressed genes in 240 pathways, including metabolic pathways, pancreatic secretion, protein digestion and absorption, fat digestion and absorption and glycerolipid metabolism. To verify the accuracy of the DGE results, quantitative reverse transcription PCR (qRT-PCR was performed, focusing on key genes in several related pathways, and the results were highly consistent with the DGE results. Our findings indicated significant differences in cuticular protein genes, ecdysone biosynthesis genes and ecdysone-related nuclear receptors genes, but no significant difference in juvenile hormone and chitin biosynthesis genes was detected. Our research findings lay the foundation for further research on the formation mechanism of the nm2 mutant.
Directory of Open Access Journals (Sweden)
Jamie A. O'Rourke
2013-06-01
Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.
Directory of Open Access Journals (Sweden)
Cristi L. Galindo
2010-01-01
Full Text Available Braun/murein lipoprotein (Lpp is involved in inflammatory responses and septic shock. We previously characterized a Δlpp mutant of Yersinia pestis CO92 and found that this mutant was defective in surviving in macrophages and was attenuated in a mouse inhalation model of plague when compared to the highly virulent wild-type (WT bacterium. We performed global transcriptional profiling of WT Y. pestis and its Δlpp mutant using microarrays. The organisms were cultured at 26 and 37 degrees Celsius to simulate the flea vector and mammalian host environments, respectively. Our data revealed vastly different effects of lpp mutation on the transcriptomes of Y. pestis grown at 37 versus 26C. While the absence of Lpp resulted mainly in the downregulation of metabolic genes at 26C, the Y. pestis Δlpp mutant cultured at 37C exhibited profound alterations in stress response and virulence genes, compared to WT bacteria. We investigated one of the stress-related genes (htrA downregulated in the Δlpp mutant relative to WT Y. pestis. Indeed, complementation of the Δlpp mutant with the htrA gene restored intracellular survival of the Y. pestis Δlpp mutant. Our results support a role for Lpp in Y. pestis adaptation to the host environment, possibly via transcriptional activation of htrA.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Chen, Longzheng; Li, Wei; Katin-Grazzini, Lorenzo; Ding, Jing; Gu, Xianbin; Li, Yanjun; Gu, Tingting; Wang, Ren; Lin, Xinchun; Deng, Ziniu; McAvoy, Richard J; Gmitter, Frederick G; Deng, Zhanao; Zhao, Yunde; Li, Yi
2018-01-01
Developing CRISPR/Cas9-mediated non-transgenic mutants in asexually propagated perennial crop plants is challenging but highly desirable. Here, we report a highly useful method using an Agrobacterium -mediated transient CRISPR/Cas9 gene expression system to create non-transgenic mutant plants without the need for sexual segregation. We have also developed a rapid, cost-effective, and high-throughput mutant screening protocol based on Illumina sequencing followed by high-resolution melting (HRM) analysis. Using tetraploid tobacco as a model species and the phytoene desaturase ( PDS ) gene as a target, we successfully created and expediently identified mutant plants, which were verified as tetra-allelic mutants. We produced pds mutant shoots at a rate of 47.5% from tobacco leaf explants, without the use of antibiotic selection. Among these pds plants, 17.2% were confirmed to be non-transgenic, for an overall non-transgenic mutation rate of 8.2%. Our method is reliable and effective in creating non-transgenic mutant plants without the need to segregate out transgenes through sexual reproduction. This method should be applicable to many economically important, heterozygous, perennial crop species that are more difficult to regenerate.
Directory of Open Access Journals (Sweden)
M. Ananda Chitra
2015-07-01
Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain
Gruszka, Damian; Gorniak, Malgorzata; Glodowska, Ewelina; Wierus, Ewa; Oklestkova, Jana; Janeczko, Anna; Maluszynski, Miroslaw; Szarejko, Iwona
2016-04-22
Brassinosteroids (BRs) are plant steroid hormones, regulating a broad range of physiological processes. The largest amount of data related with BR biosynthesis has been gathered in Arabidopsis thaliana, however understanding of this process is far less elucidated in monocot crops. Up to now, only four barley genes implicated in BR biosynthesis have been identified. Two of them, HvDWARF and HvBRD, encode BR-6-oxidases catalyzing biosynthesis of castasterone, but their relation is not yet understood. In the present study, the identification of the HvDWARF genomic sequence, its mutational and functional analysis and characterization of new mutants are reported. Various types of mutations located in different positions within functional domains were identified and characterized. Analysis of their impact on phenotype of the mutants was performed. The identified homozygous mutants show reduced height of various degree and disrupted skotomorphogenesis. Mutational analysis of the HvDWARF gene with the "reverse genetics" approach allowed for its detailed functional analysis at the level of protein functional domains. The HvDWARF gene function and mutants' phenotypes were also validated by measurement of endogenous BR concentration. These results allowed a new insight into the BR biosynthesis in barley.
Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.
Directory of Open Access Journals (Sweden)
Nemanja Vukašinović
Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.
Gene Discovery through Genomic Sequencing of Brucella abortus
Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.
2001-01-01
Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979
Characterization and fine mapping of a light-dependent leaf lesion mimic mutant 1 in rice.
Wang, Jing; Ye, Bangquan; Yin, Junjie; Yuan, Can; Zhou, Xiaogang; Li, Weitao; He, Min; Wang, Jichun; Chen, Weilan; Qin, Peng; Ma, Bintian; Wang, Yuping; Li, Shigui; Chen, Xuewei
2015-12-01
Plants that spontaneously produce lesion mimics or spots, without any signs of obvious adversity, such as pesticide and mechanical damage, or pathogen infection, are so-called lesion mimic mutants (lmms). In rice, many lmms exhibit enhanced resistance to pathogens, which provides a unique opportunity to uncover the molecular mechanism underlying lmms. We isolated a rice light-dependent leaf lesion mimic mutant 1 (llm1). Lesion spots appeared in the leaves of the llm1 mutant at the tillering stage. Furthermore, the mutant llm1 had similar agronomic traits to wild type rice. Trypan blue and diamiobenzidine staining analyses revealed that the lesion spot formation on the llm1 mutant was due to programmed cell death and reactive oxygen species. The chloroplasts were severely damaged in the llm1 mutant, suggesting that chloroplast damage was associated with the formation of lesion spots in llm1. More importantly, llm1 exhibited enhanced resistance to bacterial blight pathogens within increased expression of pathogenesis related genes (PRs). Using a map-based cloning approach, we delimited the LLM1 locus to a 121-kb interval between two simple sequence repeat markers, RM17470 and RM17473, on chromosome 4. We sequenced the candidate genes on the interval and found that a base mutation had substituted adenine phosphate for thymine in the last exon of LOC_Os04g52130, which led to an amino acid change (Asp(388) to Val) in the llm1 mutant. Our investigation showed that the putative coproporphyrinogen III oxidase (CPOX) encoded by LOC_Os04g52130 was produced by LLM1 and that amino acid Asp(388) was essential for CPOX function. Our study provides the basis for further investigations into the mechanism underlying lesion mimic initiation associated with LLM1. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.
2005-01-01
The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155
Mishra, Ratnesh Chandra; Grover, Anil
2014-11-01
In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Miri eMichaeli
2012-12-01
Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.
Isolation of new gravitropic mutants under hypergravity conditions
Directory of Open Access Journals (Sweden)
Akiko Mori
2016-09-01
Full Text Available Forward genetics is a powerful approach used to link genotypes and phenotypes, and mutant screening/analysis has provided deep insights into many aspects of plant physiology. Gravitropism is a tropistic response in plants, in which hypocotyls and stems sense the direction of gravity and grow upwards. Previous studies of gravitropic mutants have suggested that shoot endodermal cells in Arabidopsis stems and hypocotyls are capable of sensing gravity (i.e., statocytes. In the present study, we report a new screening system using hypergravity conditions to isolate enhancers of gravitropism mutants, and we also describe a rapid and efficient genome mapping method, using Next-Generation Sequencing (NGS and Single Nucleotide Polymorphism (SNP-based markers. Using the endodermal-amyloplast less 1 (eal1 mutant, which exhibits defective development of endodermal cells and gravitropism, we found that hypergravity (10 g restored the reduced gravity responsiveness in eal1 hypocotyls and could, therefore, be used to obtain mutants with further reduction in gravitropism in the eal1 background. Using the new screening system, we successfully isolated six ene (enhancer of eal1 mutants that exhibited little or no gravitropism under hypergravity conditions, and using NGS and map-based cloning with SNP markers, we narrowed down the potential causative genes, which revealed a new genetic network for shoot gravitropism in Arabidopsis.
Determinate growth in Pisum: 'det' a new mutant gene on chromosome 7
International Nuclear Information System (INIS)
Swiecicki, W.K.
1988-01-01
Full text: A characteristic feature of the growth of legume plants is the absence of a clear border between vegetative and generative phase. By contrast in cereals, the growth of the vegetative mass ceases with flowering and assimilates are destined for filling grains. With regard to this feature in breeding of legume crops the ideotype of 'the self-completion variety' has been conceived. In the broad sense, this term means a plant with a clear end of vegetative growth, after which assimilates should be transported to seeds resulting in more uniform maturity and higher seed yield. Such self-completion can be achieved in different ways, even in the same species. In white lupin, e.g. the cultivar 'Wat' drops its leaves in the stage of pod filling. Moreover, in white lupin as well as in yellow and narrow-leaved lupins unbranched genotypes have been selected in which only one, the main stem develops with the inflorescence on top. Additional nodes with a single flower appear instead of branches. The field bean Vicia faba similar to the pea produces inflorescence on nodes and consecutive nodes develop continuously from the apical meristem. But in the mutation type 'determinate growth', controlled by a single gene, the stem is ended by the inflorescence. A comparable gene was found in pea in 1980 as an effect of seed treatment of the line Wt 3527 by the combined dose 200r Nf+0.014% NEU. Plants are characterized by inflorescence on the top of the stem and smaller number of flowering nodes. Sometimes apical flowers are abnormal, open, but fertile. The mutant was included in the gene bank under number Wt 16100. A phenotypically similar line was found at the John Innes Institute, Norwich (UK). According to the locus allelism test (Wt 16100 x Jl 1358) both mutants are controlled by the same gene. The suggested symbol for this monogenic inherited character is det determinated growth. For the linkage test, the tester line Wl 1238 was crossed with the mutant Wt 16100. The
Determinate growth in Pisum: 'det' a new mutant gene on chromosome 7
Energy Technology Data Exchange (ETDEWEB)
Swiecicki, W K [Plant Breeding Station, Wiatrowo (Poland)
1988-07-01
Full text: A characteristic feature of the growth of legume plants is the absence of a clear border between vegetative and generative phase. By contrast in cereals, the growth of the vegetative mass ceases with flowering and assimilates are destined for filling grains. With regard to this feature in breeding of legume crops the ideotype of 'the self-completion variety' has been conceived. In the broad sense, this term means a plant with a clear end of vegetative growth, after which assimilates should be transported to seeds resulting in more uniform maturity and higher seed yield. Such self-completion can be achieved in different ways, even in the same species. In white lupin, e.g. the cultivar 'Wat' drops its leaves in the stage of pod filling. Moreover, in white lupin as well as in yellow and narrow-leaved lupins unbranched genotypes have been selected in which only one, the main stem develops with the inflorescence on top. Additional nodes with a single flower appear instead of branches. The field bean Vicia faba similar to the pea produces inflorescence on nodes and consecutive nodes develop continuously from the apical meristem. But in the mutation type 'determinate growth', controlled by a single gene, the stem is ended by the inflorescence. A comparable gene was found in pea in 1980 as an effect of seed treatment of the line Wt 3527 by the combined dose 200r Nf+0.014% NEU. Plants are characterized by inflorescence on the top of the stem and smaller number of flowering nodes. Sometimes apical flowers are abnormal, open, but fertile. The mutant was included in the gene bank under number Wt 16100. A phenotypically similar line was found at the John Innes Institute, Norwich (UK). According to the locus allelism test (Wt 16100 x Jl 1358) both mutants are controlled by the same gene. The suggested symbol for this monogenic inherited character is det determinated growth. For the linkage test, the tester line Wl 1238 was crossed with the mutant Wt 16100. The
Search for methylation-sensitive amplification polymorphisms in mutant figs.
Rodrigues, M G F; Martins, A B G; Bertoni, B W; Figueira, A; Giuliatti, S
2013-07-08
Fig (Ficus carica) breeding programs that use conventional approaches to develop new cultivars are rare, owing to limited genetic variability and the difficulty in obtaining plants via gamete fusion. Cytosine methylation in plants leads to gene repression, thereby affecting transcription without changing the DNA sequence. Previous studies using random amplification of polymorphic DNA and amplified fragment length polymorphism markers revealed no polymorphisms among select fig mutants that originated from gamma-irradiated buds. Therefore, we conducted methylation-sensitive amplified polymorphism analysis to verify the existence of variability due to epigenetic DNA methylation among these mutant selections compared to the main cultivar 'Roxo-de-Valinhos'. Samples of genomic DNA were double-digested with either HpaII (methylation sensitive) or MspI (methylation insensitive) and with EcoRI. Fourteen primer combinations were tested, and on an average, non-methylated CCGG, symmetrically methylated CmCGG, and hemimethylated hmCCGG sites accounted for 87.9, 10.1, and 2.0%, respectively. MSAP analysis was effective in detecting differentially methylated sites in the genomic DNA of fig mutants, and methylation may be responsible for the phenotypic variation between treatments. Further analyses such as polymorphic DNA sequencing are necessary to validate these differences, standardize the regions of methylation, and analyze reads using bioinformatic tools.
Bamaga, Omar A A; Mahdy, Mohammed A K; Lim, Yvonne A L
2015-12-22
Malaria in Yemen is mainly caused by Plasmodium falciparum and 25% of the population is at high risk. Sulfadoxine-pyrimethamine (SP) had been used as monotherapy against P. falciparum. Emergence of chloroquine resistance led to the shift in anti-malarial treatment policy in Yemen to artemisinin-based combination therapy, that is artesunate (AS) plus SP as first-line therapy for uncomplicated malaria and artemether-lumefantrine as second-line treatment. This study aimed to screen mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes associated with SP resistance among P. falciparum population in Hadhramout governorate, Yemen. Genomic DNA was extracted from dried blood spots of 137 P. falciparum isolates collected from a community-based study. DNA was amplified using nested polymerase chain reaction (PCR) and subsequently sequenced for Pfdhfr and Pfdhps genes. Sequences were analysed for mutations in Pfdhfr gene codons 51, 59, 108, and 164 and in Pfdhps gene codons 436, 437, and 540. A total of 128 and 114 P. falciparum isolates were successfully sequenced for Pfdhfr and Pfdhps genes, respectively. Each Pfdhfr mutant allele (I51 and N108) in P. falciparum population had a frequency of 84%. Pfdhfr R59 mutant allele was detected in one isolate. Mutation at codon 437 (G437) in the Pfdhps gene was detected in 44.7% of falciparum malaria isolates. Frequencies of Pfdhfr double mutant genotype (I51C59N108I164) and Pfdhfr/Pfdhps triple mutant genotype (I51C59N108I164-S436G437K540) were 82.8 and 39.3%, respectively. One isolate harboured Pfdhfr triple mutant genotype (I51, R59, N108, I164) and Pfdhfr/Pfdhps quadruple mutant genotype (I51R59N108I164-S436G437K540). High frequencies of Pfdhfr and Pfdhps mutant alleles and genotypes in P. falciparum population in Hadhramout, Yemen, highlight the risk of developing resistance for SP, the partner drug of AS, which subsequently will expose the parasite to AS monotherapy increasing then the
Variations in CCL3L gene cluster sequence and non-specific gene copy numbers
Directory of Open Access Journals (Sweden)
Edberg Jeffrey C
2010-03-01
Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.
Establishment of HeLa cell mutants deficient in sphingolipid-related genes using TALENs.
Directory of Open Access Journals (Sweden)
Toshiyuki Yamaji
Full Text Available Sphingolipids are essential components in eukaryotes and have various cellular functions. Recent developments in genome-editing technologies have facilitated gene disruption in various organisms and cell lines. We here show the disruption of various sphingolipid metabolic genes in human cervical carcinoma HeLa cells by using transcription activator-like effector nucleases (TALENs. A TALEN pair targeting the human CERT gene (alternative name COL4A3BP encoding a ceramide transport protein induced a loss-of-function phenotype in more than 60% of HeLa cells even though the cell line has a pseudo-triploid karyotype. We have isolated several loss-of-function mutant clones for CERT, UGCG (encoding glucosylceramide synthase, and B4GalT5 (encoding the major lactosylceramide synthase, and also a CERT/UGCG double-deficient clone. Characterization of these clones supported previous proposals that CERT primarily contributes to the synthesis of SM but not GlcCer, and that B4GalT5 is the major LacCer synthase. These newly established sphingolipid-deficient HeLa cell mutants together with our previously established stable transfectants provide a 'sphingolipid-modified HeLa cell panel,' which will be useful to elucidate the functions of various sphingolipid species against essentially the same genomic background.
Margis-Pinheiro, Marcia; Zhou, Xue-Rong; Zhu, Qian-Hao; Dennis, Elizabeth S; Upadhyaya, Narayana M
2005-03-01
We have isolated a severe dwarf transposon (Ds) insertion mutant in rice (Oryza sativa L.), which could be differentiated early in the seedling stage by reduced shoot growth and dark green leaves, and later by severe dwarfism and failure to initiate flowering. These mutants, however, showed normal seed germination and root growth. One of the sequences flanking Ds, rescued from the mutant, was of a chromosome 4-located putative ent-kaurene synthase (KS) gene, encoding the enzyme catalyzing the second step of the gibberellin (GA) biosynthesis pathway. Dwarf mutants were always homozygous for this Ds insertion and no normal plants homozygous for this mutation were recovered in the segregating progeny, indicating that the Ds insertion mutation is recessive. As mutations in three recently reported rice GA-responsive dwarf mutant alleles and the dwarf mutation identified in this study mapped to the same locus, we designate the corresponding gene OsKS1. The osks1 mutant seedlings were responsive to exogenous gibberellin (GA3). OsKS1 transcripts of about 2.3 kb were detected in leaves and stem of wild-type plants, but not in germinating seeds or roots, suggesting that OsKS1 is not involved in germination or root growth. There are at least five OsKS1-like genes in the rice genome, four of which are also represented in rice expressed sequence tag (EST) databases. All OsKS1-like genes are transcribed with different expression patterns. ESTs corresponding to all six OsKS genes are represented in other cereal databases including barley, wheat and maize, suggesting that they are biologically active.
Sequence comparison and phylogenetic analysis of core gene of ...
African Journals Online (AJOL)
Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...
Directory of Open Access Journals (Sweden)
Jenna VanLiere Canzoniero
2017-07-01
Full Text Available Barcoding techniques are used to reduce error from next-generation sequencing, with applications ranging from understanding tumor subclone populations to detecting circulating tumor DNA. Collisions occur when more than one sample molecule is tagged by the same unique identifier (UID and can result in failure to detect very-low-frequency mutations and error in estimating mutation frequency. Here, we created computer models of barcoding technique, with and without amplification bias introduced by the UID, and analyzed the effect of collisions for a range of mutant allele frequencies (1e−6 to 0.2, number of sample molecules (10 000 to 1e7, and number of UIDs (4 10 -4 14 . Inability to detect rare mutant alleles occurred in 0% to 100% of simulations, depending on collisions and number of mutant molecules. Collisions also introduced error in estimating mutant allele frequency resulting in underestimation of minor allele frequency. Incorporating an understanding of the effect of collisions into experimental design can allow for optimization of the number of sample molecules and number of UIDs to minimize the negative impact on rare mutant detection and mutant frequency estimation.
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams.
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-07-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar 'Sasanishiki') that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined.
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams
International Nuclear Information System (INIS)
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N.; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-01-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UVTolerantRice319), was isolated from a mutagenized population derived from 2500 M 1 seeds (of the UVB-resistant cultivar ‘Sasanishiki’) that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined
Cleyrat, Cédric; Girard, Romain; Choi, Eun H; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S
2017-09-26
Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood-derived CD34 + cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients.
Identification of Heading Date Six (Hd6 Gene Derived from Rice Mutant Varieties
Directory of Open Access Journals (Sweden)
Aryanti Aryanti
2017-04-01
Full Text Available Genes which were associated with flowering time to indicate the early maturity is known as heading date (Hd. Heading date six (Hd6 gene was identified from rice mutant varieties were Atomita 2, Atomita 3, Atomita 4, Bestari, Cilosari, Diah Suci, Sidenuk, Kahayan, Mayang, Meraoke, Mira-1, Pandan Putri, Superwin, Suluttan Unsrat 1, Suluttan Unsrat 2, Winongo, Woyla, Yuwono, while the rice var. Nipponbare was used as a positive control. All of rice mutant varieties derived from mutation induction by the dose of 0.2 kGy. The aim of this experiment was to find out the data base of mutant varieties which could be used as parent material with earlier maturity trait genetically. To obtain the DNA of plants, young leaves of each variety were extracted by liquid nitrogen, and then lysis and extracted by Kit Plant Genomic DNA. The amplification of DNA with 7 primers of Hd6 conducted of 40 cycles by PCR and were continues to separated by 1 % agarose. The results were shown that the rice Mira-1 and Bestari varieties obtained from mutation of Cisantana highly different from one to another on 7 primers of Hd6 used. Mayang variety from mutation of cross breeding between Cilosari and IR64, Pandan putri from Pandan wangi and Woyla from mutation of cross breeding from Atomita 2 and IR64 were highly different with those of their parents. Identification of Hd6 gene on Sidenuk variety was shown the same bands pattern with Nipponbare as control positive toward all primers used, this variety would be better for earlier maturity parent material compared to others. The information could be useful for breeding programs aiming to develop early maturing widely adaptive and high yielding rice cultivars.
International Nuclear Information System (INIS)
Chen Pingping; Zhang Xiaoming; Ye Shenghai; Zhao Ningchun; Lu Yanting; Liu Heqin; Jin Qingsheng; Yang Ling
2010-01-01
A lesion mimic mutant,obtained by radiation mutagenesis on the seeds of a japonica rice variety Zhejing 22, exhibited a lesion mimic phenotype during the whole growth stage under different environments. Genetic analysis indicated that the mutant trait was controlled by a single recessive gene named spl (t). Relying on simple sequence repeat (SSR) and recessive class analysis method to map the spl (t) gene with a F 2 population was constructed by crossing the mutant spl (t) with Zhenshan 97B.spl (t) was mapped in the interval of 0.8cM between RM7195 and RM27929 near centromere region on the short arm of chromosome 12.Blue trypan dye analyses indicated that the lesion mimic trait of the mutant was caused by the programmer cell death. Further study showed that the programmer cell death was caused by H 2 O 2 oxidative burst. By inoculation of bacterial leaf blight and blast strains, the resistances of the mutant were similar to the wild variety Zhejing 22. (authors)
The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.
Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G
2002-07-01
Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.
Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun
2018-02-01
The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the
Cloning of a postreplication repair gene in Drosophila
International Nuclear Information System (INIS)
Banga, S.S.; Yamamoto, A.H.; Mason, J.M.; Boyd, J.B.
1987-01-01
Mutants at the mei-41 locus in Drosophila are strongly hypersensitive to each of eight tested mutagens. Mutant flies exhibit reduced meiotic recombination and elevated levels of chromosomal aberrations. In analogy with the defect in xeroderma pigmentosum variant cells, mei-41 cells are strongly defective in postreplication repair following UV radiation. In preparation for cloning that gene they have performed complementation studies between chromosomal aberrations and mei-41 mutants. That study has localized the mei-41 gene to polytene chromosome bands 14C4-6. A chromosomal walk conducted in that region has recovered about 65 kb of contiguous DNA sequence. The position of the mei-41 gene within that region has been established with the aid of a mutation in that gene which was generated by the insertion of a transposable element. Transcription mapping is being employed to define the complete coding region of the gene in preparation for investigations of gene function
A crossing programme with mutants in peas: Utilization of a gene bank and a computer system
International Nuclear Information System (INIS)
Blixt, S.
1976-01-01
A gene bank for peas was established at Weibullsholm in 1930, comprising about 1500 lines and including a great number of spontaneous and induced mutants. A Wang 2200 computair system is used in the maintenance and utilization of the gene bank information. The system at present provides programs for establishing and maintaining data-files for lines and crosses, statistical programs for linkage calculations, and technical aids in growing and classifying the material. The system is very promising and can be handled without previous experience of computer work. This system is used in the planning of a specific plant breeding project, PMX and search for material to be used in the project. The PMX project as a whole aims at adapting the pea better to monoculture and to a highly mechanized agriculture, as well as at improving its nutritional value. The material used in the project up to now is four modern varieties, two primitive varieties, two cross-recombinants, one ecotype, three spontaneous mutants and five induced mutants. (author)
Yarimizu, Tohru; Nonklang, Sanom; Nakamura, Junpei; Tokuda, Shuya; Nakagawa, Takaaki; Lorreungsil, Sasithorn; Sutthikhumpha, Surasit; Pukahuta, Charida; Kitagawa, Takao; Nakamura, Mikiko; Cha-Aim, Kamonchai; Limtong, Savitree; Hoshida, Hisashi; Akada, Rinji
2013-12-01
The isolation and application of auxotrophic mutants for gene manipulations, such as genetic transformation, mating selection and tetrad analysis, form the basis of yeast genetics. For the development of these genetic methods in the thermotolerant fermentative yeast Kluyveromyces marxianus, we isolated a series of auxotrophic mutants with defects in amino acid or nucleic acid metabolism. To identify the mutated genes, linear DNA fragments of nutrient biosynthetic pathway genes were amplified from Saccharomyces cerevisiae chromosomal DNA and used to directly transform the K. marxianus auxotrophic mutants by random integration into chromosomes through non-homologous end joining (NHEJ). The appearance of transformant colonies indicated that the specific S. cerevisiae gene complemented the K. marxianus mutant. Using this interspecific complementation approach with linear PCR-amplified DNA, we identified auxotrophic mutations of ADE2, ADE5,7, ADE6, HIS2, HIS3, HIS4, HIS5, HIS6, HIS7, LYS1, LYS2, LYS4, LYS9, LEU1, LEU2, MET2, MET6, MET17, TRP3, TRP4 and TRP5 without the labour-intensive requirement of plasmid construction. Mating, sporulation and tetrad analysis techniques for K. marxianus were also established. With the identified auxotrophic mutant strains and S. cerevisiae genes as selective markers, NHEJ-mediated integrative transformation with PCR-amplified DNA is an attractive system for facilitating genetic analyses in the yeast K. marxianus. Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Joseph K. E. Ortega
2012-05-01
Full Text Available Regulation of cell growth is paramount to all living organisms. In plants, algae and fungi, regulation of expansive growth of cells is required for development and morphogenesis. Also, many sensory responses of stage IVb sporangiophores of Phycomyces blakesleeanus are produced by regulating elongation growth rate (growth responses and differential elongation growth rate (tropic responses. Stiff mutant sporangiophores exhibit diminished tropic responses and are found to be defective in at least four genes; madD, madE, madF and madG. Prior experimental research suggests that the defective genes affect growth regulation, but this was not verified. All the growth of the single-celled stalk of the stage IVb sporangiophore occurs in a short region termed the growth zone. Prior experimental and theoretical research indicates that elongation growth rate of the stage IVb sporangiophore can be regulated by controlling the cell wall mechanical properties within the growth zone and the magnitude of the turgor pressure. A quantitative biophysical model for elongation growth rate is required to elucidate the relationship between wall mechanical properties and turgor pressure during growth regulation. In this study, it is hypothesized that the mechanical properties of the wall within the growth zone of stiff mutant sporangiophores are different compared to wild type. A biophysical equation for elongation growth rate is derived for fungal and plant cells with a growth zone. Two strains of stiff mutants are studied, C149 madD120 (- and C216 geo- (-. Experimental results demonstrate that turgor pressure is larger but irreversible deformation rates of the wall within the growth zone and growth zone length are smaller for stiff mutant sporangiophores compared to wild type. These findings explain the diminished tropic responses of the stiff mutant sporangiophores and suggest that the defective genes affect the amount of wall-building material delivered to the inner
Cunningham, C; Davison, A J; MacLean, A R; Taus, N S; Baines, J D
2000-01-01
Herpes simplex virus type 1 (HSV-1) gene UL14 is located between divergently transcribed genes UL13 and UL15 and overlaps the promoters for both of these genes. UL14 also exhibits a substantial overlap of its coding region with that of UL13. It is one of the few HSV-1 genes for which a phenotype and protein product have not been described. Using mass spectrometric and immunological approaches, we demonstrated that the UL14 protein is a minor component of the virion tegument of 32 kDa which is expressed late in infection. In infected cells, the UL14 protein was detected in the nucleus at discrete sites within electron-dense nuclear bodies and in the cytoplasm initially in a diffuse distribution and then at discrete sites. Some of the UL14 protein was phosphorylated. A mutant with a 4-bp deletion in the central region of UL14 failed to produce the UL14 protein and generated small plaques. The mutant exhibited an extended growth cycle at low multiplicity of infection and appeared to be compromised in efficient transit of virus particles from the infected cell. In mice injected intracranially, the 50% lethal dose of the mutant was reduced more than 30,000-fold. Recovery of the mutant from the latently infected sacral ganglia of mice injected peripherally was significantly less than that of wild-type virus, suggesting a marked defect in the establishment of, or reactivation from, latent infection.
Tedesco, D; Fischer-Fantuzzi, L; Vesco, C
1993-03-01
Multiple amino acid substitutions were introduced into the SV40 large T region that harbors the retinoblastoma protein (Rb) binding site and the nuclear transport signal, changing either one or both of these determinants. Mutant activities were examined in a set of assays allowing different levels of transforming potential to be distinguished; phenotypic changes in established and pre-crisis rat embryo fibroblasts (REFs) were detected under isogenic cell conditions, and comparisons made with other established rodent cells. The limit of the transforming ability of mutants with important substitutions in the Rb binding site fell between two transformation levels of the same established rat cells. Such cells could be induced to form dense foci but not agar colonies (their parental pre-crises REFs, as expected, were untransformed either way). Nonetheless, agar colony induction was possible in other cell lines, such as mouse NIH3T3 and (for one of the mutants) rat F2408. All these mutants efficiently immortalized pre-crisis REFs. The transforming ability of cytoplasmic mutants appeared to depend on the integrity of the Rb-binding sequence to approximately the same extent as that of the wild-type large T, although evidence of in vivo Rb-cytoplasmic large T complexes was not found. The presence or absence of small t was critical when the transforming task of mutants was near the limit of their abilities.
DEFF Research Database (Denmark)
Issinger, O G; Hausmann, R
1973-01-01
During nonpermissive infection by a T7 amber mutant in gene 1 (phage RNA polymerase-deficient), synthesis of the products of the phage genes 3 (endonuclease), 3, 5 (lysozyme), 5 (DNA polymerase), and 17 (serum blocking power) was shown to occur at about half the rate as during wild-type infection...
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Cloning and sequencing of the gene for human β-casein
International Nuclear Information System (INIS)
Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.
1990-01-01
Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression
Directory of Open Access Journals (Sweden)
Rubens Monte-Neto
2015-02-01
Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.
Sequence-indexed mutations in maize using the UniformMu transposon-tagging population
Directory of Open Access Journals (Sweden)
Baier John
2007-05-01
Full Text Available Abstract Background Gene knockouts are a critical resource for functional genomics. In Arabidopsis, comprehensive knockout collections were generated by amplifying and sequencing genomic DNA flanking insertion mutants. These Flanking Sequence Tags (FSTs map each mutant to a specific locus within the genome. In maize, FSTs have been generated using DNA transposons. Transposable elements can generate unstable insertions that are difficult to analyze for simple knockout phenotypes. Transposons can also generate somatic insertions that fail to segregate in subsequent generations. Results Transposon insertion sites from 106 UniformMu FSTs were tested for inheritance by locus-specific PCR. We confirmed 89% of the FSTs to be germinal transposon insertions. We found no evidence for somatic insertions within the 11% of insertion sites that were not confirmed. Instead, this subset of insertion sites had errors in locus-specific primer design due to incomplete or low-quality genomic sequences. The locus-specific PCR assays identified a knockout of a 6-phosphogluconate dehydrogenase gene that co-segregates with a seed mutant phenotype. The mutant phenotype linked to this knockout generates novel hypotheses about the role for the plastid-localized oxidative pentose phosphate pathway during grain-fill. Conclusion We show that FSTs from the UniformMu population identify stable, germinal insertion sites in maize. Moreover, we show that these sequence-indexed mutations can be readily used for reverse genetic analysis. We conclude from these data that the current collection of 1,882 non-redundant insertion sites from UniformMu provide a genome-wide resource for reverse genetics.
International Nuclear Information System (INIS)
Shi, J.B.; Ye, G.J.; Yang, Y.Z.; Wang, F.; Zhou, Y; Wang, J.
2016-01-01
In the present study, the expression patterns of the key genes in the gibberellin synthesis pathway in the potato dwarf mutant M4P-9 were detected using quantitative real-time PCR. Using Actin as an internal control, CPS1, KS, KO, GA20ox1, and GA2ox1, genes for key gibberellin synthesis enzymes, were evaluated, along with a gibberellin receptor gene. The standard curves were obtained from dilutions of PCR product; the correlation coefficient for Actin was 0.995, and those for the target genes varied from 0.994 to 1.000. The expression patterns of gibberellin pathway genes in different growth stages and tissues were calculated according to the method of Pfaffl. These genes showed expression patterns that varied based on growth stage and tissue type. The higher expression levels of CPS1 and GA2ox1 in roots, the lower expression levels of GA20ox1 in roots during tuber formation stage; as well as the increased expression of GA20ox1 and GA2ox1 genes in stems during the tuber formation stage, likely play key roles in the plant height phenotype in M4P-9 mutant materials. This article provides a basis for researching the mechanism of gibberellin synthesis in potato. (author)
Fan, Lili; Fu, Kehe; Yu, Chuanjin; Ma, Jia; Li, Yaqian; Chen, Jie
2014-01-01
Agrobacterium tumefaciens-mediated transformation (ATMT) was used to generate an insertional mutant library of the mycelial fungus Trichoderma harzianum. From a total of 450 mutants, six mutants that showed significant influence on maize resistance to C. lunata were analyzed in detail. Maize coated with these mutants was more susceptible to C. lunata compared with those coated with a wild-type (WT) strain. Similar to other fungal ATMT libraries, all six mutants were single copy integrations, which occurred preferentially in noncoding regions (except two mutants) and were frequently accompanied by the loss of border sequences. Two mutants (T66 and T312) that were linked to resistance were characterized further. Maize seeds coated with T66 and T312 were more susceptible to C. lunata than those treated with WT. Moreover, the mutants affected the resistance of maize to C. lunata by enhancing jasmonate-responsive gene expression. T66 and T312 induced maize resistance to C. lunata infection through a jasmonic acid-dependent pathway.
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
International Nuclear Information System (INIS)
Cirullo, R.E.; Dana, S.; Wasmuth, J.J.
1983-01-01
A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure
Mutant power: using mutant allele collections for yeast functional genomics.
Norman, Kaitlyn L; Kumar, Anuj
2016-03-01
The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Human DNA repair and recombination genes
International Nuclear Information System (INIS)
Thompson, L.H.; Weber, C.A.; Jones, N.J.
1988-09-01
Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs
Viljoen, Albertus; Gutiérrez, Ana Victoria; Dupont, Christian; Ghigo, Eric; Kremer, Laurent
2018-01-01
Little is known about the disease-causing genetic determinants that are used by Mycobacterium abscessus , increasingly acknowledged as an important emerging pathogen, notably in cystic fibrosis. The presence or absence of surface exposed glycopeptidolipids (GPL) conditions the smooth (S) or rough (R) M. abscessus subsp. abscessus ( M. abscessus ) variants, respectively, which are characterized by distinct infective programs. However, only a handful of successful gene knock-out and conditional mutants have been reported in M. abscessus , testifying that genetic manipulation of this mycobacterium is difficult. To facilitate gene disruption and generation of conditional mutants in M. abscessus , we have designed a one-step single cross-over system that allows the rapid and simple generation of such mutants. Cloning of as small as 300 bp of the target gene allows for efficient homologous recombination to occur without additional exogenous recombination-promoting factors. The presence of tdTomato on the plasmids allows easily sifting out the large background of mutants spontaneously resistant to antibiotics. Using this strategy in the S genetic background and the target gene mmpL4a , necessary for GPL synthesis and transport, nearly 100% of red fluorescent clones exhibited a rough morphotype and lost GPL on the surface, suggesting that most red fluorescent colonies obtained after transformation incorporated the plasmid through homologous recombination into the chromosome. This system was further exploited to generate another strain with reduced GPL levels to explore how the presence of these cell wall-associated glycolipids influences M. abscessus hydrophobicity as well as virulence in the zebrafish model of infection. This mutant exhibited a more pronounced killing phenotype in zebrafish embryos compared to its S progenitor and this effect correlated with the production of abscesses in the central nervous system. Overall, these results suggest that the near
New applications of CRISPR/Cas9 system on mutant DNA detection.
Jia, Chenqiang; Huai, Cong; Ding, Jiaqi; Hu, Lingna; Su, Bo; Chen, Hongyan; Lu, Daru
2018-01-30
The detection of mutant DNA is critical for precision medicine, but low-frequency DNA mutation is very hard to be determined. CRISPR/Cas9 is a robust tool for in vivo gene editing, and shows the potential for precise in vitro DNA cleavage. Here we developed a DNA mutation detection system based on CRISPR/Cas9 that can detect gene mutation efficiently even in a low-frequency condition. The system of CRISPR/Cas9 cleavage in vitro showed a high accuracy similar to traditional T7 endonuclease I (T7E1) assay in estimating mutant DNA proportion in the condition of normal frequency. The technology was further used for low-frequency mutant DNA detection of EGFR and HBB somatic mutations. To the end, Cas9 was employed to cleave the wild-type (WT) DNA and to enrich the mutant DNA. Using amplified fragment length polymorphism analysis (AFLPA) and Sanger sequencing, we assessed the sensitivity of CRISPR/Cas9 cleavage-based PCR, in which mutations at 1%-10% could be enriched and detected. When combined with blocker PCR, its sensitivity reached up to 0.1%. Our results suggested that this new application of CRISPR/Cas9 system is a robust and potential method for heterogeneous specimens in the clinical diagnosis and treatment management. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
The Swedish mutant barley collection
Energy Technology Data Exchange (ETDEWEB)
NONE
1989-07-01
Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)
The Swedish mutant barley collection
International Nuclear Information System (INIS)
1989-01-01
Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)
A γA-Crystallin Mouse Mutant Secc with Small Eye, Cataract and Closed Eyelid.
Directory of Open Access Journals (Sweden)
Man Hei Cheng
Full Text Available Cataract is the most common cause of visual loss in humans. A spontaneously occurred, autosomal dominant mouse mutant Secc, which displayed combined features of small eye, cataract and closed eyelid was discovered in our laboratory. In this study, we identified the mutation and characterized the cataract phenotype of this novel Secc mutant. The Secc mutant mice have eyelids that remain half-closed throughout their life. The mutant lens has a significant reduction in size and with opaque spots clustered in the centre. Histological analysis showed that in the core region of the mutant lens, the fiber cells were disorganized and clefts and vacuoles were observed. The cataract phenotype was evident from new born stage. We identified the Secc mutation by linkage analysis using whole genome microsatellite markers and SNP markers. The Secc locus was mapped at chromosome 1 flanked by SNPs rs3158129 and rs13475900. Based on the chromosomal position, the candidate cataract locus γ-crystallin gene cluster (Cryg was investigated by sequencing. A single base deletion (299delG in exon 3 of Cryga which led to a frame-shift of amino acid sequence from position 91 was identified. As a result of this mutation, the sequences of the 3rd and 4th Greek-key motifs of the γA-crystallin are replaced with an unrelated C-terminal peptide of 75 residues long. Coincidentally, the point mutation generated a HindIII restriction site, allowing the identification of the CrygaSecc mutant allele by RFLP. Western blot analysis of 3-week old lenses showed that the expression of γ-crystallins was reduced in the CrygaSecc mutant. Furthermore, in cell transfection assays using CrygaSecc mutant cDNA expression constructs in 293T, COS-7 and human lens epithelial B3 cell lines, the mutant γA-crystallins were enriched in the insoluble fractions and appeared as insoluble aggregates in the transfected cells. In conclusion, we have demonstrated that the Secc mutation leads to the
Gene function analysis by artificial microRNAs in Physcomitrella patens.
Khraiwesh, Basel
2011-01-01
MicroRNAs (miRNAs) are ~21 nt long small RNAs transcribed from endogenous MIR genes which form precursor RNAs with a characteristic hairpin structure. miRNAs control the expression of cognate target genes by binding to reverse complementary sequences resulting in cleavage or translational inhibition of the target RNA. Artificial miRNAs (amiRNAs) can be generated by exchanging the miRNA/miRNA sequence of endogenous MIR precursor genes, while maintaining the general pattern of matches and mismatches in the foldback. Thus, for functional gene analysis amiRNAs can be designed to target any gene of interest. During the last decade the moss Physcomitrella patens emerged as a model plant for functional gene analysis based on its unique ability to integrate DNA into the nuclear genome by homologous recombination which allows for the generation of targeted gene knockout mutants. In addition to this, we developed a protocol to express amiRNAs in P. patens that has particular advantages over the generation of knockout mutants and might be used to speed up reverse genetics approaches in this model species.
Iron-dependent gene expression in Actinomyces oris
Directory of Open Access Journals (Sweden)
Matthew P. Mulé
2015-12-01
Results: When A. oris was grown under iron-limiting conditions, the genes encoding iron/siderophore transporters fetA and sidD showed increased expression. One of these genes (sidD was mutated, and the sidD::Km strain exhibited a 50% reduction in growth in late log and stationary phase cells in media that contained iron. This growth defect was restored when the sidD gene was provided in a complemented strain. We were able to isolate the AmdR-encoding gene in seven clinical isolates of Actinomyces. When these protein sequences were aligned to the laboratory strain, there was a high degree of sequence similarity. Conclusions: The growth of the sidD::Km mutant in iron-replete medium mirrored the growth of the wild-type strain grown in iron-limiting medium, suggesting that the sidD::Km mutant was compromised in iron uptake. The known iron regulator AmdR is well conserved in clinical isolates of A. oris. This work provides additional insight into iron metabolism in this important oral microbe.
Energy Technology Data Exchange (ETDEWEB)
Kokjohn, T.A.; Miller, R.V.
1987-04-01
We cloned a 2.3-kilobase-pair fragment of the Pseudomonas aeruginosa PAO chromosome which is capable of complementing recA mutations of Escherichia coli. The recA-complementing activity was further localized to a 1.5-kilobase-pair PvuII-HindIII fragment. Southern blot analysis under conditions of high stringency indicated that DNA sequence homology is shared by the E. coli recA gene and the P. aeruginosa recA analog. The cloned recA analog was shown to restore resistance to methyl methanesulfonate, nitrofurantoin, and UV irradiation to E. coli recA mutants. Upon introduction of the cloned P. aeruginosa gene, these mutants regained recombination proficiency in HfrH-mediated conjugation and the ability to induce lambda prophages and SOS functions (din gene transcription) after exposure to DNA-damaging agents. Lambda prophage carrying a cI ind mutation was not inducible, suggesting that the mechanism of induction of these SOS functions by the P. aeruginosa RecA analog is similar to that by the activated E. coli RecA protein. The product of the recA analog was identified in minicells as a protein of approximately 47,000 daltons. Western blot analysis using anti-E. coli RecA antibody demonstrated that this protein is antigenically cross-reactive with the E. coli recA protein. The recA-containing fragment was cloned into the broad-host-range vector pCP13 and introduced into Rec- strains of P. aeruginosa containing the rec-102 allele. The plasmid was shown to restore recombination proficiency in FP5-mediated conjugations and to restore resistance to UV irradiation and methyl methanesulfonate to these Rec- mutants. It was shown that a wild-type allele of rec-102 is necessary for UV-mediated induction of D3 and F116 prophages. The cloned recA analog restored the UV inducibility of these prophages in rec-102 mutants.
International Nuclear Information System (INIS)
Kokjohn, T.A.; Miller, R.V.
1987-01-01
We cloned a 2.3-kilobase-pair fragment of the Pseudomonas aeruginosa PAO chromosome which is capable of complementing recA mutations of Escherichia coli. The recA-complementing activity was further localized to a 1.5-kilobase-pair PvuII-HindIII fragment. Southern blot analysis under conditions of high stringency indicated that DNA sequence homology is shared by the E. coli recA gene and the P. aeruginosa recA analog. The cloned recA analog was shown to restore resistance to methyl methanesulfonate, nitrofurantoin, and UV irradiation to E. coli recA mutants. Upon introduction of the cloned P. aeruginosa gene, these mutants regained recombination proficiency in HfrH-mediated conjugation and the ability to induce lambda prophages and SOS functions (din gene transcription) after exposure to DNA-damaging agents. Lambda prophage carrying a cI ind mutation was not inducible, suggesting that the mechanism of induction of these SOS functions by the P. aeruginosa RecA analog is similar to that by the activated E. coli RecA protein. The product of the recA analog was identified in minicells as a protein of approximately 47,000 daltons. Western blot analysis using anti-E. coli RecA antibody demonstrated that this protein is antigenically cross-reactive with the E. coli recA protein. The recA-containing fragment was cloned into the broad-host-range vector pCP13 and introduced into Rec- strains of P. aeruginosa containing the rec-102 allele. The plasmid was shown to restore recombination proficiency in FP5-mediated conjugations and to restore resistance to UV irradiation and methyl methanesulfonate to these Rec- mutants. It was shown that a wild-type allele of rec-102 is necessary for UV-mediated induction of D3 and F116 prophages. The cloned recA analog restored the UV inducibility of these prophages in rec-102 mutants
Cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of Clostridium chauvoei
Directory of Open Access Journals (Sweden)
Saroj K. Dangi
2017-09-01
Full Text Available Aim: Blackleg disease is caused by Clostridium chauvoei in ruminants. Although virulence factors such as C. chauvoei toxin A, sialidase, and flagellin are well characterized, hyaluronidases of C. chauvoei are not characterized. The present study was aimed at cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of C. chauvoei. Materials and Methods: C. chauvoei strain ATCC 10092 was grown in ATCC 2107 media and confirmed by polymerase chain reaction (PCR using the primers specific for 16-23S rDNA spacer region. nagH gene of C. chauvoei was amplified and cloned into pRham-SUMO vector and transformed into Escherichia cloni 10G cells. The construct was then transformed into E. cloni cells. Colony PCR was carried out to screen the colonies followed by sequencing of nagH gene in the construct. Results: PCR amplification yielded nagH gene of 1143 bp product, which was cloned in prokaryotic expression system. Colony PCR, as well as sequencing of nagH gene, confirmed the presence of insert. Sequence was then subjected to BLAST analysis of NCBI, which confirmed that the sequence was indeed of nagH gene of C. chauvoei. Phylogenetic analysis of the sequence showed that it is closely related to Clostridium perfringens and Clostridium paraputrificum. Conclusion: The gene for virulence factor nagH was cloned into a prokaryotic expression vector and confirmed by sequencing.
Janssen, Dick B.; Pries, Frens; Ploeg, Jan van der; Kazemier, Bert; Terpstra, Peter; Witholt, Bernard
1989-01-01
A gene bank from the chlorinated hydrocarbon-degrading bacterium Xanthobacter autotrophicus GJ10 was prepared in the broad-host-range cosmid vector pLAFR1. By using mutants impaired in dichloroethane utilization and strains lacking dehalogenase activities, several genes involved in
Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen
2014-06-01
pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Charalampos Rallis
2014-01-01
Target of rapamycin complex 1 (TORC1, which controls growth in response to nutrients, promotes ageing in multiple organisms. The fission yeast Schizosaccharomyces pombe emerges as a valuable genetic model system to study TORC1 function and cellular ageing. Here we exploited the combinatorial action of rapamycin and caffeine, which inhibit fission yeast growth in a TORC1-dependent manner. We screened a deletion library, comprising ∼84% of all non-essential fission yeast genes, for drug-resistant mutants. This screen identified 33 genes encoding functions such as transcription, kinases, mitochondrial respiration, biosynthesis, intra-cellular trafficking, and stress response. Among the corresponding mutants, 5 showed shortened and 21 showed increased maximal chronological lifespans; 15 of the latter mutants showed no further lifespan increase with rapamycin and might thus represent key targets downstream of TORC1. We pursued the long-lived sck2 mutant with additional functional analyses, revealing that the Sck2p kinase functions within the TORC1 network and is required for normal cell growth, global protein translation, and ribosomal S6 protein phosphorylation in a nutrient-dependent manner. Notably, slow cell growth was associated with all long-lived mutants while oxidative-stress resistance was not.
Energy Technology Data Exchange (ETDEWEB)
Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.
2004-04-01
The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.
PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...
African Journals Online (AJOL)
Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.
Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H
1995-01-01
Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes
Directory of Open Access Journals (Sweden)
Manal Helal
Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
Directory of Open Access Journals (Sweden)
Eviatar Nevo
2013-10-01
Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.
Citrus plastid-related gene profiling based on expressed sequence tag analyses
Directory of Open Access Journals (Sweden)
Tercilio Calsa Jr.
2007-01-01
Full Text Available Plastid-related sequences, derived from putative nuclear or plastome genes, were searched in a large collection of expressed sequence tags (ESTs and genomic sequences from the Citrus Biotechnology initiative in Brazil. The identified putative Citrus chloroplast gene sequences were compared to those from Arabidopsis, Eucalyptus and Pinus. Differential expression profiling for plastid-directed nuclear-encoded proteins and photosynthesis-related gene expression variation between Citrus sinensis and Citrus reticulata, when inoculated or not with Xylella fastidiosa, were also analyzed. Presumed Citrus plastome regions were more similar to Eucalyptus. Some putative genes appeared to be preferentially expressed in vegetative tissues (leaves and bark or in reproductive organs (flowers and fruits. Genes preferentially expressed in fruit and flower may be associated with hypothetical physiological functions. Expression pattern clustering analysis suggested that photosynthesis- and carbon fixation-related genes appeared to be up- or down-regulated in a resistant or susceptible Citrus species after Xylella inoculation in comparison to non-infected controls, generating novel information which may be helpful to develop novel genetic manipulation strategies to control Citrus variegated chlorosis (CVC.
Speeding disease gene discovery by sequence based candidate prioritization
Directory of Open Access Journals (Sweden)
Porteous David J
2005-03-01
Full Text Available Abstract Background Regions of interest identified through genetic linkage studies regularly exceed 30 centimorgans in size and can contain hundreds of genes. Traditionally this number is reduced by matching functional annotation to knowledge of the disease or phenotype in question. However, here we show that disease genes share patterns of sequence-based features that can provide a good basis for automatic prioritization of candidates by machine learning. Results We examined a variety of sequence-based features and found that for many of them there are significant differences between the sets of genes known to be involved in human hereditary disease and those not known to be involved in disease. We have created an automatic classifier called PROSPECTR based on those features using the alternating decision tree algorithm which ranks genes in the order of likelihood of involvement in disease. On average, PROSPECTR enriches lists for disease genes two-fold 77% of the time, five-fold 37% of the time and twenty-fold 11% of the time. Conclusion PROSPECTR is a simple and effective way to identify genes involved in Mendelian and oligogenic disorders. It performs markedly better than the single existing sequence-based classifier on novel data. PROSPECTR could save investigators looking at large regions of interest time and effort by prioritizing positional candidate genes for mutation detection and case-control association studies.
Rapid gene isolation in barley and wheat by mutant chromosome sequencing
Czech Academy of Sciences Publication Activity Database
Sanchez-Martin, J.; Steuernagel, B.; Ghosh, S.; Herren, G.; Hurni, S.; Adamski, N.; Vrána, Jan; Kubaláková, Marie; Krattinger, S.G.; Wicker, T.; Doležel, Jaroslav; Keller, B.; Wulff, B. B. H.
2016-01-01
Roč. 17, OCT 31 (2016), č. článku 221. ISSN 1465-6906 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : induced mutations * mitotic chromosomes * confers resistance * exome capture * genome * identification * evolution * pathogens * hordeum * MutChromSeq * Gene cloning * Mutational genomics * Chromosome flow sorting * Triticeae * Wheat * Barley Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.313, year: 2015
Sun, Changhong; Fan, Yu; Li, Juan; Wang, Gancheng; Zhang, Hanshuo; Xi, Jianzhong Jeff
2015-02-01
Transcription activator-like effectors (TALEs) are becoming powerful DNA-targeting tools in a variety of mammalian cells and model organisms. However, generating a stable cell line with specific gene mutations in a simple and rapid manner remains a challenging task. Here, we report a new method to efficiently produce monoclonal cells using integrated TALE nuclease technology and a series of high-throughput cell cloning approaches. Following this method, we obtained three mTOR mutant 293T cell lines within 2 months, which included one homozygous mutant line. © 2014 Society for Laboratory Automation and Screening.
Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.
Directory of Open Access Journals (Sweden)
Heike Hadrys
Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae
International Nuclear Information System (INIS)
Galvao, C.W.; Pedrosa, F.O.; Souza, E.M.; Yates, M.G.; Chubatsu, L.S.; Steffens, M.B.R.
2003-01-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable σ 70 -dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response. (author)
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae
Energy Technology Data Exchange (ETDEWEB)
Galvao, C.W.; Pedrosa, F.O.; Souza, E.M.; Yates, M.G.; Chubatsu, L.S.; Steffens, M.B.R. [Univ. Federal do Parana, Dept. of Biochemistry and Molecular Biology, Curitiba (Brazil)]. E-mail: steffens@bioufpr.br
2003-02-15
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable {sigma}{sup 70}-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response. (author)
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2003-02-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.
Molecular analysis of mutants of the Neurospora adenylosuccinate ...
Indian Academy of Sciences (India)
2012-08-07
Aug 7, 2012 ... and mutants induced with X-ray, UV or chemical mutagens. ... We have sequenced the ad-8 locus from 13 of these mutants and identified the molecular nature ..... mutants in yeast by selection for constitutive behavior in pig-.
Structure and expression of cytochrome f in an Oenothera plastome mutant.
Johnson, E M; Sears, B B
1990-06-01
The chloroplast mutant pm7 is one of a number of mutants derived from the plastome mutator (pm) line of Oenothera hookeri, strain Johansen. Immunoblotting showed that this mutant accumulates a protein that is cross-antigenic with cytochrome f, but five kilodaltons larger than the mature wild-type protein. Since cytochrome f is known to be translated on plastid ribosomes as a precursor with an amino-terminal extension, it is proposed that the unprocessed cytochrome f precursor accumulates in pm7. In addition to this precursor-sized cytochrome f protein, some mature-sized cytochrome f was also found in the mutant plastids. The pm7 mutation is inherited in a non-Mendelian fashion; but no alterations in chloroplast DNA restriction patterns, or differences in DNA sequence in the region encoding cytochrome f, were found in a comparison of the wild-type and pm7 chloroplast DNAs. Although the mutant was capable of synthesizing heme, no covalently-bound heme, normally found associated with mature, functional, cytochrome f was detected in the mutant at sizes expected for the presumed precursor, or for mature cytochrome f. These results indicate that the aberrant accumulation of a precursor-sized cytochrome f in pm7 is not due to a lesion directly in the plastid gene encoding cytochrome f, petA, or to a deficiency in the ability of the mutant plastids to synthesize or accumulate heme.
Genetic analysis of plant height in induced mutants of aromatic rice
International Nuclear Information System (INIS)
Kole, P.C.
2005-01-01
Inheritance of plant height in five gamma-ray induced mutants of aromatic rice cultivar Gobindabhog was studied through 6 x 6 diallel cross and segregation analyses. Diallel analysis revealed presence of additive and non-additive gene action with the preponderance of the latter. Proportion of dominant and recessive alleles was distributed unequally among the parents. The direction of dominance was towards tallness. The number of groups of genes was found to be three. The segregation analysis indicated the role of a single major recessive gene for height reduction in three mutants and, in another mutant, a single major recessive gene with negative modifiers. The other semi-dwarf mutant had two major recessive genes with almost equal effect in height reduction. The mutant allele(s) of the latter two mutants were non-allelic to sd sub(1) gene, which could be used as an alternative source of Dee Gee Woo Gen to widen the genetic diversity in semi-dwarfism [it
Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I
2013-01-01
Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.
International Nuclear Information System (INIS)
Williamson, M.S.; Game, J.C.; Fogel, S.
1985-01-01
The PMS1 mutants, isolated on the basis of sharply elevated meiotic prototroph frequencies for two closely linked HIS4 alleles, display pleiotropic phenotypes in meiotic and mitotic cells. Two isolates carrying recessive mutations in PMS1 were characterized. They identify a function required to maintain low postmeiotic segregation (PMS) frequencies at many heterozygous sites. In addition, they are mitotic mutators. In mutant diploids, spore viability is reduced, and among survivors, gene conversion and postmeiotic segregation frequencies are increased, but reciprocal exchange frequencies are not affected. The conversion event pattern is also dramatically changed in multiply marked regions in PMS1 homozygotes. The PMS1 locus maps near MET4 on chromosome XIV. The PMS1 gene may identify an excision-resynthesis long patch mismatch correction function or a function that facilitates correction tract elongation. The PMS1 gene product may also play an important role in spontaneous mitotic mutation avoidance and correction of mismatches in heteroduplex DNA formed during spontaneous and UV-induced mitotic recombination. Based on meiotic recombination models emphasizing mismatch correction in heteroduplex DNA intermediates, this interpretation is favored, but alternative interpretations involving longer recombination intermediates in the mutants are also considered
Directory of Open Access Journals (Sweden)
Solis Julio
2010-10-01
Full Text Available Abstract Background Sweetpotato (Ipomoea batatas (L. Lam., a hexaploid outcrossing crop, is an important staple and food security crop in developing countries in Africa and Asia. The availability of genomic resources for sweetpotato is in striking contrast to its importance for human nutrition. Previously existing sequence data were restricted to around 22,000 expressed sequence tag (EST sequences and ~ 1,500 GenBank sequences. We have used 454 pyrosequencing to augment the available gene sequence information to enhance functional genomics and marker design for this plant species. Results Two quarter 454 pyrosequencing runs used two normalized cDNA collections from stems and leaves from drought-stressed sweetpotato clone Tanzania and yielded 524,209 reads, which were assembled together with 22,094 publically available expressed sequence tags into 31,685 sets of overlapping DNA segments and 34,733 unassembled sequences. Blastx comparisons with the UniRef100 database allowed annotation of 23,957 contigs and 15,342 singletons resulting in 24,657 putatively unique genes. Further, 27,119 sequences had no match to protein sequences of UniRef100database. On the basis of this gene index, we have identified 1,661 gene-based microsatellite sequences, of which 223 were selected for testing and 195 were successfully amplified in a test panel of 6 hexaploid (I. batatas and 2 diploid (I. trifida accessions. Conclusions The sweetpotato gene index is a useful source for functionally annotated sweetpotato gene sequences that contains three times more gene sequence information for sweetpotato than previous EST assemblies. A searchable version of the gene index, including a blastn function, is available at http://www.cipotato.org/sweetpotato_gene_index.
DEFF Research Database (Denmark)
Yilmaz, Pelin; Kottmann, Renzo; Field, Dawn
2011-01-01
Here we present a standard developed by the Genomic Standards Consortium (GSC) for reporting marker gene sequences--the minimum information about a marker gene sequence (MIMARKS). We also introduce a system for describing the environment from which a biological sample originates. The 'environment...
Hsieh, Wei-Yu; Liao, Jo-Chien; Wang, Hsin-Tzu; Hung, Tzu-Huan; Tseng, Ching-Chih; Chung, Tsui-Yun; Hsieh, Ming-Hsiun
2017-07-01
Thiamin diphosphate (TPP, vitamin B 1 ) is an essential coenzyme present in all organisms. Animals obtain TPP from their diets, but plants synthesize TPPde novo. We isolated and characterized an Arabidopsis pale green1 (pale1) mutant that contained higher concentrations of thiamin monophosphate (TMP) and less thiamin and TPP than the wild type. Supplementation with thiamin, but not the thiazole and pyrimidine precursors, rescued the mutant phenotype, indicating that the pale1 mutant is a thiamin-deficient mutant. Map-based cloning and whole-genome sequencing revealed that the pale1 mutant has a mutation in At5g32470 encoding a TMP phosphatase of the TPP biosynthesis pathway. We further confirmed that the mutation of At5g32470 is responsible for the mutant phenotypes by complementing the pale1 mutant with constructs overexpressing full-length At5g32470. Most plant TPP biosynthetic enzymes are located in the chloroplasts and cytosol, but At5g32470-GFP localized to the mitochondrion of the root, hypocotyl, mesophyll and guard cells of the 35S:At5g32470-GFP complemented plants. The subcellular localization of a functional TMP phosphatase suggests that the complete vitamin B1 biosynthesis pathway may involve the chloroplasts, mitochondria and cytosol in plants. Analysis of PALE1 promoter-uidA activity revealed that PALE1 is mainly expressed in vascular tissues of Arabidopsis seedlings. Quantitative RT-PCR analysis of TPP biosynthesis genes and genes encoding the TPP-dependent enzymes pyruvate dehydrogenase, α-ketoglutarate dehydrogenase and transketolase revealed that the transcript levels of these genes were upregulated in the pale1 mutant. These results suggest that endogenous levels of TPP may affect the expression of genes involved in TPP biosynthesis and TPP-dependent enzymes. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.
Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George
2010-04-01
The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.
DNA sequence analysis of the mutational specificity of u.v. light in the SUP4-o gene of yeast
International Nuclear Information System (INIS)
Kunz, B.A.; Mis, J.R.A.; Pierce, M.K.; Giroux, C.N.
1987-01-01
Mutations induced in the SUP4-o gene of Saccharomyces cerevisiae by u.v. irradiation have been characterized. DNA sequence analysis of 120 mutants revealed that u.v. induced all types of base substitutions, although transitions, in particular G:C → A:T events predominated. In addition, a small number of single base pair deletions and double mutations, occurring in tandem or separated by a few base pairs, were recovered. The base pair substitutions were not distributed randomly in the SUP4-o gene and, with one exception, were all located at sites of adjacent pyrimidines, suggesting they were targeted by u.v. photolesions. A substantial fraction of the mutations were detected at hotspots for u.v. mutagenesis. The majority of changes occurred at the 3' base of dipyrimidine sequences where both cyclobutane dimers and [6-4]-photoproducts could form. Approximately one-third of the induced base substitutions were found at potential pyrimidine dimer sites where [6-4]-photoproducts would be expected to occur rarely. Possible origins of the induced mutations and the role of cyclobutane dimers as premutational u.v. lesions in yeast are considered. (author)
A sorghum (Sorghum bicolor mutant with altered carbon isotope ratio.
Directory of Open Access Journals (Sweden)
Govinda Rizal
Full Text Available Recent efforts to engineer C4 photosynthetic traits into C3 plants such as rice demand an understanding of the genetic elements that enable C4 plants to outperform C3 plants. As a part of the C4 Rice Consortium's efforts to identify genes needed to support C4 photosynthesis, EMS mutagenized sorghum populations were generated and screened to identify genes that cause a loss of C4 function. Stable carbon isotope ratio (δ13C of leaf dry matter has been used to distinguishspecies with C3 and C4 photosynthetic pathways. Here, we report the identification of a sorghum (Sorghum bicolor mutant with a low δ13C characteristic. A mutant (named Mut33 with a pale phenotype and stunted growth was identified from an EMS treated sorghum M2 population. The stable carbon isotope analysis of the mutants showed a decrease of 13C uptake capacity. The noise of random mutation was reduced by crossing the mutant and its wildtype (WT. The back-cross (BC1F1 progenies were like the WT parent in terms of 13C values and plant phenotypes. All the BC1F2 plants with low δ13C died before they produced their 6th leaf. Gas exchange measurements of the low δ13C sorghum mutants showed a higher CO2 compensation point (25.24 μmol CO2.mol-1air and the maximum rate of photosynthesis was less than 5μmol.m-2.s-1. To identify the genetic determinant of this trait, four DNA pools were isolated; two each from normal and low δ13C BC1F2 mutant plants. These were sequenced using an Illumina platform. Comparison of allele frequency of the single nucleotide polymorphisms (SNPs between the pools with contrasting phenotype showed that a locus in Chromosome 10 between 57,941,104 and 59,985,708 bps had an allele frequency of 1. There were 211 mutations and 37 genes in the locus, out of which mutations in 9 genes showed non-synonymous changes. This finding is expected to contribute to future research on the identification of the causal factor differentiating C4 from C3 species that can be used
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Screening of whole genome sequences identified high-impact variants for stallion fertility.
Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar
2016-04-14
Stallion fertility is an economically important trait due to the increase of artificial insemination in horses. The availability of whole genome sequence data facilitates identification of rare high-impact variants contributing to stallion fertility. The aim of our study was to genotype rare high-impact variants retrieved from next-generation sequencing (NGS)-data of 11 horses in order to unravel harmful genetic variants in large samples of stallions. Gene ontology (GO) terms and search results from public databases were used to obtain a comprehensive list of human und mice genes predicted to participate in the regulation of male reproduction. The corresponding equine orthologous genes were searched in whole genome sequence data of seven stallions and four mares and filtered for high-impact genetic variants using SnpEFF, SIFT and Polyphen 2 software. All genetic variants with the missing homozygous mutant genotype were genotyped on 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. Mixed linear model analysis was employed for an association analysis with de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). We screened next generation sequenced data of whole genomes from 11 horses for equine genetic variants in 1194 human and mice genes involved in male fertility and linked through common gene ontology (GO) with male reproductive processes. Variants were filtered for high-impact on protein structure and validated through SIFT and Polyphen 2. Only those genetic variants were followed up when the homozygote mutant genotype was missing in the detection sample comprising 11 horses. After this filtering process, 17 single nucleotide polymorphism (SNPs) were left. These SNPs were genotyped in 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. An association analysis in 216 Hanoverian stallions revealed a significant association of the splice-site disruption variant
High throughput 16S rRNA gene amplicon sequencing
DEFF Research Database (Denmark)
Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup
S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...
Oloriz, María I; Gil, Víctor; Rojas, Luis; Portal, Orelvis; Izquierdo, Yovanny; Jiménez, Elio; Höfte, Monica
2012-05-01
Brown rust caused by the fungus Puccinia melanocephala is a major disease of sugarcane (Saccharum spp.). A sugarcane mutant, obtained by chemical mutagenesis of the susceptible variety B4362, showed a post-haustorial hypersensitive response (HR)-mediated resistance to the pathogen and was used to identify genes differentially expressed in response to P. melanocephala via suppression subtractive hybridization (SSH). Tester cDNA was derived from the brown rust-resistant mutant after inoculation with P. melanocephala, while driver cDNAs were obtained from the non-inoculated resistant mutant and the inoculated susceptible donor variety B4362. Database comparisons of the sequences of the SSH recombinant clones revealed that, of a subset of 89 non-redundant sequences, 88% had similarity to known functional genes, while 12% were of unknown function. Thirteen genes were selected for transcript profiling in the resistant mutant and the susceptible donor variety. Genes involved in glycolysis and C4 carbon fixation were up-regulated in both interactions probably due to disturbance of sugarcane carbon metabolism by the pathogen. Genes related with the nascent polypeptide associated complex, post-translational proteome modulation and autophagy were transcribed at higher levels in the compatible interaction. Up-regulation of a putative L-isoaspartyl O-methyltransferase S-adenosylmethionine gene in the compatible interaction may point to fungal manipulation of the cytoplasmatic methionine cycle. Genes coding for a putative no apical meristem protein, S-adenosylmethionine decarboxylase, non-specific lipid transfer protein, and GDP-L-galactose phosphorylase involved in ascorbic acid biosynthesis were up-regulated in the incompatible interaction at the onset of haustorium formation, and may contribute to the HR-mediated defense response in the rust-resistant mutant.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Cabral, Rita M; Kurban, Mazen; Wajid, Muhammad; Shimomura, Yutaka; Petukhova, Lynn; Christiano, Angela M
2012-04-01
Generalized peeling skin syndrome (PSS) is an autosomal recessive genodermatosis characterized by lifelong, continuous shedding of the upper epidermis. Using whole-genome homozygozity mapping and whole-exome sequencing, we identified a novel homozygous missense mutation (c.229C>T, R77W) within the CHST8 gene, in a large consanguineous family with non-inflammatory PSS type A. CHST8 encodes a Golgi transmembrane N-acetylgalactosamine-4-O-sulfotransferase (GalNAc4-ST1), which we show by immunofluorescence staining to be expressed throughout normal epidermis. A colorimetric assay for total sulfated glycosaminoglycan (GAG) quantification, comparing human keratinocytes (CCD1106 KERTr) expressing wild type and mutant recombinant GalNAc4-ST1, revealed decreased levels of total sulfated GAGs in cells expressing mutant GalNAc4-ST1, suggesting loss of function. Western blotting revealed lower expression levels of mutant recombinant GalNAc4-ST1 compared to wild type, suggesting that accelerated degradation may result in loss of function, leading to PSS type A. This is the first report describing a mutation as the cause of PSS type A. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Brian P Grone
Full Text Available Mutations in the synaptic machinery gene syntaxin-binding protein 1, STXBP1 (also known as MUNC18-1, are linked to childhood epilepsies and other neurodevelopmental disorders. Zebrafish STXBP1 homologs (stxbp1a and stxbp1b have highly conserved sequence and are prominently expressed in the larval zebrafish brain. To understand the functions of stxbp1a and stxbp1b, we generated loss-of-function mutations using CRISPR/Cas9 gene editing and studied brain electrical activity, behavior, development, heart physiology, metabolism, and survival in larval zebrafish. Homozygous stxbp1a mutants exhibited a profound lack of movement, low electrical brain activity, low heart rate, decreased glucose and mitochondrial metabolism, and early fatality compared to controls. On the other hand, homozygous stxbp1b mutants had spontaneous electrographic seizures, and reduced locomotor activity response to a movement-inducing "dark-flash" visual stimulus, despite showing normal metabolism, heart rate, survival, and baseline locomotor activity. Our findings in these newly generated mutant lines of zebrafish suggest that zebrafish recapitulate clinical phenotypes associated with human syntaxin-binding protein 1 mutations.
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Directory of Open Access Journals (Sweden)
Sara Kangaspeska
Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
DEFF Research Database (Denmark)
Richards, Stephen; Liu, Yue; Bettencourt, Brian R.
2005-01-01
years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences......We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each...... between the species-but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence...
RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice
Directory of Open Access Journals (Sweden)
Jian Liu
2014-01-01
Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.
Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108
Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang
1999-01-01
A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...
Lissanu Deribe, Yonathan
2016-03-01
PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2E824*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57KIP2). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.
Lissanu Deribe, Yonathan; Shi, Yanxia; Rai, Kunal; Nezi, Luigi; Amin, Samir B; Wu, Chia-Chin; Akdemir, Kadir C; Mahdavi, Mozhdeh; Peng, Qian; Chang, Qing Edward; Hornigold, Kirsti; Arold, Stefan T; Welch, Heidi C E; Garraway, Levi A; Chin, Lynda
2016-03-01
PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2(E824)*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57(KIP2)). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.
Lissanu Deribe, Yonathan; Shi, Yanxia; Rai, Kunal; Nezi, Luigi; Amin, Samir B.; Wu, Chia-Chin; Akdemir, Kadir C.; Mahdavi, Mozhdeh; Peng, Qian; Chang, Qing Edward; Hornigold, Kirsti; Arold, Stefan T.; Welch, Heidi C. E.; Garraway, Levi A.; Chin, Lynda
2016-01-01
PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2E824*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57KIP2). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.
International Nuclear Information System (INIS)
Munck, L.; Moeller Jespersen, B.
2008-01-01
As documented by eight IAEA/FAO symposia 1968-82 on nutritionally improved seeds, a wide range of high lysine endosperm mutants were isolated in maize, sorghum and barley. These mutants observed by new spectroscopic screening methods can now be exploited to advance basic biological research and theory. Since 1982 effective methods to overview the physiochemical composition of seeds by Near Infrared Spectroscopy evaluated by chemometric data analysis have developed. Spectroscopic analyses by calibration have now substituted for the wet analyses in industry. In genetics there has traditionally been a differentiation between major genes for qualitative and minor 'polygenes' for quantitative traits. This view has been coupled to an incomplete understanding of pleiotropy. It is shown that seed spectra from isogenic barley endosperm mutants represent a coarse-grained physiochemical overview of the phenome that can be classified by chemometrics. Pleiotropy expressed by a gene is quantified as a whole pattern by the gene specific mutant spectrum subtracted by the spectrum of the parent variety. Selection for an improved plumpness (starch) in a breeding material with the lys3.a mutant visualises in spectra the effect of enriching 'minor polygenes' for an increased content of starch in a mutant gene background. Morphological, spectroscopic and chemical analyses suggest that mutant genes have both qualitative and quantitative expressions. They produce qualitative pleiotropic phenomenological patterns that can be observed as more or less severe changes in macro and microstructures of the plant and seed phenotype. Behind are quantitative chemical changes that by spectroscopy and chemometrics can be transferred to qualitative patterns. In fact one major gene for a qualitative trait can act as several apparent minor polygenes for quantitative variables. This explains the reduced need for the previously expected several hundred thousands of genes and gene modifiers down to the
Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant
Directory of Open Access Journals (Sweden)
Jing Jiang
2012-03-01
Full Text Available A dwarf mutant (dwf1 was obtained among 15 transgenic lines, when TaLEA (Tamarix androssowii late embryogenesis abundant gene was introduced into Populus simonii × Populus nigra by Agrobacterium tumefaciens-mediated transformation. Under the same growth conditions, dwf1 height was significantly reduced compared with the wild type and the other transgenic lines. Because only one transgenic line (dwf1 displayed the dwarf phenotype, we considered that T-DNA insertion sites may play a role in the mutant formation. The mechanisms underlying this effect were investigated using TAIL-PCR (thermal asymmetric interlaced PCR and microarrays methods. According to the TAIL-PCR results, two flanking sequences located on chromosome IV and VIII respectively, were cloned. The results indicated the integration of two independent T-DNA copies. We searched for the potential genes near to the T-DNA insertions. The nearest gene was a putative poplar AP2 transcription factor (GI: 224073210. Expression analysis showed that AP2 was up-regulated in dwf1 compared with the wild type and the other transgenic lines. According to the microarrays results, a total of 537 genes involved in hydrolase, kinase and transcription factor activities, as well as protein and nucleotide binding, showed significant alterations in gene expression. These genes were expressed in more than 60 metabolic pathways, including starch, sucrose, galactose and glycerolipid metabolism and phenylpropanoids and flavonoid biosyntheses. Our transcriptome and T-DNA insertion sites analyses might provide some useful insights into the dwarf mutant formation.
International Nuclear Information System (INIS)
Peterson, K.R.; Ganesan, A.K.; Mount, D.W.; Stanford Univ., CA)
1986-01-01
The SOS response is displayed following treatments which damage DNA or inhibit DNA replication. Two associated activities include enhanced capacity for DNA repair resulting from derepression of the recA, uvrA, uvrB and uvrD genes and increased mutagenesis due to derepression of recA, umuC and umuD. These changes are the consequence of the derepression of at least seventeen unlinked operons negatively regulated by LexA repressor. Following treatments that induce the SOS response, a signal molecule interacts with RecA protein, converting it to an activated form. Activated RecA protein facilitates the proteolytic cleavage of LexA repressor, which results in derepression of the regulon. The cell then enters a new physiological state during which time DNA repair processes are augmented. The lexA41 mutant of E. coli is a uv-resistant derivative of another mutant, lexA3, which produces a repressor that is not cleaved following inducing treatments. The resultant protein is unstable. Lac operon fusions to most of the genes in the SOS regulon were used to show that the various damage-inducible genes were derepressed to different extents. uvrA, B, and D were almost fully derepressed. Consistent with this finding, the rate of removal of T4 endonuclease V-sensitive sites was more rapid in the uv-irradiated lexA41 mutant than in normal cells, suggesting a more active excision repair system. We propose that the instability of the LexA41 protein reduces the intracellular concentration of repressor to a level that allows a high level of excision repair. The additional observation that SOS mutagenesis was only weakly induced in a lexA41 uvrA - mutant implies that the mutant protein partially represses one or more genes whose products promote SOS mutagenesis. 17 refs., 4 figs., 1 tab
Studies on leaf mutants of Pea. (Part) I. Morphology, performance and somatic chromosomes
International Nuclear Information System (INIS)
Kaul, M.L.H.; Anjali, A.
1988-01-01
Three recessive non-allelic mutant genes alter foliar morphology of pea when present singly and in combination. Gene acacia replaces tendrils by a terminal leaflet, afila replaces leaflets by tendrils and cochleata replaces stipules by spoon shaped appendages. In combination, these genes drastically alter leaf morphology; plants can be identified only after flowering. The mutant genes influence shoot height, floral organ number, maturity period, grain yield and seed protein production; inter- and intra-genotypic variability in certain metric traits is significant. Influence of cochleata gene over floral form and function is considerable. In terms of seed yield and protein content, breeding value of all the mutants except of acacia is low because these mutant genes represent foreign untuned genes in pea genome. Segregation deficit is maximum in triple gene mutant with highly impaired fertility and low seed production. Somatic chromosome number in all the mutants and recombinants is 14; in morphology the chromosomes do not differ from the initial line, Bonneville. (author). 9 refs., 4 tabs
Mouse mammary tumor virus-like gene sequences are present in lung patient specimens
Directory of Open Access Journals (Sweden)
Rodríguez-Padilla Cristina
2011-09-01
Full Text Available Abstract Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18% of the lung carcinomas and 1 out of 7 (14% of acute inflamatory lung infiltrate specimens studied of a Mexican Population.
Methods of producing protoporphyrin IX and bacterial mutants therefor
Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming
2016-03-01
The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.
Directory of Open Access Journals (Sweden)
Holger eBudahn
2014-10-01
Full Text Available A linkage map of carrot (Daucus carota L. was developed in order to study reproductive traits. The F2 mapping population derived from an initial cross between a yellow leaf (yel chlorophyll mutant and a compressed lamina (cola mutant with unique flower defects of the sporophytic parts of male and female organs. The genetic map has a total length of 781 cM and included 285 loci. The length of the nine linkage groups ranged between 65 cM and 145 cM. All linkage groups have been anchored to the reference map. The objective of this study was the generation of a well-saturated linkage map of D. carota. Mapping of the cola-locus associated with flower development and fertility was successfully demonstrated. Two MADS-box genes (DcMADS3, DcMADS5 with prominent roles in flowering and reproduction as well as three additional genes (DcAOX2a, DcAOX2b, DcCHS2 with further importance for male reproduction were assigned to different loci that did not co-segregate with the cola-locus.
Genomic sequence around butterfly wing development genes: annotation and comparative analysis.
Directory of Open Access Journals (Sweden)
Inês C Conceição
Full Text Available BACKGROUND: Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. METHODOLOGY/PRINCIPAL FINDINGS: We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes. CONCLUSIONS: The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1 the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2 the high
Microsatellite Instability Use in Mismatch Repair Gene Sequence Variant Classification
Directory of Open Access Journals (Sweden)
Bryony A. Thompson
2015-03-01
Full Text Available Inherited mutations in the DNA mismatch repair genes (MMR can cause MMR deficiency and increased susceptibility to colorectal and endometrial cancer. Microsatellite instability (MSI is the defining molecular signature of MMR deficiency. The clinical classification of identified MMR gene sequence variants has a direct impact on the management of patients and their families. For a significant proportion of cases sequence variants of uncertain clinical significance (also known as unclassified variants are identified, constituting a challenge for genetic counselling and clinical management of families. The effect on protein function of these variants is difficult to interpret. The presence or absence of MSI in tumours can aid in determining the pathogenicity of associated unclassified MMR gene variants. However, there are some considerations that need to be taken into account when using MSI for variant interpretation. The use of MSI and other tumour characteristics in MMR gene sequence variant classification will be explored in this review.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
International Nuclear Information System (INIS)
Canama, Alma O.; Galvez, Hayde F.; Tongson, Eden Jane U.; Quilloy, Reynaldo B.; Hautea, Desiree M.
2010-01-01
Tomato (L.) is one of the most important vegetable crops grown worldwide for the fresh vegetable market and food processing industry. With the completion of the genome-sequencing projects in various crops, the major challenge will be determine the gene function. One approach is to generate and to analyze mutant phenotypes. The paper reports the generation of gamma-irradiated and ethy methane sulfonate (EMS)-treated mutant populations, identification and phenotypic characterization of dominant and visible mutations in tomato mutant lines. Mutant populations of tomato H7996 were created using physical (cobalt 60 gamma ray) and chemical EMS mutagens. Generally, based on high-throughput phenotypic characterization, mutations were observed on the plant habit, size, morphology, leaf and flower color and morphology and fruit characteristics. Specifically, the most common dominant and visible mutations noted in the M 1 generation were monopodial, compact, short internodes, multi-branch plant type, light yellow and ghost leaf coloration, tiny and long pedicel leaf morphology and small or short plant size. In the M2 generation, homogeneous and segregating M 2 families were selected to constitute the core set of visible tomato mutants. Initial bacterial wilt resistance (BWR) gene knockouts were also identified. The mutant lines will be used as a rich source of genetic materials for breeding and functional genomics of tomato. (author)
Sequencing and analysis of the gene-rich space of cowpea
Directory of Open Access Journals (Sweden)
Cheung Foo
2008-02-01
Full Text Available Abstract Background Cowpea, Vigna unguiculata (L. Walp., is one of the most important food and forage legumes in the semi-arid tropics because of its drought tolerance and ability to grow on poor quality soils. Approximately 80% of cowpea production takes place in the dry savannahs of tropical West and Central Africa, mostly by poor subsistence farmers. Despite its economic and social importance in the developing world, cowpea remains to a large extent an underexploited crop. Among the major goals of cowpea breeding and improvement programs is the stacking of desirable agronomic traits, such as disease and pest resistance and response to abiotic stresses. Implementation of marker-assisted selection and breeding programs is severely limited by a paucity of trait-linked markers and a general lack of information on gene structure and organization. With a nuclear genome size estimated at ~620 Mb, the cowpea genome is an ideal target for reduced representation sequencing. Results We report here the sequencing and analysis of the gene-rich, hypomethylated portion of the cowpea genome selectively cloned by methylation filtration (MF technology. Over 250,000 gene-space sequence reads (GSRs with an average length of 610 bp were generated, yielding ~160 Mb of sequence information. The GSRs were assembled, annotated by BLAST homology searches of four public protein annotation databases and four plant proteomes (A. thaliana, M. truncatula, O. sativa, and P. trichocarpa, and analyzed using various domain and gene modeling tools. A total of 41,260 GSR assemblies and singletons were annotated, of which 19,786 have unique GenBank accession numbers. Within the GSR dataset, 29% of the sequences were annotated using the Arabidopsis Gene Ontology (GO with the largest categories of assigned function being catalytic activity and metabolic processes, groups that include the majority of cellular enzymes and components of amino acid, carbohydrate and lipid metabolism. A
Topology of genes and nontranscribed sequences in human interphase nuclei
International Nuclear Information System (INIS)
Scheuermann, Markus O.; Tajbakhsh, Jian; Kurz, Anette; Saracoglu, Kaan; Eils, Roland; Lichter, Peter
2004-01-01
Knowledge about the functional impact of the topological organization of DNA sequences within interphase chromosome territories is still sparse. Of the few analyzed single copy genomic DNA sequences, the majority had been found to localize preferentially at the chromosome periphery or to loop out from chromosome territories. By means of dual-color fluorescence in situ hybridization (FISH), immunolabeling, confocal microscopy, and three-dimensional (3D) image analysis, we analyzed the intraterritorial and nuclear localization of 10 genomic fragments of different sequence classes in four different human cell types. The localization of three muscle-specific genes FLNA, NEB, and TTN, the oncogene BCL2, the tumor suppressor gene MADH4, and five putatively nontranscribed genomic sequences was predominantly in the periphery of the respective chromosome territories, independent from transcriptional status and from GC content. In interphase nuclei, the noncoding sequences were only rarely found associated with heterochromatic sites marked by the satellite III DNA D1Z1 or clusters of mammalian heterochromatin proteins (HP1α, HP1β, HP1γ). However, the nontranscribed sequences were found predominantly at the nuclear periphery or at the nucleoli, whereas genes tended to localize on chromosome surfaces exposed to the nuclear interior
Luo, Jun-Yi; Li, Xiao-Mei; Zhou, Yun; Zhao, Qiang; Chen, Bang-Dang; Liu, Fen; Chen, Xiao-Cui; Zheng, Hong; Ma, Yi-Tong; Gao, Xiao-Ming; Yang, Yi-Ning
2017-02-01
Nuclear factor κappa B (NF-κB) is an important transcription factor in the development and progression of coronary artery disease (CAD). Recent evidence suggests that -94 ATTG ins/del mutant in the promoter of NFKB1 gene is an essential functional mutant. The present study demonstrated the frequencies of the del/del (DD) genotype and del (D) allele were significantly higher in CAD patients than in controls. CAD patients carrying mutant DD genotype had worse stenosis of diseased coronary arteries compared to those carrying ins/ins (II) or ins/del (ID) genotype. Plasma levels of endothelial nitric oxide synthase (eNOS) were lower, while inflammatory cytokine incnterlukin-6 (IL-6) was higher in CAD patients with DD genotype than those with II or ID genotype (both PDD genotype HUVECs) were more susceptible to H 2 O 2 -induced apoptosis, which was accompanied with a decreased Bcl-2 expression. Further, mutant HUVECs had lower eNOS but higher IL-6 mRNA levels and decreased phosphorylation of eNOS under H 2 O 2 -stimulation (both PDD genotype of NFKB1 gene is associated with the risk and severity of CAD. Dwonregulation of NF-κB p50 subunit leads to exacerbated endothelial dysfunction and apoptosis and enhanced inflammatory response that is the potential underlying mechanism. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2
Directory of Open Access Journals (Sweden)
Yang Jie
2017-01-01
Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.
Directory of Open Access Journals (Sweden)
Reza Saberianfar
Full Text Available In Schizosaccharomyces pombe the nuclear-localized Lsk1p-Lsc1p cyclin dependent kinase complex promotes Ser-2 phosphorylation of the heptad repeats found within the RNA pol II carboxy terminal domain (CTD. Here, we first provide evidence supporting the existence of a third previously uncharacterized Ser-2 CTD kinase subunit, Lsg1p. As expected for a component of the complex, Lsg1p localizes to the nucleus, promotes Ser-2 phosphorylation of the CTD, and physically interacts with both Lsk1p and Lsc1p in vivo. Interestingly, we also demonstrate that lsg1Δ mutants--just like lsk1Δ and lsc1Δ strains--are compromised in their ability to faithfully and reliably complete cytokinesis. Next, to address whether kinase mediated alterations in CTD phosphorylation might selectively alter the expression of genes with roles in cytokinesis and/or the cytoskeleton, global gene expression profiles were analyzed. Mutants impaired in Ser-2 phosphorylation display little change with respect to the level of transcription of most genes. However, genes affecting cytokinesis--including the actin interacting protein gene, aip1--as well as genes with roles in meiosis, are included in a small subset that are differentially regulated. Significantly, genetic analysis of lsk1Δ aip1Δ double mutants is consistent with Lsk1p and Aip1p acting in a linear pathway with respect to the regulation of cytokinesis.
Wan, Liyun; Li, Bei; Pandey, Manish K; Wu, Yanshan; Lei, Yong; Yan, Liying; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Wei, Guo; Varshney, Rajeev K; Liao, Boshou
2016-01-01
Seed-coat cracking and undesirable color of seed coat highly affects external appearance and commercial value of peanuts ( Arachis hypogaea L.). With an objective to find genetic solution to the above problems, a peanut mutant with cracking and brown colored seed coat (testa) was identified from an EMS treated mutant population and designated as "peanut seed coat crack and brown color mutant line ( pscb )." The seed coat weight of the mutant was almost twice of the wild type, and the germination time was significantly shorter than wild type. Further, the mutant had lower level of lignin, anthocyanin, proanthocyanidin content, and highly increased level of melanin content as compared to wild type. Using RNA-Seq, we examined the seed coat transcriptome in three stages of seed development in the wild type and the pscb mutant. The RNA-Seq analysis revealed presence of highly differentially expressed phenylpropanoid and flavonoid pathway genes in all the three seed development stages, especially at 40 days after flowering (DAF40). Also, the expression of polyphenol oxidases and peroxidase were found to be activated significantly especially in the late seed developmental stage. The genome-wide comparative study of the expression profiles revealed 62 differentially expressed genes common across all the three stages. By analyzing the expression patterns and the sequences of the common differentially expressed genes of the three stages, three candidate genes namely c36498_g1 (CCoAOMT1), c40902_g2 (kinesin) , and c33560_g1 (MYB3) were identified responsible for seed-coat cracking and brown color phenotype. Therefore, this study not only provided candidate genes but also provided greater insights and molecular genetic control of peanut seed-coat cracking and color variation. The information generated in this study will facilitate further identification of causal gene and diagnostic markers for breeding improved peanut varieties with smooth and desirable seed coat color.
DEFF Research Database (Denmark)
Jensen, E O; Marcker, K A; Villadsen, IS
1986-01-01
The TM1 yeast mutant was transformed with a 2 micron-derived plasmid (YEp24) which carries a chimaeric gene containing the Escherichia coli chloramphenicol acetyl transferase (CAT) gene fused to the 5'- and 3'-flanking regions of the soybean leghemoglobin (Lb) c3 gene. Expression of the chimaeric...
Molecular cloning and biological characterization of the human excision repair gene ERCC-3
International Nuclear Information System (INIS)
Weeda, G.; van Ham, R.C.; Masurel, R.; Westerveld, A.; Odijk, H.; de Wit, J.; Bootsma, D.; van der Eb, A.J.; Hoeijmakers, J.H.
1990-01-01
In this report we present the cloning, partial characterization, and preliminary studies of the biological activity of a human gene, designated ERCC-3, involved in early steps of the nucleotide excision repair pathway. The gene was cloned after genomic DNA transfection of human (HeLa) chromosomal DNA together with dominant marker pSV3gptH to the UV-sensitive, incision-defective Chinese hamster ovary (CHO) mutant 27-1. This mutant belongs to complementation group 3 of repair-deficient rodent mutants. After selection of UV-resistant primary and secondary 27-1 transformants, human sequences associated with the induced UV resistance were rescued in cosmids from the DNA of a secondary transformant by using a linked dominant marker copy and human repetitive DNA as probes. From coinheritance analysis of the ERCC-3 region in independent transformants, we deduce that the gene has a size of 35 to 45 kilobases, of which one essential segment has so far been refractory to cloning. Conserved unique human sequences hybridizing to a 3.0-kilobase mRNA were used to isolate apparently full-length cDNA clones. Upon transfection to 27-1 cells, the ERCC-3 cDNA, inserted in a mammalian expression vector, induced specific and (virtually) complete correction of the UV sensitivity and unscheduled DNA synthesis of mutants of complementation group 3 with very high efficiency. Mutant 27-1 is, unlike other mutants of complementation group 3, also very sensitive toward small alkylating agents. This unique property of the mutant is not corrected by introduction of the ERCC-3 cDNA, indicating that it may be caused by an independent second mutation in another repair function. By hybridization to DNA of a human x rodent hybrid cell panel, the ERCC-3 gene was assigned to chromosome 2, in agreement with data based on cell fusion
Bassler, B L; Wright, M; Showalter, R E; Silverman, M R
1993-08-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of an extracellular signal molecule (autoinducer) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode functions necessary for the synthesis of, and response to, a signal molecule. Sequence analysis of the region encoding these functions revealed three open reading frames, two (luxL and luxM) that are required for production of an autoinducer substance and a third (luxN) that is required for response to this signal substance. The LuxL and LuxM proteins are not similar in amino acid sequence to other proteins in the database, but the LuxN protein contains regions of sequence resembling both the histidine protein kinase and the response regulator domains of the family of two-component, signal transduction proteins. The phenotypes of mutants with luxL, luxM and luxN defects indicated that an additional signal-response system controlling density-dependent expression of luminescence remains to be identified.
Directory of Open Access Journals (Sweden)
Ming Liu
2010-10-01
Full Text Available Recently, a syndrome of Mutant INS-gene-induced Diabetes of Youth (MIDY, derived from one of 26 distinct mutations has been identified as a cause of insulin-deficient diabetes, resulting from expression of a misfolded mutant proinsulin protein in the endoplasmic reticulum (ER of insulin-producing pancreatic beta cells. Genetic deletion of one, two, or even three alleles encoding insulin in mice does not necessarily lead to diabetes. Yet MIDY patients are INS-gene heterozygotes; inheritance of even one MIDY allele, causes diabetes. Although a favored explanation for the onset of diabetes is that insurmountable ER stress and ER stress response from the mutant proinsulin causes a net loss of beta cells, in this report we present three surprising and interlinked discoveries. First, in the presence of MIDY mutants, an increased fraction of wild-type proinsulin becomes recruited into nonnative disulfide-linked protein complexes. Second, regardless of whether MIDY mutations result in the loss, or creation, of an extra unpaired cysteine within proinsulin, Cys residues in the mutant protein are nevertheless essential in causing intracellular entrapment of co-expressed wild-type proinsulin, blocking insulin production. Third, while each of the MIDY mutants induces ER stress and ER stress response; ER stress and ER stress response alone appear insufficient to account for blockade of wild-type proinsulin. While there is general agreement that ultimately, as diabetes progresses, a significant loss of beta cell mass occurs, the early events described herein precede cell death and loss of beta cell mass. We conclude that the molecular pathogenesis of MIDY is initiated by perturbation of the disulfide-coupled folding pathway of wild-type proinsulin.
Sequence composition and gene content of the short arm of rye (Secale cereale chromosome 1.
Directory of Open Access Journals (Sweden)
Silvia Fluch
Full Text Available BACKGROUND: The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. METHODOLOGY/PRINCIPAL FINDINGS: Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3% being the most abundant. More than four thousand simple sequence repeat (SSR sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. CONCLUSIONS: The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye.
Energy Technology Data Exchange (ETDEWEB)
Hashimoto, Hideharu; Zhang, Xing; Zheng, Yu; Wilson, Geoffrey G.; Cheng, Xiaodong
2016-09-04
Mutations in human zinc-finger transcription factor WT1 result in abnormal development of the kidneys and genitalia and an array of pediatric problems including nephropathy, blastoma, gonadal dysgenesis and genital discordance. Several overlapping phenotypes are associated with WT1 mutations, including Wilms tumors, Denys-Drash syndrome (DDS), Frasier syndrome (FS) and WAGR syndrome (Wilms tumor, aniridia, genitourinary malformations, and mental retardation). These conditions vary in severity from individual to individual; they can be fatal in early childhood, or relatively benign into adulthood. DDS mutations cluster predominantly in zinc fingers (ZF) 2 and 3 at the C-terminus of WT1, which together with ZF4 determine the sequence-specificity of DNA binding. We examined three DDS associated mutations in ZF2 of human WT1 where the normal glutamine at position 369 is replaced by arginine (Q369R), lysine (Q369K) or histidine (Q369H). These mutations alter the sequence-specificity of ZF2, we find, changing its affinity for certain bases and certain epigenetic forms of cytosine. X-ray crystallography of the DNA binding domains of normal WT1, Q369R and Q369H in complex with preferred sequences revealed the molecular interactions responsible for these affinity changes. DDS is inherited in an autosomal dominant fashion, implying a gain of function by mutant WT1 proteins. This gain, we speculate, might derive from the ability of the mutant proteins to sequester WT1 into unproductive oligomers, or to erroneously bind to variant target sequences.
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
Gene Composer in a structural genomics environment
International Nuclear Information System (INIS)
Lorimer, Don; Raymond, Amy; Mixon, Mark; Burgin, Alex; Staker, Bart; Stewart, Lance
2011-01-01
For structural biology applications, protein-construct engineering is guided by comparative sequence analysis and structural information, which allow the researcher to better define domain boundaries for terminal deletions and nonconserved regions for surface mutants. A database software application called Gene Composer has been developed to facilitate construct design. The structural genomics effort at the Seattle Structural Genomics Center for Infectious Disease (SSGCID) requires the manipulation of large numbers of amino-acid sequences and the underlying DNA sequences which are to be cloned into expression vectors. To improve efficiency in high-throughput protein structure determination, a database software package, Gene Composer, has been developed which facilitates the information-rich design of protein constructs and their underlying gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bioinformatics steps used in modern structure-guided protein engineering and synthetic gene engineering. An example of the structure determination of H1N1 RNA-dependent RNA polymerase PB2 subunit is given
DEFF Research Database (Denmark)
Li, Yingrui; Xu, Xun; Song, Luting
2012-01-01
sequencing of 66 individual tumor cells from a muscle-invasive bladder transitional cell carcinoma (TCC). Analyses of the somatic mutant allele frequency spectrum and clonal structure revealed that the tumor cells were derived from a single ancestral cell, but that subsequent evolution occurred, leading...... to two distinct tumor cell subpopulations. By analyzing recurrently mutant genes in an additional cohort of 99 TCC tumors, we identified genes that might play roles in the maintenance of the ancestral clone and in the muscle-invasive capability of subclones of this bladder cancer, respectively...
Facilitating genome navigation : survey sequencing and dense radiation-hybrid gene mapping
Hitte, C; Madeoy, J; Kirkness, EF; Priat, C; Lorentzen, TD; Senger, F; Thomas, D; Derrien, T; Ramirez, C; Scott, C; Evanno, G; Pullar, B; Cadieu, E; Oza, [No Value; Lourgant, K; Jaffe, DB; Tacher, S; Dreano, S; Berkova, N; Andre, C; Deloukas, P; Fraser, C; Lindblad-Toh, K; Ostrander, EA; Galibert, F
Accurate and comprehensive sequence coverage for large genomes has been restricted to only a few species of specific interest. Lower sequence coverage (survey sequencing) of related species can yield a wealth of information about gene content and putative regulatory elements. But survey sequences
Liu, Wen; Ghouri, Fozia; Yu, Hang; Li, Xiang; Yu, Shuhong; Shahid, Muhammad Qasim; Liu, Xiangdong
2017-01-01
Common wild rice (Oryza rufipogon Griff.) is an important germplasm for rice breeding, which contains many resistance genes. Re-sequencing provides an unprecedented opportunity to explore the abundant useful genes at whole genome level. Here, we identified the nucleotide-binding site leucine-rich repeat (NBS-LRR) encoding genes by re-sequencing of two wild rice lines (i.e. Huaye 1 and Huaye 2) that were developed from common wild rice. We obtained 128 to 147 million reads with approximately 32.5-fold coverage depth, and uniquely covered more than 89.6% (> = 1 fold) of reference genomes. Two wild rice lines showed high SNP (single-nucleotide polymorphisms) variation rate in 12 chromosomes against the reference genomes of Nipponbare (japonica cultivar) and 93-11 (indica cultivar). InDels (insertion/deletion polymorphisms) count-length distribution exhibited normal distribution in the two lines, and most of the InDels were ranged from -5 to 5 bp. With reference to the Nipponbare genome sequence, we detected a total of 1,209,308 SNPs, 161,117 InDels and 4,192 SVs (structural variations) in Huaye 1, and 1,387,959 SNPs, 180,226 InDels and 5,305 SVs in Huaye 2. A total of 44.9% and 46.9% genes exhibited sequence variations in two wild rice lines compared to the Nipponbare and 93-11 reference genomes, respectively. Analysis of NBS-LRR mutant candidate genes showed that they were mainly distributed on chromosome 11, and NBS domain was more conserved than LRR domain in both wild rice lines. NBS genes depicted higher levels of genetic diversity in Huaye 1 than that found in Huaye 2. Furthermore, protein-protein interaction analysis showed that NBS genes mostly interacted with the cytochrome C protein (Os05g0420600, Os01g0885000 and BGIOSGA038922), while some NBS genes interacted with heat shock protein, DNA-binding activity, Phosphoinositide 3-kinase and a coiled coil region. We explored abundant NBS-LRR encoding genes in two common wild rice lines through genome wide re-sequencing
Planarian homeobox genes: cloning, sequence analysis, and expression.
Garcia-Fernàndez, J; Baguñà, J; Saló, E
1991-01-01
Freshwater planarians (Platyhelminthes, Turbellaria, and Tricladida) are acoelomate, triploblastic, unsegmented, and bilaterally symmetrical organisms that are mainly known for their ample power to regenerate a complete organism from a small piece of their body. To identify potential pattern-control genes in planarian regeneration, we have isolated two homeobox-containing genes, Dth-1 and Dth-2 [Dugesia (Girardia) tigrina homeobox], by using degenerate oligonucleotides corresponding to the most conserved amino acid sequence from helix-3 of the homeodomain. Dth-1 and Dth-2 homeodomains are closely related (68% at the nucleotide level and 78% at the protein level) and show the conserved residues characteristic of the homeodomains identified to data. Similarity with most homeobox sequences is low (30-50%), except with Drosophila NK homeodomains (80-82% with NK-2) and the rodent TTF-1 homeodomain (77-87%). Some unusual amino acid residues specific to NK-2, TTF-1, Dth-1, and Dth-2 can be observed in the recognition helix (helix-3) and may define a family of homeodomains. The deduced amino acid sequences from the cDNAs contain, in addition to the homeodomain, other domains also present in various homeobox-containing genes. The expression of both genes, detected by Northern blot analysis, appear slightly higher in cephalic regions than in the rest of the intact organism, while a slight increase is detected in the central period (5 days) or regeneration. Images PMID:1714599
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Energy Technology Data Exchange (ETDEWEB)
Phanchaisri, Boonrak [Science and Technology Research Institute, Chiang Mai University, Chiang Mai 50200 (Thailand); Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Samsang, Nuananong [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Yu, Liang Deng; Singkarat, Somsorn [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Anuntalabhochai, Somboon, E-mail: soanu.1@gmail.com [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2012-06-01
The culm length of two semidwarf rice mutants (PKOS1, HyKOS1) obtained from low-energy N-ion beam bombardments of dehusked Thai jasmine rice (Oryza sativa L. cv. KDML 105) seeds showed 25.7% and 21.5% height reductions and one spindly rice mutant (TKOS4) showed 21.4% increase in comparison with that of the KDML 105 control. A cDNA-RAPD analysis identified differential gene expression in internode tissues of the rice mutants. Two genes identified from the cDNA-RAPD were OsSPY and 14-3-3, possibly associated with stem height variations of the semidwarf and spindly mutants, respectively. The OsSPY gene encoded the SPY protein which is considered to be a negative regulator of gibberellin (GA). On the other hand, the 14-3-3 encoded a signaling protein which can bind and prevent the RSG (repression of shoot growth) protein function as a transcriptional repressor of the kaurene oxidase (KO) gene in the GA biosynthetic pathway. Expression analysis of OsSPY, 14-3-3, RSG, KO, and SLR1 was confirmed in rice internode tissues during the reproductive stage of the plants by semi-quantitative RT-PCR technique. The expression analysis showed a clear increase of the levels of OsSPY transcripts in PKOS1 and HyKOS1 tissue samples compared to that of the KDML 105 and TKOS4 samples at the age of 50-60 days which were at the ages of internode elongation. The 14-3-3 expression had the highest increase in the TKOS4 samples compared to those in KDML 105, PKOS1 and HyKOS1 samples. The expression analysis of RSG and KO showed an increase in TKOS4 samples compared to that of the KDML 105 and that of the two semidwarf mutants. These results indicate that changes of OsSPY and 14-3-3 expression could affect internode elongation and cause the phenotypic changes of semidwarf and spindly rice mutants, respectively.
International Nuclear Information System (INIS)
Phanchaisri, Boonrak; Samsang, Nuananong; Yu, Liang Deng; Singkarat, Somsorn; Anuntalabhochai, Somboon
2012-01-01
The culm length of two semidwarf rice mutants (PKOS1, HyKOS1) obtained from low-energy N-ion beam bombardments of dehusked Thai jasmine rice (Oryza sativa L. cv. KDML 105) seeds showed 25.7% and 21.5% height reductions and one spindly rice mutant (TKOS4) showed 21.4% increase in comparison with that of the KDML 105 control. A cDNA-RAPD analysis identified differential gene expression in internode tissues of the rice mutants. Two genes identified from the cDNA-RAPD were OsSPY and 14-3-3, possibly associated with stem height variations of the semidwarf and spindly mutants, respectively. The OsSPY gene encoded the SPY protein which is considered to be a negative regulator of gibberellin (GA). On the other hand, the 14-3-3 encoded a signaling protein which can bind and prevent the RSG (repression of shoot growth) protein function as a transcriptional repressor of the kaurene oxidase (KO) gene in the GA biosynthetic pathway. Expression analysis of OsSPY, 14-3-3, RSG, KO, and SLR1 was confirmed in rice internode tissues during the reproductive stage of the plants by semi-quantitative RT-PCR technique. The expression analysis showed a clear increase of the levels of OsSPY transcripts in PKOS1 and HyKOS1 tissue samples compared to that of the KDML 105 and TKOS4 samples at the age of 50–60 days which were at the ages of internode elongation. The 14-3-3 expression had the highest increase in the TKOS4 samples compared to those in KDML 105, PKOS1 and HyKOS1 samples. The expression analysis of RSG and KO showed an increase in TKOS4 samples compared to that of the KDML 105 and that of the two semidwarf mutants. These results indicate that changes of OsSPY and 14-3-3 expression could affect internode elongation and cause the phenotypic changes of semidwarf and spindly rice mutants, respectively.
Directory of Open Access Journals (Sweden)
Hisashi Hashimoto
Full Text Available Polycystic kidney disease (PKD is a common hereditary disease in humans. Recent studies have shown an increasing number of ciliary genes that are involved in the pathogenesis of PKD. In this study, the Gli-similar3 (glis3 gene was identified as the causal gene of the medaka pc mutant, a model of PKD. In the pc mutant, a transposon was found to be inserted into the fourth intron of the pc/glis3 gene, causing aberrant splicing of the pc/glis3 mRNA and thus a putatively truncated protein with a defective zinc finger domain. pc/glis3 mRNA is expressed in the epithelial cells of the renal tubules and ducts of the pronephros and mesonephros, and also in the pancreas. Antisense oligonucleotide-mediated knockdown of pc/glis3 resulted in cyst formation in the pronephric tubules of medaka fry. Although three other glis family members, glis1a, glis1b and glis2, were found in the medaka genome, none were expressed in the embryonic or larval kidney. In the pc mutant, the urine flow rate in the pronephros was significantly reduced, which was considered to be a direct cause of renal cyst formation. The cilia on the surface of the renal tubular epithelium were significantly shorter in the pc mutant than in wild-type, suggesting that shortened cilia resulted in a decrease in driving force and, in turn, a reduction in urine flow rate. Most importantly, EGFP-tagged pc/glis3 protein localized in primary cilia as well as in the nucleus when expressed in mouse renal epithelial cells, indicating a strong connection between pc/glis3 and ciliary function. Unlike human patients with GLIS3 mutations, the medaka pc mutant shows none of the symptoms of a pancreatic phenotype, such as impaired insulin expression and/or diabetes, suggesting that the pc mutant may be suitable for use as a kidney-specific model for human GLIS3 patients.
Population genetic implications from sequence variation in four Y chromosome genes.
Shen, P; Wang, F; Underhill, P A; Franco, C; Yang, W H; Roxas, A; Sung, R; Lin, A A; Hyman, R W; Vollrath, D; Davis, R W; Cavalli-Sforza, L L; Oefner, P J
2000-06-20
Some insight into human evolution has been gained from the sequencing of four Y chromosome genes. Primary genomic sequencing determined gene SMCY to be composed of 27 exons that comprise 4,620 bp of coding sequence. The unfinished sequencing of the 5' portion of gene UTY1 was completed by primer walking, and a total of 20 exons were found. By using denaturing HPLC, these two genes, as well as DBY and DFFRY, were screened for polymorphic sites in 53-72 representatives of the five continents. A total of 98 variants were found, yielding nucleotide diversity estimates of 2.45 x 10(-5), 5. 07 x 10(-5), and 8.54 x 10(-5) for the coding regions of SMCY, DFFRY, and UTY1, respectively, with no variant having been observed in DBY. In agreement with most autosomal genes, diversity estimates for the noncoding regions were about 2- to 3-fold higher and ranged from 9. 16 x 10(-5) to 14.2 x 10(-5) for the four genes. Analysis of the frequencies of derived alleles for all four genes showed that they more closely fit the expectation of a Luria-Delbrück distribution than a distribution expected under a constant population size model, providing evidence for exponential population growth. Pairwise nucleotide mismatch distributions date the occurrence of population expansion to approximately 28,000 years ago. This estimate is in accord with the spread of Aurignacian technology and the disappearance of the Neanderthals.
Chae, S K; Kafer, E
1993-01-01
Three UV-sensitive mutations of A. nidulans, uvsI, uvsJ and uvsA, were tested for epistatic relationships with members of the previously established groups, here called the "UvsF", "UvsC", and "UvsB" groups. uvsI mutants are defective for spontaneous and induced reversion of certain point mutations and differ also for other properties from previously analyzed uvs types. They are very sensitive to the killing effects of UV-light and 4-NQO (4-nitro-quinoline-N-oxide) but not to MMS (methylmethane sulfonate). When double- and single-mutant uvs strains were compared for sensitivity to these three agents, synergistic or additive effects were found for uvsI with all members of the three groups. The uvsI gene may therefore represent a fourth epistatic group, possibly involved in mutagenic repair. On the other hand, uvsJ was clearly epistatic with members of the UvsF group and fitted well into this group also by phenotype. The uvsA gene was tentatively assigned to the UvsC group. uvsA showed epistatic interactions with uvsC in all tests, and like UvsC-group mutants is UV-sensitive mainly in dividing cells. However, the uvsA mutation does not cause the defects in recombination and UV mutagenesis typical for this group.
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops
Zhang, Yanfeng; Huang, Shuhua; Wang, Xuefang; Liu, Jianwei; Guo, Xupeng; Mu, Jianxin; Tian, Jianhua; Wang, Xiaofeng
2018-01-01
Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm). DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2) that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus) by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops. PMID:29616073
Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops
Directory of Open Access Journals (Sweden)
Yanfeng Zhang
2018-03-01
Full Text Available Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm. DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2 that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops.
An Undergraduate Laboratory Class Using CRISPR/Cas9 Technology to Mutate Drosophila Genes
Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L.; Chechenova, Maria B.; Guerin, Paul; Cripps, Richard M.
2016-01-01
CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using…
International Nuclear Information System (INIS)
Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.
1989-01-01
Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development
Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi
2015-10-01
Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.
Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space
Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.
2013-01-01
For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960
Combinatorial pooling enables selective sequencing of the barley gene space.
Directory of Open Access Journals (Sweden)
Stefano Lonardi
2013-04-01
Full Text Available For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.
Combinatorial pooling enables selective sequencing of the barley gene space.
Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J
2013-04-01
For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis
DEFF Research Database (Denmark)
Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata
2000-01-01
The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...
Draft Genome Sequence of Xylella fastidiosa subsp. fastidiosa Strain Stag?s Leap
Chen, J.; Wu, F.; Zheng, Z.; Deng, X.; Burbank, L. P.; Stenger, D. C.
2016-01-01
Xylella fastidiosa subsp. fastidiosa causes Pierce?s disease of grapevine. Presented here is the draft genome sequence of the Stag?s Leap strain, previously used in pathogenicity/virulence assays to evaluate grapevine germplasm bearing Pierce?s disease resistance and a phenotypic assessment of knockout mutants to determine gene function.
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-08-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the beta clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25 degrees C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25 degrees C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42 degrees C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25 degrees C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25 degrees C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway.
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-01-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the β clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25°C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25°C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42°C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25°C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25°C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway. PMID:18502852
Hoffmann, Robert D; Palmgren, Michael
2016-06-13
Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.
Directory of Open Access Journals (Sweden)
Fatemeh Maghuly
2018-04-01
Full Text Available Mutagenesis in combination with Genotyping by Sequencing (GBS is a powerful tool for introducing variation, studying gene function and identifying causal mutations underlying phenotypes of interest in crop plant genomes. About 400 million paired-end reads were obtained from 82 ethylmethane sulfonate (EMS induced mutants and 14 wild-type accessions of Jatropha curcas for the detection of Single Nucleotide Polymorphisms (SNPs and Insertion/Deletions (InDels by two different approaches (nGBS and ddGBS on an Illumina HiSeq 2000 sequencer. Using bioinformatics analyses, 1,452 induced SNPs and InDels were identified in coding regions, which were distributed across 995 genes. The predominantly observed mutations were G/C to A/T transitions (64%, while transversions were observed at a lower frequency (36%. Regarding the effect of mutations on gene function, 18% of the mutations were located in intergenic regions. In fact, mutants with the highest number of heterozygous SNPs were found in samples treated with 0.8% EMS for 3 h. Reconstruction of the metabolic pathways showed that in total 16 SNPs were located in six KEGG pathways by nGBS and two pathways by ddGBS. The most highly represented pathways were ether-lipid metabolism and glycerophospholipid metabolism, followed by starch and sucrose metabolism by nGBS and triterpenoid biosynthesis as well as steroid biosynthesis by ddGBS. Furthermore, high genome methylation was observed in J. curcas, which might help to understand the plasticity of the Jatropha genome in response to environmental factors. At last, the results showed that continuously vegetatively propagated tissue is a fast, efficient and accurate method to dissolve chimeras, especially for long-lived plants like J. curcas. Obtained data showed that allelic variations and in silico analyses of gene functions (gene function prediction, which control important traits, could be identified in mutant populations using nGBS and ddGBS. However, the
Limited number of immunoglobulin VH regions expressed in the mutant rabbit "Alicia".
DiPietro, L A; Short, J A; Zhai, S K; Kelus, A S; Meier, D; Knight, K L
1990-06-01
A unique feature of rabbit Ig is the presence of VH region allotypic specificities. In normal rabbits, more than 80% of circulating immunoglobulin molecules bear the VHa allotypic specificities, al, a2 or a3; the remaining 10% to 20% of immunoglobulin molecules lack VHa allotypic specificities and are designated VHa-. A mutant rabbit designated Alicia, in contrast, has predominantly serum immunoglobulin molecules that lack the VHa allotypic specificities (Kelus and Weiss, Proc. Natl. Acad. Sci. USA 1986. 83: 4883). To study the nature and molecular complexity of VHa- molecules, we cloned and determined the nucleotide sequence of seven cDNA prepared from splenic RNA of an Alicia rabbit. Six of the clones appeared to encode VHa- molecules; the framework regions encoded by these clones were remarkably similar to each other, each having an unusual insertion of four amino acids at position 10. This insertion of four amino acids has been seen in only 2 of 54 sequenced rabbit VH genes. The similarity of the sequences of the six VHa- clones to each other and their dissimilarity to most other VH genes leads us to suggest that the VHa- molecules in Alicia rabbits are derived predominantly from one or a small number of very similar VH genes. Such preferential utilization of a small number of VH genes may explain the allelic inheritance of VH allotypes.
Directory of Open Access Journals (Sweden)
Satoru Noguchi
2014-01-01
Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.
Transcriptome Analysis for Abnormal Spike Development of the Wheat Mutant dms.
Zhu, Xin-Xin; Li, Qiao-Yun; Shen, Chun-Cai; Duan, Zong-Biao; Yu, Dong-Yan; Niu, Ji-Shan; Ni, Yong-Jing; Jiang, Yu-Mei
2016-01-01
Wheat (Triticum aestivum L.) spike development is the foundation for grain yield. We obtained a novel wheat mutant, dms, characterized as dwarf, multi-pistil and sterility. Although the genetic changes are not clear, the heredity of traits suggests that a recessive gene locus controls the two traits of multi-pistil and sterility in self-pollinating populations of the medium plants (M), such that the dwarf genotype (D) and tall genotype (T) in the progeny of the mutant are ideal lines for studies regarding wheat spike development. The objective of this study was to explore the molecular basis for spike abnormalities of dwarf genotype. Four unigene libraries were assembled by sequencing the mRNAs of the super-bulked differentiating spikes and stem tips of the D and T plants. Using integrative analysis, we identified 419 genes highly expressed in spikes, including nine typical homeotic genes of the MADS-box family and the genes TaAP2, TaFL and TaDL. We also identified 143 genes that were significantly different between young spikes of T and D, and 26 genes that were putatively involved in spike differentiation. The result showed that the expression levels of TaAP1-2, TaAP2, and other genes involved in the majority of biological processes such as transcription, translation, cell division, photosynthesis, carbohydrate transport and metabolism, and energy production and conversion were significantly lower in D than in T. We identified a set of genes related to wheat floral organ differentiation, including typical homeotic genes. Our results showed that the major causal factors resulting in the spike abnormalities of dms were the lower expression homeotic genes, hormonal imbalance, repressed biological processes, and deficiency of construction materials and energy. We performed a series of studies on the homeotic genes, however the other three causal factors for spike abnormal phenotype of dms need further study.
Hunting down frame shifts: Ecological analysis of diverse functional gene sequences
Directory of Open Access Journals (Sweden)
Michal eStrejcek
2015-11-01
Full Text Available Functional gene ecological analyses using amplicon sequencing can be challenging as translated sequences are often burdened with shifted reading frames. The aim of this work was to evaluate several bioinformatics tools designed to correct errors which arise during sequencing in an effort to reduce the number of frame-shifts (FS. Genes encoding for alpha subunits of biphenyl (bphA and benzoate (benA dioxygenases were used as model sequences. FrameBot, a FS correction tool, was able to reduce the number of detected FS to zero. However, up to 43.1% of sequences were discarded by FrameBot as non-specific targets. Therefore, we proposed a de novo mode of FrameBot for FS correction, which works on a similar basis as common chimera identifying platforms and is not dependent on reference sequences. By nature of FrameBot de novo design, it is crucial to provide it with data as error free as possible. We tested the ability of several publicly available correction tools to decrease the number of errors in the data sets. The combination of Maximum Expected Error (MEE filtering and single linkage pre-clustering (SLP proved the most efficient read procession. Applying FrameBot de novo on the processed data enabled analysis of BphA sequences with minimal losses of potentially functional sequences not homologous to those previously known. This experiment also demonstrated the extensive diversity of dioxygenases in soil. A script which performs FrameBot de novo is presented in the supplementary material to the study and the tool was implemented into FunGene Pipeline available at http://fungene.cme.msu.edu/FunGenePipeline/ and https://github.com/rdpstaff/Framebot.
Kim, Hong-Il; Noh, Tae-Hwan; Lee, Chang-Soo; Park, Young-Jin
2015-01-01
Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight (BB) in rice. To study its function, a random insertion mutation library of Xoo was constructed using the Tn5 transposon. A mutant strain with decreased virulence against the susceptible rice cultivar IR24 was isolated from the library (aroE mutant), which also had extremely low pigment production. Thermal asymmetric interlaced-polymerase chain reaction (TAIL-PCR) and sequence analysis of the mutant revealed that the transposon was inserted into the aroE gene (encoding shikimate dehydrogenase). To investigate gene expression changes in the pigment- and virulence-deficient mutant, DNA microarray analysis was performed, which showed downregulation of 20 genes involved in the chemotaxis of Xoo. Our findings reveal that mutation of the aroE gene affects virulence and pigment production, as well as expression of genes involved in Xoo chemotaxis. Copyright © 2014 Elsevier GmbH. All rights reserved.
Zhu, Lin; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2013-07-01
The filamentous fungus Aspergillus oryzae is used as one of the most favored hosts for heterologous protein production due to its ability to secrete large amounts of proteins into the culture medium. We previously generated a hyper-producing mutant strain of A. oryzae, AUT1, which produced 3.2- and 2.6-fold higher levels of bovine chymosin (CHY) and human lysozyme (HLY), respectively, compared with the wild-type strain. However, further enhancement of heterologous protein production by multiple gene disruption is difficult because of the low gene-targeting efficiency in strain AUT1. Here, we disrupted the ligD gene, which is involved in nonhomologous recombination, and the pyrG gene to create uridine/uracil auxotrophy in strain AUT1, to generate a hyper-producing mutant applicable to pyrG marker recycling with highly efficient gene targeting. We generated single and double disruptants of the tripeptidyl peptidase gene AosedD and vacuolar sorting receptor gene Aovps10 in the hyper-producing mutant background, and found that all disruptants showed significant increases in heterologous protein production. Particularly, double disruption of the Aovps10 and AosedD genes increased the production levels of CHY and HLY by 1.6- and 2.1-fold, respectively, compared with the parental strain. Thus, we successfully generated a fungal host for further enhancing the heterologous protein production ability by combining mutational and molecular breeding techniques.
Thermodynamics-based models of transcriptional regulation with gene sequence.
Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing
2015-12-01
Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.
Comparative analysis of the prion protein gene sequences in African lion.
Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming
2006-10-01
The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.
Cloning of the PYR3 gene of Ustilago maydis and its use in DNA transformation
Energy Technology Data Exchange (ETDEWEB)
Banks, G.R.; Taylor, S.Y. (National Institute for Medical Research, London (England))
1988-12-01
The Ustilago maydis PYR3 gene encoding dihydroorotase activity was cloned by direct complementation of Escherichia coli pyrC mutations. PYR3 transformants of E. coli pyrC mutants expressed homologous transcripts of a variety of sizes and regained dihydroorotase activity. PYR3 also complemented Saccharomyces cerevisiae ura4 mutations, and again multiple transcripts were expressed in transformants, and enzyme activity was regained. A 1.25-kilobase poly(rA)+ PYR3 transcript was detected in U. maydis itself. Linear DNA carrying the PYR3 gene transformed a U. maydis pyr3-1 pyrimidine auxotroph to prototrophy. Hybridization analysis revealed that three different types of transformants could be generated, depending on the structure of the transforming DNA used. The first type involved exchange of chromosomal mutant gene sequences with the cloned wild-type plasmid sequences. A second type had integrated linear transforming DNA at the chromosomal PYR3 locus, probably via a single crossover event. The third type had integrated transforming DNA sequences at multiple sites in the U. maydis genome. In the last two types, tandemly reiterated copies of the transforming DNA were found to have been integrated. All three types had lost the sensitivity of the parental pyr3-1 mutant to UV irradiation. They had also regained dihydroorotase activity, although its level did not correlate with the PYR3 gene copy number.
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
McDonald, M P; Wong, R; Goldstein, G; Weintraub, B; Cheng, S Y; Crawley, J N
1998-01-01
Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor beta (TRbeta) gene on chromosome 3, representing a mutation of the ligand-binding domain of the TRbeta gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRbeta gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.
McDonald, Michael P.; Wong, Rosemary; Goldstein, Gregory; Weintraub, Bruce; Cheng, Sheue-yann; Crawley, Jacqueline N.
1998-01-01
Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor β (TRβ) gene on chromosome 3, representing a mutation of the ligandbinding domain of the TRβ gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRβ gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRβ gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD. PMID:10454355
Directory of Open Access Journals (Sweden)
Tae Kyung Hyun
Full Text Available The Korean black raspberry (Rubus coreanus Miquel, KB on ripening is usually consumed as fresh fruit, whereas the unripe KB has been widely used as a source of traditional herbal medicine. Such a stage specific utilization of KB has been assumed due to the changing metabolite profile during fruit ripening process, but so far molecular and biochemical changes during its fruit maturation are poorly understood. To analyze biochemical changes during fruit ripening process at molecular level, firstly, we have sequenced, assembled, and annotated the transcriptome of KB fruits. Over 4.86 Gb of normalized cDNA prepared from fruits was sequenced using Illumina HiSeq™ 2000, and assembled into 43,723 unigenes. Secondly, we have reported that alterations in anthocyanins and proanthocyanidins are the major factors facilitating variations in these stages of fruits. In addition, up-regulation of F3'H1, DFR4 and LDOX1 resulted in the accumulation of cyanidin derivatives during the ripening process of KB, indicating the positive relationship between the expression of anthocyanin biosynthetic genes and the anthocyanin accumulation. Furthermore, the ability of RcMCHI2 (R. coreanus Miquel chalcone flavanone isomerase 2 gene to complement Arabidopsis transparent testa 5 mutant supported the feasibility of our transcriptome library to provide the gene resources for improving plant nutrition and pigmentation. Taken together, these datasets obtained from transcriptome library and metabolic profiling would be helpful to define the gene-metabolite relationships in this non-model plant.
Sakoda, H; Imanaka, T
1992-02-01
Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those catalytic amino acid residues were fairly conserved in ADH-T and other ADHs, ADH-T was inferred to have basically the same proton release system as horse liver ADH. The putative proton release system of ADH-T was elucidated by introducing point mutations at the catalytic amino acid residues, Cys-38 (cysteine at position 38), Thr-40, and His-43, with site-directed mutagenesis. The mutant enzyme Thr-40-Ser (Thr-40 was replaced by serine) showed a little lower level of activity than wild-type ADH-T did. The result indicates that the OH group of serine instead of threonine can also be used for the catalytic activity. To change the pKa value of the putative system, His-43 was replaced by the more basic amino acid arginine. As a result, the optimum pH of the mutant enzyme His-43-Arg was shifted from 7.8 (wild-type enzyme) to 9.0. His-43-Arg exhibited a higher level of activity than wild-type enzyme at the optimum pH.
Stagni, Camilla; Zamuner, Carolina; Elefanti, Lisa; Zanin, Tiziana; Bianco, Paola Del; Sommariva, Antonio; Fabozzi, Alessio; Pigozzo, Jacopo; Mocellin, Simone; Montesco, Maria Cristina; Chiarion-Sileni, Vanna; De Nicolo, Arcangela; Menin, Chiara
2018-06-01
Metastatic melanoma is characterized by complex genomic alterations, including a high rate of mutations in driver genes and widespread deletions and amplifications encompassing various chromosome regions. Among them, chromosome 7 is frequently gained in BRAF -mutant melanoma, inducing a mutant allele-specific imbalance. Although BRAF amplification is a known mechanism of acquired resistance to therapy with MAPK inhibitors, it is still unclear if BRAF copy-number variation and BRAF mutant allele imbalance at baseline can be associated with response to treatment. In this study, we used a multimodal approach to assess BRAF copy number and mutant allele frequency in pretreatment melanoma samples from 46 patients who received MAPK inhibitor-based therapy, and we analyzed the association with progression-free survival. We found that 65% patients displayed BRAF gains, often supported by chromosome 7 polysomy. In addition, we observed that 64% patients had a balanced BRAF -mutant/wild-type allele ratio, whereas 14% and 23% patients had low and high BRAF mutant allele frequency, respectively. Notably, a significantly higher risk of progression was observed in patients with a diploid BRAF status versus those with BRAF gains [HR, 2.86; 95% confidence interval (CI), 1.29-6.35; P = 0.01] and in patients with low percentage versus those with a balanced BRAF mutant allele percentage (HR, 4.54; 95% CI, 1.33-15.53; P = 0.016). Our data suggest that quantitative analysis of the BRAF gene could be useful to select the melanoma patients who are most likely to benefit from therapy with MAPK inhibitors. Mol Cancer Ther; 17(6); 1332-40. ©2018 AACR . ©2018 American Association for Cancer Research.
Le Chevanton, L; Leblon, G
1989-04-15
We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.
Directory of Open Access Journals (Sweden)
Graner Andreas
2008-10-01
Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular
Directory of Open Access Journals (Sweden)
Fang Liu
Full Text Available In this study, a red mutant was obtained through in vitro regeneration of a wild purple potato. High-performance liquid chromatography and Mass spectrometry analysis revealed that pelargonidin-3-O-glucoside and petunidin-3-O-glucoside were main anthocyanins in the mutant and wild type tubers, respectively. In order to thoroughly understand the mechanism of anthocyanin transformation in two materials, a comparative transcriptome analysis of the mutant and wild type was carried out through high-throughput RNA sequencing, and 295 differentially expressed genes (DEGs were obtained. Real-time qRT-PCR validation of DEGs was consistent with the transcriptome date. The DEGs mainly influenced biological and metabolic pathways, including phenylpropanoid biosynthesis and translation, and biosynthesis of flavone and flavonol. In anthocyanin biosynthetic pathway, the analysis of structural genes expressions showed that three genes, one encoding phenylalanine ammonia-lyase, one encoding 4-coumarate-CoA ligase and one encoding flavonoid 3',5'-hydroxylasem were significantly down-regulated in the mutant; one gene encoding phenylalanine ammonia-lyase was significantly up-regulated. Moreover, the transcription factors, such as bZIP family, MYB family, LOB family, MADS family, zf-HD family and C2H2 family, were significantly regulated in anthocyanin transformation. Response proteins of hormone, such as gibberellin, abscisic acid and brassinosteroid, were also significantly regulated in anthocyanin transformation. The information contributes to discovering the candidate genes in anthocyanin transformation, which can serve as a comprehensive resource for molecular mechanism research of anthocyanin transformation in potatoes.
Cloning and sequence of the human adrenodoxin reductase gene
International Nuclear Information System (INIS)
Lin, Dong; Shi, Y.; Miller, W.L.
1990-01-01
Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon
Saffarini, Daad A.; Nelson, Kenneth H.
1993-01-01
An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.
Analysis and comparison of fragrant gene sequence in some rice cultivars
Directory of Open Access Journals (Sweden)
Karami Noushafarin
2016-01-01
Full Text Available It is known that the fragrant trait in rice (Oryza sativa L. is largely controlled by fgr gene on chromosome 8 and it has been specified that the existence of an 8 bp deletion and three single nucleotide polymorphism (SNP in exon 7 is effective on this trait. In this study, sequence alignment analysis of fgr exon7 on chromosome 8 for 11 different fragrant and non-fragrant cultivars revealed that 5 aromatic rice cultivars carried 3 SNPs and 8 bp deletion in exon7 which terminates prematurely at a TAA stop codon. However, 5 of the non-aromatics showed a sequence identical to the published Nipponbare, being non-fragrant Japonica variety sequence. An exception among them was Bejar, which had 8 bp deletion and 3SNPs but it was non-aromatic. Sequencing can determine nucleotide alignment of a gene and give beneficial information about gene function. In silico prediction showed proteins sequences alignment of fgr gene for Khazar and Domsiah genotypes were different. Betaine aldehyde dehydrogenase complete enzyme belongs to Khazar non-fragrant genotype that has complete length and 503 amino acids while non-functional BADH2 enzyme for Domsiah fragrant genotype has 251 amino acids that result in accumulate 2-acetyl-1-pyrroline (2AP and produces aroma in fragrant genotypes.
[Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].
Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo
2008-09-01
Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle
Directory of Open Access Journals (Sweden)
R. Lakshmi
2016-06-01
Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.
Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.
Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai
2018-01-09
Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of
Genomic sequence and organization of two members of a human lectin gene family
International Nuclear Information System (INIS)
Gitt, M.A.; Barondes, S.H.
1991-01-01
The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family
Kalajdzic, Predrag; Markaki, Maria; Oehler, Stefan; Savakis, Charalambos
2013-10-01
Certain xenobiotics have the capacity to induce the expression of genes involved in various biological phenomena, including insecticide resistance. The induction potential of different chemicals, among them different insecticides, has been documented for a number of insect species. In this study, we have analyzed the induction potential of Imidacloprid, a widely used member of the neonicotinoid insecticide family. Genes Cyp6g1 and Cyp6a2, known to be involved in the resistance of mutant Drosophila melanogaster line MiT[W⁻]3R2 to Imidacloprid and DDT were included in the analyzed sample. We find that Imidacloprid does not induce expression of the analyzed genes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Luca eTadini
2012-12-01
Full Text Available Perturbations in organellar gene expression (OGE and the thylakoid redox state (TRS activate retrograde signalling pathways that adaptively modify nuclear gene expression (NGE, according to developmental and metabolic needs. The prors1-1 mutation in Arabidopsis down-regulates the expression of the nuclear gene Prolyl-tRNA Synthetase1 (PRORS1 which acts in both plastids and mitochondria, thereby impairing protein synthesis in both organelles and triggering OGE-dependent retrograde signalling. Because the mutation also affects thylakoid electron transport, TRS-dependent signals may likewise have an impact on the changes in NGE observed in this genotype. In this study, we have investigated whether signals related to TRS are actually integrated into the OGE-dependent retrograde signalling pathway. To this end, the chaos mutation (for chlorophyll a/b binding protein harvesting-organelle specific, which shows a partial loss of PSII antennae proteins and thus a reduction in PSII light absorption capability, was introduced into the prors1-1 mutant background. The resulting double mutant displayed a prors1-1-like reduction in plastid translation rate and a chaos-like decrease in PSII antenna size, whereas the hyper-reduction of the thylakoid electron transport chain, caused by the prors1-1 mutation, was alleviated, as determined by monitoring chlorophyll (Chl fluorescence and thylakoid phosphorylation. Interestingly, a substantial fraction of the nucleus-encoded photosynthesis genes down-regulated in the prors1-1 mutant are expressed at nearly wild-type rates in prors1-1 chaos leaves, and this recovery is reflected in the steady-state levels of their protein products in the chloroplast. We therefore conclude that signals related to photosynthetic electron transport and TRS, and indirectly to carbohydrate metabolism and energy balance, are indeed fed into the OGE-dependent retrograde pathway to modulate NGE and adjust the abundance of chloroplast proteins.
Li, Li; Brunk, Brian P.; Kissinger, Jessica C.; Pape, Deana; Tang, Keliang; Cole, Robert H.; Martin, John; Wylie, Todd; Dante, Mike; Fogarty, Steven J.; Howe, Daniel K.; Liberator, Paul; Diaz, Carmen; Anderson, Jennifer; White, Michael; Jerome, Maria E.; Johnson, Emily A.; Radke, Jay A.; Stoeckert, Christian J.; Waterston, Robert H.; Clifton, Sandra W.; Roos, David S.; Sibley, L. David
2003-01-01
Large-scale EST sequencing projects for several important parasites within the phylum Apicomplexa were undertaken for the purpose of gene discovery. Included were several parasites of medical importance (Plasmodium falciparum, Toxoplasma gondii) and others of veterinary importance (Eimeria tenella, Sarcocystis neurona, and Neospora caninum). A total of 55,192 ESTs, deposited into dbEST/GenBank, were included in the analyses. The resulting sequences have been clustered into nonredundant gene assemblies and deposited into a relational database that supports a variety of sequence and text searches. This database has been used to compare the gene assemblies using BLAST similarity comparisons to the public protein databases to identify putative genes. Of these new entries, ∼15%–20% represent putative homologs with a conservative cutoff of p neurona: , , , , , , , , , , , , , –, –, –, –, –. Eimeria tenella: –, –, –, –, –, –, –, –, – , –, –, –, –, –, –, –, –, –, –, –. Neospora caninum: –, –, , – , –, –.] PMID:12618375
Penninckx, I.A.M.A.; Eggermont, K.; Schenk, P.M.; Ackerveken, van den G.; Cammue, B.P.A.; Thomma, B.P.H.J.
2003-01-01
Jasmonate and ethylene are concomitantly involved in the induction of the Arabidopsis plant defensin gene PDF1.2. To define genes in the signal transduction pathway leading to the induction of PDF1.2, we screened for mutants with induced over-expression of a β-glucuronidase reporter, under the
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
The use of a cloned bacterial gene to study mutation in mammalian cells
International Nuclear Information System (INIS)
Thacker, J.; Debenham, P.G.; Stretch, A.; Webb, M.B.T.
1983-01-01
The recombinant DNA molecule pSV2-gpt, which contains the bacterial gene coding for xanthine-guanine phosphoribosyl transferase (XGPRT) activity, was introduced into a hamster cell line lacking the equivalent mammalian enzyme (HGPRT). Hamster cell sublines were found with stable expression of XGPRT activity and were used to study mutation of the integrated pSV2-gpt DNA sequence. Mutants were selected by their resistance to 6-thioguanine (TG) under optimal conditions which were found to be very similar to those for selection of HGPRT-deficient mutants of mammalian cells. The frequency of XGPRT-deficient mutants was increased by treatment with X-rays, ethyl methanesulphonate and ethyl nitrosourea. X-Ray induction of mutants increased approximately linearly with dose up to about 500 rad, but the frequency of mutants per rad was very much higher than that usually found for 'native' mammalian genes. (orig./AJ)
Sequencing results of pncA gene at JALMA
Indian Academy of Sciences (India)
First page Back Continue Last page Overview Graphics. Sequencing results of pncA gene at JALMA. Red colour indicates novel mutations, Blue colour indicates the novel mutations reported at the same codon earlier also.
Clinical utility of a 377 gene custom next-generation sequencing ...
Indian Academy of Sciences (India)
JEN BEVILACQUA
2017-07-26
Jul 26, 2017 ... Clinical utility of a 377 gene custom next-generation sequencing epilepsy panel ... number of genes, making it a very attractive option for a condition as .... clinical value of various test offerings to guide decision making.
Directory of Open Access Journals (Sweden)
Keisuke Tabara
Full Text Available Non-small-cell lung cancer harboring epidermal growth factor receptor (EGFR mutations attains a meaningful response to EGFR-tyrosine kinase inhibitors (TKIs. However, acquired resistance to EGFR-TKIs could affect long-term outcome in almost all patients. To identify the potential mechanisms of resistance, we established cell lines resistant to EGFR-TKIs from the human lung cancer cell lines PC9 and11-18, which harbored activating EGFR mutations. One erlotinib-resistant cell line from PC9 and two erlotinib-resistant cell lines and two gefitinib-resistant cell lines from 11-18 were independently established. Almost complete loss of mutant delE746-A750 EGFR gene was observed in the erlotinib-resistant cells isolated from PC9, and partial loss of the mutant L858R EGFR gene copy was specifically observed in the erlotinib- and gefitinib-resistant cells from 11-18. However, constitutive activation of EGFR downstream signaling, PI3K/Akt, was observed even after loss of the mutated EGFR gene in all resistant cell lines even in the presence of the drug. In the erlotinib-resistant cells from PC9, constitutive PI3K/Akt activation was effectively inhibited by lapatinib (a dual TKI of EGFR and HER2 or BIBW2992 (pan-TKI of EGFR family proteins. Furthermore, erlotinib with either HER2 or HER3 knockdown by their cognate siRNAs also inhibited PI3K/Akt activation. Transfection of activating mutant EGFR complementary DNA restored drug sensitivity in the erlotinib-resistant cell line. Our study indicates that loss of addiction to mutant EGFR resulted in gain of addiction to both HER2/HER3 and PI3K/Akt signaling to acquire EGFR-TKI resistance.
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
[Effect of the 10 kb sequence of piscine Streptococcus agalactiae on bacterial virulence].
Liu, Guangjin; Zhu, Jielian; Shi, Ziwei; Ding, Ming; Wang, Ruyi; Yao, Huochun; Lu, Chengping; Xu, Pao
2016-01-04
From the previous comparative genomic analysis, we found a specific unknown 10 kb sequence (including 11 Open reading Frames) in Chinese piscine strain GD201008-001 genome. To study the role of 10 kb in the pathogenicity of piscine S. agalactiae, the 10 kb sequence was deleted from the GD201008-001 genome. The isogenic mutant Δ10 kb was constructed by using the temperature-sensitive Streptococcus-E. coli shuttle vector pSET4s. We compared the growth characteristics, adherence to HEp-2 cell and bacterial virulence in a zebrafish infection model between wild strain and mutant. Meanwhile the expressions of the known virulence genes from GD201008-001 and Δ10 kb were also quantified by real-time PCR. The Δ10 kb showed no significant differences in bacterial morphology and adherence to HEp-2 cells compared with the wild-type strain, but the speed of growth was slightly slower than the wild strain. Furthermore the 50% lethal dose of Δ10 kb was decreased up to 10-fold (P kb sequence of piscine Streptococcus agalactiae exerts a significant effect on bacterial virulence and probably regulates the virulence genes expression of GD20 1008-001.
High prevalence of human polyomavirus JC VP1 gene sequences in pediatric malignancies.
Shiramizu, B; Hu, N; Frisque, R J; Nerurkar, V R
2007-05-15
The oncogenic potential of human polyomavirus JC (JCV), a ubiquitous virus that establishes infection during early childhood in approximately 70% of the human population, is unclear. As a neurotropic virus, JCV has been implicated in pediatric central nervous system tumors and has been suggested to be a pathogenic agent in pediatric acute lymphoblastic leukemia. Recent studies have demonstrated JCV gene sequences in pediatric medulloblastomas and among patients with colorectal cancer. JCV early protein T-antigen (TAg) can form complexes with cellular regulatory proteins and thus may play a role in tumorigenesis. Since JCV is detected in B-lymphocytes, a retrospective analysis of pediatric B-cell and non-B-cell malignancies as well as other HIV-associated pediatric malignancies was conducted for the presence of JCV gene sequences. DNA was extracted from 49 pediatric malignancies, including Hodgkin disease, non-Hodgkin lymphoma, large cell lymphoma and sarcoma. Polymerase chain reaction (PCR) was conducted using JCV specific nested primer sets for the transcriptional control region (TCR), TAg, and viral capsid protein 1 (VP1) genes. Southern blot analysis and DNA sequencing were used to confirm specificity of the amplicons. A 215-bp region of the JCV VP1 gene was amplified from 26 (53%) pediatric tumor tissues. The JCV TCR and two JCV gene regions were amplified from a leiomyosarcoma specimen from an HIV-infected patient. The leiomyosarcoma specimen from the cecum harbored the archetype strain of JCV. Including the leiomyosarcoma specimen, three of five specimens sequenced were typed as JCV genotype 2. The failure to amplify JCV TCR, and TAg gene sequences in the presence of JCV VP1 gene sequence is surprising. Even though JCV TAg gene, which is similar to the SV40 TAg gene, is oncogenic in animal models, the presence of JCV gene sequences in pediatric malignancies does not prove causality. In light of the available data on the presence of JCV in normal and cancerous
In vitro selection of mutants: Inducible gene regulation for salt tolerance
International Nuclear Information System (INIS)
Winicov, I.; Bastola, D.R.; Deutch, C.E.; Pethe, V.V.; Petrusa, L.
2001-01-01
Regulation of differentially expressed genes in plants may be involved in inducing tolerance to stress. Isogenic salt-sensitive and salt-tolerant alfalfa lines were investigated for molecular differences in their response to salt. The genes, which are differentially induced by salt in the salt-tolerant alfalfa cells and are also regulated by salt at the whole plant level, were cloned. Both transcriptional and post- transcriptional mechanisms influenced salt-induced product accumulation in the salt-tolerant alfalfa. The salt-tolerant plants doubled proline concentration rapidly in roots, while salt-sensitive plants showed a delayed response. To understand the regulatory system in the salt-tolerant alfalfa, two genes that are expressed in roots were studied. Alfin1 encodes a zinc-finger type putative DNA transcription factor conserved in alfalfa, rice and Arabidopsis, and MsPRP2 encodes a protein that serves as a cell wall- membrane linker in roots. Recombinant Alfin1 protein was selected, amplified, cloned and its consensus sequence was identified. The recombinant Alfin1 also bound specifically to fragments of the MsPRP2 promoter in vitro, containing the Alfin1 binding consensus sequence. The results show unambiguously binding specificity of Alfin1 DNA, supporting its role in gene regulation. Alfin1 function was tested in transformed alfalfa in vivo by over-expressing Alfin1 from 35S CaMV promoter. The transgenic plants appeared normal. However, plants harboring the anti-sense construct did not grow well in soil, indicating that Alfin1 expression was essential. Alfin1 over-expression in transgenic alfalfa led to enhanced levels of MsPRP2 transcript accumulation, demonstrating that Alfin1 functioned in vivo in gene regulation. Since MsPRP2 gene is also induced by salt, it is likely that Alfin1 is an important transcription factor for gene regulation in salt-tolerant alfalfa, and an excellent target for manipulation to improve salt tolerance. (author)
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling
2012-10-01
To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.
Energy Technology Data Exchange (ETDEWEB)
Kars, Goekhan; Guenduez, Ufuk; Yuecel, Meral [Department of Biological Sciences, Middle East Technical University, 06531 Ankara (Turkey); Rakhely, Gabor; Kovacs, Kornel L. [Institute of Biophysics, Biological Research Centre, Hungarian Academy of Sciences, Szeged (Hungary); Eroglu, Inci [Department of Chemical Engineering, Middle East Technical University, 06531 Ankara (Turkey)
2008-06-15
Rhodobacter sphaeroides O.U.001 is a purple non-sulfur bacterium producing hydrogen under photoheterotrophic conditions. Hydrogen is produced by Mo-nitrogenase enzyme and substantial amount of H{sub 2} is reoxidized by a membrane-bound uptake hydrogenase in the wild type strain. To improve the hydrogen producing capacity of the cells, a suicide vector containing a gentamicin cassette in the hupSL genes was introduced into R. sphaeroiodes O.U.001 and the uptake hydrogenase genes were destroyed by site directed mutagenesis. The correct integration of the construct was confirmed by uptake hydrogenase activity measurement, PCR and subsequent sequence analysis. The wild type and the mutant cells showed similar growth patterns but the total volume of hydrogen gas evolved by the mutant was 20% higher than that of the wild type strain. This result demonstrated that the hydrogen produced by the nitrogenase was not consumed by uptake hydrogenase leading to higher hydrogen production. (author)
DEFF Research Database (Denmark)
Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen
2001-01-01
A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...
Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.
Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke
2018-06-01
In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .
International Nuclear Information System (INIS)
Deen, K.C.; Sweet, R.W.
1986-01-01
Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively
Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo).
Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko
2017-03-01
Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism ( mog ) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf ( rl ) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD ( PPD ) that regulates arrest of cell divisions in meristematic cells . We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes.
Institute of Scientific and Technical Information of China (English)
XIAO Gui-qing[1,2; ZHANG Hal-wen[3; LU Xiang-yang[1,2; HUANG Rong-feng[3
2015-01-01
A novel rice lesion mimic mutant (LMM) was isolated from an ethane methyl sulfonate (EMS)-induced 02428 mutant bank. The mutant, tentatively designated as Imm6, develops necrotic lesions in the whole growth period along with changes in several important agronomic traits. We found that the initiation of the lesions was induced by light and cell death occurred in Imm6 accompanied with accumulation of reactive oxygen species (ROS). The lower chlorophyll content, soluble protein content and superoxide dismutase (SOD) activity, the higher malondialdehyde (MDA) content were detected in Imm6 than in the wild type (WT). Moreover, the observation by transmission electronic microscope (TEM) demonstrated that some organelles were damaged and the stroma lamella of chloroplast was irregular and loose in mesophyll cell of Imm6. In addition, Imm6 was more resistant than WT to rice blast fungus Magnaporthe grisea infection, which was consistent with increased expression of four genes involved in the defense-related reaction. Genetic analysis showed that mutant trait of Imm6 is inherited as a monogenic recessive nuclear gene located on the long arm of chromosome 6. Using simple sequence repeat (SSR) markers, the target gene was finally delimited to an interval of 80.8 kb between markers MM2359 and MM2370, containing 7 annotated genes. Taken together, our results provide the information to identify a new gene involved in rice lesion mimic, which will be helpful in clarifying the mechanism of cell death and disease resistance in rice.
Clinical Whole-Exome Sequencing for the Diagnosis of Mendelian Disorders
Yang, Yaping; Muzny, Donna M.; Reid, Jeffrey G.; Bainbridge, Matthew N.; Willis, Alecia; Ward, Patricia A.; Braxton, Alicia; Beuten, Joke; Xia, Fan; Niu, Zhiyv; Hardison, Matthew; Person, Richard; Bekheirnia, Mir Reza; Leduc, Magalie S.; Kirby, Amelia; Pham, Peter; Scull, Jennifer; Wang, Min; Ding, Yan; Plon, Sharon E.; Lupski, James R.; Beaudet, Arthur L.; Gibbs, Richard A.; Eng, Christine M.
2014-01-01
BACKGROUND Whole-exome sequencing is a diagnostic approach for the identification of molecular defects in patients with suspected genetic disorders. METHODS We developed technical, bioinformatic, interpretive, and validation pipelines for whole-exome sequencing in a certified clinical laboratory to identify sequence variants underlying disease phenotypes in patients. RESULTS We present data on the first 250 probands for whom referring physicians ordered whole-exome sequencing. Patients presented with a range of phenotypes suggesting potential genetic causes. Approximately 80% were children with neurologic pheno-types. Insurance coverage was similar to that for established genetic tests. We identified 86 mutated alleles that were highly likely to be causative in 62 of the 250 patients, achieving a 25% molecular diagnostic rate (95% confidence interval, 20 to 31). Among the 62 patients, 33 had autosomal dominant disease, 16 had auto-somal recessive disease, and 9 had X-linked disease. A total of 4 probands received two nonoverlapping molecular diagnoses, which potentially challenged the clinical diagnosis that had been made on the basis of history and physical examination. A total of 83% of the autosomal dominant mutant alleles and 40% of the X-linked mutant alleles occurred de novo. Recurrent clinical phenotypes occurred in patients with mutations that were highly likely to be causative in the same genes and in different genes responsible for genetically heterogeneous disorders. CONCLUSIONS Whole-exome sequencing identified the underlying genetic defect in 25% of consecutive patients referred for evaluation of a possible genetic condition. (Funded by the National Human Genome Research Institute.) PMID:24088041
Rapid evolution of the sequences and gene repertoires of secreted proteins in bacteria.
Directory of Open Access Journals (Sweden)
Teresa Nogueira
Full Text Available Proteins secreted to the extracellular environment or to the periphery of the cell envelope, the secretome, play essential roles in foraging, antagonistic and mutualistic interactions. We hypothesize that arms races, genetic conflicts and varying selective pressures should lead to the rapid change of sequences and gene repertoires of the secretome. The analysis of 42 bacterial pan-genomes shows that secreted, and especially extracellular proteins, are predominantly encoded in the accessory genome, i.e. among genes not ubiquitous within the clade. Genes encoding outer membrane proteins might engage more frequently in intra-chromosomal gene conversion because they are more often in multi-genic families. The gene sequences encoding the secretome evolve faster than the rest of the genome and in particular at non-synonymous positions. Cell wall proteins in Firmicutes evolve particularly fast when compared with outer membrane proteins of Proteobacteria. Virulence factors are over-represented in the secretome, notably in outer membrane proteins, but cell localization explains more of the variance in substitution rates and gene repertoires than sequence homology to known virulence factors. Accordingly, the repertoires and sequences of the genes encoding the secretome change fast in the clades of obligatory and facultative pathogens and also in the clades of mutualists and free-living bacteria. Our study shows that cell localization shapes genome evolution. In agreement with our hypothesis, the repertoires and the sequences of genes encoding secreted proteins evolve fast. The particularly rapid change of extracellular proteins suggests that these public goods are key players in bacterial adaptation.
Directory of Open Access Journals (Sweden)
David Jean-Philippe
2009-11-01
Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full
Wan, Liyun; Li, Bei; Pandey, Manish K.; Wu, Yanshan; Lei, Yong; Yan, Liying; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Wei, Guo; Varshney, Rajeev K.; Liao, Boshou
2016-01-01
Seed-coat cracking and undesirable color of seed coat highly affects external appearance and commercial value of peanuts (Arachis hypogaea L.). With an objective to find genetic solution to the above problems, a peanut mutant with cracking and brown colored seed coat (testa) was identified from an EMS treated mutant population and designated as “peanut seed coat crack and brown color mutant line (pscb).” The seed coat weight of the mutant was almost twice of the wild type, and the germination time was significantly shorter than wild type. Further, the mutant had lower level of lignin, anthocyanin, proanthocyanidin content, and highly increased level of melanin content as compared to wild type. Using RNA-Seq, we examined the seed coat transcriptome in three stages of seed development in the wild type and the pscb mutant. The RNA-Seq analysis revealed presence of highly differentially expressed phenylpropanoid and flavonoid pathway genes in all the three seed development stages, especially at 40 days after flowering (DAF40). Also, the expression of polyphenol oxidases and peroxidase were found to be activated significantly especially in the late seed developmental stage. The genome-wide comparative study of the expression profiles revealed 62 differentially expressed genes common across all the three stages. By analyzing the expression patterns and the sequences of the common differentially expressed genes of the three stages, three candidate genes namely c36498_g1 (CCoAOMT1), c40902_g2 (kinesin), and c33560_g1 (MYB3) were identified responsible for seed-coat cracking and brown color phenotype. Therefore, this study not only provided candidate genes but also provided greater insights and molecular genetic control of peanut seed-coat cracking and color variation. The information generated in this study will facilitate further identification of causal gene and diagnostic markers for breeding improved peanut varieties with smooth and desirable seed coat color. PMID
Expressed sequence tags of differential genes in the radioresistant mice and their parental mice
International Nuclear Information System (INIS)
Wang Qin; Yue Jingyin; Li Jin; Song Li; Liu Qiang; Mu Chuanjie; Wu Hongying
2009-01-01
Objective: To explore radioresistance correlative genes in IRM-2 inbred mouse. Methods: The total RNA was extracted from spleen cells of IRM-2 and their parent 615 and ICR/JCL mouse. The mRNA differential display technique was used to analyze gene expression differences. Each differential bands were amplified by PCR, cloned and sequenced. Results: There were 75 differential expression bands appearing in IRM-2 mouse but not in 615 and ICR/JCL mouse. Fifty-two pieces of cDNA sequences were got by sequencing. Twenty-one expressed sequence tags (EST) that were not the same as known mice genes were found and registered by comparing with GenBank database. Conclusion: Twenty-one EST denote that radioresistance correlative genes may be in IRM-2 mouse, which have laid a foundation for isolating and identifying radioresistance correlative genes in further study. (authors)
Gene expression profiling in wild-type and metallothionein mutant fibroblast cell lines
Directory of Open Access Journals (Sweden)
ÁNGELA D ARMENDÁRIZ
2006-01-01
Full Text Available The role of metallothioneins (MT in copper homeostasis is of great interest, as it appears to be partially responsible for the regulation of intracellular copper levels during adaptation to extracellular excess of the metal. To further investigate a possible role of MTs in copper metabolism, a genomics approach was utilized to evaluate the role of MT on gene expression. Microarray analysis was used to examine the effects of copper overload in fibroblast cells from normal and MT I and II double knock-out mice (MT-/-. As a first step, we compared genes that were significantly upregulated in wild-type and MT-/- cells exposed to copper. Even though wild-type and mutant cells are undistinguishable in terms of their morphological features and rates of growth, our results show that MT-/- cells do not respond with induction of typical markers of cellular stress under copper excess conditions, as observed in the wild-type cell line, suggesting that the transcription initiation rate or the mRNA stability of stress genes is affected when there is an alteration in the copper store capacity. The functional classification of other up-regulated genes in both cell lines indicates that a large proportion (>80% belong to two major categories: 1 metabolism; and 2 cellular physiological processes, suggesting that at the transcriptional level copper overload induces the expression of genes associated with diverse molecular functions. These results open the possibility to understand how copper homeostasis is being coordinated with other metabolic pathways.
Analysis of Msx1; Msx2 double mutants reveals multiple roles for Msx genes in limb development.
Lallemand, Yvan; Nicola, Marie-Anne; Ramos, Casto; Bach, Antoine; Cloment, Cécile Saint; Robert, Benoît
2005-07-01
The homeobox-containing genes Msx1 and Msx2 are highly expressed in the limb field from the earliest stages of limb formation and, subsequently, in both the apical ectodermal ridge and underlying mesenchyme. However, mice homozygous for a null mutation in either Msx1 or Msx2 do not display abnormalities in limb development. By contrast, Msx1; Msx2 double mutants exhibit a severe limb phenotype. Our analysis indicates that these genes play a role in crucial processes during limb morphogenesis along all three axes. Double mutant limbs are shorter and lack anterior skeletal elements (radius/tibia, thumb/hallux). Gene expression analysis confirms that there is no formation of regions with anterior identity. This correlates with the absence of dorsoventral boundary specification in the anterior ectoderm, which precludes apical ectodermal ridge formation anteriorly. As a result, anterior mesenchyme is not maintained, leading to oligodactyly. Paradoxically, polydactyly is also frequent and appears to be associated with extended Fgf activity in the apical ectodermal ridge, which is maintained up to 14.5 dpc. This results in a major outgrowth of the mesenchyme anteriorly, which nevertheless maintains a posterior identity, and leads to formation of extra digits. These defects are interpreted in the context of an impairment of Bmp signalling.
Co-expression and characterization of enterocin CRL35 and its mutant in Escherichia coli Rosetta
Directory of Open Access Journals (Sweden)
Masías Emilse
2014-01-01
Full Text Available Even though many sequences and structures of bacteriocins from lactic acid bacteria have been fully characterized so far, little information is currently available about bacteriocins heterologously produced by Escherichia coli. For this purpose, the structural gene of enterocin CRL35, munA, was PCR-amplified using specific primers and cloned downstream of PelB sequence in the pET22b (+ expression vector. E. coli Rosetta (DE3 pLysS was chosen as the host for production and enterocin was purified by an easy two-step protocol. The bacteriocin was correctly expressed with the expected intramolecular disulfide bond. Nevertheless, it was found that a variant of the enterocin, differing by 12 Da from the native polypeptide, was co-expressed by E. coli Rosetta in comparable amount. Indeed, the mutant bacteriocin contained two amino acid substitutions that were characterized by matrix assisted laser desorption ionization-time of flight (MALDI-TOF and HPLCelectrospray (ESI-Q-TOF tandem mass spectrometry (MS/ MS sequencing. This is the first report regarding the production of mutants of pediocin-like bacteriocins in the E. coli expression system.
Reshamwala, Shamlan M S; Noronha, Santosh B
2011-10-01
Cra is a pleiotropic regulatory protein that controls carbon and energy flux in enteric bacteria. Recent studies have shown that Cra also regulates other cell processes and influences biofilm formation. The purpose of the present study was to investigate the role of Cra in biofilm formation in Escherichia coli. Congo red-binding studies suggested that curli biosynthesis is impaired in cra mutants. Microarray analysis of wild-type and mutant E. coli cultivated in conditions promoting biofilm formation revealed that the curli biosynthesis genes, csgBAC and csgDEFG, are poorly expressed in the mutant, suggesting that transcription of genes required for curli production is regulated by Cra. Four putative Cra-binding sites were identified in the curli intergenic region, which were experimentally validated by performing electromobility shift assays. Site-directed mutagenesis of three Cra-binding sites in the promoter region of the csgDEFG operon suggests that Cra activates transcription of this operon upon binding to operator regions both downstream and upstream of the transcription start site. Based on the Cra-binding sites identified in this and other studies, the Cra consensus sequence is refined.
Reactive oxygen species (ROS) are very harmful to living organisms due to the potential oxidation of membrane lipids, DNA, proteins, and carbohydrates. Transformed E.coli strain QC 871, superoxide dismutase (SOD) double-mutant, with three sequence variant MnSOD1, MnSOD2, and MnSOD3 manganese supero...
A functional analysis of the formyl-coenzyme A (frc) gene from Lactobacillus reuteri 100-23C.
Kullin, B; Tannock, G W; Loach, D M; Kimura, K; Abratt, V R; Reid, S J
2014-06-01
To examine the role of the Lactobacillus reuteri 100-23C frc gene product in oxalate metabolism, host colonization and the acid stress response. Genes encoding putative formyl-CoA transferase (frc) and oxalyl-CoA decarboxylase (oxc) enzymes are present in the genome sequences of Lact. reuteri strains. Two strains isolated from humans harboured an IS200 insertion sequence in the frc ORF and a group 2 intron-associated transposase downstream of the frc gene, both of which were lacking in two strains of animal origin, which contained intact frc and oxc genes. An frc(-) insertional mutant of Lact. reuteri 100-23C was compared with the parent strain with respect to oxalate degradation, colonization of an RLF-mouse host model and growth in the presence of acids. Neither parent nor mutant degraded oxalate in vitro or in vivo. However, the parent outcompeted the frc(-) mutant in the mouse intestine during co-colonization and the frc(-) mutant showed a reduced growth rate in the presence of hydrochloric acid. Intact oxc and frc genes do not ensure oxalate degradation under the conditions tested. The frc gene product is important during host colonization and survival of acid stress by Lact. reuteri 100-23C. Oxalate metabolism by oxalate-degrading intestinal bacterial strains may be important in preventing urolithiasis and might lead to the derivation of probiotic products. To produce safe and efficacious probiotics, however, an understanding of the genetic characteristics of potential oxalate degraders must be obtained, together with knowledge of their functional ramifications. © 2014 The Society for Applied Microbiology.
Dwarf mutant of rice variety Seratus Malam
International Nuclear Information System (INIS)
Mugiono, P. S.; Soemanggono, A.M.R.
1989-01-01
Full text: Seeds of 'Seratus Malam', a local tall upland variety with long panicles and high yield potential were irradiated with 10-50 krad gamma rays in 1983. From 50,000 M 2 plants, 130 semidwarf mutants and 1 dwarf mutant were selected. The dwarf mutant M-362 was obtained from the 10 krad treatment. The mutant shows about 50% reduction in plant height, but also in number of productive tillers. Thus the yield per plant is also significantly less. However, the mutant gene is not allelic to DGWG and therefore may be useful in cross breeding. (author)
Characterization of MORE AXILLARY GROWTH genes in Populus.
Directory of Open Access Journals (Sweden)
Olaf Czarnecki
Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.
Kwon, Minseok; Leem, Sangseob; Yoon, Joon; Park, Taesung
2018-03-19
With the rapid advancement of array-based genotyping techniques, genome-wide association studies (GWAS) have successfully identified common genetic variants associated with common complex diseases. However, it has been shown that only a small proportion of the genetic etiology of complex diseases could be explained by the genetic factors identified from GWAS. This missing heritability could possibly be explained by gene-gene interaction (epistasis) and rare variants. There has been an exponential growth of gene-gene interaction analysis for common variants in terms of methodological developments and practical applications. Also, the recent advancement of high-throughput sequencing technologies makes it possible to conduct rare variant analysis. However, little progress has been made in gene-gene interaction analysis for rare variants. Here, we propose GxGrare which is a new gene-gene interaction method for the rare variants in the framework of the multifactor dimensionality reduction (MDR) analysis. The proposed method consists of three steps; 1) collapsing the rare variants, 2) MDR analysis for the collapsed rare variants, and 3) detect top candidate interaction pairs. GxGrare can be used for the detection of not only gene-gene interactions, but also interactions within a single gene. The proposed method is illustrated with 1080 whole exome sequencing data of the Korean population in order to identify causal gene-gene interaction for rare variants for type 2 diabetes. The proposed GxGrare performs well for gene-gene interaction detection with collapsing of rare variants. GxGrare is available at http://bibs.snu.ac.kr/software/gxgrare which contains simulation data and documentation. Supported operating systems include Linux and OS X.
Energy Technology Data Exchange (ETDEWEB)
Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang, E-mail: wolfgang.marwan@ovgu.de
2013-05-24
Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level.
International Nuclear Information System (INIS)
Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang
2013-01-01
Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level
Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata
Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.
2018-03-01
It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.
Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.
Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia
2017-07-24
Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.
Directory of Open Access Journals (Sweden)
Ulrike Rensch
Full Text Available The biocide triclosan (TRC is used in a wide range of household, personal care, veterinary, industrial and medical products to control microbial growth. This extended use raises concerns about a possible association between the application of triclosan and the development of antibiotic resistance. In the present study we determined triclosan mutant prevention concentrations (MPC for Salmonella enterica isolates of eight serovars and investigated selected mutants for their mechanisms mediating decreased susceptibility to triclosan. MPCTRC values were 8-64-fold higher than MIC values and ranged between 1-16 µg/ml. The frequencies at which mutants were selected varied between 1.3 x 10(-10-9.9 x 10(-11. Even if MIC values of mutants decreased by 3-7 dilution steps in the presence of the efflux pump inhibitor Phe-Arg-β-naphtylamide, only minor changes were observed in the expression of genes encoding efflux components or regulators, indicating that neither the major multidrug efflux pump AcrAB-TolC nor AcrEF are up-regulated in triclosan-selected mutants. Nucleotide sequence comparisons confirmed the absence of alterations in the regulatory regions acrRA, soxRS, marORAB, acrSE and ramRA of selected mutants. Single bp and deduced Gly93→Val amino acid exchanges were present in fabI, the target gene of triclosan, starting from a concentration of 1 µg/ml TRC used for MPC determinations. The fabI genes were up to 12.4-fold up-regulated. Complementation experiments confirmed the contribution of Gly93→Val exchanges and fabI overexpression to decreased triclosan susceptibility. MIC values of mutants compared to parent strains were even equal or resulted in a more susceptible phenotype (1-2 dilution steps for the aminoglycoside antibiotics kanamycin and gentamicin as well as for the biocide chlorhexidine. Growth rates of selected mutants were significantly lower and hence, might partly explain the rare occurrence of Salmonella field isolates exhibiting
Bron, P.A.; Meijer, M.; Bongers, R.S.; Vos, de W.M.; Kleerebezem, M.
2007-01-01
This study aims to evaluate the impact of mutation of previously identified in vivo-induced (ivi) genes on the persistence and survival of Lactobacillus plantarum WCFS1 in the gastrointestinal (GI) tract of mice. Methods and Results:¿ Nine Lact. plantarum ivi gene replacement mutants were
A human gut microbial gene catalogue established by metagenomic sequencing
DEFF Research Database (Denmark)
dos Santos, Marcelo Bertalan Quintanilha; Sicheritz-Pontén, Thomas; Nielsen, Henrik Bjørn
2010-01-01
To understand the impact of gut microbes on human health and well-being it is crucial to assess their genetic potential. Here we describe the Illumina-based metagenomic sequencing, assembly and characterization of 3.3 million non-redundant microbial genes, derived from 576.7 gigabases of sequence...
Okuda, Naoyuki; Fujii, Tatsuya; Inoue, Hiroyuki; Ishikawa, Kazuhiko; Hoshino, Tamotsu
2016-10-01
We obtained strains with the xylanase regulator gene, xlnR, overexpressed (HXlnR) and disrupted (DXlnR) derived from Talaromyces cellulolyticus strain C-1, which is a cellulase hyperproducing mutant. Filter paper degrading enzyme activity and cellobiohydrolase I gene expression was the highest in HXlnR, followed by C-1 and DXlnR. These results indicate that the enhancement of cellulase productivity was succeeded by xlnR overexpression.
Studies on reduced height mutants in rice
International Nuclear Information System (INIS)
Narahari, P.; Bhagwat, S.G.
1984-01-01
Two cross-bred derivatives of the mutant TR5xTR17 and TR21 continued to show promise and were advanced to wider scale testing. TR5 was found to carry a semi-dwarfing gene different from that in IR8. New semi-dwarf mutants were screened from M 2 through M 4 from two separate radiation experiments. The gibberellin response of seedlings of mutant and tester strains was evaluated and crosses of tester stocks and mutant semi-dwarfs were made for genetic analyses. (author)
Directory of Open Access Journals (Sweden)
Fernando Calahorro
Full Text Available Neuroligins are cell adhesion proteins that interact with neurexins at the synapse. This interaction may contribute to differentiation, plasticity and specificity of synapses. In humans, single mutations in neuroligin encoding genes lead to autism spectrum disorder and/or mental retardation. Caenorhabditis elegans mutants deficient in nlg-1, an orthologue of human neuroligin genes, have defects in different behaviors. Here we show that the expression of human NLGN1 or rat Nlgn1 cDNAs in C. elegans nlg-1 mutants rescues the fructose osmotic strength avoidance and gentle touch response phenotypes. Two specific point mutations in NLGN3 and NLGN4 genes, involved in autistic spectrum disorder, were further characterized in this experimental system. The R451C allele described in NLGN3, was analyzed with both human NLGN1 (R453C and worm NLG-1 (R437C proteins, and both were not functional in rescuing the osmotic avoidance behavior and the gentle touch response phenotype. The D396X allele described in NLGN4, which produces a truncated protein, was studied with human NLGN1 (D432X and they did not rescue any of the behavioral phenotypes analyzed. In addition, RNAi feeding experiments measuring gentle touch response in wild type strain and worms expressing SID-1 in neurons (which increases the response to dsRNA, both fed with bacteria expressing dsRNA for nlg-1, provided evidence for a postsynaptic in vivo function of neuroligins both in muscle cells and neurons, equivalent to that proposed in mammals. This finding was further confirmed generating transgenic nlg-1 deficient mutants expressing NLG-1 under pan-neuronal (nrx-1 or pan-muscular (myo-3 specific promoters. All these results suggest that the nematode could be used as an in vivo model for studying particular synaptic mechanisms with proteins orthologues of humans involved in pervasive developmental disorders.
International Nuclear Information System (INIS)
Baloch, M.J.; Jatoi, W.A.
2012-01-01
Physiological and yield traits such as stomatal conductance (mmol m-/sup 2/s/sup -1/), Leaf relative water content (RWC %) and grain yield per plant were studied in a separate experiment. Results revealed that five out of sixteen cultivars viz. Anmol, Moomal, Sarsabz, Bhitai and Pavan, appeared to be relatively more drought tolerant. Based on morphophysiological results, studies were continued to look at these cultivars for drought tolerance at molecular level. Initially, four well recognized primers for dehydrin genes (DHNs) responsible for drought induction in T. durum L., T. aestivum L. and O. sativa L. were used for profiling gene sequence of sixteen wheat cultivars. The primers amplified the DHN genes variably like Primer WDHN13 (T. aestivum L.) amplified the DHN gene in only seven cultivars whereas primer TdDHN15 ( T. durum L.) amplified all the sixteen cultivars with even different DNA banding patterns some showing second weaker DNA bands. Third primer TdDHN16 (T. durum L.) has shown entirely different PCR amplification prototype, specially showing two strong DNA bands while fourth primer RAB16C (O. sativa L.) failed to amplify DHN gene in any of the cultivars. Examination of DNA sequences revealed several interesting features. First, it identified the two exon/one intron structure of this gene (complete sequences were not shown), a feature not previously described in the two database cDNA sequences available from T. aestivum L. (gi|21850). Secondly, the analysis identified several single nucleotide polymorphisms (SNPs), positions in gene sequence. Although complete gene sequence was not obtained for all the cultivars, yet there were a total of 38 variable positions in exonic (coding region) sequence, from a total gene length of 453 nucleotides. Matrix of SNP shows these 37 positions with individual sequence at positions given for each of the 14 cultivars (sequence of two cultivars was not obtained) included in this analysis. It demonstrated a considerab le
Molecular typing of a novel canine parvovirus type 2a mutant circulating in Italy.
Mira, Francesco; Dowgier, Giulia; Purpari, Giuseppa; Vicari, Domenico; Di Bella, Santina; Macaluso, Giusi; Gucciardi, Francesca; Randazzo, Vincenzo; Decaro, Nicola; Guercio, Annalisa
2018-07-01
Canine parvovirus (CPV) is the etiological agent of a severe viral disease of dogs. After its emergence in late 1970s, the CPV original type (CPV-2) was rapidly and totally replaced by three antigenic variants named CPV-2a, CPV-2b and CPV-2c. CPV has an evolutionary rate nearest to those of RNA viruses, with consequences on disease diagnosis and epidemiology. This paper reports the molecular characterization of eight CPV-2a strains collected from dogs in Italy in 2016-2017. Genetic analysis was conducted on a CPV genomic region encompassing both open reading frames (ORFs) encoding for nonstructural (NS1-NS2) and structural proteins (VP1-VP2). Sequence analysis indicates new and unreported sequence changes, mainly affecting the VP2 gene, which included the mutation Tyr324Leu. This study represents the first evidence of a new CPV-2a mutant (VP2 324Leu) and illustrates the importance of a continuous molecular survey in order to obtain more information on effective spread of new CPV mutants. Copyright © 2018 Elsevier B.V. All rights reserved.
Cai, Zhiying; Li, Guohua; Lin, Chunhua; Shi, Tao; Zhai, Ligang; Chen, Yipeng; Huang, Guixiu
2013-07-19
To gain more insight into the molecular mechanisms of Colletotrichum gloeosporioides pathogenesis, Agrobacterium tumefaciens-mediated transformation (ATMT) was used to identify mutants of C. gloeosporioides impaired in pathogenicity. An ATMT library of 4128 C. gloeosporioides transformants was generated. Transformants were screened for defects in pathogenicity with a detached copper brown leaf assay. 32 mutants showing reproducible pathogenicity defects were obtained. Southern blot analysis showed 60.4% of the transformants had single-site T-DNA integrations. 16 Genomic sequences flanking T-DNA were recovered from mutants by thermal asymmetric interlaced PCR, and were used to isolate the tagged genes from the genome sequence of wild-type C. gloeosporioides by Basic Local Alignment Search Tool searches against the local genome database of the wild-type C. gloeosporioides. One potential pathogenicity genes encoded calcium-translocating P-type ATPase. Six potential pathogenicity genes had no known homologs in filamentous fungi and were likely to be novel fungal virulence factors. Two putative genes encoded Glycosyltransferase family 28 domain-containing protein and Mov34/MPN/PAD-1 family protein, respectively. Five potential pathogenicity genes had putative function matched with putative protein of other Colletotrichum species. Two known C. gloeosporioides pathogenicity genes were also identified, the encoding Glomerella cingulata hard-surface induced protein and C. gloeosporioides regulatory subunit of protein kinase A gene involved in cAMP-dependent PKA signal transduction pathway. Copyright © 2013 Elsevier GmbH. All rights reserved.
Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming
2016-05-27
Dwarfism is one of the most valuable traits in banana breeding because semi-dwarf cultivars show good resistance to damage by wind and rain. Moreover, these cultivars present advantages of convenient cultivation, management, and so on. We obtained a dwarf mutant '8818-1' through EMS (ethyl methane sulphonate) mutagenesis of Williams banana 8818 (Musa spp. AAA group). Our research have shown that gibberellins (GAs) content in 8818-1 false stems was significantly lower than that in its parent 8818 and the dwarf type of 8818-1 could be restored by application of exogenous GA3. Although GA exerts important impacts on the 8818-1 dwarf type, our understanding of the regulation of GA metabolism during banana dwarf mutant development remains limited. Genome-wide screening revealed 36 candidate GA metabolism genes were systematically identified for the first time; these genes included 3 MaCPS, 2 MaKS, 1 MaKO, 2 MaKAO, 10 MaGA20ox, 4 MaGA3ox, and 14 MaGA2ox genes. Phylogenetic tree and conserved protein domain analyses showed sequence conservation and divergence. GA metabolism genes exhibited tissue-specific expression patterns. Early GA biosynthesis genes were constitutively expressed but presented differential regulation in different tissues in Williams banana. GA oxidase family genes were mainly transcribed in young fruits, thus suggesting that young fruits were the most active tissue involved in GA metabolism, followed by leaves, bracts, and finally approximately mature fruits. Expression patterns between 8818 and 8818-1 revealed that MaGA20ox4, MaGA20ox5, and MaGA20ox7 of the MaGA20ox gene family and MaGA2ox7, MaGA2ox12, and MaGA2ox14 of the MaGA2ox gene family exhibited significant differential expression and high-expression levels in false stems. These genes are likely to be responsible for the regulation of GAs content in 8818-1 false stems. Overall, phylogenetic evolution, tissue specificity and differential expression analyses of GA metabolism genes can provide a
Transcriptional regulation of male-sterility in 7B-1 male-sterile tomato mutant.
Directory of Open Access Journals (Sweden)
Vahid Omidvar
Full Text Available The 7B-1 tomato (Solanum lycopersicum L. cv Rutgers is a male-sterile mutant with enhanced tolerance to abiotic stress, which makes it a potential candidate for hybrid seed breeding and stress engineering. To underline the molecular mechanism regulating the male-sterility in 7B-1, transcriptomic profiles of the 7B-1 male-sterile and wild type (WT anthers were studied using mRNA sequencing (RNA-Seq. In total, 768 differentially expressed genes (DEGs were identified, including 132 up-regulated and 636 down-regulated transcripts. Gene ontology (GO enrichment analysis of DEGs suggested a general impact of the 7B-1 mutation on metabolic processes, such as proteolysis and carbohydrate catabolic process. Sixteen candidates with key roles in regulation of anther development were subjected to further analysis using qRT-PCR and in situ hybridization. Cytological studies showed several defects associated with anther development in the 7B-1 mutant, including unsynchronized anther maturation, dysfunctional meiosis, arrested microspores, defect in callose degradation and abnormal tapetum development. TUNEL assay showed a defect in programmed cell death (PCD of tapetal cells in 7B-1 anthers. The present study provides insights into the transcriptome of the 7B-1 mutant. We identified several genes with altered expression level in 7B-1 (including beta-1,3 glucanase, GA2oxs, cystatin, cysteine protease, pectinesterase, TA29, and actin that could potentially regulate anther developmental processes, such as meiosis, tapetum development, and cell-wall formation/degradation.
Soto-Suárez, Mauricio; Serrato, Antonio J; Rojas-González, José A; Bautista, Rocío; Sahrawy, Mariam
2016-12-01
During the photosynthesis, two isoforms of the fructose-1,6-bisphosphatase (FBPase), the chloroplastidial (cFBP1) and the cytosolic (cyFBP), catalyse the first irreversible step during the conversion of triose phosphates (TP) to starch or sucrose, respectively. Deficiency in cyFBP and cFBP1 isoforms provokes an imbalance of the starch/sucrose ratio, causing a dramatic effect on plant development when the plastidial enzyme is lacking. We study the correlation between the transcriptome and proteome profile in rosettes and roots when cFBP1 or cyFBP genes are disrupted in Arabidopsis thaliana knock-out mutants. By using a 70-mer oligonucleotide microarray representing the genome of Arabidopsis we were able to identify 1067 and 1243 genes whose expressions are altered in the rosettes and roots of the cfbp1 mutant respectively; whilst in rosettes and roots of cyfbp mutant 1068 and 1079 genes are being up- or down-regulated respectively. Quantitative real-time PCR validated 100% of a set of 14 selected genes differentially expressed according to our microarray analysis. Two-dimensional (2-D) gel electrophoresis-based proteomic analysis revealed quantitative differences in 36 and 26 proteins regulated in rosettes and roots of cfbp1, respectively, whereas the 18 and 48 others were regulated in rosettes and roots of cyfbp mutant, respectively. The genes differentially expressed and the proteins more or less abundant revealed changes in protein metabolism, RNA regulation, cell signalling and organization, carbon metabolism, redox regulation, and transport together with biotic and abiotic stress. Notably, a significant set (25%) of the proteins identified were also found to be regulated at a transcriptional level. This transcriptomic and proteomic analysis is the first comprehensive and comparative study of the gene/protein re-adjustment that occurs in photosynthetic and non-photosynthetic organs of Arabidopsis mutants lacking FBPase isoforms.
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S.; Johnson, Marc T.J.; Wright, Stephen I.; Pellizzer, Tommaso; Sobanski, Johanna; Greiner, Stephan
2016-01-01
Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. PMID:27053421
Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J
2015-10-01
FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental
Bastian, Thomas W; Rice, Stephen A
2009-01-01
Previous studies have shown that the herpes simplex virus type 1 (HSV-1) immediate-early protein ICP22 alters the phosphorylation of the host cell RNA polymerase II (Pol II) during viral infection. In this study, we have engineered several ICP22 plasmid and virus mutants in order to map the ICP22 sequences that are involved in this function. We identify a region in the C-terminal half of ICP22 (residues 240 to 340) that is critical for Pol II modification and further show that the N-terminal half of the protein (residues 1 to 239) is not required. However, immunofluorescence analysis indicates that the N-terminal half of ICP22 is needed for its localization to nuclear body structures. These results demonstrate that ICP22's effects on Pol II do not require that it accumulate in nuclear bodies. As ICP22 is known to enhance viral late gene expression during infection of certain cultured cells, including human embryonic lung (HEL) cells, we used our engineered viral mutants to map this function of ICP22. It was found that mutations in both the N- and C-terminal halves of ICP22 result in similar defects in viral late gene expression and growth in HEL cells, despite having distinctly different effects on Pol II. Thus, our results genetically uncouple ICP22's effects on Pol II from its effects on viral late gene expression. This suggests that these two functions of ICP22 may be due to distinct activities of the protein.
Genetic and agronomic evaluation of induced semi-dwarf mutants of rice
International Nuclear Information System (INIS)
Rutger, J.N.
1984-01-01
Induced semi-dwarf mutants have played an important role in California's rapid shift from nearly all tall rice varieties in 1978 to nearly all semi-dwarf varieties at present. In 1981 over half of the California rice area was planted with semi-dwarf varieties carrying the induced mutant semi-dwarfing gene sd 1 , while much of the other half was planted to a variety deriving its semi-dwarfism from IR8. The sd 1 mutant is allelic to the major semi-dwarfing gene in DGWG and IR8. Current objectives are to determine the inheritance of new semi-dwarf mutants, including allelism tests with sd 1 , and to evaluate the agronomic potential of nonallelic sources and of double-dwarfs. To date semi-dwarf mutants from 10 varieties have been partially or completely evaluated. At least three nonallelic semi-dwarfing genes, sd 1 , sd 2 , and sd 4 , have been described. Rather than attempt to determine all possible allelic relationships of new mutants, crosses are being made only to the reference sd 1 source, since sd 1 , still seems to be the most productive semi-dwarfing gene source. However, nonallelic semi-dwarf mutants in the varieties M5 and Labelle may be useful if genetic vulnerability from widespread usage of the sd 1 source becomes a problem. (author)
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Transcriptome-based analysis on carbon metabolism of Haematococcus pluvialis mutant under 15% CO2.
Li, Ke; Cheng, Jun; Lu, Hongxiang; Yang, Weijuan; Zhou, Junhu; Cen, Kefa
2017-06-01
To elucidate the mechanism underlying the enhanced growth rate in the Haematococcus pluvialis mutated with 60 Co-γ rays and domesticated with 15% CO 2 , transcriptome sequencing was conducted to clarify the carbon metabolic pathways of mutant cells. The CO 2 fixation rate of mutant cells increased to 2.57gL -1 d -1 under 15% CO 2 due to the enhanced photosynthesis, carbon fixation, glycolysis pathways. The upregulation of PetH, ATPF0A and PetJ related to photosynthetic electron transport, ATP synthase and NADPH generation promoted the photosynthesis. The upregulation of genes related to Calvin cycle and ppdK promoted carbon fixation in both C3 and C4 photosynthetic pathways. The reallocation of carbon was also enhanced under 15% CO 2 . The 19-, 14- and 3.5-fold upregulation of FBA, TPI and PK genes, respectively, remarkably promoted the glycolysis pathways. This accelerated the conversion of photosynthetic carbon to pyruvate, which was an essential precursor for astaxanthin and lipids biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hosomi, Koji; Kuwana, Ritsuko; Takamatsu, Hiromu; Kohda, Tomoko; Kozaki, Shunji; Mukamoto, Masafumi
2015-06-01
Clostridium botulinum is a heat-resistant spore-forming bacterium that causes the serious paralytic illness botulism. Heat-resistant spores may cause food sanitation hazards and sporulation plays a central role in the survival of C. botulinum. We observed morphological changes and investigated the role of the transcriptional regulator SpoIIID in the sporulation of C. botulinum type B strain 111 in order to elucidate the molecular mechanism in C. botulinum. C. botulinum type B formed heat-resistant spores through successive morphological changes corresponding to those of Bacillus subtilis, a spore-forming model organism. An analysis of the spoIIID gene knockout mutant revealed that the transcriptional regulator SpoIIID contributed to heat-resistant spore formation by C. botulinum type B and activated the transcription of the sigK gene later during sporulation. Transcription of the spoIIID gene, which differed from that in B. subtilis and Clostridium difficile, was observed in the sigE gene knockout mutant of C. botulinum type B. An analysis of the sigF gene knockout mutant showed that the sporulation-specific sigma factor SigF was essential for transcription of the spoIIID gene in C. botulinum type B. These results suggest that the regulation of sporulation in C. botulinum is not similar to that in B. subtilis and other clostridia. Copyright © 2015 Elsevier Ltd. All rights reserved.
Probiotic features of Lactobacillus plantarum mutant strains.
Bove, Pasquale; Gallone, Anna; Russo, Pasquale; Capozzi, Vittorio; Albenzio, Marzia; Spano, Giuseppe; Fiocco, Daniela
2012-10-01
In this study, the probiotic potential of Lactobacillus plantarum wild-type and derivative mutant strains was investigated. Bacterial survival was evaluated in an in vitro system, simulating the transit along the human oro-gastro-intestinal tract. Interaction with human gut epithelial cells was studied by assessing bacterial adhesive ability to Caco-2 cells and induction of genes involved in innate immunity. L. plantarum strains were resistant to the combined stress at the various steps of the simulated gastrointestinal tract. Major decreases in the viability of L. plantarum cells were observed mainly under drastic acidic conditions (pH ≤ 2.0) of the gastric compartment. Abiotic stresses associated to small intestine poorly affected bacterial viability. All the bacterial strains significantly adhered to Caco-2 cells, with the ΔctsR mutant strain exhibiting the highest adhesion. Induction of immune-related genes resulted higher upon incubation with heat-inactivated bacteria rather than with live ones. For specific genes, a differential transcriptional pattern was observed upon stimulation with different L. plantarum strains, evidencing a possible role of the knocked out bacterial genes in the modulation of host cell response. In particular, cells from Δhsp18.55 and ΔftsH mutants strongly triggered immune defence genes. Our study highlights the relevance of microbial genetic background in host-probiotic interaction and might contribute to identify candidate bacterial genes and molecules involved in probiosis.
Involvement of the VEP1 gene in vascular strand development in Arabidopsis thaliana.
Jun, Ji Hyung; Ha, Chan Man; Nam, Hong Gil
2002-03-01
A dominant mutant line characterized by abnormal leaf venation pattern was isolated from a transgenic Arabidopsis plant pool that was generated with Agrobacterium culture harboring an Arabidopsis antisense cDNA library. In the mutant line, the phenotype was due to antisense suppression of a gene we named VEP1 (Vein Patterning). The predicted amino acid sequence of the gene contained a motif related to the mammalian death domain that is found in the apoptotic machinery. Reduced expression of the VEP1 gene resulted in the reduced complexity of the venation pattern of the cotyledons and foliar leaves, which was mainly due to the reduced number of the minor veins and their incomplete connection. The analysis of mutant embryos indicated that the phenotype was originated, at least in part, from a defect in the procambium patterning. In the mutant, the stem and root were thinner than those in wild type. This phenotype was associated with reduced vascular development. The promoter activity of the VEP1 gene was detected preferentially in the vascular regions. We propose that the death domain-containing protein VEP1 functions as a positive element required for vascular strand development in Arabidopsis thaliana.
International Nuclear Information System (INIS)
Du Zeji; Wang Mingsuo
1998-12-01
Deinococcus radiodurans (Dr) possesses a prominent ability to repair DNA injury induced by various DNA-damaging agents including mitomycin C (MC), ultraviolet light (UV) and ionizing radiation. A DNA repair mutant Dr KH3111 is a streptomycin resistant (Sm R ) derivative of KH311 which is generated by treatment with nitrosoguanidine and is sensitive to MC, 8-trimethyl-psoralen, UV and γ-ray irradiation. Gene affected by a mutation in the mutant is identified and its nucleotide sequence is determined. A complete open reading frame (ORF) which encompassed the KH3111 mutation region is found and tentatively designated as orf144b. The deduced amino acid (aa) sequence of orf144b consists of 284 aa and has no significant homology to other known proteins. The exact KH3111 mutation site is one nucleotide altered (G to A) in the sequence of orf144b in the mutant. The KH3111 mutation causes the substitution of Gly for Glu at aa position 149 of Orf144b. Survival measurements of a revertant KH3112 which was produced by transforming with DNA containing a part of the orf144b gene of KD8301 showed that the resistances to MC, UV and γ-ray in the revertant were fully restored at a level equal to the wild type. Thus, the orf144b gene required for the multiple-DNA-damaging agent resistance of Dr was designated with the name of pprA (Pleiotropic gene promoting DNA repair). This new gene can express in E. coli at very high level, and make the host E. coli resistant to MC, UV and γ-ray. The pprA gene does not express in normal Dr, but it can be induced to express by treatment with MC, UV and γ-ray. It was thought that the PprA polypeptide is a cytoplasmic protein because of the absence of characteristics found in the aa sequence of membrane proteins
Swainsonine Biosynthesis Genes in Diverse Symbiotic and Pathogenic Fungi
Directory of Open Access Journals (Sweden)
Daniel Cook
2017-06-01
Full Text Available Swainsonine—a cytotoxic fungal alkaloid and a potential cancer therapy drug—is produced by the insect pathogen and plant symbiont Metarhizium robertsii, the clover pathogen Slafractonia leguminicola, locoweed symbionts belonging to Alternaria sect. Undifilum, and a recently discovered morning glory symbiont belonging to order Chaetothyriales. Genome sequence analyses revealed that these fungi share orthologous gene clusters, designated “SWN,” which included a multifunctional swnK gene comprising predicted adenylylation and acyltransferase domains with their associated thiolation domains, a β-ketoacyl synthase domain, and two reductase domains. The role of swnK was demonstrated by inactivating it in M. robertsii through homologous gene replacement to give a ∆swnK mutant that produced no detectable swainsonine, then complementing the mutant with the wild-type gene to restore swainsonine biosynthesis. Other SWN cluster genes were predicted to encode two putative hydroxylases and two reductases, as expected to complete biosynthesis of swainsonine from the predicted SwnK product. SWN gene clusters were identified in six out of seven sequenced genomes of Metarhzium species, and in all 15 sequenced genomes of Arthrodermataceae, a family of fungi that cause athlete’s foot and ringworm diseases in humans and other mammals. Representative isolates of all of these species were cultured, and all Metarhizium spp. with SWN clusters, as well as all but one of the Arthrodermataceae, produced swainsonine. These results suggest a new biosynthetic hypothesis for this alkaloid, extending the known taxonomic breadth of swainsonine producers to at least four orders of Ascomycota, and suggest that swainsonine has roles in mutualistic symbioses and diseases of plants and animals.
Respiratory-deficient mutants of the unicellular green alga Chlamydomonas: a review.
Salinas, Thalia; Larosa, Véronique; Cardol, Pierre; Maréchal-Drouard, Laurence; Remacle, Claire
2014-05-01
Genetic manipulation of the unicellular green alga Chlamydomonas reinhardtii is straightforward. Nuclear genes can be interrupted by insertional mutagenesis or targeted by RNA interference whereas random or site-directed mutagenesis allows the introduction of mutations in the mitochondrial genome. This, combined with a screen that easily allows discriminating respiratory-deficient mutants, makes Chlamydomonas a model system of choice to study mitochondria biology in photosynthetic organisms. Since the first description of Chlamydomonas respiratory-deficient mutants in 1977 by random mutagenesis, many other mutants affected in mitochondrial components have been characterized. These respiratory-deficient mutants increased our knowledge on function and assembly of the respiratory enzyme complexes. More recently some of these mutants allowed the study of mitochondrial gene expression processes poorly understood in Chlamydomonas. In this review, we update the data concerning the respiratory components with a special focus on the assembly factors identified on other organisms. In addition, we make an inventory of different mitochondrial respiratory mutants that are inactivated either on mitochondrial or nuclear genes. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
2013-01-01
Background Salamanders are unique among vertebrates in their ability to completely regenerate amputated limbs through the mediation of blastema cells located at the stump ends. This regeneration is nerve-dependent because blastema formation and regeneration does not occur after limb denervation. To obtain the genomic information of blastema tissues, de novo transcriptomes from both blastema tissues and denervated stump ends of Ambystoma mexicanum (axolotls) 14 days post-amputation were sequenced and compared using Solexa DNA sequencing. Results The sequencing done for this study produced 40,688,892 reads that were assembled into 307,345 transcribed sequences. The N50 of transcribed sequence length was 562 bases. A similarity search with known proteins identified 39,200 different genes to be expressed during limb regeneration with a cut-off E-value exceeding 10-5. We annotated assembled sequences by using gene descriptions, gene ontology, and clusters of orthologous group terms. Targeted searches using these annotations showed that the majority of the genes were in the categories of essential metabolic pathways, transcription factors and conserved signaling pathways, and novel candidate genes for regenerative processes. We discovered and confirmed numerous sequences of the candidate genes by using quantitative polymerase chain reaction and in situ hybridization. Conclusion The results of this study demonstrate that de novo transcriptome sequencing allows gene expression analysis in a species lacking genome information and provides the most comprehensive mRNA sequence resources for axolotls. The characterization of the axolotl transcriptome can help elucidate the molecular mechanisms underlying blastema formation during limb regeneration. PMID:23815514
Stetina, Mandy; Behr, Jürgen; Vogel, Rudi F
2014-07-01
As a result of its strong adaptation to wheat and rye sourdoughs, Lactobacillus sanfranciscensis has the smallest genome within the genus Lactobacillus. The concomitant absence of some important antioxidative enzymes and the inability to synthesize glutathione suggest a role of cystine transport in maintenance of an intracellular thiol balance. Diamide [synonym 1,1'-azobis(N,N-dimethylformamide)] disturbs intracellular and membrane thiol levels in oxidizing protein thiols depending on its initial concentration. In this study, RNA sequencing was used to reveal the transcriptional response of L. sanfranciscensis DSM 20451(T) (wild type [WT]) and its ΔtcyB mutant with a nonfunctional cystine transporter after thiol stress caused by diamide. Along with the different expression of genes involved in amino acid starvation, pyrimidine synthesis, and energy production, our results show that thiol stress in the wild type can be compensated through activation of diverse chaperones and proteases whereas the ΔtcyB mutant shifts its metabolism in the direction of survival. Only a small set of genes are significantly differentially expressed between the wild type and the mutant. In the WT, mainly genes which are associated with a heat shock response are upregulated whereas glutamine import and synthesis genes are downregulated. In the ΔtcyB mutant, the whole opp operon was more highly expressed, as well as a protein which probably includes enzymes for methionine transport. The two proteins encoded by spxA and nrdH, which are involved in direct or indirect oxidative stress responses, are also upregulated in the mutant. This work emphasizes that even in the absence of definitive antioxidative enzymes, bacteria with a small genome and a high frequency of gene inactivation and elimination use small molecules such as the cysteine/cystine couple to overcome potential cell damage resulting from oxidative stress. Copyright © 2014, American Society for Microbiology. All Rights
Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes
Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee
2012-01-01
Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon
2014-11-01
The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.
Whole Exome Sequencing in Females with Autism Implicates Novel and Candidate Genes
Directory of Open Access Journals (Sweden)
Merlin G. Butler
2015-01-01
Full Text Available Classical autism or autistic disorder belongs to a group of genetically heterogeneous conditions known as Autism Spectrum Disorders (ASD. Heritability is estimated as high as 90% for ASD with a recently reported compilation of 629 clinically relevant candidate and known genes. We chose to undertake a descriptive next generation whole exome sequencing case study of 30 well-characterized Caucasian females with autism (average age, 7.7 ± 2.6 years; age range, 5 to 16 years from multiplex families. Genomic DNA was used for whole exome sequencing via paired-end next generation sequencing approach and X chromosome inactivation status. The list of putative disease causing genes was developed from primary selection criteria using machine learning-derived classification score and other predictive parameters (GERP2, PolyPhen2, and SIFT. We narrowed the variant list to 10 to 20 genes and screened for biological significance including neural development, function and known neurological disorders. Seventy-eight genes identified met selection criteria ranging from 1 to 9 filtered variants per female. Five females presented with functional variants of X-linked genes (IL1RAPL1, PIR, GABRQ, GPRASP2, SYTL4 with cadherin, protocadherin and ankyrin repeat gene families most commonly altered (e.g., CDH6, FAT2, PCDH8, CTNNA3, ANKRD11. Other genes related to neurogenesis and neuronal migration (e.g., SEMA3F, MIDN, were also identified.
Donnini, C; Lodi, T; Ferrero, I; Puglisi, P P
1992-02-01
The IMP2 gene of Saccharomyces cerevisiae is involved in the nucleo-mitochondrial control of maltose, galactose and raffinose utilization as shown by the inability of imp2 mutants to grow on these carbon sources in respiratory-deficient conditions or in the presence of ethidium bromide and erythromycin. The negative phenotype cannot be scored in the presence of inhibitors of respiration and oxidative phosphorylation, indicating that the role of the mitochondria in the utilization of the above-mentioned carbon sources in imp2 mutants is not at the energetical level. Mutations in the IMP2 gene also confer many phenotypic alterations in respiratory-sufficient conditions, e.g. leaky phenotype on oxidizable carbon sources, sensitivity to heat shock and sporulation deficiency. The IMP2 gene has been cloned, sequenced and disrupted. The phenotype of null imp2 mutants is indistinguishable from that of the originally isolated mutant.
Fidelity and Mutational Spectrum of Pfu DNA Polymerase on a Human Mitochondrial DNA Sequence
André, Paulo; Kim, Andrea; Khrapko, Konstantin; Thilly, William G.
1997-01-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10−6 must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or “PCR noise”. Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 × 10−7, and five of its more frequent mutations (hot spots) consisted of three transversions (GC → TA, AT → TA, and AT → CG), one transition (AT → GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be
Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.
André, P; Kim, A; Khrapko, K; Thilly, W G
1997-08-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.
Vassilara, Foula; Galani, Irene; Souli, Maria; Papanikolaou, Konstantinos; Giamarellou, Helen; Papadopoulos, Antonios
2017-07-01
The aim of this study was to determine the propensities of imipenem to select for resistant Pseudomonas aeruginosa mutants by determining the mutant prevention concentrations (MPCs) for 9 unrelated clinical isolates and the accession of any relationship with mechanisms of resistance development. The MPC/MIC ratios ranged from 4 to 16. Detection of resistance mechanisms in the mutant derivatives of the nine isolates mainly revealed inactivating mutations in the gene coding for outer membrane protein OprD. Point mutations leading to premature stop codons or amino acid substitution S278P, ≥1bp deletion leading to frameshift mutations and interruption of the oprD by an insertion sequence, were observed. MPC and mutant selection window (MSW) are unique parameters that may guide the implementation of antimicrobial treatment, providing useful information about the necessary imipenem concentration needed in the infection area, in order to avoid the emergence of resistance, especially in clinical situations with high bacterial load. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Su Chen
2014-09-01
Full Text Available In our previous research, the Tamarix androssowii LEA gene (Tamarix androssowii late embryogenesis abundant protein Mrna, GenBank ID: DQ663481 was transferred into Populus simonii × Populus nigra. Among the eleven transgenic lines, one exhibited a dwarf phenotype compared to the wild type and other transgenic lines, named dwf1. To uncover the mechanisms underlying this phenotype, digital gene expression libraries were produced from dwf1, wild-type, and other normal transgenic lines, XL-5 and XL-6. Gene expression profile analysis indicated that dwf1 had a unique gene expression pattern in comparison to the other two transgenic lines. Finally, a total of 1246 dwf1-unique differentially expressed genes were identified. These genes were further subjected to gene ontology and pathway analysis. Results indicated that photosynthesis and carbohydrate metabolism related genes were significantly affected. In addition, many transcription factors genes were also differentially expressed in dwf1. These various differentially expressed genes may be critical for dwarf mutant formation; thus, the findings presented here might provide insight for our understanding of the mechanisms of tree growth and development.
Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S; Zupok, Arkadiusz; Johnson, Marc T J; Wright, Stephen I; Pellizzer, Tommaso; Sobanski, Johanna; Bock, Ralph; Greiner, Stephan
2016-04-01
Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. © 2016 American Society of Plant Biologists. All rights reserved.
Chemotaxis-defective mutants of the nematode Caenorhabditis elegans.
Dusenbery, D B; Sheridan, R E; Russell, R L
1975-06-01
The technique of countercurrent separation has been used to isolate 17 independent chemotaxis-defective mutants of the nematode Caenorhabditis elegans. The mutants, selected to be relatively insensitive to the normally attractive salt NaCl, show varying degrees of residual sensitivity; some are actually weakly repelled by NaCl. The mutants are due to single gene defects, are autosomal and recessive, and identify at least five complementation groups.
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis
DEFF Research Database (Denmark)
Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata
2000-01-01
The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...
Gene Unprediction with Spurio: A tool to identify spurious protein sequences.
Höps, Wolfram; Jeffryes, Matt; Bateman, Alex
2018-01-01
We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation. Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases. We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes. Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.
Technology development for gene discovery and full-length sequencing
Energy Technology Data Exchange (ETDEWEB)
Marcelo Bento Soares
2004-07-19
In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.
Directory of Open Access Journals (Sweden)
Barik Sailen
2001-12-01
Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.
Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M
1998-04-01
Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.
Characterization and Sequencing of MT-Cox1 Gene in Khorasan ...
African Journals Online (AJOL)
The aim of this study was to investigate the nucleotide sequence of COX1 gene in mitochondrial genome of Khorasan native chicken and detect the possible mutations in the genome. For this purpose, after sampling and extracting DNA from the whole blood samples, the COX1 gene was amplified using specific primers and ...
Sequence analysis of putative swrW gene required for surfactant ...
African Journals Online (AJOL)
owner
2012-07-17
Jul 17, 2012 ... These nucleotide and protein sequence analysis of the putative swrW gene provides vital information on the versatility .... chain reaction (PCR) products were stored at 4°C. Presence of ... identical to the same gene with an E-value of 0.0. .... The Prokaryotes-A Handbook on the Biol. of Bacteria:Ecophysiol.
Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways
Cirulli, Elizabeth T.; Lasseigne, Brittany N.; Petrovski, Slavé; Sapp, Peter C.; Dion, Patrick A.; Leblond, Claire S.; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J.; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E.; Boone, Braden E.; Wimbish, Jack R.; Waite, Lindsay L.; Jones, Angela L.; Carulli, John P.; Day-Williams, Aaron G.; Staropoli, John F.; Xin, Winnie W.; Chesi, Alessandra; Raphael, Alya R.; McKenna-Yasek, Diane; Cady, Janet; de Jong, J. M. B. Vianney; Kenna, Kevin P.; Smith, Bradley N.; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H.; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E.; Baloh, Robert H.; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M.; Gibson, Summer; Trojanowski, John Q.; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Baas, Frank; ten Asbroek, Anneloor L. M. A.
2015-01-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS
The role of the β-1,6-endoglucanase gene vegB in physiology and virulence of Verticillium dahliae
Directory of Open Access Journals (Sweden)
Lugard EBOIGBE
2014-05-01
Full Text Available The β-1,6-endoglucanase gene (vegB of Verticillium dahliae was isolated using a genome walking technique. Nucleotide and deduced amino acid sequences of the gene showed high identity with the PAN1 sequence deposited at the Verticillium genome database (Broad Institute, but significant differences in intron numbers and sites of insertion. Detailed in silico analysis, accompanied by sequencing of both genomic and cDNA, as well as RT-PCR experiments, provided the correct size of the gene and the exact number, length and positions of introns. The putative protein of this gene was compared with corresponding β-1,6-endoglucanases from other fungi, and sequences were used to construct a phylogenetic tree. A clear differentiation between enzymes derived from plant pathogenic and mycoparasitic fungi was observed, fully supported by bootstrap data. An internal fragment (1.2kb of vegB was used to disrupt the wild-type gene of a V. dahliae tomato race 2 strain, and the mutant strain, vegB-, was tested for pathogenicity on tomato plants. Results showed a small but constant reduction in disease symptoms only on eggplants for the vegB- strain in comparison with the wild type. Growth on minimal medium supplemented with different carbon sources showed reduced ability of the mutant to breakdown cellulose, whereas growth on glucose, pectin and sucrose was similar to the wild type.
Sequence variations in the FAD2 gene in seeded pumpkins.
Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P
2015-12-21
Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.
D'Alessio, Maya; Nordeste, Ricardo; Doxey, Andrew C; Charles, Trevor C
2017-01-01
Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti , we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis ( phbA , phbB , phbAB , and phbC ), PHB degradation ( bdhA , phaZ , and acsA2 ), and glycogen synthesis ( glgA1 ). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to
Directory of Open Access Journals (Sweden)
Gregory N. Thyssen
2016-06-01
Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Genetic Segregation Analysis of a Rapeseed Dwarf Mutant
International Nuclear Information System (INIS)
Xiang, G.; Yu, S.; Zhang, T.; Zhao, J.; Lei, S.; Du, C.
2016-01-01
Dwarf resources in Brassica napus are very important for developing high-yield cultivars through dwarf-type and lodging-resistant breeding. However, few dwarf varieties have been available for this species. Here, we reported a new rapeseed dwarf mutant GRC1157, which exhibits obvious phenotypic variations on dwarf. Six generations (P /sub 1/, P/sub 1/, F/sub 1/, F/sub 1/, B/sub 1/, and B/sub 1/) were produced from a cross between dwarf mutant GRC1157 and an elite tall-type line XR16 to analyze genetic inheritances of plant height (PH), numbers of the 1st valid branch (VBN), main inflorescence length (MIL), pod numbers per main inflorescence (MPN), pod length (PL) and seed numbers per pod (PSN) using the mixed major gene plus polygene inheritance model. The genetic analysis shows different traits were controlled by different inheritance models: PH and PL by two pairs of additive-dominant-epistatic major genes plus additive-dominant-epistatic polygenes, MPN and PSN by two-pair additive-dominant-epistatic major genes plus additive-dominant polygenes, MIL by two-pair additive-dominant-epistatic major genes and VBN by one-pair additive-dominant major genes plus additive-dominant-epistatic polygenes. Furthermore, positive correlations between PH and some other traits were observed, suggesting that some traits may be co-regulated by several linkage or same loci/genes. In addition, high heritability (40.35-93.7 percent) were found for five traits (except VBN) in different segregating generations, indicating these traits were mainly affected by hereditary factors and suitable for early artificial selection. In sum, the dwarf mutant GRC1157 can serve as a valuable resource for rapeseed dwarf breeding and the genetic analysis in this study provided a foundation for further mapping and cloning dwarf genes in mutant GRC1157. (author)
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Directory of Open Access Journals (Sweden)
Bharti Arvind K
2008-12-01
Full Text Available Abstract Background Many plant genomes are resistant to whole-genome assembly due to an abundance of repetitive sequence, leading to the development of gene-rich sequencing techniques. Two such techniques are hypomethylated partial restriction (HMPR and methylation spanning linker libraries (MSLL. These libraries differ from other gene-rich datasets in having larger insert sizes, and the MSLL clones are designed to provide reads localized to "epigenetic boundaries" where methylation begins or ends. Results A large-scale study in maize generated 40,299 HMPR sequences and 80,723 MSLL sequences, including MSLL clones exceeding 100 kb. The paired end reads of MSLL and HMPR clones were shown to be effective in linking existing gene-rich sequences into scaffolds. In addition, it was shown that the MSLL clones can be used for anchoring these scaffolds to a BAC-based physical map. The MSLL end reads effectively identified epigenetic boundaries, as indicated by their preferential alignment to regions upstream and downstream from annotated genes. The ability to precisely map long stretches of fully methylated DNA sequence is a unique outcome of MSLL analysis, and was also shown to provide evidence for errors in gene identification. MSLL clones were observed to be significantly more repeat-rich in their interiors than in their end reads, confirming the correlation between methylation and retroelement content. Both MSLL and HMPR reads were found to be substantially gene-enriched, with the SalI MSLL libraries being the most highly enriched (31% align to an EST contig, while the HMPR clones exhibited exceptional depletion of repetitive DNA (to ~11%. These two techniques were compared with other gene-enrichment methods, and shown to be complementary. Conclusion MSLL technology provides an unparalleled approach for mapping the epigenetic status of repetitive blocks and for identifying sequences mis-identified as genes. Although the types and natures of
Käfer, Etta
1987-01-01
All available amino acid-requiring mutants of Aspergillus nidulans were found to be hypersensitive to MMS (methyl methanesulfonate) to various degrees. On MMS media, secondary mutations could be selected which suppress this MMS sensitivity but do not affect the requirement. Many such mutations were analyzed and found to be alleles of one gene, smsA (= suppressor of MMS sensitivity), which mapped distal on the right arm of chromosome V. This gene is more likely to be involved in general regula...
Mutations in the maize zeta-carotene desaturase gene lead to viviparous kernel.
Directory of Open Access Journals (Sweden)
Yan Chen
Full Text Available Preharvest sprouting reduces the maize quality and causes a significant yield loss in maize production. vp-wl2 is a Mutator (Mu-induced viviparous mutant in maize, causing white or pale yellow kernels, dramatically reduced carotenoid and ABA content, and a high level of zeta-carotene accumulation. Here, we reported the cloning of the vp-wl2 gene using a modified digestion-ligation-amplification method (DLA. The results showed that an insertion of Mu9 in the first intron of the zeta-carotene desaturase (ZDS gene results in the vp-wl2 mutation. Previous studies have suggested that ZDS is likely the structural gene of the viviparous9 (vp9 locus. Therefore, we performed an allelic test using vp-wl2 and three vp9 mutants. The results showed that vp-wl2 is a novel allele of the vp9 locus. In addition, the sequences of ZDS gene were identified in these three vp9 alleles. The vp-wl2 mutant gene was subsequently introgressed into four maize inbred lines, and a viviparous phenotype was observed with yield losses from 7.69% to 13.33%.
Ağladıoğlu, Sebahat Yılmaz; Aycan, Zehra; Çetinkaya, Semra; Baş, Veysel Nijat; Önder, Aşan; Peltek Kendirci, Havva Nur; Doğan, Haldun; Ceylaner, Serdar
2016-04-01
Maturity-onset diabetes of the youth (MODY), is a genetically and clinically heterogeneous group of diseasesand is often misdiagnosed as type 1 or type 2 diabetes. The aim of this study is to investigate both novel and proven mutations of 11 MODY genes in Turkish children by using targeted next generation sequencing. A panel of 11 MODY genes were screened in 43 children with MODY diagnosed by clinical criterias. Studies of index cases was done with MISEQ-ILLUMINA, and family screenings and confirmation studies of mutations was done by Sanger sequencing. We identified 28 (65%) point mutations among 43 patients. Eighteen patients have GCK mutations, four have HNF1A, one has HNF4A, one has HNF1B, two have NEUROD1, one has PDX1 gene variations and one patient has both HNF1A and HNF4A heterozygote mutations. This is the first study including molecular studies of 11 MODY genes in Turkish children. GCK is the most frequent type of MODY in our study population. Very high frequency of novel mutations (42%) in our study population, supports that in heterogenous disorders like MODY sequence analysis provides rapid, cost effective and accurate genetic diagnosis.
Directory of Open Access Journals (Sweden)
Guocai Li
Full Text Available Neisseria gonorrhoeae (N. gonorrhoeae outer membrane protein reduction modifiable protein (Rmp has strong immunogenicity. However, anti-Rmp antibodies block rather than preserve the antibacterial effects of protective antibodies, which hampers the development of vaccines for gonococcal infections. We herein constructed an Rmp deletion mutant strain of N. gonorrhoeae by gene homologous recombination. The 261-460 nucleotide residues of Rmp gene amplified from N. gonorrhoeae WHO-A strain were replaced with a kanamycin-resistant Kan gene amplified from pET-28a. The resultant hybridized DNA was transformed into N. gonorrhoeae WHO-A strain. PCR was used to screen the colonies in which wild-type Rmp gene was replaced with a mutant gene fragment. Western blotting revealed that the Rmp deletion mutant strain did not express Rmp protein. Rmp deletion did not alter the morphological and Gram staining properties of the mutant strain that grew slightly more slowly than the wild-type one. Rmp gene mutated stably throughout 25 generations of passage. Antibody-mediated complement-dependent cytotoxicity assay indicated that the antibodies induced by the mutant strain had evidently higher bactericidal activities than those induced by the wild-type strain. Further modification of the Rmp deletion mutant strain is still required in the development of novel live attenuated vaccines for gonorrhea by Opa genes deletion or screening of phenotypic variant strains that do not express Opa proteins.
Directory of Open Access Journals (Sweden)
Iwona Szarejko
2013-06-01
Full Text Available Abscisic acid plays a pivotal role in the abiotic stress response in plants. Although great progress has been achieved explaining the complexity of the stress and ABA signaling cascade, there are still many questions to answer. Mutants are a valuable tool in the identification of new genes or new alleles of already known genes and in elucidating their role in signaling pathways. We applied a suppressor mutation approach in order to find new components of ABA and abiotic stress signaling in Arabidopsis. Using the abh1 (ABA hypersensitive 1 insertional mutant as a parental line for EMS mutagenesis, we selected several mutants with suppressed hypersensitivity to ABA during seed germination. Here, we present the response to ABA and a wide range of abiotic stresses during the seed germination and young seedling development of two suppressor mutants—soa2 (suppressor of abh1 hypersensitivity to ABA 2 and soa3 (suppressor of abh1 hypersensitivity to ABA 3. Generally, both mutants displayed a suppression of the hypersensitivity of abh1 to ABA, NaCl and mannitol during germination. Both mutants showed a higher level of tolerance than Columbia-0 (Col-0—the parental line of abh1 in high concentrations of glucose. Additionally, soa2 exhibited better root growth than Col-0 in the presence of high ABA concentrations. soa2 and soa3 were drought tolerant and both had about 50% fewer stomata per mm2 than the wild-type but the same number as their parental line—abh1. Taking into account that suppressor mutants had the same genetic background as their parental line—abh1, it was necessary to backcross abh1 with Landsberg erecta four times for the map-based cloning approach. Mapping populations, derived from the cross of abh1 in the Landsberg erecta background with each suppressor mutant, were created. Map based cloning in order to identify the suppressor genes is in progress.
Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants
Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.
2010-01-01
Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic ...
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Rawat, Mamta; Newton, Gerald L.; Ko, Mary; Martinez, Gladys J.; Fahey, Robert C.; Av-Gay, Yossef
2002-01-01
Mycothiol (MSH; 1d-myo-inosityl 2-[N-acetyl-l-cysteinyl]amido-2-deoxy-α-d-glucopyranoside) is the major low-molecular-weight thiol produced by mycobacteria. Mutants of Mycobacterium smegmatis mc2155 deficient in MSH production were produced by chemical mutagenesis as well as by transposon mutagenesis. One chemical mutant (mutant I64) and two transposon mutants (mutants Tn1 and Tn2) stably deficient in MSH production were isolated by screening for reduced levels of MSH content. The MSH contents of transposon mutants Tn1 and Tn2 were found to be less than 0.1% that of the parent strain, and the MSH content of I64 was found to be 1 to 5% that of the parent strain. All three strains accumulated 1d-myo-inosityl 2-deoxy-α-d-glucopyranoside to levels 20- to 25-fold the level found in the parent strain. The cysteine:1d-myo-inosityl 2-amino-2-deoxy-α-d-glucopyranoside ligase (MshC) activities of the three mutant strains were ≤2% that of the parent strain. Phenotypic analysis revealed that these MSH-deficient mutants possess increased susceptibilities to free radicals and alkylating agents and to a wide range of antibiotics including erythromycin, azithromycin, vancomycin, penicillin G, rifamycin, and rifampin. Conversely, the mutants possess at least 200-fold higher levels of resistance to isoniazid than the wild type. We mapped the mutation in the chemical mutant by sequencing the mshC gene and showed that a single amino acid substitution (L205P) is responsible for reduced MSH production and its associated phenotype. Our results demonstrate that there is a direct correlation between MSH depletion and enhanced sensitivity to toxins and antibiotics. PMID:12384335
Synonymous genes explore different evolutionary landscapes.
Directory of Open Access Journals (Sweden)
Guillaume Cambray
2008-11-01
Full Text Available The evolutionary potential of a gene is constrained not only by the amino acid sequence of its product, but by its DNA sequence as well. The topology of the genetic code is such that half of the amino acids exhibit synonymous codons that can reach different subsets of amino acids from each other through single mutation. Thus, synonymous DNA sequences should access different regions of the protein sequence space through a limited number of mutations, and this may deeply influence the evolution of natural proteins. Here, we demonstrate that this feature can be of value for manipulating protein evolvability. We designed an algorithm that, starting from an input gene, constructs a synonymous sequence that systematically includes the codons with the most different evolutionary perspectives; i.e., codons that maximize accessibility to amino acids previously unreachable from the template by point mutation. A synonymous version of a bacterial antibiotic resistance gene was computed and synthesized. When concurrently submitted to identical directed evolution protocols, both the wild type and the recoded sequence led to the isolation of specific, advantageous phenotypic variants. Simulations based on a mutation isolated only from the synthetic gene libraries were conducted to assess the impact of sub-functional selective constraints, such as codon usage, on natural adaptation. Our data demonstrate that rational design of synonymous synthetic genes stands as an affordable improvement to any directed evolution protocol. We show that using two synonymous DNA sequences improves the overall yield of the procedure by increasing the diversity of mutants generated. These results provide conclusive evidence that synonymous coding sequences do experience different areas of the corresponding protein adaptive landscape, and that a sequence's codon usage effectively constrains the evolution of the encoded protein.
Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying
2014-01-01
A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.
RNA-Seq analysis and gene discovery of Andrias davidianus using Illumina short read sequencing.
Directory of Open Access Journals (Sweden)
Fenggang Li
Full Text Available The Chinese giant salamander, Andrias davidianus, is an important species in the course of evolution; however, there is insufficient genomic data in public databases for understanding its immunologic mechanisms. High-throughput transcriptome sequencing is necessary to generate an enormous number of transcript sequences from A. davidianus for gene discovery. In this study, we generated more than 40 million reads from samples of spleen and skin tissue using the Illumina paired-end sequencing technology. De novo assembly yielded 87,297 transcripts with a mean length of 734 base pairs (bp. Based on the sequence similarities, searching with known proteins, 38,916 genes were identified. Gene enrichment analysis determined that 981 transcripts were assigned to the immune system. Tissue-specific expression analysis indicated that 443 of transcripts were specifically expressed in the spleen and skin. Among these transcripts, 147 transcripts were found to be involved in immune responses and inflammatory reactions, such as fucolectin, β-defensins and lymphotoxin beta. Eight tissue-specific genes were selected for validation using real time reverse transcription quantitative PCR (qRT-PCR. The results showed that these genes were significantly more expressed in spleen and skin than in other tissues, suggesting that these genes have vital roles in the immune response. This work provides a comprehensive genomic sequence resource for A. davidianus and lays the foundation for future research on the immunologic and disease resistance mechanisms of A. davidianus and other amphibians.
Minson, A C; Darby, G K; Wildy, P
1979-11-01
Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.
Toyama, H; Anthony, C; Lidstrom, M E
1998-09-01
Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.
Mutants dissecting development and behaviour in drosophila
International Nuclear Information System (INIS)
Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.
2005-01-01
We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50
Directory of Open Access Journals (Sweden)
Nian-Zhang Zhang
2014-01-01
Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.
Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean
Directory of Open Access Journals (Sweden)
Sujan Mamidi
2016-07-01
Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.
Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase
International Nuclear Information System (INIS)
Behme, M.T.; Ebisuzaki, K.
1975-01-01
A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli. A mutant phage strain lacking this enzyme has been isolated and characterized. Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected. Burst sizes were similar for the mutant phage and T4D in polAl, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E. coli. UV sensitivity and genetic recombination were normal in a variety of E. coli hosts. Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56. The nonessential nature of this gene is discussed
Analysis of mutations in the entire coding sequence of the factor VIII gene
Energy Technology Data Exchange (ETDEWEB)
Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others
1994-09-01
Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.
Energy Technology Data Exchange (ETDEWEB)
Chaudhuri, R K; Dutta, S.K. Ojha, M.
1973-01-01
DNA from seven experimentally induced morphological mutants and the wild type strain 74A of Neurospora crassa showed typical bimodal denaturation profiles in a Gilford 2400 spectrophotometer. The ''slime'' and ''ropy'' mutants showed a comparatively high proportion of A + T rich DNA sequences. Studies on thermal denaturation, percent hybridization, and thermal stability indicate the DNA sequences of the slime mutant were distinctly different from the normal genomes of parental DNA as well as other wild type DNAs. No such difference was noticed in any other mutant and natural isolate of the species N. crassa tested. These studies indicate possible correlation between a change in DNA nucleotide sequences and abnormal morphogenesis.
Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli
DEFF Research Database (Denmark)
Triman, K; Becker, E; Dammel, C
1989-01-01
Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance....... The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature......-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between...
International Nuclear Information System (INIS)
Bedian, V.; Summers, M.C.; Kauffman, S.A.
1988-01-01
We have identified early embryo proteins related to the segmentation gene Krueppel by [35S]methionine pulse labelling and two-dimensional gel electrophoresis. Protein synthesis differences shared by homozygous embryos of two Krueppel alleles when compared to heterozygous and wild-type embryos are reported. The study was extended to syncytial blastoderm stages by pulse labelling and gel analysis of single embryos, using Krueppel-specific proteins from gastrula stages as molecular markers for identifying homozygous Krueppel embryos. Localized expression of interesting proteins was examined in embryo fragments. The earliest differences detected at nuclear migration stages showed unregulated synthesis in mutant embryos of two proteins that have stage specific synthesis in normal embryos. At the cellular blastoderm stage one protein was not synthesized and two proteins showed apparent shifts in isoelectric point in mutant embryos. Differences observed in older embryos included additional proteins with shifted isoelectric points and a number of qualitative and quantitative changes in protein synthesis. Five of the proteins with altered rates of synthesis in mutant embryos showed localized synthesis in normal embryos. The early effects observed are consistent with the hypothesis that the Krueppel product can be a negative or positive regulator of expression of other loci, while blastoderm and gastrula stage shifts in isoelectric point indicate that a secondary effect of Krueppel function may involve post-translational modification of proteins
SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS
Directory of Open Access Journals (Sweden)
M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3
2006-10-01
Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.
Potter, Christopher S; Pruett, Nathanael D; Kern, Michael J; Baybo, Mary Ann; Godwin, Alan R; Potter, Kathleen A; Peterson, Ron L; Sundberg, John P; Awgulewitsch, Alexander
2011-04-01
Among the Hox genes, homeobox C13 (Hoxc13) has been shown to be essential for proper hair shaft differentiation, as Hoxc13 gene-targeted (Hoxc13(tm1Mrc)) mice completely lack external hair. Because of the remarkable overt phenotypic parallels to the Foxn1(nu) (nude) mutant mice, we sought to determine whether Hoxc13 and forkhead box N1 (Foxn1) might act in a common pathway of hair follicle (HF) differentiation. We show that the alopecia exhibited by both the Hoxc13(tm1Mrc) and Foxn1(nu) mice is because of strikingly similar defects in hair shaft differentiation and that both mutants suffer from a severe nail dystrophy. These phenotypic similarities are consistent with the extensive overlap between Hoxc13 and Foxn1 expression patterns in the HF and the nail matrix. Furthermore, DNA microarray analysis of skin from Hoxc13(tm1Mrc) mice identified Foxn1 as significantly downregulated along with numerous hair keratin genes. This Foxn1 downregulation apparently reflects the loss of direct transcriptional control by HOXC13 as indicated by our results obtained through co-transfection and chromatin immunoprecipitation (ChIP) assays. As presented in the discussion, these data support a regulatory model of keratinocyte differentiation in which HOXC13-dependent activation of Foxn1 is part of a regulatory cascade controlling the expression of terminal differentiation markers.
International Nuclear Information System (INIS)
Walker, D.C.; McCloskey, D.A.; Simard, L.R.; McInnes, R.R.
1990-01-01
Argininosuccinic acid lyase (ASAL) deficiency is a clinically heterogeneous autosomal recessive urea cycle disorder. The authors previously established by complementation analysis that 29 ASAL-deficient patients have heterogeneous mutations in a single gene. To prove that the ASAL structural gene is the affected locus, they sequenced polymerase chain reaction-amplified ASAL cDNA of a representative mutant from the single complementation group. Fibroblast strain 944 from a late-onset patient who was the product of a consanguineous mating, had only a single base-pair change in the coding region, a C-283→ T transition at a CpG dinucleotide in exon 3. This substitution converts Arg-95 to Cys (R95C), occurs in a stretch of 13 residues that is identical in yeast and human ASAL, and was present in both of the patient's alleles but not in 14 other mutant or 10 normal alleles. They observed that amplified cDNA from mutant 944 and normal cells (liver, keratinocytes, lymphoblasts, and fibroblasts) contained, in addition to the expected 5' 513-base-pair band, a prominent 318-base-pair ASAL band formed by the splicing of exon 2 from the transcript. The short transcript maintains the ASAL reading frame but removes Lys-51, a residue that may be essential for catalysis, since it binds the argininosuccinate substrate. They conclude (i) that the identification of the R95C mutation in strain 944 demonstrates that virtually all ASAL deficiency results from defects in the ASAL structural gene and (ii) that minor alternative splicing of the coding region occurs at the ASAL locus
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Gowrisankar, Sivakumar; Lerner-Ellis, Jordan P; Cox, Stephanie; White, Emily T; Manion, Megan; LeVan, Kevin; Liu, Jonathan; Farwell, Lisa M; Iartchouk, Oleg; Rehm, Heidi L; Funke, Birgit H
2010-11-01
Medical sequencing for diseases with locus and allelic heterogeneities has been limited by the high cost and low throughput of traditional sequencing technologies. "Second-generation" sequencing (SGS) technologies allow the parallel processing of a large number of genes and, therefore, offer great promise for medical sequencing; however, their use in clinical laboratories is still in its infancy. Our laboratory offers clinical resequencing for dilated cardiomyopathy (DCM) using an array-based platform that interrogates 19 of more than 30 genes known to cause DCM. We explored both the feasibility and cost effectiveness of using PCR amplification followed by SGS technology for sequencing these 19 genes in a set of five samples enriched for known sequence alterations (109 unique substitutions and 27 insertions and deletions). While the analytical sensitivity for substitutions was comparable to that of the DCM array (98%), SGS technology performed better than the DCM array for insertions and deletions (90.6% versus 58%). Overall, SGS performed substantially better than did the current array-based testing platform; however, the operational cost and projected turnaround time do not meet our current standards. Therefore, efficient capture methods and/or sample pooling strategies that shorten the turnaround time and decrease reagent and labor costs are needed before implementing this platform into routine clinical applications.
Huang, Kristen M; Geunes-Boyer, Scarlett; Wu, Sufen; Dutra, Amalia; Favor, Jack; Stambolian, Dwight
2004-05-01
Xcat mice display X-linked congenital cataracts and are a mouse model for the human X-linked cataract disease Nance Horan syndrome (NHS). The genetic defect in Xcat mice and NHS patients is not known. We isolated and sequenced a BAC contig representing a portion of the Xcat critical region. We combined our sequencing data with the most recent mouse sequence assemblies from both Celera and public databases. The sequence of the 2.2-Mb Xcat critical region was then analyzed for potential Xcat candidate genes. The coding regions of the seven known genes within this area (Rai2, Rbbp7, Ctps2, Calb3, Grpr, Reps2, and Syap1) were sequenced in Xcat mice and no mutations were detected. The expression of Rai2 was quantitatively identical in wild-type and Xcat mutant eyes. These results indicate that the Xcat mutation is within a novel, undiscovered gene.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Genetic control of some morphological mutants in sunflower [Helianthus annuus L.
International Nuclear Information System (INIS)
Nabipour, A.; Sarrafi, A.; Yazdi-Samadi, B.
2004-01-01
Inheritance study of induced mutants is an important tool in genetic and breeding programs. Sunflower is one of the most important oil crops for which mutant collection is meager. Seeds of sunflower line AS-613 were irradiated with gamma rays and mutant phenotypes were traced until M4 generation. In M5 generation, the following traits were studied: dwarfing, branching, leaf shape, albinism, rosette, lack of apex and alternative leaves. In most cases, the mutated characters were controlled by a single recessive gene, while in two cases they were controlled by two recessive genes. In M5 progenies, segregation for two albino, one alternative leaves, one dwarfism, 5 branching, one rosette, 2 lacks of apex and 5 leaf shape mutants was recorded. Amongst five cases of branching, one was controlled by two recessive genes, where at least one homozygote recessive locus was necessary for branching. In one case, the lack of apex was controlled by two recessive genes and even only one dominant allele could provoke the normal plant [it
Loss of circadian clock accelerates aging in neurodegeneration-prone mutants.
Krishnan, Natraj; Rakshit, Kuntol; Chow, Eileen S; Wentzell, Jill S; Kretzschmar, Doris; Giebultowicz, Jadwiga M
2012-03-01
Circadian clocks generate rhythms in molecular, cellular, physiological, and behavioral processes. Recent studies suggest that disruption of the clock mechanism accelerates organismal senescence and age-related pathologies in mammals. Impaired circadian rhythms are observed in many neurological diseases; however, it is not clear whether loss of rhythms is the cause or result of neurodegeneration, or both. To address this important question, we examined the effects of circadian disruption in Drosophila melanogaster mutants that display clock-unrelated neurodegenerative phenotypes. We combined a null mutation in the clock gene period (per(01)) that abolishes circadian rhythms, with a hypomorphic mutation in the carbonyl reductase gene sniffer (sni(1)), which displays oxidative stress induced neurodegeneration. We report that disruption of circadian rhythms in sni(1) mutants significantly reduces their lifespan compared to single mutants. Shortened lifespan in double mutants was coupled with accelerated neuronal degeneration evidenced by vacuolization in the adult brain. In addition, per(01)sni(1) flies showed drastically impaired vertical mobility and increased accumulation of carbonylated proteins compared to age-matched single mutant flies. Loss of per function does not affect sni mRNA expression, suggesting that these genes act via independent pathways producing additive effects. Finally, we show that per(01) mutation accelerates the onset of brain pathologies when combined with neurodegeneration-prone mutation in another gene, swiss cheese (sws(1)), which does not operate through the oxidative stress pathway. Taken together, our data suggest that the period gene may be causally involved in neuroprotective pathways in aging Drosophila. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jill B. Keeney
2009-12-01
Full Text Available We have developed a laboratory exercise, currently being used with college sophomores, which uses the yeast Saccharomyces cerevisiae to convey the concepts of amino acid biosynthesis, mutation, and gene complementation. In brief, selective medium is used to isolate yeast cells carrying a mutation in the lysine biosynthesis pathway. A spontaneous mutation in any one of three separate genetic loci will allow for growth on selective media; however, the frequency of mutations isolated from each locus differs. Following isolation of a mutated strain, students use complementation analysis to identify which gene contains the mutation. Since the yeast genome has been mapped and sequenced, students with access to the Internet can then research and develop hypotheses to explain the differences in frequencies of mutant genes obtained.
Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard
The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport
Qin, Ran; Zeng, Dongdong; Liang, Rong; Yang, Chengcong; Akhter, Delara; Alamin, Md; Jin, Xiaoli; Shi, Chunhai
2017-09-05
A new mutant named sdl (stripe and drooping leaf) was characterized from indica cultivar Zhenong 34 by ethylmethane sulfonate (EMS) mutagenesis. The mutant sdl exhibited development defects including stripe and drooping leaf, dwarfism and deformed floral organs. The gene SDL was found allelic to RNRS1 by map-based cloning, which was homologous to Arabidopsis TSO2 encoding the small subunit of ribonucleotide reductase. The gDNA sequencing results of sdl in mutant showed that there was a repetitive sequence insertion of 138-bp at the 475 th bp in the exon. The redundant sequence was conserved in SDL homologous proteins, which contained the active site (tyrosine), as well as two amino acids glutamate and histidine involved in the binding of iron. There were fewer chloroplasts and grana lamellas in sdl leaf compared with those of wild-type. Additionally, the stripe leaves of sdl seedlings were highly sensitive to temperature, since the chlorophyll content was increased with the temperature rising. The drooping leaf of sdl might be resulted from the disappearance of vascular bundles and mesophyll cells in both leaf midrib and lateral veins. Fittingly to the phenotypes of mutant sdl, the expression levels of genes associated with photosynthesis and chlorophyll synthesis were found to be down- or up-regulated at different temperatures in mutant sdl. Also, the transcriptional levels of genes related to plant height and floral organ formation showed obvious differences between wild-type and sdl. The "SDL/RNRS1" was, hence, required for the chlorophyll biosynthesis and also played pleiotropic roles in the regulation of plant development. Copyright © 2017. Published by Elsevier B.V.