Shift-Peristrophic Multiplexing for High Density Holographic Data Storage

Directory of Open Access Journals (Sweden)

Zenta Ushiyama

2014-03-01

Full Text Available Holographic data storage is a promising technology that provides very large data storage capacity, and the multiplexing method plays a significant role in increasing this capacity. Various multiplexing methods have been previously researched. In the present study, we propose a shift-peristrophic multiplexing technique that uses spherical reference waves, and experimentally verify that this method efficiently increases the data capacity. In the proposed method, a series of holograms is recorded with shift multiplexing, in which the recording material is rotated with its axis perpendicular to the material’s surface. By iterating this procedure, multiplicity is shown to improve. This method achieves more than 1 Tbits/inch2 data density recording. Furthermore, a capacity increase of several TB per disk is expected by maximizing the recording medium performance.

Comparison of pre-processing methods for multiplex bead-based immunoassays.

Science.gov (United States)

Rausch, Tanja K; Schillert, Arne; Ziegler, Andreas; Lüking, Angelika; Zucht, Hans-Dieter; Schulz-Knappe, Peter

2016-08-11

High throughput protein expression studies can be performed using bead-based protein immunoassays, such as the Luminex® xMAP® technology. Technical variability is inherent to these experiments and may lead to systematic bias and reduced power. To reduce technical variability, data pre-processing is performed. However, no recommendations exist for the pre-processing of Luminex® xMAP® data. We compared 37 different data pre-processing combinations of transformation and normalization methods in 42 samples on 384 analytes obtained from a multiplex immunoassay based on the Luminex® xMAP® technology. We evaluated the performance of each pre-processing approach with 6 different performance criteria. Three performance criteria were plots. All plots were evaluated by 15 independent and blinded readers. Four different combinations of transformation and normalization methods performed well as pre-processing procedure for this bead-based protein immunoassay. The following combinations of transformation and normalization were suitable for pre-processing Luminex® xMAP® data in this study: weighted Box-Cox followed by quantile or robust spline normalization (rsn), asinh transformation followed by loess normalization and Box-Cox followed by rsn.

Properly quantized history-dependent Parrondo games, Markov processes, and multiplexing circuits

Energy Technology Data Exchange (ETDEWEB)

Bleiler, Steven A. [Fariborz Maseeh Department of Mathematics and Statistics, Portland State University, PO Box 751, Portland, OR 97207 (United States); Khan, Faisal Shah, E-mail: faisal.khan@kustar.ac.a [Khalifa University of Science, Technology and Research, PO Box 127788, Abu Dhabi (United Arab Emirates)

2011-05-09

Highlights: History-dependent Parrondo games are viewed as Markov processes. Quantum mechanical analogues of these Markov processes are constructed. These quantum analogues restrict to the original process on measurement. Relationship between these analogues and a quantum circuits is exhibited. - Abstract: In the context of quantum information theory, 'quantization' of various mathematical and computational constructions is said to occur upon the replacement, at various points in the construction, of the classical randomization notion of probability distribution with higher order randomization notions from quantum mechanics such as quantum superposition with measurement. For this to be done 'properly', a faithful copy of the original construction is required to exist within the new quantum one, just as is required when a function is extended to a larger domain. Here procedures for extending history-dependent Parrondo games, Markov processes and multiplexing circuits to their quantum versions are analyzed from a game theoretic viewpoint, and from this viewpoint, proper quantizations developed.

Multiplexing a high-throughput liability assay to leverage efficiencies.

Science.gov (United States)

Herbst, John; Anthony, Monique; Stewart, Jeremy; Connors, David; Chen, Taosheng; Banks, Martyn; Petrillo, Edward W; Agler, Michele

2009-06-01

In order to identify potential cytochrome P-450 3A4 (drug-metabolizing enzyme) inducers at an early stage of the drug discovery process, a cell-based transactivation high-throughput luciferase reporter assay for the human pregnane X receptor (PXR) in HepG2 cells has been implemented and multiplexed with a viability end point for data interpretation, as part of a Lead Profiling portfolio of assays. As a routine part of Lead Profiling operations, assays are periodically evaluated for utility as well as for potential improvements in technology or process. We used a recent evaluation of our PXR-transactivation assay as a model for the application of Lean Thinking-based process analysis to lab-bench assay optimization and automation. This resulted in the development of a 384-well multiplexed homogeneous assay simultaneously detecting PXR transactivation and HepG2 cell cytotoxicity. In order to multiplex fluorescent and luminescent read-outs, modifications to each assay were necessary, which included optimization of multiple assay parameters such as cell density, plate type, and reagent concentrations. Subsequently, a set of compounds including known cytotoxic compounds and PXR inducers were used to validate the multiplexed assay. Results from the multiplexed assay correlate well with those from the singleplexed assay formats measuring PXR transactivation and viability separately. Implementation of the multiplexed assay for routine compound profiling provides improved data quality, sample conservation, cost savings, and resource efficiencies.

Multiplex flow cytometry barcoding and antibody arrays identify surface antigen profiles of primary and metastatic colon cancer cell lines.

Directory of Open Access Journals (Sweden)

Kumar Sukhdeo

Full Text Available Colon cancer is a deadly disease affecting millions of people worldwide. Current treatment challenges include management of disease burden as well as improvements in detection and targeting of tumor cells. To identify disease state-specific surface antigen signatures, we combined fluorescent cell barcoding with high-throughput flow cytometric profiling of primary and metastatic colon cancer lines (SW480, SW620, and HCT116. Our multiplexed technique offers improvements over conventional methods by permitting the simultaneous and rapid screening of cancer cells with reduced effort and cost. The method uses a protein-level analysis with commercially available antibodies on live cells with intact epitopes to detect potential tumor-specific targets that can be further investigated for their clinical utility. Multiplexed antibody arrays can easily be applied to other tumor types or pathologies for discovery-based approaches to target identification.

Fluorescence-Raman Dual Modal Endoscopic System for Multiplexed Molecular Diagnostics

Science.gov (United States)

Jeong, Sinyoung; Kim, Yong-Il; Kang, Homan; Kim, Gunsung; Cha, Myeong Geun; Chang, Hyejin; Jung, Kyung Oh; Kim, Young-Hwa; Jun, Bong-Hyun; Hwang, Do Won; Lee, Yun-Sang; Youn, Hyewon; Lee, Yoon-Sik; Kang, Keon Wook; Lee, Dong Soo; Jeong, Dae Hong

2015-03-01

Optical endoscopic imaging, which was recently equipped with bioluminescence, fluorescence, and Raman scattering, allows minimally invasive real-time detection of pathologies on the surface of hollow organs. To characterize pathologic lesions in a multiplexed way, we developed a dual modal fluorescence-Raman endomicroscopic system (FRES), which used fluorescence and surface-enhanced Raman scattering nanoprobes (F-SERS dots). Real-time, in vivo, and multiple target detection of a specific cancer was successful, based on the fast imaging capability of fluorescence signals and the multiplex capability of simultaneously detected SERS signals using an optical fiber bundle for intraoperative endoscopic system. Human epidermal growth factor receptor 2 (HER2) and epidermal growth factor receptor (EGFR) on the breast cancer xenografts in a mouse orthotopic model were successfully detected in a multiplexed way, illustrating the potential of FRES as a molecular diagnostic instrument that enables real-time tumor characterization of receptors during routine endoscopic procedures.

Optimizing diffusion in multiplexes by maximizing layer dissimilarity

Science.gov (United States)

Serrano, Alfredo B.; Gómez-Gardeñes, Jesús; Andrade, Roberto F. S.

2017-05-01

Diffusion in a multiplex depends on the specific link distribution between the nodes in each layer, but also on the set of the intralayer and interlayer diffusion coefficients. In this work we investigate, in a quantitative way, the efficiency of multiplex diffusion as a function of the topological similarity among multiplex layers. This similarity is measured by the distance between layers, taken among the pairs of layers. Results are presented for a simple two-layer multiplex, where one of the layers is held fixed, while the other one can be rewired in a controlled way in order to increase or decrease the interlayer distance. The results indicate that, for fixed values of all intra- and interlayer diffusion coefficients, a large interlayer distance generally enhances the global multiplex diffusion, providing a topological mechanism to control the global diffusive process. For some sets of networks, we develop an algorithm to identify the most sensitive nodes in the rewirable layer, so that changes in a small set of connections produce a drastic enhancement of the global diffusion of the whole multiplex system.

Upconversion Nanoparticles-Encoded Hydrogel Microbeads-Based Multiplexed Protein Detection

Science.gov (United States)

Shikha, Swati; Zheng, Xiang; Zhang, Yong

2018-06-01

Fluorescently encoded microbeads are in demand for multiplexed applications in different fields. Compared to organic dye-based commercially available Luminex's xMAP technology, upconversion nanoparticles (UCNPs) are better alternatives due to their large anti-Stokes shift, photostability, nil background, and single wavelength excitation. Here, we developed a new multiplexed detection system using UCNPs for encoding poly(ethylene glycol) diacrylate (PEGDA) microbeads as well as for labeling reporter antibody. However, to prepare UCNPs-encoded microbeads, currently used swelling-based encapsulation leads to non-uniformity, which is undesirable for fluorescence-based multiplexing. Hence, we utilized droplet microfluidics to obtain encoded microbeads of uniform size, shape, and UCNPs distribution inside. Additionally, PEGDA microbeads lack functionality for probe antibodies conjugation on their surface. Methods to functionalize the surface of PEGDA microbeads (acrylic acid incorporation, polydopamine coating) reported thus far quench the fluorescence of UCNPs. Here, PEGDA microbeads surface was coated with silica followed by carboxyl modification without compromising the fluorescence intensity of UCNPs. In this study, droplet microfluidics-assisted UCNPs-encoded microbeads of uniform shape, size, and fluorescence were prepared. Multiple color codes were generated by mixing UCNPs emitting red and green colors at different ratios prior to encapsulation. UCNPs emitting blue color were used to label the reporter antibody. Probe antibodies were covalently immobilized on red UCNPs-encoded microbeads for specific capture of human serum albumin (HSA) as a model protein. The system was also demonstrated for multiplexed detection of both human C-reactive protein (hCRP) and HSA protein by immobilizing anti-hCRP antibodies on green UCNPs.

User Multiplexing in Relay Enhanced LTE-Advanced Networks

DEFF Research Database (Denmark)

Teyeb, Oumer Mohammed; Frederiksen, Frank; Redana, Simone

2010-01-01

is radio relaying. This uses relay nodes that act as surrogate base stations for mobile users whose radio links with the base stations are not experiencing good enough conditions. In the downlink, the data that is destined for the relayed users may first have to be multiplexed by the base station, sent...... over the wireless backhaul link towards the relay node, and de-multiplexed and forwarded to the individual users by the relay node. The reverse process also has to be undertaken in the uplink. In this paper, we present a novel multiplexing scheme which is able to adapt the addressing and bitmapping...... of user identification to the actual number of users being served by the relay nodes, and thus greatly reduce the multiplexing overhead....

Functional Multiplex PageRank

Science.gov (United States)

Iacovacci, Jacopo; Rahmede, Christoph; Arenas, Alex; Bianconi, Ginestra

2016-10-01

Recently it has been recognized that many complex social, technological and biological networks have a multilayer nature and can be described by multiplex networks. Multiplex networks are formed by a set of nodes connected by links having different connotations forming the different layers of the multiplex. Characterizing the centrality of the nodes in a multiplex network is a challenging task since the centrality of the node naturally depends on the importance associated to links of a certain type. Here we propose to assign to each node of a multiplex network a centrality called Functional Multiplex PageRank that is a function of the weights given to every different pattern of connections (multilinks) existent in the multiplex network between any two nodes. Since multilinks distinguish all the possible ways in which the links in different layers can overlap, the Functional Multiplex PageRank can describe important non-linear effects when large relevance or small relevance is assigned to multilinks with overlap. Here we apply the Functional Page Rank to the multiplex airport networks, to the neuronal network of the nematode C. elegans, and to social collaboration and citation networks between scientists. This analysis reveals important differences existing between the most central nodes of these networks, and the correlations between their so-called pattern to success.

Multiplex PageRank.

Directory of Open Access Journals (Sweden)

Arda Halu

Full Text Available Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.

Multiplex PageRank.

Science.gov (United States)

Halu, Arda; Mondragón, Raúl J; Panzarasa, Pietro; Bianconi, Ginestra

2013-01-01

Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.

Competing spreading processes on multiplex networks: awareness and epidemics.

Science.gov (United States)

Granell, Clara; Gómez, Sergio; Arenas, Alex

2014-07-01

Epidemiclike spreading processes on top of multilayered interconnected complex networks reveal a rich phase diagram of intertwined competition effects. A recent study by the authors [C. Granell et al., Phys. Rev. Lett. 111, 128701 (2013).] presented an analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the spreading of information awareness to prevent infection, on top of multiplex networks. The results in the case in which awareness implies total immunization to the disease revealed the existence of a metacritical point at which the critical onset of the epidemics starts, depending on completion of the awareness process. Here we present a full analysis of these critical properties in the more general scenario where the awareness spreading does not imply total immunization, and where infection does not imply immediate awareness of it. We find the critical relation between the two competing processes for a wide spectrum of parameters representing the interaction between them. We also analyze the consequences of a massive broadcast of awareness (mass media) on the final outcome of the epidemic incidence. Importantly enough, the mass media make the metacritical point disappear. The results reveal that the main finding, i.e., existence of a metacritical point, is rooted in the competition principle and holds for a large set of scenarios.

Moving through a multiplex holographic scene

Science.gov (United States)

Mrongovius, Martina

2013-02-01

This paper explores how movement can be used as a compositional element in installations of multiplex holograms. My holographic images are created from montages of hand-held video and photo-sequences. These spatially dynamic compositions are visually complex but anchored to landmarks and hints of the capturing process - such as the appearance of the photographer's shadow - to establish a sense of connection to the holographic scene. Moving around in front of the hologram, the viewer animates the holographic scene. A perception of motion then results from the viewer's bodily awareness of physical motion and the visual reading of dynamics within the scene or movement of perspective through a virtual suggestion of space. By linking and transforming the physical motion of the viewer with the visual animation, the viewer's bodily awareness - including proprioception, balance and orientation - play into the holographic composition. How multiplex holography can be a tool for exploring coupled, cross-referenced and transformed perceptions of movement is demonstrated with a number of holographic image installations. Through this process I expanded my creative composition practice to consider how dynamic and spatial scenes can be conveyed through the fragmented view of a multiplex hologram. This body of work was developed through an installation art practice and was the basis of my recently completed doctoral thesis: 'The Emergent Holographic Scene — compositions of movement and affect using multiplex holographic images'.

All Inkjet-Printed Amperometric Multiplexed Biosensors Based on Nanostructured Conductive Hydrogel Electrodes.

Science.gov (United States)

Li, Lanlan; Pan, Lijia; Ma, Zhong; Yan, Ke; Cheng, Wen; Shi, Yi; Yu, Guihua

2018-02-12

Multiplexing, one of the main trends in biosensors, aims to detect several analytes simultaneously by integrating miniature sensors on a chip. However, precisely depositing electrode materials and selective enzymes on distinct microelectrode arrays remains an obstacle to massively produced multiplexed sensors. Here, we report on a "drop-on-demand" inkjet printing process to fabricate multiplexed biosensors based on nanostructured conductive hydrogels in which the electrode material and several kinds of enzymes were printed on the electrode arrays one by one by employing a multinozzle inkjet system. The whole inkjet printing process can be finished within three rounds of printing and only one round of alignment. For a page of sensor arrays containing 96 working electrodes, the printing process took merely ∼5 min. The multiplexed assays can detect glucose, lactate, and triglycerides in real time with good selectivity and high sensitivity, and the results in phosphate buffer solutions and calibration serum samples are comparable. The inkjet printing process exhibited advantages of high efficiency and accuracy, which opens substantial possibilities for massive fabrication of integrated multiplexed biosensors for human health monitoring.

Analogue multiplexer

International Nuclear Information System (INIS)

Gorshkov, V.A.; Kuznetsov, A.N.

1980-01-01

In systems of signal recording from several parallel spectrometric channels one can considerably reduce the total apparatus volume using a special unit - an analog multiplexer. A description of the multiplexer in the CAMAC system on the base of fast linear gating circuits which allows one analog-to-code converter to attend four spectrometric channels is given. On the example of the 4-channel spectrometer the logics of interaction of the multiple with analog-to-digital coxernver and signal recorder is shown. Electrical and functional multiplexer flow-sheets are given and its main characteristics are presented

Development of an analogue multiplexed regulation for periodic 1. order delayed processes

International Nuclear Information System (INIS)

Amblard, J.C.

1967-07-01

The present note deals with the study regulations of the sampled type, for 1. order process with simple delay. In order to obtain a good stability in such regulations, together with acceptable performances, it is interesting to use polynomial type correctors acting directly on the sampled error signals. The active elements of these correctors can be shared by all the channels to be controlled. Furthermore, the determination of the correction parameters results from an optimal study of the system. In the second part is described the construction of a multiplexed regulation for diffusion ovens. (author) [fr

Dynamical interplay between awareness and epidemic spreading in multiplex networks

OpenAIRE

Granell, Clara; Gomez, Sergio; Arenas, Alex

2013-01-01

We present the analysis of the interrelation between two processes accounting for the spreading of an epidemics, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusiv...

A multiplex microplatform for the detection of multiple DNA methylation events using gold-DNA affinity.

Science.gov (United States)

Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt

2017-10-07

We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.

Generating multiplex gradients of biomolecules for controlling cellular adhesion in parallel microfluidic channels.

Science.gov (United States)

Didar, Tohid Fatanat; Tabrizian, Maryam

2012-11-07

Here we present a microfluidic platform to generate multiplex gradients of biomolecules within parallel microfluidic channels, in which a range of multiplex concentration gradients with different profile shapes are simultaneously produced. Nonlinear polynomial gradients were also generated using this device. The gradient generation principle is based on implementing parrallel channels with each providing a different hydrodynamic resistance. The generated biomolecule gradients were then covalently functionalized onto the microchannel surfaces. Surface gradients along the channel width were a result of covalent attachments of biomolecules to the surface, which remained functional under high shear stresses (50 dyn/cm(2)). An IgG antibody conjugated to three different fluorescence dyes (FITC, Cy5 and Cy3) was used to demonstrate the resulting multiplex concentration gradients of biomolecules. The device enabled generation of gradients with up to three different biomolecules in each channel with varying concentration profiles. We were also able to produce 2-dimensional gradients in which biomolecules were distributed along the length and width of the channel. To demonstrate the applicability of the developed design, three different multiplex concentration gradients of REDV and KRSR peptides were patterned along the width of three parallel channels and adhesion of primary human umbilical vein endothelial cell (HUVEC) in each channel was subsequently investigated using a single chip.

Dynamical Interplay between Awareness and Epidemic Spreading in Multiplex Networks

Science.gov (United States)

Granell, Clara; Gómez, Sergio; Arenas, Alex

2013-09-01

We present the analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusive processes are interacting affecting each other. The analysis using a microscopic Markov chain approach reveals the phase diagram of the incidence of the epidemics and allows us to capture the evolution of the epidemic threshold depending on the topological structure of the multiplex and the interrelation with the awareness process. Interestingly, the critical point for the onset of the epidemics has a critical value (metacritical point) defined by the awareness dynamics and the topology of the virtual network, from which the onset increases and the epidemics incidence decreases.

Dynamical interplay between awareness and epidemic spreading in multiplex networks.

Science.gov (United States)

Granell, Clara; Gómez, Sergio; Arenas, Alex

2013-09-20

We present the analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusive processes are interacting affecting each other. The analysis using a microscopic Markov chain approach reveals the phase diagram of the incidence of the epidemics and allows us to capture the evolution of the epidemic threshold depending on the topological structure of the multiplex and the interrelation with the awareness process. Interestingly, the critical point for the onset of the epidemics has a critical value (metacritical point) defined by the awareness dynamics and the topology of the virtual network, from which the onset increases and the epidemics incidence decreases.

Multiplex gas chromatography

Science.gov (United States)

Valentin, Jose R.

1990-01-01

The principles of the multiplex gas chromatography (GC) technique, which is a possible candidate for chemical analysis of planetary atmospheres, are discussed. Particular attention is given to the chemical modulators developed by present investigators for multiplex GC, namely, the thermal-desorption, thermal-decomposition, and catalytic modulators, as well as to mechanical modulators. The basic technique of multiplex GC using chemical modulators and a mechanical modulator is demonstrated. It is shown that, with the chemical modulators, only one gas stream consisting of the carrier in combination with the components is being analyzed, resulting in a simplified instrument that requires relatively few consumables. The mechanical modulator demonstrated a direct application of multiplex GC for the analysis of gases in atmosphere of Titan at very low pressures.

Direction-division multiplexed holographic free-electron-driven light sources

Science.gov (United States)

Clarke, Brendan P.; MacDonald, Kevin F.; Zheludev, Nikolay I.

2018-01-01

We report on a free-electron-driven light source with a controllable direction of emission. The source comprises a microscopic array of plasmonic surface-relief holographic domains, each tailored to direct electron-induced light emission at a selected wavelength into a collimated beam in a prescribed direction. The direction-division multiplexed source is tested by driving it with the 30 kV electron beam of a scanning electron microscope: light emission, at a wavelength of 800 nm in the present case, is switched among different output angles by micron-scale repositioning of the electron injection point among domains. Such sources, with directional switching/tuning possible at picosecond timescales, may be applied to field-emission and surface-conduction electron-emission display technologies, optical multiplexing, and charged-particle-beam position metrology.

A simple electron multiplexer

International Nuclear Information System (INIS)

Dobrzynski, L; Akjouj, A; Djafari-Rouhani, B; Al-Wahsh, H; Zielinski, P

2003-01-01

We present a simple multiplexing device made of two atomic chains coupled by two other transition metal atoms. We show that this simple atomic device can transfer electrons at a given energy from one wire to the other, leaving all other electron states unaffected. Closed-form relations between the transmission coefficients and the inter-atomic distances are given to optimize the desired directional electron ejection. Such devices can be adsorbed on insulating substrates and characterized by current surface technologies. (letter to the editor)

Consideration for wavelength multiplexing versus time multiplexing in optical transport network

DEFF Research Database (Denmark)

Limal, Emmanuel; Stubkjær, Kristian Elmholdt

1999-01-01

We compare optical wavelength multiplexing and time multiplexing techniquesfor optical transport network by studying the space switch sizes of OXCs andtheir interfaces as a function of the fraction of add/drop traffic....

Extracting information from multiplex networks

Science.gov (United States)

Iacovacci, Jacopo; Bianconi, Ginestra

2016-06-01

Multiplex networks are generalized network structures that are able to describe networks in which the same set of nodes are connected by links that have different connotations. Multiplex networks are ubiquitous since they describe social, financial, engineering, and biological networks as well. Extending our ability to analyze complex networks to multiplex network structures increases greatly the level of information that is possible to extract from big data. For these reasons, characterizing the centrality of nodes in multiplex networks and finding new ways to solve challenging inference problems defined on multiplex networks are fundamental questions of network science. In this paper, we discuss the relevance of the Multiplex PageRank algorithm for measuring the centrality of nodes in multilayer networks and we characterize the utility of the recently introduced indicator function Θ ˜ S for describing their mesoscale organization and community structure. As working examples for studying these measures, we consider three multiplex network datasets coming for social science.

Multiplexed Colorimetric Solid-Phase Extraction

Science.gov (United States)

Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.

2009-01-01

Multiplexed colorimetric solid-phase extraction (MC-SPE) is an extension of colorimetric solid-phase extraction (C-SPE) an analytical platform that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water. In CSPE, analytes are extracted and complexed on the surface of an extraction membrane impregnated with a colorimetric reagent. The analytes are then quantified directly on the membrane surface using a handheld diffuse reflectance spectrophotometer. Importantly, the use of solid-phase extraction membranes as the matrix for impregnation of the colorimetric reagents creates a concentration factor that enables the detection of low concentrations of analytes in small sample volumes. In extending C-SPE to a multiplexed format, a filter holder that incorporates discrete analysis channels and a jig that facilitates the concurrent operation of multiple sample syringes have been designed, enabling the simultaneous determination of multiple analytes. Separate, single analyte membranes, placed in a readout cartridge create unique, analyte-specific addresses at the exit of each channel. Following sample exposure, the diffuse reflectance spectrum of each address is collected serially and the Kubelka-Munk function is used to quantify each water quality parameter via calibration curves. In a demonstration, MC-SPE was used to measure the pH of a sample and quantitate Ag(I) and Ni(II).

Parallel excitation-emission multiplexed fluorescence lifetime confocal microscopy for live cell imaging.

Science.gov (United States)

Zhao, Ming; Li, Yu; Peng, Leilei

2014-05-05

We present a novel excitation-emission multiplexed fluorescence lifetime microscopy (FLIM) method that surpasses current FLIM techniques in multiplexing capability. The method employs Fourier multiplexing to simultaneously acquire confocal fluorescence lifetime images of multiple excitation wavelength and emission color combinations at 44,000 pixels/sec. The system is built with low-cost CW laser sources and standard PMTs with versatile spectral configuration, which can be implemented as an add-on to commercial confocal microscopes. The Fourier lifetime confocal method allows fast multiplexed FLIM imaging, which makes it possible to monitor multiple biological processes in live cells. The low cost and compatibility with commercial systems could also make multiplexed FLIM more accessible to biological research community.

Microfluidic impact printer with interchangeable cartridges for versatile non-contact multiplexed micropatterning.

Science.gov (United States)

Ding, Yuzhe; Huang, Eric; Lam, Kit S; Pan, Tingrui

2013-05-21

Biopatterning has been increasingly used for well-defined cellular microenvironment, patterned surface topology, and guided biological cues; however, it meets challenges on biocompatibility, thermal and chemical sensitivity, as well as limited availability of reagents. In this paper, we aim at combining the desired features from non-contact inkjet printing and dot-matrix impact printing to establish a versatile multiplexed micropatterning platform, referred to as Microfluidic Impact Printer (MI-Printer), for emerging biomedical applications. Using this platform, we can achieve the distinct features of no cross-contamination, sub-microliter ink loading with a minimal dead volume, high-throughput printing, biocompatible non-contact processing, sequential patterning with self-alignment, wide adaptability for complex media (e.g., cell suspension or colloidal solutions), interchangeable/disposable cartridge design, and simple assembly and configuration, all highly desirable towards laboratory-based research and development. Specifically, the printing resolution of the MI-printer platform has been experimentally characterized and theoretically analysed. Optimal printing resolution of 80 μm has been repeatedly obtained. Furthermore, two useful functions of the MI-printer, multiplexed printing and combinatorial printing, have been experimentally demonstrated with less than 10 μm misalignment. Moreover, molecular and biological patterning, utilizing the multiplexed and combinatorial printing, has been implemented to illustrate the utility of this versatile printing technique for emerging biomedical applications.

Multiplexed FBG and etched fiber sensors for process and health monitoring of 2-&3-D RTM components

OpenAIRE

Keulen, Casey J.; Yıldız, Mehmet; Yildiz, Mehmet; Suleman, Afzal

2011-01-01

This paper presents research being conducted on the use of a combination of fiber optic sensors for process and health monitoring of resin transfer molded (RTM) composite structures. A laboratory scale RTM apparatus has been designed and built with the capability of visually monitoring the resin filling process and embedding fiber optic sensors into the composite. Fiber Bragg gratings (FBG) and etched fiber sensors (EFS) have been multiplexed and embedded in quasi-2-D panels and 3-D hollow se...

A novel multiplex bead-based platform highlights the diversity of extracellular vesicles.

Science.gov (United States)

Koliha, Nina; Wiencek, Yvonne; Heider, Ute; Jüngst, Christian; Kladt, Nikolay; Krauthäuser, Susanne; Johnston, Ian C D; Bosio, Andreas; Schauss, Astrid; Wild, Stefan

2016-01-01

The surface protein composition of extracellular vesicles (EVs) is related to the originating cell and may play a role in vesicle function. Knowledge of the protein content of individual EVs is still limited because of the technical challenges to analyse small vesicles. Here, we introduce a novel multiplex bead-based platform to investigate up to 39 different surface markers in one sample. The combination of capture antibody beads with fluorescently labelled detection antibodies allows the analysis of EVs that carry surface markers recognized by both antibodies. This new method enables an easy screening of surface markers on populations of EVs. By combining different capture and detection antibodies, additional information on relative expression levels and potential vesicle subpopulations is gained. We also established a protocol to visualize individual EVs by stimulated emission depletion (STED) microscopy. Thereby, markers on single EVs can be detected by fluorophore-conjugated antibodies. We used the multiplex platform and STED microscopy to show for the first time that NK cell-derived EVs and platelet-derived EVs are devoid of CD9 or CD81, respectively, and that EVs isolated from activated B cells comprise different EV subpopulations. We speculate that, according to our STED data, tetraspanins might not be homogenously distributed but may mostly appear as clusters on EV subpopulations. Finally, we demonstrate that EV mixtures can be separated by magnetic beads and analysed subsequently with the multiplex platform. Both the multiplex bead-based platform and STED microscopy revealed subpopulations of EVs that have been indistinguishable by most analysis tools used so far. We expect that an in-depth view on EV heterogeneity will contribute to our understanding of different EVs and functions.

Fully Integrated, Multiport, Planar-Waveguide, Spectral Comparators and Multiplexers Based on Lithographic Holography

National Research Council Canada - National Science Library

Mossberg, Thomas; Greiner, Christoph

2005-01-01

.... for the first time the successful application of HBRs to wavelength division multiplexing. Measured device performance indicates that the photolithographic fabrication process has reduced multiplexer designs to practice essentially perfectly...

Increased Sensory Processing Atypicalities in Parents of Multiplex ASD Families Versus Typically Developing and Simplex ASD Families

OpenAIRE

Donaldson, Chelsea K.; Stauder, Johannes E. A.; Donkers, Franc C. L.

2016-01-01

Recent studies have suggested that sensory processing atypicalities may share genetic influences with autism spectrum disorder (ASD). To further investigate this, the adolescent/adult sensory profile (AASP) questionnaire was distributed to 85 parents of typically developing children (P-TD), 121 parents from simplex ASD families (SPX), and 54 parents from multiplex ASD families (MPX). After controlling for gender and presence of mental disorders, results showed that MPX parents significantly d...

Multiplexed Engineering in Biology.

Science.gov (United States)

Rogers, Jameson K; Church, George M

2016-03-01

Biotechnology is the manufacturing technology of the future. However, engineering biology is complex, and many possible genetic designs must be evaluated to find cells that produce high levels of a desired drug or chemical. Recent advances have enabled the design and construction of billions of genetic variants per day, but evaluation capacity remains limited to thousands of variants per day. Here we evaluate biological engineering through the lens of the design–build–test cycle framework and highlight the role that multiplexing has had in transforming the design and build steps. We describe a multiplexed solution to the ‘test’ step that is enabled by new research. Achieving a multiplexed test step will permit a fully multiplexed engineering cycle and boost the throughput of biobased product development by up to a millionfold.

Silicon Chip-to-Chip Mode-Division Multiplexing

DEFF Research Database (Denmark)

Baumann, Jan Markus; Porto da Silva, Edson; Ding, Yunhong

2018-01-01

A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes.......A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes....

Multiplex measuring systems in physics

International Nuclear Information System (INIS)

Soroko, L.M.

1980-01-01

The principles of operation of multiplex devices used in different spheres of physics are discussed. The ''multiplex'' notion means that the data output of the device is an integral image of the functional dependence under investigation, but not its readings as in usual instruments. The analysis of the present state of developments of the multiplex systems in optics, nuclear magnetic resonance spectroscopy, in time-of-flight spectrometers for slow and fast neutrons, as well as elementary particle detectors, is given. The construction algorithms for the digital codes are presented, the history of development of the multiplex measuring principle is given [ru

Integrated photonics : compact multiplexing

NARCIS (Netherlands)

Pile, D.; Chen, H.; Uden, van R.G.H.; Okonkwo, C.M.; Koonen, A.M.J.

2015-01-01

Spatial multiplexers (SMUXs) for mode division multiplexing often involve multiple strategies for mode-selective excitation and the minimization of insertion and other losses. Haoshuo Chen, Roy van Uden, Chigo Okonkwo and Ton Koonen, working at the COBRA Institute at the Eindhoven University of

Dynamic Optically Multiplexed Imaging

Science.gov (United States)

2015-07-29

Dynamic Optically Multiplexed Imaging Yaron Rachlin, Vinay Shah, R. Hamilton Shepard, and Tina Shih Lincoln Laboratory, Massachusetts Institute of...V. Shah, and T. Shih “Design Architectures for Optically Multiplexed Imaging,” in submission 9 R. Gupta , P. Indyk, E. Price, and Y. Rachlin

Polarization-multiplexing ghost imaging

Science.gov (United States)

Dongfeng, Shi; Jiamin, Zhang; Jian, Huang; Yingjian, Wang; Kee, Yuan; Kaifa, Cao; Chenbo, Xie; Dong, Liu; Wenyue, Zhu

2018-03-01

A novel technique for polarization-multiplexing ghost imaging is proposed to simultaneously obtain multiple polarimetric information by a single detector. Here, polarization-division multiplexing speckles are employed for object illumination. The light reflected from the objects is detected by a single-pixel detector. An iterative reconstruction method is used to restore the fused image containing the different polarimetric information by using the weighted sum of the multiplexed speckles based on the correlation coefficients obtained from the detected intensities. Next, clear images of the different polarimetric information are recovered by demultiplexing the fused image. The results clearly demonstrate that the proposed method is effective.

Fluorescence-Based Multiplex Protein Detection Using Optically Encoded Microbeads

Directory of Open Access Journals (Sweden)

Dae Hong Jeong

2012-03-01

Full Text Available Potential utilization of proteins for early detection and diagnosis of various diseases has drawn considerable interest in the development of protein-based multiplex detection techniques. Among the various techniques for high-throughput protein screening, optically-encoded beads combined with fluorescence-based target monitoring have great advantages over the planar array-based multiplexing assays. This review discusses recent developments of analytical methods of screening protein molecules on microbead-based platforms. These include various strategies such as barcoded microbeads, molecular beacon-based techniques, and surface-enhanced Raman scattering-based techniques. Their applications for label-free protein detection are also addressed. Especially, the optically-encoded beads such as multilayer fluorescence beads and SERS-encoded beads are successful for generating a large number of coding.

Color multiplexing using directional holographic gratings and linear polarization

International Nuclear Information System (INIS)

Lugo, L I; Rodriguez, A; Ramirez, G; Guel, S; Nunez, O F

2011-01-01

We propose a system of multiplexing and de-multiplexing, which uses a holographic diffraction grating to compel modulated light of different colors to be sent through an optical fiber. Diffraction gratings were fabricated specifically to pick the desired direction in which we wanted the light of different wavelengths to impinge the optic fiber, and also to be separated at the output. It was been found that the system preserves the polarization of light, which give us a one more freedom degree, allowing us to process twice the original information amount.

Steatocystoma multiplex hos 39-årig kvinde

DEFF Research Database (Denmark)

Duffy, Jonas Raymond; Siersen, Hans Erik; Bonde, Christian T

2011-01-01

-coloured cystic lesions on the chest, abdomen, axillae and back. The patient's clinical presentations and history were compatible with steatocystoma multiplex. Various treatment options for steatocystoma multiplex and steatocystoma multiplex suppurativum have been published and include oral antibiotics...

Explaining HIV Risk Multiplexity: A Social Network Analysis.

Science.gov (United States)

Felsher, Marisa; Koku, Emmanuel

2018-04-21

Risk multiplexity (i.e., overlap in drug-use, needle exchange and sexual relations) is a known risk factor for HIV. However, little is known about predictors of multiplexity. This study uses egocentric data from the Colorado Springs study to examine how individual, behavioral and social network factors influence engagement in multiplex risk behavior. Analyses revealed that compared to Whites, Hispanics were significantly more likely to engage in risk multiplexity and Blacks less so. Respondents who were similar to each other (e.g., in terms of race) had significantly higher odds of being in risk multiplex relationships, and respondents' risk perceptions and network size were significantly associated with engaging in multiplex risk behaviors. Findings from interaction analysis showed the effect of knowing someone with HIV on the odds of multiplexity depends partly on whether respondents' know their HIV status. Findings suggest that demographics, HIV behaviors and network factors impact engagement in multiplex risk behaviors, highlighting the need for multi-level interventions aimed at reducing HIV risk behavior.

Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

Directory of Open Access Journals (Sweden)

Anupam Berwal

2017-01-01

Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

Percolation in real multiplex networks

Science.gov (United States)

Bianconi, Ginestra; Radicchi, Filippo

2016-12-01

We present an exact mathematical framework able to describe site-percolation transitions in real multiplex networks. Specifically, we consider the average percolation diagram valid over an infinite number of random configurations where nodes are present in the system with given probability. The approach relies on the locally treelike ansatz, so that it is expected to accurately reproduce the true percolation diagram of sparse multiplex networks with negligible number of short loops. The performance of our theory is tested in social, biological, and transportation multiplex graphs. When compared against previously introduced methods, we observe improvements in the prediction of the percolation diagrams in all networks analyzed. Results from our method confirm previous claims about the robustness of real multiplex networks, in the sense that the average connectedness of the system does not exhibit any significant abrupt change as its individual components are randomly destroyed.

Design and Performance of the Multiplexed SQUID/TES Array at Ninety Gigahertz

Science.gov (United States)

Stanchfield, Sara; Ade, Peter; Aguirre, James; Brevik, Justus A.; Cho, Hsiao-Mei; Datta, Rahul; Devlin, Mark; Dicker, Simon R.; Dober, Bradley; Duff, Shannon M.; Egan, Dennis; Ford, Pam; Hilton, Gene; Hubmayr, Johannes; Irwin, Kent; Knowles, Kenda; Marganian, Paul; Mason, Brian Scott; Mates, John A. B.; McMahon, Jeff; Mello, Melinda; Mroczkowski, Tony; Romero, Charles; Sievers, Jonathon; Tucker, Carole; Vale, Leila R.; Vissers, Michael; White, Steven; Whitehead, Mark; Ullom, Joel; Young, Alexander

2018-01-01

We present the array performance and astronomical images from early science results from MUSTANG-2, a 90 GHz feedhorn-coupled, microwave SQUID-multiplexed TES bolometer array operating on the Robert C. Byrd Green Bank Telescope (GBT). MUSTANG-2 was installed on the GBT on December 2, 2016 and immediately began commissioning efforts, followed by science observations, which are expected to conclude June 2017. The feedhorn and waveguide-probe-coupled detector technology is a mature technology, which has been used on instrument including the South Pole Telescope, the Atacama Cosmology Telescope, and the Atacama B-mode Search telescope. The microwave SQUID readout system developed for MUSTANG-2 currently reads out 66 detectors with a single coaxial cable and will eventually allow thousands of detectors to be multiplexed. This microwave SQUID multiplexer combines the proven abilities of millimeterwave TES detectors with the multiplexing capabilities of KIDs with no degradation in noise performance of the detectors. Each multiplexing device is read out using warm electronics consisting of a commercially available ROACH board, a DAC/ADC card, and an Intermediate Frequency mixer circuit. The hardware was originally developed by the UC Berkeley Collaboration for Astronomy Signal Processing and Electronic Research (CASPER) group, whose primary goal is to develop scalable FPGA-based hardware with the flexibility to be used in a wide range of radio signal processing applications. MUSTANG-2 is the first on-sky instrument to use microwave SQUID multiplexing and is available as a shared-risk/PI instrument on the GBT. In MUSTANG-2's first season 7 separate proposals were awarded a total of 230 hours of telescope time.

Data multiplexing in radio interferometric calibration

Science.gov (United States)

Yatawatta, Sarod; Diblen, Faruk; Spreeuw, Hanno; Koopmans, L. V. E.

2018-03-01

New and upcoming radio interferometers will produce unprecedented amount of data that demand extremely powerful computers for processing. This is a limiting factor due to the large computational power and energy costs involved. Such limitations restrict several key data processing steps in radio interferometry. One such step is calibration where systematic errors in the data are determined and corrected. Accurate calibration is an essential component in reaching many scientific goals in radio astronomy and the use of consensus optimization that exploits the continuity of systematic errors across frequency significantly improves calibration accuracy. In order to reach full consensus, data at all frequencies need to be calibrated simultaneously. In the SKA regime, this can become intractable if the available compute agents do not have the resources to process data from all frequency channels simultaneously. In this paper, we propose a multiplexing scheme that is based on the alternating direction method of multipliers with cyclic updates. With this scheme, it is possible to simultaneously calibrate the full data set using far fewer compute agents than the number of frequencies at which data are available. We give simulation results to show the feasibility of the proposed multiplexing scheme in simultaneously calibrating a full data set when a limited number of compute agents are available.

Adaptive Channel Estimation based on Soft Information Processing in Broadband Spatial Multiplexing Receivers

Directory of Open Access Journals (Sweden)

P. Beinschob

2010-11-01

Full Text Available In this paper we present a novel approach in Multiple-Input Multiple Output (MIMO Orthogonal Frequency Division Multiplexing (OFDM channel estimation technique based on a Decision Directed Recursive Least Squares (RLS algorithm in which no pilot symbols need to be integrated in the data after a short initial preamble. The novelty and key concept of the proposed technique is the block-wise causal and anti-causal RLS processing that yields two independent processings of RLS along with the associated decisions. Due to the usage of low density parity check (LDPC channel code, the receiver operates with soft information, which enables us to introduce a new modification of the Turbo principle as well as a simple information combining approach based on approximated aposteriori log-likelihood ratios (LLRs. Although the computational complexity is increased by both of our approaches, the latter is relatively less complex than the former. Simulation results show that these implementations outperform the simple RLS-DDCE algorithm and yield lower bit error rates (BER and more accurate channel estimates.

Spatial analysis of various multiplex cinema types

Directory of Open Access Journals (Sweden)

Young-Seo Park

2016-03-01

Full Text Available This study identifies the spatial characteristics and relationships of each used space according to the multiplex type. In this study, multiplexes are classified according to screen rooms and circulation systems, and each used space is quantitatively analyzed. The multiplex type based on screen rooms and moving line systems influences the relationship and characteristics of each used space in various ways. In particular, the structure of the used space of multiplexes has a significant effect on profit generation and audience convenience.

A novel IPTV program multiplex access system to EPON

Science.gov (United States)

Xu, Xian; Liu, Deming; He, Wei; Lu, Xi

2007-11-01

With the rapid development of high speed networks, such as Ethernet Passive Optical Network (EPON), traffic patterns in access networks have evolved from traditional text-oriented service to the mixed text-, voice- and video- based services, leading to so called "Triple Play". For supporting IPTV service in EPON access network infrastructure, in this article we propose a novel IPTV program multiplex access system to EPON, which enables multiple IPTV program source servers to seamlessly access to IPTV service access port of optical line terminal (OLT) in EPON. There are two multiplex schemes, namely static multiplex scheme and dynamic multiplex scheme, in implementing the program multiplexing. Static multiplex scheme is to multiplex all the IPTV programs and forward them to the OLT, regardless of the need of end-users. While dynamic multiplex scheme can dynamically multiplex and forward IPTV programs according to what the end-users actually demand and those watched by no end-user would not be multiplexed. By comparing these two schemes, a reduced traffic of EPON can be achieved by using dynamic multiplex scheme, especially when most end-users are watching the same few IPTV programs. Both schemes are implemented in our system, with their hardware and software designs described.

Bilevel alarm monitoring multiplexer

International Nuclear Information System (INIS)

Johnson, C.S.

1977-06-01

This report describes the operation of the Bilevel Alarm Monitoring Multiplexer used in the Adaptive Intrusion Data System (AIDS) to transfer and control alarm signals being sent to the Nova 2 computer, the Memory Controlled Data Processor, and its own integral Display Panel. The multiplexer can handle 48 alarm channels and format the alarms into binary formats compatible with the destination of the alarm data

Multiplexing of adjacent vortex modes with the forked grating coupler

Science.gov (United States)

Nadovich, Christopher T.; Kosciolek, Derek J.; Crouse, David T.; Jemison, William D.

2017-08-01

For vortex fiber multiplexing to reach practical commercial viability, simple silicon photonic interfaces with vortex fiber will be required. These interfaces must support multiplexing. Toward this goal, an efficient singlefed multimode Forked Grating Coupler (FGC) for coupling two different optical vortex OAM charges to or from the TE0 and TE1 rectangular waveguide modes has been developed. A simple, apodized device implemented with e-beam lithography and a conventional dual-etch processing on SOI wafer exhibits low crosstalk and reasonable mode match. Advanced designs using this concept are expected to further improve performance.

Frequency multiplexing for readout of spin qubits

Energy Technology Data Exchange (ETDEWEB)

Hornibrook, J. M.; Colless, J. I.; Mahoney, A. C.; Croot, X. G.; Blanvillain, S.; Reilly, D. J., E-mail: david.reilly@sydney.edu.au [ARC Centre of Excellence for Engineered Quantum Systems, School of Physics, University of Sydney, Sydney, NSW 2006 (Australia); Lu, H.; Gossard, A. C. [Materials Department, University of California, Santa Barbara, California 93106 (United States)

2014-03-10

We demonstrate a low loss, chip-level frequency multiplexing scheme for readout of scaled-up spin qubit devices. By integrating separate bias tees and resonator circuits on-chip for each readout channel, we realise dispersive gate-sensing in combination with charge detection based on two radio frequency quantum point contacts. We apply this approach to perform multiplexed readout of a double quantum dot in the few-electron regime and further demonstrate operation of a 10-channel multiplexing device. Limitations for scaling spin qubit readout to large numbers of multiplexed channels are discussed.

Design and fabrication of three-dimensional polymer mode multiplexer based on asymmetric waveguide couplers

Science.gov (United States)

He, Guobing; Gao, Yang; Xu, Yan; Ji, Lanting; Sun, Xiaoqiang; Wang, Xibin; Yi, Yunji; Chen, Changming; Wang, Fei; Zhang, Daming; Wu, Yuanda

2018-05-01

A polymer mode multiplexer based on asymmetric couplers is theoretically designed and experimentally demonstrated. The proposed X-junction coupler is formed by waveguides overlapped with different crossing angles in the vertical direction. A beam propagation method is adopted to optimize the dimensional parameters of the mode multiplexer to convert LP01 mode of two lower waveguides to LP11a and LP21a mode of the upper waveguide. The ultraviolet lithography and wet chemical etching are used in the fabrication process. A conversion ratio over 98% for both LP11a and LP21a mode in the wavelength range from 1530 to 1570 nm are experimentally demonstrated. This mode multiplexer has potential in broadband mode-division multiplexing transmission systems.

Evaluation of HOPG mounting possibilities for multiplexing spectrometers

DEFF Research Database (Denmark)

Groitl, Felix; Bartkowiak, Marek; Bergmann, Ryan M.

2017-01-01

Four different methods for mounting HOPG analyzer crystals on Si holders have been evaluated in the design process of the new multiplexing spectrometer CAMEA. Contrary to neutron optics used in standard spectrometers, the new instrument concept employs a series of analyzer segments behind each...

Demonstration of hybrid orbital angular momentum multiplexing and time-division multiplexing passive optical network.

Science.gov (United States)

Wang, Andong; Zhu, Long; Liu, Jun; Du, Cheng; Mo, Qi; Wang, Jian

2015-11-16

Mode-division multiplexing passive optical network (MDM-PON) is a promising scheme for next-generation access networks to further increase fiber transmission capacity. In this paper, we demonstrate the proof-of-concept experiment of hybrid mode-division multiplexing (MDM) and time-division multiplexing (TDM) PON architecture by exploiting orbital angular momentum (OAM) modes. Bidirectional transmissions with 2.5-Gbaud 4-level pulse amplitude modulation (PAM-4) downstream and 2-Gbaud on-off keying (OOK) upstream are demonstrated in the experiment. The observed optical signal-to-noise ratio (OSNR) penalties for downstream and upstream transmissions at a bit-error rate (BER) of 2 × 10(-3) are less than 2.0 dB and 3.0 dB, respectively.

Technical Considerations for Reduced Representation Bisulfite Sequencing with Multiplexed Libraries

Science.gov (United States)

Chatterjee, Aniruddha; Rodger, Euan J.; Stockwell, Peter A.; Weeks, Robert J.; Morison, Ian M.

2012-01-01

Reduced representation bisulfite sequencing (RRBS), which couples bisulfite conversion and next generation sequencing, is an innovative method that specifically enriches genomic regions with a high density of potential methylation sites and enables investigation of DNA methylation at single-nucleotide resolution. Recent advances in the Illumina DNA sample preparation protocol and sequencing technology have vastly improved sequencing throughput capacity. Although the new Illumina technology is now widely used, the unique challenges associated with multiplexed RRBS libraries on this platform have not been previously described. We have made modifications to the RRBS library preparation protocol to sequence multiplexed libraries on a single flow cell lane of the Illumina HiSeq 2000. Furthermore, our analysis incorporates a bioinformatics pipeline specifically designed to process bisulfite-converted sequencing reads and evaluate the output and quality of the sequencing data generated from the multiplexed libraries. We obtained an average of 42 million paired-end reads per sample for each flow-cell lane, with a high unique mapping efficiency to the reference human genome. Here we provide a roadmap of modifications, strategies, and trouble shooting approaches we implemented to optimize sequencing of multiplexed libraries on an a RRBS background. PMID:23193365

Signal multiplexing scheme for LINAC

International Nuclear Information System (INIS)

Sujo, C.I.; Mohan, Shyam; Joshi, Gopal; Singh, S.K.; Karande, Jitendra

2004-01-01

For the proper operation of the LINAC some signals, RF (radio frequency) as well as LF (low frequency) have to be available at the Master Control Station (MCS). These signals are needed to control, calibrate and characterize the RF fields in the resonators. This can be achieved by proper multiplexing of various signals locally and then routing the selected signals to the MCS. A multiplexing scheme has been designed and implemented, which will allow the signals from the selected cavity to the MCS. High isolation between channels and low insertion loss for a given signal are important issues while selecting the multiplexing scheme. (author)

Multiplexed electrospray scaling for liquid fuel injection

International Nuclear Information System (INIS)

Waits, C Mike; Hanrahan, Brendan; Lee, Ivan

2010-01-01

Evaporation and space-charge requirements are evaluated to understand the effect of device scaling and fuel preheating for a liquid fuel injector using a multiplexed electrospray (MES) configuration in compact combustion applications. This work reveals the influence of the droplet diameter, droplet velocity and droplet surface temperature as well as the surrounding gas temperature on the size and performance of microfabricated MES. Measurements from MES devices are used in the model to accurately account for the droplet diameter versus flow rate relationship, the minimum droplet diameter and the relevant droplet velocities. A maximum extractor electrode to ground electrode distance of 3.1 mm required to overcome space-charge forces is found to be independent of voltage or droplet velocity for large levels of multiplexing. This maximum distance also becomes the required evaporation length scale which imposes minimum fuel pre-heating requirements for large flow densities. Required fuel preheating is therefore evaluated for both ethanol and 1-butanol with combustor parameters relevant to fuel reformation, thermoelectric conversion, thermophotovoltaic conversion and thermionic conversion

Thermally multiplexed polymerase chain reaction.

Science.gov (United States)

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

A Time-Multiplexed Track-Trigger architecture for CMS

CERN Document Server

Hall, Geoffrey; Pesaresi, Mark Franco; Rose, A

2014-01-01

The CMS Tracker under development for the High Luminosity LHC includes an outer tracker based on ``PT-modules'' which will provide track stubs based on coincident clusters in two closely spaced sensor layers, aiming to reject low transverse momentum track hits before data transmission to the Level-1 trigger. The tracker data will be used to reconstruct track segments in dedicated processors before onward transmission to other trigger processors which will combine tracker information with data originating from the calorimeter and muon detectors, to make the final L1 trigger decision. The architecture for processing the tracker data is still an open question. One attractive option is to explore a Time Multiplexed design similar to one which is currently being implemented in the CMS calorimeter trigger as part of the Phase I trigger upgrade. The Time Multiplexed Trigger concept is explained, the potential benefits of applying it for processing future tracker data are described and a possible design based on cur...

Laguerre Gaussian beam multiplexing through turbulence

CSIR Research Space (South Africa)

Trichili, A

2014-08-17

Full Text Available We analyze the effect of atmospheric turbulence on the propagation of multiplexed Laguerre Gaussian modes. We present a method to multiplex Laguerre Gaussian modes using digital holograms and decompose the resulting field after encountering a...

Advanced combinational microfluidic multiplexer for fuel cell reactors

International Nuclear Information System (INIS)

Lee, D W; Kim, Y; Cho, Y-H; Doh, I

2013-01-01

An advanced combinational microfluidic multiplexer capable to address multiple fluidic channels for fuel cell reactors is proposed. Using only 4 control lines and two different levels of control pressures, the proposed multiplexer addresses up to 19 fluidic channels, at least two times larger than the previous microfluidic multiplexers. The present multiplexer providing high control efficiency and simple structure for channel addressing would be used in the application areas of the integrated microfluidic systems such as fuel cell reactors and dynamic pressure generators

Epidemics in partially overlapped multiplex networks.

Directory of Open Access Journals (Sweden)

Camila Buono

Full Text Available Many real networks exhibit a layered structure in which links in each layer reflect the function of nodes on different environments. These multiple types of links are usually represented by a multiplex network in which each layer has a different topology. In real-world networks, however, not all nodes are present on every layer. To generate a more realistic scenario, we use a generalized multiplex network and assume that only a fraction [Formula: see text] of the nodes are shared by the layers. We develop a theoretical framework for a branching process to describe the spread of an epidemic on these partially overlapped multiplex networks. This allows us to obtain the fraction of infected individuals as a function of the effective probability that the disease will be transmitted [Formula: see text]. We also theoretically determine the dependence of the epidemic threshold on the fraction [Formula: see text] of shared nodes in a system composed of two layers. We find that in the limit of [Formula: see text] the threshold is dominated by the layer with the smaller isolated threshold. Although a system of two completely isolated networks is nearly indistinguishable from a system of two networks that share just a few nodes, we find that the presence of these few shared nodes causes the epidemic threshold of the isolated network with the lower propagating capacity to change discontinuously and to acquire the threshold of the other network.

Multiplexed image storage by electromagnetically induced transparency in a solid

Science.gov (United States)

Heinze, G.; Rentzsch, N.; Halfmann, T.

2012-11-01

We report on frequency- and angle-multiplexed image storage by electromagnetically induced transparency (EIT) in a Pr3+:Y2SiO5 crystal. Frequency multiplexing by EIT relies on simultaneous storage of light pulses in atomic coherences, driven in different frequency ensembles of the inhomogeneously broadened solid medium. Angular multiplexing by EIT relies on phase matching of the driving laser beams, which permits simultaneous storage of light pulses propagating under different angles into the crystal. We apply the multiplexing techniques to increase the storage capacity of the EIT-driven optical memory, in particular to implement multiplexed storage of larger two-dimensional amounts of data (images). We demonstrate selective storage and readout of images by frequency-multiplexed EIT and angular-multiplexed EIT, as well as the potential to combine both multiplexing approaches towards further enhanced storage capacities.

Frequency-domain readout multiplexing of transition-edge sensor arrays

Energy Technology Data Exchange (ETDEWEB)

Lanting, T.M. [Physics Department, University of California, Berkeley, CA 94720 (United States)]. E-mail: tlanting@berkeley.edu; Arnold, K. [Physics Department, University of California, Berkeley, CA 94720 (United States); Cho, Hsiao-Mei [Physics Department, University of California, Berkeley, CA 94720 (United States); Clarke, John [Physics Department, University of California, Berkeley, CA 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Dobbs, Matt [Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Holzapfel, William [Physics Department, University of California, Berkeley, CA 94720 (United States); Lee, Adrian T. [Physics Department, University of California, Berkeley, CA 94720 (United States); Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Lueker, M. [Physics Department, University of California, Berkeley, CA 94720 (United States); Richards, P.L. [Physics Department, University of California, Berkeley, CA 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Smith, A.D. [Northrop-Grumman, Redondo Beach, CA 94278 (United States); Spieler, H.G. [Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)

2006-04-15

We have demonstrated frequency-domain readout multiplexing of eight channels for superconducting transition-edge sensor bolometer arrays. The multiplexed readout noise is 6.5 pA/{radical}Hz, well below the bolometer dark noise of 15-20 pA/{radical}Hz. We measure an upper limit on crosstalk of 0.004 between channels adjacent in frequency which meets our design requirement of 0.01. We have observed vibration insensitivity in our frequency-domain multiplexed transition-edge sensors, making this system very attractive for telescope and satellite observations. We also discuss extensions to our multiplexed readout. In particular, we are developing a SQUID flux-locked loop that is entirely cold and collaborating on digital multiplexer technology in order to scale up the number of multiplexed channels.

Immunization of Epidemics in Multiplex Networks

Science.gov (United States)

Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

2014-01-01

Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks. PMID:25401755

Immunization of epidemics in multiplex networks.

Science.gov (United States)

Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

2014-01-01

Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks.

Prototype data terminal-multiplexer/demultiplexer

Science.gov (United States)

Leck, D. E.; Goodwin, J. E.

1972-01-01

The design and operation of a quad redundant data terminal and a multiplexer/demultiplexer (MDU) is described. The most unique feature is the design of the quad redundant data terminal. This is one of the few designs where the unit is fail/op, fail/op, fail/safe. Laboratory tests confirm that the unit will operate satisfactorily with the failure of three out of four channels. Although the design utilizes state-of-the-art technology, the waveform error checks, the voting techniques, and the parity bit checks are believed to be used in unique configurations. Correct word selection routines are also novel. The MDU design, while not redundant, utilizes, the latest state-of-the-art advantages of light coupler and interested amplifiers. Much of the technology employed was an evolution of prior NASA contracts related to the Addressable Time Division Data System. A good example of the earlier technology development was the development of a low level analog multiplexer, a high level analog multiplexer, and a digital multiplexer. A list of all drawings is included for reference and all schematic, block and timing diagrams are incorporated.

Multiplexed detection of DNA sequences using a competitive displacement assay in a microfluidic SERRS-based device.

Science.gov (United States)

Yazdi, Soroush H; Giles, Kristen L; White, Ian M

2013-11-05

We demonstrate sensitive and multiplexed detection of DNA sequences through a surface enhanced resonance Raman spectroscopy (SERRS)-based competitive displacement assay in an integrated microsystem. The use of the competitive displacement scheme, in which the target DNA sequence displaces a Raman-labeled reporter sequence that has lower affinity for the immobilized probe, enables detection of unlabeled target DNA sequences with a simple single-step procedure. In our implementation, the displacement reaction occurs in a microporous packed column of silica beads prefunctionalized with probe-reporter pairs. The use of a functionalized packed-bead column in a microfluidic channel provides two major advantages: (i) immobilization surface chemistry can be performed as a batch process instead of on a chip-by-chip basis, and (ii) the microporous network eliminates the diffusion limitations of a typical biological assay, which increases the sensitivity. Packed silica beads are also leveraged to improve the SERRS detection of the Raman-labeled reporter. Following displacement, the reporter adsorbs onto aggregated silver nanoparticles in a microfluidic mixer; the nanoparticle-reporter conjugates are then trapped and concentrated in the silica bead matrix, which leads to a significant increase in plasmonic nanoparticles and adsorbed Raman reporters within the detection volume as compared to an open microfluidic channel. The experimental results reported here demonstrate detection down to 100 pM of the target DNA sequence, and the experiments are shown to be specific, repeatable, and quantitative. Furthermore, we illustrate the advantage of using SERRS by demonstrating multiplexed detection. The sensitivity of the assay, combined with the advantages of multiplexed detection and single-step operation with unlabeled target sequences makes this method attractive for practical applications. Importantly, while we illustrate DNA sequence detection, the SERRS-based competitive

X-ray microcalorimeter arrays fabricated by surface micromachining

International Nuclear Information System (INIS)

Hilton, G.C.; Beall, J.A.; Deiker, S.; Vale, L.R.; Doriese, W.B.; Beyer, Joern; Ullom, J.N.; Reintsema, C.D.; Xu, Y.; Irwin, K.D.

2004-01-01

We are developing arrays of Mo/Cu transition edge sensor-based detectors for use as X-ray microcalorimeters and sub-millimeter bolometers. We have fabricated 8x8 pixel X-ray microcalorimeter arrays using surface micromachining. Surface-micromachining techniques hold the promise of scalability to much larger arrays and may allow for the integration of in-plane multiplexer elements. In this paper we describe the surface micromachining process and recent improvements in the device geometry that provide for increased mechanical strength. We also present X-ray and heat pulse spectra collected using these detectors

Immunization of epidemics in multiplex networks.

Directory of Open Access Journals (Sweden)

Dawei Zhao

Full Text Available Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted immunization and layer node-based random (targeted immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF networks.

Available number of multiplexed holograms based on signal-to-noise ratio analysis in reflection-type holographic memory using three-dimensional speckle-shift multiplexing.

Science.gov (United States)

Nishizaki, Tatsuya; Matoba, Osamu; Nitta, Kouichi

2014-09-01

The recording properties of three-dimensional speckle-shift multiplexing in reflection-type holographic memory are analyzed numerically. Three-dimensional recording can increase the number of multiplexed holograms by suppressing the cross-talk noise from adjacent holograms by using depth-direction multiplexing rather than in-plane multiplexing. Numerical results indicate that the number of multiplexed holograms in three-layer recording can be increased by 1.44 times as large as that of a single-layer recording when an acceptable signal-to-noise ratio is set to be 2 when NA=0.43 and the thickness of the recording medium is 0.5 mm.

Strain measurement using multiplexed fiber optic sensors

International Nuclear Information System (INIS)

Kwon, Il Bum; Kim, Chi Yeop; Yoon, Dong Jin; Lee, Seung Seok

2003-01-01

FBG(Fiber Bragg grating) sensor, which is one of the fiber optic sensors for the application of smart structures, can not only measure one specific point but also multiple points by multiplexing techniques. We have proposed a novel multiplexing technique of FBG sensor by the intensity modulation of light source. This technique is applicable to WDM(Wavelength Division Multiplexing) technique and number of sensors in this system can be increased by using this technique with WDM technique.

Actively stabilized optical fiber interferometry technique for online/in-process surface measurement

International Nuclear Information System (INIS)

Wang Kaiwei; Martin, Haydn; Jiang Xiangqian

2008-01-01

In this paper, we report the recent progress in optical-beam scanning fiber interferometry for potential online nanoscale surface measurement based on the previous research. It attempts to generate a robust and miniature measurement device for future development into a multiprobe array measurement system. In this research, both fiber-optic-interferometry and the wavelength-division-multiplexing techniques have been used, so that the optical probe and the optical interferometer are well spaced and fast surface scanning can be carried out, allowing flexibility for online measurement. In addition, this system provides a self-reference signal to stabilize the optical detection with high common-mode noise suppression by adopting an active phase tracking and stabilization technique. Low-frequency noise was significantly reduced compared with unstabilized result. The measurement of a sample surface shows an attained repeatability of 3.3 nm

A micro-controlled universal message multiplexer

International Nuclear Information System (INIS)

Fontaine, G.; Guglielmi, L.; Jaeger, J.J.; Szafran, S.

1981-01-01

Based on the Motorola 6800, this multiplexer is designed to provide a microprocessor development tool in the specific environment of a high energy physics laboratory. The basic philosophy of this device is to allow communication of a target (prototype) processor with a host computer under control of a human operator. The host can be an experimental on-line computer or any remote machine with a time-sharing network. It is thus possible to speed up design and debugging of a physics application program by taking advantage of the sophisticated resources usually available in a computer centre (powerful editor, large disk space, source management via ''Patchy'' etc...). In addition to the classical cross-macroassembler, a loader is available on the host for down-line loading binary code, via the multiplexer, into the prototype memory. Such a scheme is easiextended to the communication of any host interactive processing program with a data acquisition microprocessor, and provides the latter with a convenient and easily portable extension of its computing power. A typical application of this mode is described in a separate paper

Evolution of cooperation under social pressure in multiplex networks.

Science.gov (United States)

Pereda, María

2016-09-01

In this work, we aim to contribute to the understanding of human prosocial behavior by studying the influence that a particular form of social pressure, "being watched," has on the evolution of cooperative behavior. We study how cooperation emerges in multiplex complex topologies by analyzing a particular bidirectionally coupled dynamics on top of a two-layer multiplex network (duplex). The coupled dynamics appears between the prisoner's dilemma game in a network and a threshold cascade model in the other. The threshold model is intended to abstract the behavior of a network of vigilant nodes that impose the pressure of being observed altering hence the temptation to defect of the dilemma. Cooperation or defection in the game also affects the state of a node of being vigilant. We analyze these processes on different duplex networks structures and assess the influence of the topology, average degree and correlated multiplexity, on the outcome of cooperation. Interestingly, we find that the social pressure of vigilance may impact cooperation positively or negatively, depending on the duplex structure, specifically the degree correlations between layers is determinant. Our results give further quantitative insights in the promotion of cooperation under social pressure.

Coevolution of Cooperation and Layer Selection Strategy in Multiplex Networks

Directory of Open Access Journals (Sweden)

Katsuki Hayashi

2016-11-01

Full Text Available Recently, the emergent dynamics in multiplex networks, composed of layers of multiple networks, has been discussed extensively in network sciences. However, little is still known about whether and how the evolution of strategy for selecting a layer to participate in can contribute to the emergence of cooperative behaviors in multiplex networks of social interactions. To investigate these issues, we constructed a coevolutionary model of cooperation and layer selection strategies in which each an individual selects one layer from multiple layers of social networks and plays the Prisoner’s Dilemma with neighbors in the selected layer. We found that the proportion of cooperative strategies increased with increasing the number of layers regardless of the degree of dilemma, and this increase occurred due to a cyclic coevolution process of game strategies and layer selection strategies. We also showed that the heterogeneity of links among layers is a key factor for multiplex networks to facilitate the evolution of cooperation, and such positive effects on cooperation were observed regardless of the difference in the stochastic properties of network topologies.

Cavity enhanced eigenmode multiplexing for volume holographic data storage

Science.gov (United States)

Miller, Bo E.; Takashima, Yuzuru

2017-08-01

Previously, we proposed and experimentally demonstrated enhanced recording speeds by using a resonant optical cavity to semi-passively increase the reference beam power while recording image bearing holograms. In addition to enhancing the reference beam power the cavity supports the orthogonal reference beam families of its eigenmodes, which can be used as a degree of freedom to multiplex data pages and increase storage densities for volume Holographic Data Storage Systems (HDSS). While keeping the increased recording speed of a cavity enhanced reference arm, image bearing holograms are multiplexed by orthogonal phase code multiplexing via Hermite-Gaussian eigenmodes in a Fe:LiNbO3 medium with a 532 nm laser at two Bragg angles for expedited recording of four multiplexed holograms. We experimentally confirmed write rates are enhanced by an average factor of 1.1, and page crosstalk is about 2.5%. This hybrid multiplexing opens up a pathway to increase storage density while minimizing modifications to current angular multiplexing HDSS.

Community Size Effects on Epidemic Spreading in Multiplex Social Networks.

Directory of Open Access Journals (Sweden)

Ting Liu

Full Text Available The dynamical process of epidemic spreading has drawn much attention of the complex network community. In the network paradigm, diseases spread from one person to another through the social ties amongst the population. There are a variety of factors that govern the processes of disease spreading on the networks. A common but not negligible factor is people's reaction to the outbreak of epidemics. Such reaction can be related information dissemination or self-protection. In this work, we explore the interactions between disease spreading and population response in terms of information diffusion and individuals' alertness. We model the system by mapping multiplex networks into two-layer networks and incorporating individuals' risk awareness, on the assumption that their response to the disease spreading depends on the size of the community they belong to. By comparing the final incidence of diseases in multiplex networks, we find that there is considerable mitigation of diseases spreading for full phase of spreading speed when individuals' protection responses are introduced. Interestingly, the degree of community overlap between the two layers is found to be critical factor that affects the final incidence. We also analyze the consequences of the epidemic incidence in communities with different sizes and the impacts of community overlap between two layers. Specifically, as the diseases information makes individuals alert and take measures to prevent the diseases, the effective protection is more striking in small community. These phenomena can be explained by the multiplexity of the networked system and the competition between two spreading processes.

Community Size Effects on Epidemic Spreading in Multiplex Social Networks.

Science.gov (United States)

Liu, Ting; Li, Ping; Chen, Yan; Zhang, Jie

2016-01-01

The dynamical process of epidemic spreading has drawn much attention of the complex network community. In the network paradigm, diseases spread from one person to another through the social ties amongst the population. There are a variety of factors that govern the processes of disease spreading on the networks. A common but not negligible factor is people's reaction to the outbreak of epidemics. Such reaction can be related information dissemination or self-protection. In this work, we explore the interactions between disease spreading and population response in terms of information diffusion and individuals' alertness. We model the system by mapping multiplex networks into two-layer networks and incorporating individuals' risk awareness, on the assumption that their response to the disease spreading depends on the size of the community they belong to. By comparing the final incidence of diseases in multiplex networks, we find that there is considerable mitigation of diseases spreading for full phase of spreading speed when individuals' protection responses are introduced. Interestingly, the degree of community overlap between the two layers is found to be critical factor that affects the final incidence. We also analyze the consequences of the epidemic incidence in communities with different sizes and the impacts of community overlap between two layers. Specifically, as the diseases information makes individuals alert and take measures to prevent the diseases, the effective protection is more striking in small community. These phenomena can be explained by the multiplexity of the networked system and the competition between two spreading processes.

Deep Reactive Ion Etching (DRIE) of High Aspect Ratio SiC Microstructures using a Time-Multiplexed Etch-Passivate Process

Science.gov (United States)

Evans, Laura J.; Beheim, Glenn M.

2006-01-01

High aspect ratio silicon carbide (SiC) microstructures are needed for microengines and other harsh environment micro-electro-mechanical systems (MEMS). Previously, deep reactive ion etching (DRIE) of low aspect ratio (AR less than or = 1) deep (greater than 100 micron) trenches in SiC has been reported. However, existing DRIE processes for SiC are not well-suited for definition of high aspect ratio features because such simple etch-only processes provide insufficient control over sidewall roughness and slope. Therefore, we have investigated the use of a time-multiplexed etch-passivate (TMEP) process, which alternates etching with polymer passivation of the etch sidewalls. An optimized TMEP process was used to etch high aspect ratio (AR greater than 5) deep (less than 100 micron) trenches in 6H-SiC. Power MEMS structures (micro turbine blades) in 6H-SiC were also fabricated.

A Novel Threshold Voltage Defined Multiplexer for Interconnect Camouflaging

Science.gov (United States)

2017-03-01

piracy of nalysis due to gates has been ates. However, ower and delay amouflaging of tect the IP. A or multiplexer is since transistor e proposed...is hidden cost is higher tsourcing the ncreasing the s effective in ld loss during rmore, it still ly processes. propose an o hide the nceptually

miRge - A Multiplexed Method of Processing Small RNA-Seq Data to Determine MicroRNA Entropy.

Directory of Open Access Journals (Sweden)

Alexander S Baras

Full Text Available Small RNA RNA-seq for microRNAs (miRNAs is a rapidly developing field where opportunities still exist to create better bioinformatics tools to process these large datasets and generate new, useful analyses. We built miRge to be a fast, smart small RNA-seq solution to process samples in a highly multiplexed fashion. miRge employs a Bayesian alignment approach, whereby reads are sequentially aligned against customized mature miRNA, hairpin miRNA, noncoding RNA and mRNA sequence libraries. miRNAs are summarized at the level of raw reads in addition to reads per million (RPM. Reads for all other RNA species (tRNA, rRNA, snoRNA, mRNA are provided, which is useful for identifying potential contaminants and optimizing small RNA purification strategies. miRge was designed to optimally identify miRNA isomiRs and employs an entropy based statistical measurement to identify differential production of isomiRs. This allowed us to identify decreasing entropy in isomiRs as stem cells mature into retinal pigment epithelial cells. Conversely, we show that pancreatic tumor miRNAs have similar entropy to matched normal pancreatic tissues. In a head-to-head comparison with other miRNA analysis tools (miRExpress 2.0, sRNAbench, omiRAs, miRDeep2, Chimira, UEA small RNA Workbench, miRge was faster (4 to 32-fold and was among the top-two methods in maximally aligning miRNAs reads per sample. Moreover, miRge has no inherent limits to its multiplexing. miRge was capable of simultaneously analyzing 100 small RNA-Seq samples in 52 minutes, providing an integrated analysis of miRNA expression across all samples. As miRge was designed for analysis of single as well as multiple samples, miRge is an ideal tool for high and low-throughput users. miRge is freely available at http://atlas.pathology.jhu.edu/baras/miRge.html.

High resolution multiplexed functional imaging in live embryos (Conference Presentation)

Science.gov (United States)

Xu, Dongli; Zhou, Weibin; Peng, Leilei

2017-02-01

Fourier multiplexed fluorescence lifetime imaging (FmFLIM) scanning laser optical tomography (FmFLIM-SLOT) combines FmFLIM and Scanning laser optical tomography (SLOT) to perform multiplexed 3D FLIM imaging of live embryos. The system had demonstrate multiplexed functional imaging of zebrafish embryos genetically express Foster Resonant Energy Transfer (FRET) sensors. However, previous system has a 20 micron resolution because the focused Gaussian beam diverges quickly from the focused plane, makes it difficult to achieve high resolution imaging over a long projection depth. Here, we present a high-resolution FmFLIM-SLOT system with achromatic Bessel beam, which achieves 3 micron resolution in 3D deep tissue imaging. In Bessel-FmFLIM-SLOT, multiple laser excitation lines are firstly intensity modulated by a Michelson interferometer with a spinning polygon mirror optical delay line, which enables Fourier multiplexed multi-channel lifetime measurements. Then, a spatial light modulator and a prism are used to transform the modulated Gaussian laser beam to an achromatic Bessel beam. The achromatic Bessel beam scans across the whole specimen with equal angular intervals as sample rotated. After tomography reconstruction and the frequency domain lifetime analysis method, both the 3D intensity and lifetime image of multiple excitation-emission can be obtained. Using Bessel-FmFLIM-SLOT system, we performed cellular-resolution FLIM tomography imaging of live zebrafish embryo. Genetically expressed FRET sensors in these embryo will allow non-invasive observation of multiple biochemical processes in vivo.

Helicity multiplexed broadband metasurface holograms.

Science.gov (United States)

Wen, Dandan; Yue, Fuyong; Li, Guixin; Zheng, Guoxing; Chan, Kinlong; Chen, Shumei; Chen, Ming; Li, King Fai; Wong, Polis Wing Han; Cheah, Kok Wai; Pun, Edwin Yue Bun; Zhang, Shuang; Chen, Xianzhong

2015-09-10

Metasurfaces are engineered interfaces that contain a thin layer of plasmonic or dielectric nanostructures capable of manipulating light in a desirable manner. Advances in metasurfaces have led to various practical applications ranging from lensing to holography. Metasurface holograms that can be switched by the polarization state of incident light have been demonstrated for achieving polarization multiplexed functionalities. However, practical application of these devices has been limited by their capability for achieving high efficiency and high image quality. Here we experimentally demonstrate a helicity multiplexed metasurface hologram with high efficiency and good image fidelity over a broad range of frequencies. The metasurface hologram features the combination of two sets of hologram patterns operating with opposite incident helicities. Two symmetrically distributed off-axis images are interchangeable by controlling the helicity of the input light. The demonstrated helicity multiplexed metasurface hologram with its high performance opens avenues for future applications with functionality switchable optical devices.

Surface Modification and Surface - Subsurface Exchange Processes on Europa

Science.gov (United States)

Phillips, C. B.; Molaro, J.; Hand, K. P.

2017-12-01

The surface of Jupiter's moon Europa is modified by exogenic processes such as sputtering, gardening, radiolysis, sulfur ion implantation, and thermal processing, as well as endogenic processes including tidal shaking, mass wasting, and the effects of subsurface tectonic and perhaps cryovolcanic activity. New materials are created or deposited on the surface (radiolysis, micrometeorite impacts, sulfur ion implantation, cryovolcanic plume deposits), modified in place (thermal segregation, sintering), transported either vertically or horizontally (sputtering, gardening, mass wasting, tectonic and cryovolcanic activity), or lost from Europa completely (sputtering, plumes, larger impacts). Some of these processes vary spatially, as visible in Europa's leading-trailing hemisphere brightness asymmetry. Endogenic geologic processes also vary spatially, depending on terrain type. The surface can be classified into general landform categories that include tectonic features (ridges, bands, cracks); disrupted "chaos-type" terrain (chaos blocks, matrix, domes, pits, spots); and impact craters (simple, complex, multi-ring). The spatial distribution of these terrain types is relatively random, with some differences in apex-antiapex cratering rates and latitudinal variation in chaos vs. tectonic features. In this work, we extrapolate surface processes and rates from the top meter of the surface in conjunction with global estimates of transport and resurfacing rates. We combine near-surface modification with an estimate of surface-subsurface (and vice versa) transport rates for various geologic terrains based on an average of proposed formation mechanisms, and a spatial distribution of each landform type over Europa's surface area. Understanding the rates and mass balance for each of these processes, as well as their spatial and temporal variability, allows us to estimate surface - subsurface exchange rates over the average surface age ( 50myr) of Europa. Quantifying the timescale

Ultra-High Capacity Silicon Photonic Interconnects through Spatial Multiplexing

Science.gov (United States)

Chen, Christine P.

-fabrication. Through ModePROP simulations, optimizing device performance dynamically post-fabrication is analyzed, through either electro-optical or thermo-optical means. By biasing the arm introducing the slight spectral offset, we can quantifiably improve device performance. Scaling bandwidth is experimentally demonstrated through the device at 3 modes, 2 wavelengths, and 40 Gb/s data rate for 240 Gb/s aggregate bandwidth, with the potential to reduce power penalty per the device optimization process we described. A main motivation for this on-chip spatial multiplexing is the need to reduce costs. As the laser source serves as the greatest power consumer in an optical system, mode-division multiplexing and other forms of spatial multiplexing can be implemented to push its potentially prohibitive cost metrics down. In order to demonstrate an intelligent platform capable of dynamically multicasting data and reallocating power as needed by the system, we must first initialize the switch fabric to control with an electronic interface. A dithering mechanism, whereby exact cross, bar, and sub-percentage states are enforced through the device, is described here. Such a method could be employed for actuating the device table of bias values to states automatically. We then employ a dynamic power reallocation algorithm through a data acquisition unit, showing real-time channel recovery for channels experiencing power loss by diverting power from paths that could tolerate it. The data that is being multicast through the system is experimentally shown to be error-free at 40 Gb/s data rate, when transmitting from one to three clients and going from automatic bar/cross states to equalized power distribution. For the last portion of this topic, the switch fabric was inserted into a high-performance computing system. In order to run benchmarks at 10 Gb/s data ontop of the switch fabric, a newer model of the control plane was implemented to toggle states according to the command issued by the server

A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

Directory of Open Access Journals (Sweden)

Diego Cardeñosa

Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

Description of two-process surface topography

International Nuclear Information System (INIS)

Grabon, W; Pawlus, P

2014-01-01

After two machining processes, a large number of surface topography measurements were made using Talyscan 150 stylus measuring equipment. The measured samples were divided into two groups. The first group contained two-process surfaces of random nature, while the second group used random-deterministic textures of random plateau parts and portions of deterministic valleys. For comparison, one-process surfaces were also analysed. Correlation and regression analysis was used to study the dependencies among surface texture parameters in 2D and 3D systems. As the result of this study, sets of parameters describing multi-process surface topography were obtained for two-process surfaces of random and of random-deterministic types. (papers)

Online Continuous Trace Process Analytics Using Multiplexing Gas Chromatography.

Science.gov (United States)

Wunsch, Marco R; Lehnig, Rudolf; Trapp, Oliver

2017-04-04

The analysis of impurities at a trace level in chemical products, nutrition additives, and drugs is highly important to guarantee safe products suitable for consumption. However, trace analysis in the presence of a dominating component can be a challenging task because of noncompatible linear detection ranges or strong signal overlap that suppresses the signal of interest. Here, we developed a technique for quantitative analysis using multiplexing gas chromatography (mpGC) for continuous and completely automated process trace analytics exemplified for the analysis of a CO 2 stream in a production plant for detection of benzene, toluene, ethylbenzene, and the three structural isomers of xylene (BTEX) in the concentration range of 0-10 ppb. Additional minor components are methane and methanol with concentrations up to 100 ppm. The sample is injected up to 512 times according to a pseudorandom binary sequence (PRBS) with a mean frequency of 0.1 Hz into a gas chromatograph equipped with a flame ionization detector (FID). A superimposed chromatogram is recorded which is deconvoluted into an averaged chromatogram with Hadamard transformation. Novel algorithms to maintain the data acquisition rate of the detector by application of Hadamard transformation and to suppress correlation noise induced by components with much higher concentrations than the target substances are shown. Compared to conventional GC-FID, the signal-to-noise ratio has been increased by a factor of 10 with mpGC-FID. Correspondingly, the detection limits for BTEX in CO 2 have been lowered from 10 to 1 ppb each. This has been achieved despite the presence of detectable components (methane and methanol) with a concentration about 1000 times higher than the target substances. The robustness and reliability of mpGC has been proven in a two-month field test in a chemical production plant.

Diversity of Salmonella isolates from central Florida surface waters.

Science.gov (United States)

McEgan, Rachel; Chandler, Jeffrey C; Goodridge, Lawrence D; Danyluk, Michelle D

2014-11-01

Identification of Salmonella serotypes is important for understanding the environmental diversity of the genus Salmonella. This study evaluates the diversity of Salmonella isolates recovered from 165 of 202 Central Florida surface water samples and investigates whether the serotype of the environmental Salmonella isolates can be predicted by a previously published multiplex PCR assay (S. Kim, J. G. Frye, J. Hu, P. J. Fedorka-Cray, R. Gautom, and D. S. Boyle, J. Clin. Microbiol. 44:3608-3615, 2006, http://dx.doi.org/10.1128/JCM.00701-06). Multiplex PCR was performed on 562 Salmonella isolates (as many as 36 isolates per water sample) to predict serotypes. Kauffmann-White serogrouping was used to confirm multiplex PCR pattern groupings before isolates were serotyped, analyzed by pulsed-field gel electrophoresis, and assayed for antimicrobial susceptibility. In 41.2% of the Salmonella-positive water samples, all Salmonella isolates had identical multiplex PCR patterns; in the remaining 58.8%, two or more multiplex PCR patterns were identified. Within each sample, isolates with matching multiplex PCR patterns had matching serogroups. The multiplex patterns of 495 isolates (88.1%) did not match any previously reported pattern. The remaining 68 isolates matched reported patterns but did not match the serotypes for those patterns. The use of the multiplex PCR allowed the number of isolates requiring further analysis to be reduced to 223. Thirty-three Salmonella enterica serotypes were identified; the most frequent included serotypes Muenchen, Rubislaw, Anatum, Gaminara, and IV_50:z4,z23:-. A majority (141/223) of Salmonella isolates clustered into one genotypic group. Salmonella isolates in Central Florida surface waters are serotypically, genotypically, and phenotypically (in terms of antimicrobial susceptibility) diverse. While isolates could be grouped as different or potentially the same using multiplex PCR, the multiplex PCR pattern did not predict the Salmonella

Development of ROACH firmware for microwave multiplexed X-ray TES microcalorimeters

Energy Technology Data Exchange (ETDEWEB)

Madden, T. J.; Cecil, T. W.; Gades, L. M.; Quaranta, O.; Yan, D.; Miceli, A.; Gard, J. D.

2016-09-04

We are developing room temperature electronics based upon the ROACH platform for reading out microwave multiplexed X-ray TES. ROACH is an open-source hardware and software platform featuring a large Xilinx Field Programmable Gate Array (FPGA), Power PC processor, several 10GB Ethernet SFP+ interfaces, and a collection of daughter boards for analog signal generation and acquisition. The combination of a ROACH board, ADC/DAC conversion daughter boards, and hardware for RF mixing allows for the generation and capture of multiple RF tones for reading out microwave multiplexed x-ray TES microcalorimeters. The FPGA is used to generate multiple tones in base band, from 10MHz to 250MHz, which are subsequently mixed to RF in the multiple GHz range and sent through the microwave multiplexer. The tones are generated in the FPGA by storing a large lookup table in Quad Data Rate (QDR) SRAM modules and playing out the waveform to a DAC board. Once the signal has been modulated to RF, passed through the microwave multiplexer, and has been modulated back to base band, the signal is digitized by an ADC board. The tones are modulated to 0Hz by using a FPGA circuit consisting of a polyphase filter bank, several Xilinx FFT blocks, Xilinx CORDIC blocks (for converting to magnitude and phase), and special phase accumulator circuit for mixing to exactly 0Hz. Upwards of 256 channels can be simultaneously captured and written into a bank of 256 First-In-First-Out (FIFO) memories, with each FIFO corresponding to a channel. Individual channel data can be further processed in the FPGA before being streamed through a 10GB Ethernet fiber-optic interface to a Linux system. The Linux system runs software written in Python and QT C++ for controlling the ROACH system, capturing data, and processing data.

Optimization of the segmented method for optical compression and multiplexing system

Science.gov (United States)

Al Falou, Ayman

2002-05-01

Because of the constant increasing demands of images exchange, and despite the ever increasing bandwidth of the networks, compression and multiplexing of images is becoming inseparable from their generation and display. For high resolution real time motion pictures, electronic performing of compression requires complex and time-consuming processing units. On the contrary, by its inherent bi-dimensional character, coherent optics is well fitted to perform such processes that are basically bi-dimensional data handling in the Fourier domain. Additionally, the main limiting factor that was the maximum frame rate is vanishing because of the recent improvement of spatial light modulator technology. The purpose of this communication is to benefit from recent optical correlation algorithms. The segmented filtering used to store multi-references in a given space bandwidth product optical filter can be applied to networks to compress and multiplex images in a given bandwidth channel.

Miniaturized high-temperature superconducting multiplexer with cascaded quadruplet structure

Science.gov (United States)

Xu, Zhang; Jingping, Liu; Shaolin, Yan; Lan, Fang; Bo, Zhang; Xinjie, Zhao

2015-06-01

In this paper, compact high temperature superconducting (HTS) multiplexers are presented for satellite communication applications. The first multiplexer consists of an input coupling node and three high-order bandpass filters, which is named triplexer. The node is realized by a loop microstrip line instead of conventional T-junction to eliminate the redundant susceptance due to combination of three filters. There are two eight-pole band-pass filters and one ten-pole band-pass filter with cascaded quadruplet structure for realizing high isolation. Moreover, the triplexer is extended to a multiplexer with six channels so as to verify the expansibility of the suggested approach. The triplexer is fabricated using double-sided YBa2Cu3O7 thin films on a 38 × 25 mm2 LaAlO3 substrate. The experimental results, when compared with those ones from the T-junction multiplexer, show that our multiplexer has lower insertion loss, smaller sizes and higher isolation between any two channels. Also, good agreement has been achieved between simulations and measurements, which illustrate the effectiveness of our methods for the design of high performance HTS multiplexers.

A demonstration of a Time Multiplexed Trigger for the CMS experiment

Energy Technology Data Exchange (ETDEWEB)

Frazier, R; Newbold, D [University of Bristol, H.H. Wills Physics Laboratory, Tyndall Avenue, Bristol BS8 1TL (United Kingdom); Fayer, S; Hall, G; Hunt, C; Iles, G; Rose, A [Imperial College London, Blackett Laboratory, Prince Consort Road, London SW7 2BW (United Kingdom)

2012-01-15

A novel approach to first-level hardware triggering in the LHC experiments has been studied and a prototype system built. Calorimeter trigger primitive data ( {approx} 5 Tb/s) are re-organised and time-multiplexed so that a single processing node (FPGA) may access the data corresponding to the entire detector for a given bunch crossing. This provides maximal flexibility in the construction of new trigger algorithms, which will be an important factor in ensuring adequate trigger performance at the very high levels of background expected at the upgraded LHC. A test system that incorporates all the key technologies for a final system and demonstrates the time-multiplexing and algorithm performance is presented.

Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

International Nuclear Information System (INIS)

Trejos, Sorayda; Barrera, John Fredy; Torroba, Roberto

2015-01-01

We present for the first time an optical encrypting–decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome. (paper)

Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

Science.gov (United States)

Trejos, Sorayda; Fredy Barrera, John; Torroba, Roberto

2015-08-01

We present for the first time an optical encrypting-decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome.

Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

Science.gov (United States)

Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

2011-01-01

In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

SQUID readout multiplexers for transition-edge sensor arrays

Energy Technology Data Exchange (ETDEWEB)

Lee, Adrian T. [Physics Department, University of California, Berkeley, CA 94720 (United States) and Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)]. E-mail: atl@physics.berkeley.edu

2006-04-15

Two classes of SQUID multiplexer are being developed for large arrays of cryogenic sensors, distinguished by their operation in either the time domain or frequency domain. Several systems optimized for use with Transition-Edge Sensors (TES) are reaching a high level of maturity, and will be deployed on funded astrophysics experiments in the next several years. A useful technical figure of merit is the product of the number of detectors multplexed multipled by the bandwidth of the detectors, which can be termed the 'total signal bandwidth' of a multiplexer system. This figure of merit is comparable within a factor of two for the mature systems. Several new concepts for increasing the total bandwidth are being developed in the broad class of frequency domain multiplexers. Another notable area of progress is in the level of integration of muliplexer and detector array. The time domain system for SCUBA-II is a sophisticated bump-bonded sandwich structure, and the Jena/MPI group is integrating detectors and a time domain multiplexer on one substrate. Finally, the Kinetic Inductance Detectors (KID)/HEMT (non-SQUID) detector/multiplexer system, will be discussed briefly.

Evaluation of Optical Detection Platforms for Multiplexed Detection of Proteins and the Need for Point-of-Care Biosensors for Clinical Use

Directory of Open Access Journals (Sweden)

Samantha Spindel

2014-11-01

Full Text Available This review investigates optical sensor platforms for protein multiplexing, the ability to analyze multiple analytes simultaneously. Multiplexing is becoming increasingly important for clinical needs because disease and therapeutic response often involve the interplay between a variety of complex biological networks encompassing multiple, rather than single, proteins. Multiplexing is generally achieved through one of two routes, either through spatial separation on a surface (different wells or spots or with the use of unique identifiers/labels (such as spectral separation—different colored dyes, or unique beads—size or color. The strengths and weaknesses of conventional platforms such as immunoassays and new platforms involving protein arrays and lab-on-a-chip technology, including commercially-available devices, are discussed. Three major public health concerns are identified whereby detecting medically-relevant markers using Point-of-Care (POC multiplex assays could potentially allow for a more efficient diagnosis and treatment of diseases.

Multiplexing schemes for an achromatic programmable diffractive lens

Energy Technology Data Exchange (ETDEWEB)

Millan, M S; Perez-Cabre, E; Oton, J [Technical University of Catalonia, Dep. Optics and Optometry, Terrassa-Barcelona, 08222 (Spain)], E-mail: millan@oo.upc.edu

2008-11-01

A multiplexed programmable diffractive lens, displayed on a pixelated liquid crystal device under broadband illumination, is proposed to compensate for the severe chromatic aberration that affects diffractive elements. The proposed lens is based on multiplexing a set of sublenses with a common focal length for different wavelengths. We consider different types of integration of the optical information (spatial only, temporal only and hybrid spatial-temporal) combined with a proper selection of the spectral bandwidth. The properties and limits of the achromatic programmable multiplexed lens are described. Experimental results are presented and discussed.

Multiplexing schemes for an achromatic programmable diffractive lens

International Nuclear Information System (INIS)

Millan, M S; Perez-Cabre, E; Oton, J

2008-01-01

A multiplexed programmable diffractive lens, displayed on a pixelated liquid crystal device under broadband illumination, is proposed to compensate for the severe chromatic aberration that affects diffractive elements. The proposed lens is based on multiplexing a set of sublenses with a common focal length for different wavelengths. We consider different types of integration of the optical information (spatial only, temporal only and hybrid spatial-temporal) combined with a proper selection of the spectral bandwidth. The properties and limits of the achromatic programmable multiplexed lens are described. Experimental results are presented and discussed.

Photocleavage-based affinity purification of biomarkers from serum: Application to multiplex allergy testing.

Directory of Open Access Journals (Sweden)

Zhi Wan

Full Text Available Multiplex serological immunoassays, such as implemented on microarray or microsphere-based platforms, provide greater information content and higher throughput, while lowering the cost and blood volume required. These features are particularly attractive in pediatric food allergy testing to facilitate high throughput multi-allergen analysis from finger- or heel-stick collected blood. However, the miniaturization and microfluidics necessary for creating multiplex assays make them highly susceptible to the "matrix effect" caused by interference from non-target agents in serum and other biofluids. Such interference can result in lower sensitivity, specificity, reproducibility and quantitative accuracy. These problems have in large part prevented wide-spread implementation of multiplex immunoassays in clinical laboratories. We report the development of a novel method to eliminate the matrix effect by utilizing photocleavable capture antibodies to purify and concentrate blood-based biomarkers (a process termed PC-PURE prior to detection in a multiplex immunoassay. To evaluate this approach, it was applied to blood-based allergy testing. Patient total IgE was purified and enriched using PC-PURE followed by multiplex microsphere-based detection of allergen-specific IgEs (termed the AllerBead assay. AllerBead was formatted to detect the eight most common pediatric food allergens: milk, soy, wheat, egg, peanuts, tree nuts, fin fish and shellfish, which account for >90% of all pediatric food allergies. 205 serum samples obtained from Boston Children's Hospital were evaluated. When PC-PURE was employed with AllerBead, excellent agreement was obtained with the standard, non-multiplex, ImmunoCAP® assay (average sensitivity above published negative predictive cutoffs = 96% and average Pearson r = 0.90; average specificity = 97%. In contrast, poor ImmunoCAP®-correlation was observed when PC-PURE was not utilized (average sensitivity above published negative

Eigenmode multiplexing with SLM for volume holographic data storage

Science.gov (United States)

Chen, Guanghao; Miller, Bo E.; Takashima, Yuzuru

2017-08-01

The cavity supports the orthogonal reference beam families as its eigenmodes while enhancing the reference beam power. Such orthogonal eigenmodes are used as additional degree of freedom to multiplex data pages, consequently increase storage densities for volume Holographic Data Storage Systems (HDSS) when the maximum number of multiplexed data page is limited by geometrical factor. Image bearing holograms are multiplexed by orthogonal phase code multiplexing via Hermite-Gaussian eigenmodes in a Fe:LiNbO3 medium with a 532 nm laser at multiple Bragg angles by using Liquid Crystal on Silicon (LCOS) spatial light modulators (SLMs) in reference arms. Total of nine holograms are recorded with three angular and three eigenmode.

Multiplexed infrared plasmonic surface lattice resonances

Science.gov (United States)

Gutha, Rithvik R.; Sadeghi, Seyed M.; Sharp, Christina; Wing, Waylin J.

2018-01-01

We demonstrate that arrays of flat gold nanodisks with rectangular lattices can support a tunable hybrid frequency gap formed by the surface lattice resonances in the substrate ((+1, 0)sub) and the superstrate ((-1, 0)sup). For a certain polarization, rotation of the arrays reduces this gap, forming a band crossing (degenerate state) wherein both surface lattice resonances happen around a single wavelength (˜1300 nm). This highlights a situation wherein hybridization of the Rayleigh anomaly with localized surface plasmon resonances with different multipolar natures happens around the same wavelength. We demonstrate that for a different polarization of the incident light the arrays support the formation of a photonic-plasmonic state at about 1650 nm. Our results show that as the projection of the wave vector of the incident light on the planes of the nanodisk arrays increases, within a given wavelength range, the (+1, 0) mode of this state becomes amplified. Under this condition, this mode can undergo a significant blue shift without broadening, while its amplitude increases.

Social contagions on correlated multiplex networks

Science.gov (United States)

Wang, Wei; Cai, Meng; Zheng, Muhua

2018-06-01

The existence of interlayer degree correlations has been disclosed by abundant multiplex network analysis. However, how they impose on the dynamics of social contagions are remain largely unknown. In this paper, we propose a non-Markovian social contagion model in multiplex networks with inter-layer degree correlations to delineate the behavior spreading, and develop an edge-based compartmental (EBC) theory to describe the model. We find that multiplex networks promote the final behavior adoption size. Remarkably, it can be observed that the growth pattern of the final behavior adoption size, versus the behavioral information transmission probability, changes from discontinuous to continuous once decreasing the behavior adoption threshold in one layer. We finally unravel that the inter-layer degree correlations play a role on the final behavior adoption size but have no effects on the growth pattern, which is coincidence with our prediction by using the suggested theory.

Aqueous two-phase system patterning of detection antibody solutions for cross-reaction-free multiplex ELISA

Science.gov (United States)

Frampton, John P.; White, Joshua B.; Simon, Arlyne B.; Tsuei, Michael; Paczesny, Sophie; Takayama, Shuichi

2014-05-01

Accurate disease diagnosis, patient stratification and biomarker validation require the analysis of multiple biomarkers. This paper describes cross-reactivity-free multiplexing of enzyme-linked immunosorbent assays (ELISAs) using aqueous two-phase systems (ATPSs) to confine detection antibodies at specific locations in fully aqueous environments. Antibody cross-reactions are eliminated because the detection antibody solutions are co-localized only to corresponding surface-immobilized capture antibody spots. This multiplexing technique is validated using plasma samples from allogeneic bone marrow recipients. Patients with acute graft versus host disease (GVHD), a common and serious condition associated with allogeneic bone marrow transplantation, display higher mean concentrations for four multiplexed biomarkers (HGF, elafin, ST2 and TNFR1) relative to healthy donors and transplant patients without GVHD. The antibody co-localization capability of this technology is particularly useful when using inherently cross-reactive reagents such as polyclonal antibodies, although monoclonal antibody cross-reactivity can also be reduced. Because ATPS-ELISA adapts readily available antibody reagents, plate materials and detection instruments, it should be easily transferable into other research and clinical settings.

Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

Directory of Open Access Journals (Sweden)

Nayereh Nouri

2014-01-01

Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

Radiometric and signal-to-noise ratio properties of multiplex dispersive spectrometry

International Nuclear Information System (INIS)

Barducci, Alessandro; Guzzi, Donatella; Lastri, Cinzia; Nardino, Vanni; Marcoionni, Paolo; Pippi, Ivan

2010-01-01

Recent theoretical investigations have shown important radiometric disadvantages of interferential multiplexing in Fourier transform spectrometry that apparently can be applied even to coded aperture spectrometers. We have reexamined the methods of noninterferential multiplexing in order to assess their signal-to-noise ratio (SNR) performance, relying on a theoretical modeling of the multiplexed signals. We are able to show that quite similar SNR and radiometric disadvantages affect multiplex dispersive spectrometry. The effect of noise on spectral estimations is discussed.

SERS-based inverse molecular sentinel (iMS) nanoprobes for multiplexed detection of microRNA cancer biomarkers in biological samples

Science.gov (United States)

Crawford, Bridget M.; Wang, Hsin-Neng; Fales, Andrew M.; Bowie, Michelle L.; Seewaldt, Victoria L.; Vo-Dinh, Tuan

2017-02-01

The development of sensitive and selective biosensing techniques is of great interest for clinical diagnostics. Here, we describe the development and application of a surface enhanced Raman scattering (SERS) sensing technology, referred to as "inverse Molecular Sentinel (iMS)" nanoprobes, for the detection of nucleic acid biomarkers in biological samples. This iMS nanoprobe involves the use of plasmonic-active nanostars as the sensing platform for a homogenous assay for multiplexed detection of nucleic acid biomarkers, including DNA, RNA and microRNA (miRNA). The "OFF-to-ON" signal switch is based on a non-enzymatic strand-displacement process and the conformational change of stem-loop (hairpin) oligonucleotide probes upon target binding. Here, we demonstrate the development of iMS nanoprobes for the detection of DNA sequences as well as a modified design of the nanoprobe for the detection of short (22-nt) microRNA sequences. The application of iMS nanoprobes to detect miRNAs in real biological samples was performed with total small RNA extracted from breast cancer cell lines. The multiplex capability of the iMS technique was demonstrated using a mixture of the two differently labeled nanoprobes to detect miR-21 and miR-34a miRNA biomarkers for breast cancer. The results of this study demonstrate the feasibility of applying the iMS technique for multiplexed detection of nucleic acid biomarkers, including short miRNAs molecules.

Topology-optimized silicon photonic wire mode (de)multiplexer

DEFF Research Database (Denmark)

Frellsen, Louise Floor; Frandsen, Lars Hagedorn; Ding, Yunhong

2015-01-01

We have designed and for the first time experimentally verified a topology optimized mode (de)multiplexer, which demultiplexes the fundamental and the first order mode of a double mode photonic wire to two separate single mode waveguides (and multiplexes vice versa). The device has a footprint...

Performance of 20:1 multiplexer for large area charge readouts in directional dark matter TPC detectors

Science.gov (United States)

Ezeribe, A. C.; Robinson, M.; Robinson, N.; Scarff, A.; Spooner, N. J. C.; Yuriev, L.

2018-02-01

More target mass is required in current TPC based directional dark matter detectors for improved detector sensitivity. This can be achieved by scaling up the detector volumes, but this results in the need for more analogue signal channels. A possible solution to reducing the overall cost of the charge readout electronics is to multiplex the signal readout channels. Here, we present a multiplexer system in expanded mode based on LMH6574 chips produced by Texas Instruments, originally designed for video processing. The setup has a capability of reducing the number of readouts in such TPC detectors by a factor of 20. Results indicate that the important charge distribution asymmetry along an ionization track is retained after multiplexed signals are demultiplexed.

Link overlap, viability, and mutual percolation in multiplex networks

International Nuclear Information System (INIS)

Min, Byungjoon; Lee, Sangchul; Lee, Kyu-Min; Goh, K.-I.

2015-01-01

Many real-world complex systems are best modeled by multiplex networks. The multiplexity has proved to have broad impact on the system’s structure and function. Most theoretical studies on multiplex networks to date, however, have largely ignored the effect of the link overlap across layers despite strong empirical evidences for its significance. In this article, we investigate the effect of the link overlap in the viability of multiplex networks, both analytically and numerically. After a short recap of the original multiplex viability study, the distinctive role of overlapping links in viability and mutual connectivity is emphasized and exploited for setting up a proper analytic framework. A rich phase diagram for viability is obtained and greatly diversified patterns of hysteretic behavior in viability are observed in the presence of link overlap. Mutual percolation with link overlap is revisited as a limit of multiplex viability problem, and the controversy between existing results is clarified. The distinctive role of overlapping links is further demonstrated by the different responses of networks under random removals of overlapping and non-overlapping links, respectively, as well as under several link-removal strategies. Our results show that the link overlap facilitates the viability and mutual percolation; at the same time, the presence of link overlap poses a challenge in analytical approaches to the problem

Effect of Shot Noise on Simultaneous Sensing in Frequency Division Multiplexed Diffuse Optical Tomographic Imaging Process.

Science.gov (United States)

Jang, Hansol; Lim, Gukbin; Hong, Keum-Shik; Cho, Jaedu; Gulsen, Gultekin; Kim, Chang-Seok

2017-11-28

Diffuse optical tomography (DOT) has been studied for use in the detection of breast cancer, cerebral oxygenation, and cognitive brain signals. As optical imaging studies have increased significantly, acquiring imaging data in real time has become increasingly important. We have developed frequency-division multiplexing (FDM) DOT systems to analyze their performance with respect to acquisition time and imaging quality, in comparison with the conventional time-division multiplexing (TDM) DOT. A large tomographic area of a cylindrical phantom 60 mm in diameter could be successfully reconstructed using both TDM DOT and FDM DOT systems. In our experiment with 6 source-detector (S-D) pairs, the TDM DOT and FDM DOT systems required 6.18 and 1 s, respectively, to obtain a single tomographic data set. While the absorption coefficient of the reconstruction image was underestimated in the case of the FDM DOT, we experimentally confirmed that the abnormal region can be clearly distinguished from the background phantom using both methods.

Effect of Shot Noise on Simultaneous Sensing in Frequency Division Multiplexed Diffuse Optical Tomographic Imaging Process

Directory of Open Access Journals (Sweden)

Hansol Jang

2017-11-01

Full Text Available Diffuse optical tomography (DOT has been studied for use in the detection of breast cancer, cerebral oxygenation, and cognitive brain signals. As optical imaging studies have increased significantly, acquiring imaging data in real time has become increasingly important. We have developed frequency-division multiplexing (FDM DOT systems to analyze their performance with respect to acquisition time and imaging quality, in comparison with the conventional time-division multiplexing (TDM DOT. A large tomographic area of a cylindrical phantom 60 mm in diameter could be successfully reconstructed using both TDM DOT and FDM DOT systems. In our experiment with 6 source-detector (S-D pairs, the TDM DOT and FDM DOT systems required 6.18 and 1 s, respectively, to obtain a single tomographic data set. While the absorption coefficient of the reconstruction image was underestimated in the case of the FDM DOT, we experimentally confirmed that the abnormal region can be clearly distinguished from the background phantom using both methods.

Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

Science.gov (United States)

Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

2018-04-23

Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

Doubling transmission capacity in optical wireless system by antenna horizontal- and vertical-polarization multiplexing.

Science.gov (United States)

Li, Xinying; Yu, Jianjun; Zhang, Junwen; Dong, Ze; Chi, Nan

2013-06-15

We experimentally demonstrate 2×56 Gb/s two-channel polarization-division-multiplexing quadrature-phase-shift-keying signal delivery over 80 km single-mode fiber-28 and 2 m Q-band (33-50 GHz) wireless link, adopting antenna horizontal- (H-) and vertical-polarization (V-polarization) multiplexing. At the wireless receiver, classic constant-modulus-algorithm equalization based on digital signal processing can realize polarization demultiplexing and remove the crosstalk at the same antenna polarization. By adopting antenna polarization multiplexing, the signal baud rate and performance requirements for optical and wireless devices can be reduced but at the cost of double antennas and devices, while wireless transmission capacity can also be increased but at the cost of stricter requirements for V-polarization. The isolation is only about 19 dB when V-polarization deviation approaches 10°, which will affect high-speed (>50 Gb/s) wireless delivery.

Digital holograms for laser mode multiplexing

CSIR Research Space (South Africa)

Mhlanga, T

2014-10-02

Full Text Available multiplexing Thandeka Mhlangaa, b, Abderrahmen Trichilic, Angela Dudleya, Darryl Naidooa, b, Mourad Zghalc and Andrew Forbesa, b aCSIR National Laser Centre, P.O. Box 395, Pretoria 0001, South Africa bSchool of Physics, University of KwaZulu-Natal, Private Bag... problems. In this context, we demonstrate a method of multiplexing laser modes using spatial light modulators (SLMs). In our proposed technique, we use Laguerre Gaussian (LG) modes, which form a complete basis set; hence multi-mode masks can be created...

Simple Multiplexing Hand-Held Control Unit

Science.gov (United States)

Hannaford, Blake

1989-01-01

Multiplexer consists of series of resistors, each shunted by single-pole, single-throw switch. User operates switches by pressing buttons or squeezing triggers. Prototype includes three switches operated successfully in over 200 hours of system operations. Number of switches accommodated determined by signal-to-noise ratio of current source, noise induced in control unit and cable, and number of bits in output of analog-to-digital converter. Because many computer-contolled robots have extra analog-to-digital channels, such multiplexer added at little extra cost.

Effects of temporal correlations in social multiplex networks.

Science.gov (United States)

Starnini, Michele; Baronchelli, Andrea; Pastor-Satorras, Romualdo

2017-08-17

Multi-layered networks represent a major advance in the description of natural complex systems, and their study has shed light on new physical phenomena. Despite its importance, however, the role of the temporal dimension in their structure and function has not been investigated in much detail so far. Here we study the temporal correlations between layers exhibited by real social multiplex networks. At a basic level, the presence of such correlations implies a certain degree of predictability in the contact pattern, as we quantify by an extension of the entropy and mutual information analyses proposed for the single-layer case. At a different level, we demonstrate that temporal correlations are a signature of a 'multitasking' behavior of network agents, characterized by a higher level of switching between different social activities than expected in a uncorrelated pattern. Moreover, temporal correlations significantly affect the dynamics of coupled epidemic processes unfolding on the network. Our work opens the way for the systematic study of temporal multiplex networks and we anticipate it will be of interest to researchers in a broad array of fields.

A monolithic charge multiplexer with 0.5% accuracy

International Nuclear Information System (INIS)

Lewis, J.; McPherson, G.M.; Morrissey, M.C.; Thompson, J.C.; Tucker, A.W.

1990-01-01

This paper describes a 16 channel monolithic charge multiplexer providing a close tolerance, low cost, low power solution to the problem of handling the signals from detectors with large numbers of channels. Outputs may be wire-orred to increase the degree of multiplexing. A system designed with this chip and with suitable close tolerance processing downstream will have a gain match of ±0.5% and a front end chip cost of approximately $1 per channel. The chip is fabricated in CMOS technology and the test of a 1500 channel system has demonstrated the feasibility of CMOS in this context. The chip produces a prompt sum of the charges from the 16 signal sources and integrates and stores the individual charges for later serial readout. A single network provides amplifier bias and releases area to facilitate optimum noise performance and signal handling. Amplifier and bias network design together with p-well screens to isolate storage capacitors from the substrate provide the power line rejection essential in systems generating a trigger from large numbers of channels. (orig.)

Frequency Domain Multiplexing for Use With NaI[Tl] Detectors

Science.gov (United States)

Belling, Samuel; Coherent Collaboration

2017-09-01

A process used in many forms of signal communication known as multiplexing is adapted for the purpose of combining signals from NaI[Tl] detectors so that fewer digitizer channels can be used to process the signal information from large experiments within the COHERENT collaboration. Each signal is passed through a ringing circuit to modulate it with a characteristic frequency. Information about the signal can be extracted from its amplitude, frequency, and phase. Simulations in LTSpice show that an operational amplifier circuit with a parallel LRC feedback loop can serve as the modulating circuit. Several such circuits can be constructed and housed compactly in a unit, and fed to an inverting, summing amplifier with tunable gain, such that the signals are carried by one cable. The signals are analyzed based on a Fourier transform after being digitized. The results show that the energy, channel, and time of the original interaction can be recovered by this process. In some cases it is possible through filtering and deconvolution to recover the shape of the original signal. The effort is ongoing, but with the design presented it is possible to multiplex 10 detectors into a single digitizer channel. NSF REU Program at Duke University.

Combining target enrichment with barcode multiplexing for high throughput SNP discovery

Directory of Open Access Journals (Sweden)

Lunke Sebastian

2010-11-01

Full Text Available Abstract Background The primary goal of genetic linkage analysis is to identify genes affecting a phenotypic trait. After localisation of the linkage region, efficient genetic dissection of the disease linked loci requires that functional variants are identified across the loci. These functional variations are difficult to detect due to extent of genetic diversity and, to date, incomplete cataloguing of the large number of variants present both within and between populations. Massively parallel sequencing platforms offer unprecedented capacity for variant discovery, however the number of samples analysed are still limited by cost per sample. Some progress has been made in reducing the cost of resequencing using either multiplexing methodologies or through the utilisation of targeted enrichment technologies which provide the ability to resequence genomic areas of interest rather that full genome sequencing. Results We developed a method that combines current multiplexing methodologies with a solution-based target enrichment method to further reduce the cost of resequencing where region-specific sequencing is required. Our multiplex/enrichment strategy produced high quality data with nominal reduction of sequencing depth. We undertook a genotyping study and were successful in the discovery of novel SNP alleles in all samples at uniplex, duplex and pentaplex levels. Conclusion Our work describes the successful combination of a targeted enrichment method and index barcode multiplexing to reduce costs, time and labour associated with processing large sample sets. Furthermore, we have shown that the sequencing depth obtained is adequate for credible SNP genotyping analysis at uniplex, duplex and pentaplex levels.

Microprocessorized message multiplexer

International Nuclear Information System (INIS)

Ejzman, S.; Guglielmi, L.; Jaeger, J.J.

1980-07-01

The 'Microprocessorized Message Multiplexer' is an elementary development tool used to create and debug the software of a target microprocessor (User Module: UM). It connects together four devices: a terminal, a cassette recorder, the target microprocessor and a host computer where macro and editor for the M 6800 microprocessor are resident [fr

Multiplex PCR identification of Taenia spp. in rodents and carnivores.

Science.gov (United States)

Al-Sabi, Mohammad N S; Kapel, Christian M O

2011-11-01

The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

Characterization of highly multiplexed monolithic PET / gamma camera detector modules

Science.gov (United States)

Pierce, L. A.; Pedemonte, S.; DeWitt, D.; MacDonald, L.; Hunter, W. C. J.; Van Leemput, K.; Miyaoka, R.

2018-04-01

PET detectors use signal multiplexing to reduce the total number of electronics channels needed to cover a given area. Using measured thin-beam calibration data, we tested a principal component based multiplexing scheme for scintillation detectors. The highly-multiplexed detector signal is no longer amenable to standard calibration methodologies. In this study we report results of a prototype multiplexing circuit, and present a new method for calibrating the detector module with multiplexed data. A 50 × 50 × 10 mm3 LYSO scintillation crystal was affixed to a position-sensitive photomultiplier tube with 8 × 8 position-outputs and one channel that is the sum of the other 64. The 65-channel signal was multiplexed in a resistive circuit, with 65:5 or 65:7 multiplexing. A 0.9 mm beam of 511 keV photons was scanned across the face of the crystal in a 1.52 mm grid pattern in order to characterize the detector response. New methods are developed to reject scattered events and perform depth-estimation to characterize the detector response of the calibration data. Photon interaction position estimation of the testing data was performed using a Gaussian Maximum Likelihood estimator and the resolution and scatter-rejection capabilities of the detector were analyzed. We found that using a 7-channel multiplexing scheme (65:7 compression ratio) with 1.67 mm depth bins had the best performance with a beam-contour of 1.2 mm FWHM (from the 0.9 mm beam) near the center of the crystal and 1.9 mm FWHM near the edge of the crystal. The positioned events followed the expected Beer–Lambert depth distribution. The proposed calibration and positioning method exhibited a scattered photon rejection rate that was a 55% improvement over the summed signal energy-windowing method.

High-Capacity Multi-Core Fibers for Space-Division Multiplexing

DEFF Research Database (Denmark)

Ye, Feihong

The transmission capacity of the present optical fiber communication systems based on time division multiplexing (TDM) and wavelength-division multiplexing (WDM) using single-mode fibers (SMFs) is reaching its limit of around 100 Tbit/s per fiber due to the fiber nonlinearities, fiber fuse...... phenomenon and the optical amplifier bandwidth. To meet the ever increasing global data traffic growth and to overcome the looming capacity crunch, a new multiplexing technology using new optical fibers is urgently needed. Space-division multiplexing (SDM) is a promising scheme to overcome the capacity limit...... of the present SMF-based systems. Among the proposed SDM schemes, the one based on uncoupled multi-core fibers (MCFs) having multiple cores in a mutual cladding has proven effective in substantially increasing the transmission capacity per fiber with least system complexity as demonstrated in several state...

Preliminary Assessment of Microwave Readout Multiplexing Factor

Energy Technology Data Exchange (ETDEWEB)

Croce, Mark Philip [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Koehler, Katrina Elizabeth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rabin, Michael W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Bennett, D. A. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Mates, J. A. B. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Gard, J. D. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Becker, D. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Schmidt, D. R. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Ullom, J. N. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States)

2017-01-23

Ultra-high resolution microcalorimeter gamma spectroscopy is a new non-destructive assay technology for measurement of plutonium isotopic composition, with the potential to reduce total measurement uncertainty to a level competitive with destructive analysis methods [1-4]. Achieving this level of performance in practical applications requires not only the energy resolution now routinely achieved with transition-edge sensor microcalorimeter arrays (an order of magnitude better than for germanium detectors) but also high throughput. Microcalorimeter gamma spectrometers have not yet achieved detection efficiency and count rate capability that is comparable to germanium detectors, largely because of limits from existing readout technology. Microcalorimeter detectors must be operated at low temperature to achieve their exceptional energy resolution. Although the typical 100 mK operating temperatures can be achieved with reliable, cryogen-free systems, the cryogenic complexity and heat load from individual readout channels for large sensor arrays is prohibitive. Multiplexing is required for practical systems. The most mature multiplexing technology at present is time-division multiplexing (TDM) [3, 5-6]. In TDM, the sensor outputs are switched by applying bias current to one SQUID amplifier at a time. Transition-edge sensor (TES) microcalorimeter arrays as large as 256 pixels have been developed for X-ray and gamma-ray spectroscopy using TDM technology. Due to bandwidth limits and noise scaling, TDM is limited to a maximum multiplexing factor of approximately 32-40 sensors on one readout line [8]. Increasing the size of microcalorimeter arrays above the kilopixel scale, required to match the throughput of germanium detectors, requires the development of a new readout technology with a much higher multiplexing factor.

Coherence Multiplex System Topologies

NARCIS (Netherlands)

Meijerink, Arjan; Taniman, R.O.; Heideman, G.H.L.M.; van Etten, Wim

2007-01-01

Coherence multiplexing is a potentially inexpensive form of optical code-division multiple access, which is particularly suitable for short-range applications with moderate bandwidth requirements, such as access networks, LANs, or interconnects. Various topologies are known for constructing an

Automation and integration of multiplexed on-line sample preparation with capillary electrophoresis for DNA sequencing

Energy Technology Data Exchange (ETDEWEB)

Tan, H.

1999-03-31

The purpose of this research is to develop a multiplexed sample processing system in conjunction with multiplexed capillary electrophoresis for high-throughput DNA sequencing. The concept from DNA template to called bases was first demonstrated with a manually operated single capillary system. Later, an automated microfluidic system with 8 channels based on the same principle was successfully constructed. The instrument automatically processes 8 templates through reaction, purification, denaturation, pre-concentration, injection, separation and detection in a parallel fashion. A multiplexed freeze/thaw switching principle and a distribution network were implemented to manage flow direction and sample transportation. Dye-labeled terminator cycle-sequencing reactions are performed in an 8-capillary array in a hot air thermal cycler. Subsequently, the sequencing ladders are directly loaded into a corresponding size-exclusion chromatographic column operated at {approximately} 60 C for purification. On-line denaturation and stacking injection for capillary electrophoresis is simultaneously accomplished at a cross assembly set at {approximately} 70 C. Not only the separation capillary array but also the reaction capillary array and purification columns can be regenerated after every run. DNA sequencing data from this system allow base calling up to 460 bases with accuracy of 98%.

Towards Multiplex Molecular Diagnosis—A Review of Microfluidic Genomics Technologies

Directory of Open Access Journals (Sweden)

Ismail Hussain Kamal Basha

2017-08-01

Full Text Available Highly sensitive and specific pathogen diagnosis is essential for correct and timely treatment of infectious diseases, especially virulent strains, in people. Point-of-care pathogen diagnosis can be a tremendous help in managing disease outbreaks as well as in routine healthcare settings. Infectious pathogens can be identified with high specificity using molecular methods. A plethora of microfluidic innovations in recent years have now made it increasingly feasible to develop portable, robust, accurate, and sensitive genomic diagnostic devices for deployment at the point of care. However, improving processing time, multiplexed detection, sensitivity and limit of detection, specificity, and ease of deployment in resource-limited settings are ongoing challenges. This review outlines recent techniques in microfluidic genomic diagnosis and devices with a focus on integrating them into a lab on a chip that will lead towards the development of multiplexed point-of-care devices of high sensitivity and specificity.

Mode-multiplexed transmission over conventional graded-index multimode fibers

NARCIS (Netherlands)

Ryf, R.; Fontaine, N.K.; Chen, H.; Guan, B.; Huang, B.; Esmaeelpour, M.; Gnauck, A.H.; Randel, S.; Yoo, S.J.B.; Koonen, A.M.J.; Shubochkin, R.; Sun, Yi; Lingle, R.

2015-01-01

We present experimental results for combined mode-multiplexed and wavelength multiplexed transmission over conventional graded-index multimode fibers. We use mode-selective photonic lanterns as mode couplers to precisely excite a subset of the modes of the multimode fiber and additionally to

Multiplex editing system

DEFF Research Database (Denmark)

2015-01-01

The present invention relates to a multiplex editing system. The system allows multiple editing of nucleic acid sequences such as genomic sequences, such as knockins of genes of interest in a genome, knockouts of genomic sequences and/or allele replacement. Also provided herein are a method...... for editing nucleic acids and a cell comprising a stably integrated endonuclease....

Conditions for Viral Influence Spreading through Multiplex Correlated Social Networks

Science.gov (United States)

Hu, Yanqing; Havlin, Shlomo; Makse, Hernán A.

2014-04-01

A fundamental problem in network science is to predict how certain individuals are able to initiate new networks to spring up "new ideas." Frequently, these changes in trends are triggered by a few innovators who rapidly impose their ideas through "viral" influence spreading, producing cascades of followers and fragmenting an old network to create a new one. Typical examples include the rise of scientific ideas or abrupt changes in social media, like the rise of Facebook to the detriment of Myspace. How this process arises in practice has not been conclusively demonstrated. Here, we show that a condition for sustaining a viral spreading process is the existence of a multiplex-correlated graph with hidden "influence links." Analytical solutions predict percolation-phase transitions, either abrupt or continuous, where networks are disintegrated through viral cascades of followers, as in empirical data. Our modeling predicts the strict conditions to sustain a large viral spreading via a scaling form of the local correlation function between multilayers, which we also confirm empirically. Ultimately, the theory predicts the conditions for viral cascading in a large class of multiplex networks ranging from social to financial systems and markets.

Microwave multiplex readout for superconducting sensors

Energy Technology Data Exchange (ETDEWEB)

Ferri, E., E-mail: elena.ferri@mib.infn.it [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Becker, D.; Bennett, D. [NIST, Boulder, CO (United States); Faverzani, M. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Fowler, J.; Gard, J. [NIST, Boulder, CO (United States); Giachero, A. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Hays-Wehle, J.; Hilton, G. [NIST, Boulder, CO (United States); Maino, M. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Mates, J. [NIST, Boulder, CO (United States); Puiu, A.; Nucciotti, A. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Reintsema, C.; Schmidt, D.; Swetz, D.; Ullom, J.; Vale, L. [NIST, Boulder, CO (United States)

2016-07-11

The absolute neutrino mass scale is still an outstanding challenge in both particle physics and cosmology. The calorimetric measurement of the energy released in a nuclear beta decay is a powerful tool to determine the effective electron-neutrino mass. In the last years, the progress on low temperature detector technologies has allowed to design large scale experiments aiming at pushing down the sensitivity on the neutrino mass below 1 eV. Even with outstanding performances in both energy (~ eV on keV) and time resolution (~ 1 μs) on the single channel, a large number of detectors working in parallel is required to reach a sub-eV sensitivity. Microwave frequency domain readout is the best available technique to readout large array of low temperature detectors, such as Transition Edge Sensors (TESs) or Microwave Kinetic Inductance Detectors (MKIDs). In this way a multiplex factor of the order of thousands can be reached, limited only by the bandwidth of the available commercial fast digitizers. This microwave multiplexing system will be used to readout the HOLMES detectors, an array of 1000 microcalorimeters based on TES sensors in which the {sup 163}Ho will be implanted. HOLMES is a new experiment for measuring the electron neutrino mass by means of the electron capture (EC) decay of {sup 163}Ho. We present here the microwave frequency multiplex which will be used in the HOLMES experiment and the microwave frequency multiplex used to readout the MKID detectors developed in Milan as well.

Control of Angular Intervals for Angle-Multiplexed Holographic Memory

Science.gov (United States)

Kinoshita, Nobuhiro; Muroi, Tetsuhiko; Ishii, Norihiko; Kamijo, Koji; Shimidzu, Naoki

2009-03-01

In angle-multiplexed holographic memory, the full width at half maximum of the Bragg selectivity curves is dependent on the angle formed between the medium and incident laser beams. This indicates the possibility of high density and high multiplexing number by varying the angular intervals between adjacent holograms. We propose an angular interval scheduling for closely stacking holograms into medium even when the angle range is limited. We obtained bit error rates of the order of 10-4 under the following conditions: medium thickness of 1 mm, laser beam wavelength of 532 nm, and angular multiplexing number of 300.

Demonstration of Time Domain Multiplexed Readout for Magnetically Coupled Calorimeters

Science.gov (United States)

Porst, J.-P.; Adams, J. S.; Balvin, M.; Bandler, S.; Beyer, J.; Busch, S. E.; Drung, D.; Seidel, G. M.; Smith, S. J.; Stevenson, T. R.

2012-01-01

Magnetically coupled calorimeters (MCC) have extremely high potential for x-ray applications due to the inherent high energy resolution capability and being non-dissipative. Although very high energy-resolution has been demonstrated, until now there has been no demonstration of multiplexed read-out. We report on the first realization of a time domain multiplexed (TDM) read-out. While this has many similarities with TDM of transition-edge-sensors (TES), for MGGs the energy resolution is limited by the SQUID read-out noise and requires the well established scheme to be altered in order to minimize degradation due to noise aliasing effects. In cur approach, each pixel is read out by a single first stage SQUID (SQ1) that is operated in open loop. The outputs of the SQ1 s are low-pass filtered with an array of low cross-talk inductors, then fed into a single-stage SQUID TD multiplexer. The multiplexer is addressed from room temperature and read out through a single amplifier channel. We present results achieved with a new detector platform. Noise performance is presented and compared to expectations. We have demonstrated multiplexed X-ray spectroscopy at 5.9keV with delta_FWHM=10eV. In an optimized setup, we show it is possible to multiplex 32 detectors without significantly degrading the Intrinsic detector resolution.

Multiplexing of spatial modes in the mid-IR region

Science.gov (United States)

Gailele, Lucas; Maweza, Loyiso; Dudley, Angela; Ndagano, Bienvenu; Rosales-Guzman, Carmelo; Forbes, Andrew

2017-02-01

Traditional optical communication systems optimize multiplexing in polarization and wavelength both trans- mitted in fiber and free-space to attain high bandwidth data communication. Yet despite these technologies, we are expected to reach a bandwidth ceiling in the near future. Communications using orbital angular momentum (OAM) carrying modes offers infinite dimensional states, providing means to increase link capacity by multiplexing spatially overlapping modes in both the azimuthal and radial degrees of freedom. OAM modes are multiplexed and de-multiplexed by the use of spatial light modulators (SLM). Implementation of complex amplitude modulation is employed on laser beams phase and amplitude to generate Laguerre-Gaussian (LG) modes. Modal decomposition is employed to detect these modes due to their orthogonality as they propagate in space. We demonstrate data transfer by sending images as a proof-of concept in a lab-based scheme. We demonstrate the creation and detection of OAM modes in the mid-IR region as a precursor to a mid-IR free-space communication link.

Spatially Multiplexed Micro-Spectrophotometry in Bright Field Mode for Thin Film Characterization

Directory of Open Access Journals (Sweden)

Valerio Pini

2016-06-01

Full Text Available Thickness characterization of thin films is of primary importance in a variety of nanotechnology applications, either in the semiconductor industry, quality control in nanofabrication processes or engineering of nanoelectromechanical systems (NEMS because small thickness variability can strongly compromise the device performance. Here, we present an alternative optical method in bright field mode called Spatially Multiplexed Micro-Spectrophotometry that allows rapid and non-destructive characterization of thin films over areas of mm2 and with 1 μm of lateral resolution. We demonstrate an accuracy of 0.1% in the thickness characterization through measurements performed on four microcantilevers that expand an area of 1.8 mm2 in one minute of analysis time. The measured thickness variation in the range of few tens of nm translates into a mechanical variability that produces an error of up to 2% in the response of the studied devices when they are used to measure surface stress variations.

Determinants of public cooperation in multiplex networks

Science.gov (United States)

Battiston, Federico; Perc, Matjaž; Latora, Vito

2017-07-01

Synergies between evolutionary game theory and statistical physics have significantly improved our understanding of public cooperation in structured populations. Multiplex networks, in particular, provide the theoretical framework within network science that allows us to mathematically describe the rich structure of interactions characterizing human societies. While research has shown that multiplex networks may enhance the resilience of cooperation, the interplay between the overlap in the structure of the layers and the control parameters of the corresponding games has not yet been investigated. With this aim, we consider here the public goods game on a multiplex network, and we unveil the role of the number of layers and the overlap of links, as well as the impact of different synergy factors in different layers, on the onset of cooperation. We show that enhanced public cooperation emerges only when a significant edge overlap is combined with at least one layer being able to sustain some cooperation by means of a sufficiently high synergy factor. In the absence of either of these conditions, the evolution of cooperation in multiplex networks is determined by the bounds of traditional network reciprocity with no enhanced resilience. These results caution against overly optimistic predictions that the presence of multiple social domains may in itself promote cooperation, and they help us better understand the complexity behind prosocial behavior in layered social systems.

Low-latency optical parallel adder based on a binary decision diagram with wavelength division multiplexing scheme

Science.gov (United States)

Shinya, A.; Ishihara, T.; Inoue, K.; Nozaki, K.; Kita, S.; Notomi, M.

2018-02-01

We propose an optical parallel adder based on a binary decision diagram that can calculate simply by propagating light through electrically controlled optical pass gates. The CARRY and CARRY operations are multiplexed in one circuit by a wavelength division multiplexing scheme to reduce the number of optical elements, and only a single gate constitutes the critical path for one digit calculation. The processing time reaches picoseconds per digit when we use a 100-μm-long optical path gates, which is ten times faster than a CMOS circuit.

Cavity-enhanced eigenmode and angular hybrid multiplexing in holographic data storage systems.

Science.gov (United States)

Miller, Bo E; Takashima, Yuzuru

2016-12-26

Resonant optical cavities have been demonstrated to improve energy efficiencies in Holographic Data Storage Systems (HDSS). The orthogonal reference beams supported as cavity eigenmodes can provide another multiplexing degree of freedom to push storage densities toward the limit of 3D optical data storage. While keeping the increased energy efficiency of a cavity enhanced reference arm, image bearing holograms are multiplexed by orthogonal phase code multiplexing via Hermite-Gaussian eigenmodes in a Fe:LiNbO3 medium with a 532 nm laser at two Bragg angles. We experimentally confirmed write rates are enhanced by an average factor of 1.1, and page crosstalk is about 2.5%. This hybrid multiplexing opens up a pathway to increase storage density while minimizing modification of current angular multiplexing HDSS.

Epidemic spreading with activity-driven awareness diffusion on multiplex network.

Science.gov (United States)

Guo, Quantong; Lei, Yanjun; Jiang, Xin; Ma, Yifang; Huo, Guanying; Zheng, Zhiming

2016-04-01

There has been growing interest in exploring the interplay between epidemic spreading with human response, since it is natural for people to take various measures when they become aware of epidemics. As a proper way to describe the multiple connections among people in reality, multiplex network, a set of nodes interacting through multiple sets of edges, has attracted much attention. In this paper, to explore the coupled dynamical processes, a multiplex network with two layers is built. Specifically, the information spreading layer is a time varying network generated by the activity driven model, while the contagion layer is a static network. We extend the microscopic Markov chain approach to derive the epidemic threshold of the model. Compared with extensive Monte Carlo simulations, the method shows high accuracy for the prediction of the epidemic threshold. Besides, taking different spreading models of awareness into consideration, we explored the interplay between epidemic spreading with awareness spreading. The results show that the awareness spreading can not only enhance the epidemic threshold but also reduce the prevalence of epidemics. When the spreading of awareness is defined as susceptible-infected-susceptible model, there exists a critical value where the dynamical process on the awareness layer can control the onset of epidemics; while if it is a threshold model, the epidemic threshold emerges an abrupt transition with the local awareness ratio α approximating 0.5. Moreover, we also find that temporal changes in the topology hinder the spread of awareness which directly affect the epidemic threshold, especially when the awareness layer is threshold model. Given that the threshold model is a widely used model for social contagion, this is an important and meaningful result. Our results could also lead to interesting future research about the different time-scales of structural changes in multiplex networks.

Epidemic spreading with activity-driven awareness diffusion on multiplex network

Science.gov (United States)

Guo, Quantong; Lei, Yanjun; Jiang, Xin; Ma, Yifang; Huo, Guanying; Zheng, Zhiming

2016-04-01

There has been growing interest in exploring the interplay between epidemic spreading with human response, since it is natural for people to take various measures when they become aware of epidemics. As a proper way to describe the multiple connections among people in reality, multiplex network, a set of nodes interacting through multiple sets of edges, has attracted much attention. In this paper, to explore the coupled dynamical processes, a multiplex network with two layers is built. Specifically, the information spreading layer is a time varying network generated by the activity driven model, while the contagion layer is a static network. We extend the microscopic Markov chain approach to derive the epidemic threshold of the model. Compared with extensive Monte Carlo simulations, the method shows high accuracy for the prediction of the epidemic threshold. Besides, taking different spreading models of awareness into consideration, we explored the interplay between epidemic spreading with awareness spreading. The results show that the awareness spreading can not only enhance the epidemic threshold but also reduce the prevalence of epidemics. When the spreading of awareness is defined as susceptible-infected-susceptible model, there exists a critical value where the dynamical process on the awareness layer can control the onset of epidemics; while if it is a threshold model, the epidemic threshold emerges an abrupt transition with the local awareness ratio α approximating 0.5. Moreover, we also find that temporal changes in the topology hinder the spread of awareness which directly affect the epidemic threshold, especially when the awareness layer is threshold model. Given that the threshold model is a widely used model for social contagion, this is an important and meaningful result. Our results could also lead to interesting future research about the different time-scales of structural changes in multiplex networks.

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Multiplexed Detection of Attomoles of Nucleic Acids Using Fluorescent Nanoparticle Counting Platform.

Science.gov (United States)

Pei, Xiaojing; Yin, Haoyan; Lai, Tiancheng; Zhang, Junlong; Liu, Feng; Xu, Xiao; Li, Na

2018-01-16

The sensitive multiplexed detection of nucleic acids in a single sample by a simple manner is of pivotal importance for the diagnosis and therapy of human diseases. Herein, we constructed an automatic fluorescent nanoparticle (FNP) counting platform with a common fluorescence microscopic imaging setup for nonamplification multiplexed detection of attomoles of nucleic acids. Taking the advantages of the highly bright, multicolor emitting FNPs and magnetic separation, the platform enables sensitive multiplexed detection without the need for extra fluorescent labels. Quantification for multiplex DNAs, multiplex microRNAs (miRNA), as well as a DNA and miRNA mixture was achieved with a similar dynamic range, a limit of detection down to 5 amol (5 μL detection volume), and a 81-115% spike recovery from different biological sample matrices. In particular, the sensitivity for multiplex miRNA is by far among the highest without using amplification or the lock nucleic acid hybridization enhancement strategy. Results regarding miRNA-141 from four different cell lines were agreeable with those of the quantitative reverse transcription polymerase chain reaction. Simultaneous detection of miRNA-141 and miRNA-21 in four different cell lines yielded consistent results with publications, indicating the potential for monitoring multiplex miRNA expression associated with the collaborative regulation of important cellular events. This work expands the rule set of multiplex nucleic acid detection strategies and shows promising potential application in clinical diagnosis.

Investigation into constant envelope orthogonal frequency division multiplexing for polarization-division multiplexing coherent optical communication

Science.gov (United States)

Li, Yupeng; Ding, Ding

2017-09-01

Benefiting from the high spectral efficiency and low peak-to-average power ratio, constant envelope orthogonal frequency division multiplexing (OFDM) is a promising technique in coherent optical communication. Polarization-division multiplexing (PDM) has been employed as an effective way to double the transmission capacity in the commercial 100 Gb/s PDM-QPSK system. We investigated constant envelope OFDM together with PDM. Simulation results show that the acceptable maximum launch power into the fiber improves 10 and 6 dB for 80- and 320-km transmission, respectively (compared with the conventional PDM OFDM system). The maximum reachable distance of the constant envelope OFDM system is able to reach 800 km, and even 1200 km is reachable if an ideal erbium doped fiber amplifier is employed.

M.U.M.M. - a micro-controlled universal message multiplexer

CERN Document Server

Fontaine, G; Jaeger, J J; Szafran, S

1981-01-01

Based on the Motorola 6800, this multiplexer is designed to provide a microprocessor development tool in the specific environment of a high- energy physics laboratory. The basic philosophy of this device is to allow communication of a target (prototype) processor with a host computer under control of a human operator. The host can be an experimental online computer or any remote machine with a time-sharing network. It is thus possible to speed up design and debugging of a physics application program by taking advantage of the sophisticated resources usually available in a computer centre (powerful editor, large disk space, source management via 'Patchy', etc.). In addition to the classical cross-macroassembler, a loader is available on the host for down-line loading binary code, via the multiplexer, into the prototype memory. Such a scheme is easily extended to the communication of any host interactive processing program with a data acquisition microprocessor, and provides the latter with a convenient and eas...

Experimental demonstration of subcarrier multiplexed quantum key distribution system.

Science.gov (United States)

Mora, José; Ruiz-Alba, Antonio; Amaya, Waldimar; Martínez, Alfonso; García-Muñoz, Víctor; Calvo, David; Capmany, José

2012-06-01

We provide, to our knowledge, the first experimental demonstration of the feasibility of sending several parallel keys by exploiting the technique of subcarrier multiplexing (SCM) widely employed in microwave photonics. This approach brings several advantages such as high spectral efficiency compatible with the actual secure key rates, the sharing of the optical fainted pulse by all the quantum multiplexed channels reducing the system complexity, and the possibility of upgrading with wavelength division multiplexing in a two-tier scheme, to increase the number of parallel keys. Two independent quantum SCM channels featuring a sifted key rate of 10 Kb/s/channel over a link with quantum bit error rate <2% is reported.

76 FR 71982 - Advancing Regulatory Science for Highly Multiplexed Microbiology/Medical Countermeasure Devices...

Science.gov (United States)

2011-11-21

... Multiplexed Microbiology Devices: Their clinical application and public health/clinical needs; inclusion of...] Advancing Regulatory Science for Highly Multiplexed Microbiology/ Medical Countermeasure Devices; Public... Multiplexed Microbiology/ Medical Countermeasure Devices'' that published in the Federal Register of August 8...

Turbulence mitigation scheme based on spatial diversity in orbital-angular-momentum multiplexed system

Science.gov (United States)

Zou, Li; Wang, Le; Zhao, Shengmei

2017-10-01

Atmospheric turbulence (AT) induced crosstalk can significantly impair the performance of free-space optical (FSO) communication link using orbital angular momentum (OAM) multiplexing. In this paper, we propose a spatial diversity (SD) turbulence mitigation scheme in an OAM-multiplexed FSO communication link. First, we present a SD mitigation model for the OAM-multiplexed FSO communication link under AT. Then we present a SD combining technique based on equal gain to enhance AT tolerance of the OAM-multiplexed FSO communication link. The numerical results show that performance of the OAM-multiplexed communication link has greatly improved by the proposed scheme. When the turbulence strength Cn2 is 5 × 10-15m - 2 / 3, the transmission distance is 1000 m and the channel signal-to-noise ratio (SNR) is 20 dB, the bit-error-rate (BER) performance of four spatial multiplexed OAM modes lm = + 1 , + 2 , + 3 , + 4 are 3 fold increase in comparison with those results without the proposed scheme. The proposed scheme is a promising direction for compensating the interference caused by AT in the OAM-multiplexed FSO communication link.

Performance modeling, loss networks, and statistical multiplexing

CERN Document Server

Mazumdar, Ravi

2009-01-01

This monograph presents a concise mathematical approach for modeling and analyzing the performance of communication networks with the aim of understanding the phenomenon of statistical multiplexing. The novelty of the monograph is the fresh approach and insights provided by a sample-path methodology for queueing models that highlights the important ideas of Palm distributions associated with traffic models and their role in performance measures. Also presented are recent ideas of large buffer, and many sources asymptotics that play an important role in understanding statistical multiplexing. I

Surface Energy and Setting Process of Contacting Surfaces

Directory of Open Access Journals (Sweden)

M. V. Musokhranov

2014-01-01

Full Text Available The paper deals with a challenge in terms of ensuring an accuracy of the relative position of the conjugated surfaces that is to determine a coefficient of friction. To solve it, there is a proposal to use the surface energy, as a tool that influences the contacting parts nature. Presently, energy of the surface layers at best is only stated, but not used in practice.Analysis of the conditions of interaction between two contacting surfaces, such as seizing and setting cannot be explained only from the position of the roughness parameters. It is found that these phenomena are explained by the appearing gripe (setting bridges, which result from the energy of interaction between two or more adjacent surfaces. The emerging phenomenon such as micro welding, i.e. occurring bonds, is caused by the overflow of energy, according to the theory of physics, from the surface with a high level of energy to the surface with the smaller one to balance the system as a whole.The paper shows that through the use of process, controlling the depth of the surface layer and creating a certain structure, the energy level of the material as a whole can be specified. And this will allow us to provide the necessary performance and mechanical properties. It means to create as many gripe bridges as possible to ensure continuous positioning i.e. a fixed connection of the contacting surfaces.It was determined that to increase a value of the friction coefficient, the physical and mechanical properties of the surface layer of the parts material must be taken into account, namely, in the part body accumulate the energy to be consumed for forming the surface.The paper gives recommendations for including the parts of the surface energy in the qualitative indicators of characteristics. This will make a technologist, when routing a process, to choose such operations and modes to provide the designer-specified parameters not only of the accuracy and surface finish, but also of the

Multiplexed CRISPR/Cas9 Genome Editing and Gene Regulation Using Csy4 in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Ferreira, Raphael; Skrekas, Christos; Nielsen, Jens

2018-01-01

Clustered regularly interspaced short palindromic repeats (CRISPR) technology has greatly accelerated the field of strain engineering. However, insufficient efforts have been made toward developing robust multiplexing tools in Saccharomyces cerevisiae. Here, we exploit the RNA processing capacity...

Earth Surface Processes, Landforms and Sediment Deposits

Science.gov (United States)

Bridge, John; Demicco, Robert

Earth surface processes, landforms and sediment deposits are intimately related - involving erosion of rocks, generation of sediment, and transport and deposition of sediment through various Earth surface environments. These processes, and the landforms and deposits that they generate, have a fundamental bearing on engineering, environmental and public safety issues; on recovery of economic resources; and on our understanding of Earth history. This unique textbook brings together the traditional disciplines of sedimentology and geomorphology to explain Earth surface processes, landforms and sediment deposits in a comprehensive and integrated way. It is the ideal resource for a two-semester course in sedimentology, stratigraphy, geomorphology, and Earth surface processes from the intermediate undergraduate to beginning graduate level. The book is also accompanied by a website hosting illustrations and material on field and laboratory methods for measuring, describing and analyzing Earth surface processes, landforms and sediments.

Penalty-free transmission at 10 Gbit/s through 40 cascaded 1-nm arrayed waveguide multiplexers

DEFF Research Database (Denmark)

Nissov, Morten; Jørgensen, Bo Foged; Pedersen, Rune Johan Skullerud

1997-01-01

Cascaded optical add-drop multiplexers (OADM) and optical cross connects (OXC) are key components in optical wavelength-division multiplex networks. OADMs with filtering of the passing signals and OXCs can be constructed by the use of wavelength-division multiplexers. Cascadability of multiplexers...

Surface studies of plasma processed Nb samples

International Nuclear Information System (INIS)

Tyagi, Puneet V.; Doleans, Marc; Hannah, Brian S.; Afanador, Ralph; Stewart, Stephen; Mammosser, John; Howell, Matthew P; Saunders, Jeffrey W; Degraff, Brian D; Kim, Sang-Ho

2015-01-01

Contaminants present at top surface of superconducting radio frequency (SRF) cavities can act as field emitters and restrict the cavity accelerating gradient. A room temperature in-situ plasma processing technology for SRF cavities aiming to clean hydrocarbons from inner surface of cavities has been recently developed at the Spallation Neutron Source (SNS). Surface studies of the plasma-processed Nb samples by Secondary ion mass spectrometry (SIMS) and Scanning Kelvin Probe (SKP) showed that the NeO_2 plasma processing is very effective to remove carbonaceous contaminants from top surface and improves the surface work function by 0.5 to 1.0 eV.

Super-multiplex vibrational imaging

Science.gov (United States)

Wei, Lu; Chen, Zhixing; Shi, Lixue; Long, Rong; Anzalone, Andrew V.; Zhang, Luyuan; Hu, Fanghao; Yuste, Rafael; Cornish, Virginia W.; Min, Wei

2017-04-01

The ability to visualize directly a large number of distinct molecular species inside cells is increasingly essential for understanding complex systems and processes. Even though existing methods have successfully been used to explore structure-function relationships in nervous systems, to profile RNA in situ, to reveal the heterogeneity of tumour microenvironments and to study dynamic macromolecular assembly, it remains challenging to image many species with high selectivity and sensitivity under biological conditions. For instance, fluorescence microscopy faces a ‘colour barrier’, owing to the intrinsically broad (about 1,500 inverse centimetres) and featureless nature of fluorescence spectra that limits the number of resolvable colours to two to five (or seven to nine if using complicated instrumentation and analysis). Spontaneous Raman microscopy probes vibrational transitions with much narrower resonances (peak width of about 10 inverse centimetres) and so does not suffer from this problem, but weak signals make many bio-imaging applications impossible. Although surface-enhanced Raman scattering offers high sensitivity and multiplicity, it cannot be readily used to image specific molecular targets quantitatively inside live cells. Here we use stimulated Raman scattering under electronic pre-resonance conditions to image target molecules inside living cells with very high vibrational selectivity and sensitivity (down to 250 nanomolar with a time constant of 1 millisecond). We create a palette of triple-bond-conjugated near-infrared dyes that each displays a single peak in the cell-silent Raman spectral window; when combined with available fluorescent probes, this palette provides 24 resolvable colours, with the potential for further expansion. Proof-of-principle experiments on neuronal co-cultures and brain tissues reveal cell-type-dependent heterogeneities in DNA and protein metabolism under physiological and pathological conditions, underscoring the

Orbital Angular Momentum Multiplexing over Visible Light Communication Systems

Science.gov (United States)

Tripathi, Hardik Rameshchandra

This thesis proposes and explores the possibility of using Orbital Angular Momentum multiplexing in Visible Light Communication system. Orbital Angular Momentum is mainly applied for laser and optical fiber transmissions, while Visible Light Communication is a technology using the light as a carrier for wireless communication. In this research, the study of the state of art and experiments showing some results on multiplexing based on Orbital Angular Momentum over Visible Light Communication system were done. After completion of the initial stage; research work and simulations were performed on spatial multiplexing over Li-Fi channel modeling. Simulation scenarios which allowed to evaluate the Signal-to-Noise Ratio, Received Power Distribution, Intensity and Illuminance were defined and developed.

A time-multiplexed track-trigger for the CMS HL-LHC upgrade

Energy Technology Data Exchange (ETDEWEB)

Hall, G., E-mail: g.hall@imperial.ac.uk

2016-07-11

A new CMS Tracker is under development for operation at the High Luminosity LHC from 2025. It includes an outer tracker based on special modules of two different types which will construct track stubs using spatially coincident clusters in two closely spaced sensor layers, to reject low transverse momentum track hits and reduce the data volume before data transmission to the Level-1 trigger. The tracker data will be used to reconstruct track segments in dedicated processors before onward transmission to other trigger processors which will combine tracker information with data originating from the calorimeter and muon detectors, to make the final L1 trigger decision. The architecture for processing the tracker data outside the detector is under study, using several alternative approaches. One attractive possibility is to exploit a Time Multiplexed design similar to the one which is currently being implemented in the CMS calorimeter trigger as part of the Phase I trigger upgrade. The novel Time Multiplexed Trigger concept is explained, the potential benefits for processing future tracker data are described and a feasible design based on currently existing hardware is outlined.

Time-varying multiplex network: Intralayer and interlayer synchronization

Science.gov (United States)

Rakshit, Sarbendu; Majhi, Soumen; Bera, Bidesh K.; Sinha, Sudeshna; Ghosh, Dibakar

2017-12-01

A large class of engineered and natural systems, ranging from transportation networks to neuronal networks, are best represented by multiplex network architectures, namely a network composed of two or more different layers where the mutual interaction in each layer may differ from other layers. Here we consider a multiplex network where the intralayer coupling interactions are switched stochastically with a characteristic frequency. We explore the intralayer and interlayer synchronization of such a time-varying multiplex network. We find that the analytically derived necessary condition for intralayer and interlayer synchronization, obtained by the master stability function approach, is in excellent agreement with our numerical results. Interestingly, we clearly find that the higher frequency of switching links in the layers enhances both intralayer and interlayer synchrony, yielding larger windows of synchronization. Further, we quantify the resilience of synchronous states against random perturbations, using a global stability measure based on the concept of basin stability, and this reveals that intralayer coupling strength is most crucial for determining both intralayer and interlayer synchrony. Lastly, we investigate the robustness of interlayer synchronization against a progressive demultiplexing of the multiplex structure, and we find that for rapid switching of intralayer links, the interlayer synchronization persists even when a large number of interlayer nodes are disconnected.

Superhydrophobic surfaces by electrochemical processes.

Science.gov (United States)

Darmanin, Thierry; Taffin de Givenchy, Elisabeth; Amigoni, Sonia; Guittard, Frederic

2013-03-13

This review is an exhaustive representation of the electrochemical processes reported in the literature to produce superhydrophobic surfaces. Due to the intensive demand in the elaboration of superhydrophobic materials using low-cost, reproducible and fast methods, the use of strategies based on electrochemical processes have exponentially grown these last five years. These strategies are separated in two parts: the oxidation processes, such as oxidation of metals in solution, the anodization of metals or the electrodeposition of conducting polymers, and the reduction processed such as the electrodeposition of metals or the galvanic deposition. One of the main advantages of the electrochemical processes is the relative easiness to produce various surface morphologies and a precise control of the structures at a micro- or a nanoscale. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A multiplex PCR for detection of six viruses in ducks.

Science.gov (United States)

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

The new challenges of multiplex networks: Measures and models

Science.gov (United States)

Battiston, Federico; Nicosia, Vincenzo; Latora, Vito

2017-02-01

What do societies, the Internet, and the human brain have in common? They are all examples of complex relational systems, whose emerging behaviours are largely determined by the non-trivial networks of interactions among their constituents, namely individuals, computers, or neurons, rather than only by the properties of the units themselves. In the last two decades, network scientists have proposed models of increasing complexity to better understand real-world systems. Only recently we have realised that multiplexity, i.e. the coexistence of several types of interactions among the constituents of a complex system, is responsible for substantial qualitative and quantitative differences in the type and variety of behaviours that a complex system can exhibit. As a consequence, multilayer and multiplex networks have become a hot topic in complexity science. Here we provide an overview of some of the measures proposed so far to characterise the structure of multiplex networks, and a selection of models aiming at reproducing those structural properties and quantifying their statistical significance. Focusing on a subset of relevant topics, this brief review is a quite comprehensive introduction to the most basic tools for the analysis of multiplex networks observed in the real-world. The wide applicability of multiplex networks as a framework to model complex systems in different fields, from biology to social sciences, and the colloquial tone of the paper will make it an interesting read for researchers working on both theoretical and experimental analysis of networked systems.

A channel multiplexing for the analog input channel of the advantech PCL-718 ADC-12 bit by using PCLD-889 programmable ampliplexer / multiplexer board have been done

International Nuclear Information System (INIS)

Sudiyanto; Aminus, S; Sujono, Djoko; Ngatinu; Sudaryanto; Wiyana, Badi

1996-01-01

A channel multiplexing for the analog input channels of the Advantech PCL-718 ADC-12 bit by using PCLD-889 programmable Amplifier / multiplexer board have been done. The experiments have been prepared by using Turbo-C software where every PCLD-889 board multiplexes 16 differential input channels into one analog output channel, up to 10 PCLD-889 can be cascaded to expand the analog input of PCL-718 ADC-12 bit to 8 x 16 channels

Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

Science.gov (United States)

Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

2018-02-01

The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

Centrality in earthquake multiplex networks

Science.gov (United States)

Lotfi, Nastaran; Darooneh, Amir Hossein; Rodrigues, Francisco A.

2018-06-01

Seismic time series has been mapped as a complex network, where a geographical region is divided into square cells that represent the nodes and connections are defined according to the sequence of earthquakes. In this paper, we map a seismic time series to a temporal network, described by a multiplex network, and characterize the evolution of the network structure in terms of the eigenvector centrality measure. We generalize previous works that considered the single layer representation of earthquake networks. Our results suggest that the multiplex representation captures better earthquake activity than methods based on single layer networks. We also verify that the regions with highest seismological activities in Iran and California can be identified from the network centrality analysis. The temporal modeling of seismic data provided here may open new possibilities for a better comprehension of the physics of earthquakes.

Multiplex congruence network of natural numbers.

Science.gov (United States)

Yan, Xiao-Yong; Wang, Wen-Xu; Chen, Guan-Rong; Shi, Ding-Hua

2016-03-31

Congruence theory has many applications in physical, social, biological and technological systems. Congruence arithmetic has been a fundamental tool for data security and computer algebra. However, much less attention was devoted to the topological features of congruence relations among natural numbers. Here, we explore the congruence relations in the setting of a multiplex network and unveil some unique and outstanding properties of the multiplex congruence network. Analytical results show that every layer therein is a sparse and heterogeneous subnetwork with a scale-free topology. Counterintuitively, every layer has an extremely strong controllability in spite of its scale-free structure that is usually difficult to control. Another amazing feature is that the controllability is robust against targeted attacks to critical nodes but vulnerable to random failures, which also differs from ordinary scale-free networks. The multi-chain structure with a small number of chain roots arising from each layer accounts for the strong controllability and the abnormal feature. The multiplex congruence network offers a graphical solution to the simultaneous congruences problem, which may have implication in cryptography based on simultaneous congruences. Our work also gains insight into the design of networks integrating advantages of both heterogeneous and homogeneous networks without inheriting their limitations.

Characteristics of Multiplexed Grooved Nozzles for High Flow Rate Electrospray

International Nuclear Information System (INIS)

Kim, Kyoung Tae; Kim, Woo Jin; Kim, Sang Soo

2007-01-01

The electrospray operated in the cone-jet mode can generate highly charged micro droplets in an almost uniform size at flow rates. Therefore, the multiplexing system which can retain the characteristics of the cone-jet mode is inevitable for the electrospray application. This experiment reports the multiplexed grooved nozzle system with the extractor. The effects of the grooves and the extractor on the performance of the electrospray were evaluated through experiments. Using the grooved nozzle, the stable cone-jet mode can be achieved at the each groove in the grooved mode. Furthermore, the number of nozzles per unit area is increased by the extractor. The multiplexing density is 12 jets per cm 2 at 30 mm distance from the nozzle tip to the ground plate. The multiplexing system for the high flow rate electrospray is realized with the extractor which can diminish the space charge effect without sacrificing characteristics of the cone-jet mode

Functionalization of optical nanotip arrays with an electrochemical microcantilever for multiplexed DNA detection.

Science.gov (United States)

Descamps, Emeline; Duroure, Nathalie; Deiss, Frédérique; Leichlé, Thierry; Adam, Catherine; Mailley, Pascal; Aït-Ikhlef, Ali; Livache, Thierry; Nicu, Liviu; Sojic, Neso

2013-08-07

Optical nanotip arrays fabricated on etched fiber bundles were functionalized with DNA spots. Such unconventional substrates (3D and non-planar) are difficult to pattern with standard microfabrication techniques but, using an electrochemical cantilever, up to 400 spots were electrodeposited on the nanostructured optical surface in 5 min. This approach allows each spot to be addressed individually and multiplexed fluorescence detection is demonstrated. Finally, remote fluorescence detection was performed by imaging through the optical fiber bundle itself after hybridisation with the complementary sequence.

A Time-Multiplexed Track-Trigger for the CMS HL-LHC upgrade

CERN Document Server

Hall, Geoffrey

2016-01-01

A new CMS Tracker is under development for operation at the High Luminosity LHC from 2025. It includes an outer tracker based on special modules of two different types which will construct track stubs using spatially coincident clusters in two closely spaced sensor layers, to reject low transverse momentum track hits and reduce the data volume before data transmission to the Level-1 trigger. The tracker data will be used to reconstruct track segments in dedicated processors before onward transmission to other trigger processors which will combine tracker information with data originating from the calorimeter and muon detectors, to make the final L1 trigger decision. The architecture for processing the tracker data outside the detector is under study, using several alternative approaches. One attractive possibility is to exploit a Time Multiplexed design similar to the one which is currently being implemented in the CMS calorimeter trigger as part of the Phase I trigger upgrade. The novel Time Multiplexed Trig...

3-D display of magnetic resonance images by use of multiplex holography

International Nuclear Information System (INIS)

Oshita, Hiroshi; Yokoi, Shigeki; Toriwaki, Jun-ichiro; Matsuo, Michimasa.

1987-01-01

In this paper, we study the method of generating a true 3-D image from MRI multiple slices by using the multiplex holography. The purpose in our method is to display effectively the density information distributed in the 3-D space. For making a multiplex hologram any projected image in each direction from multiple slices should be computed. We study computer processing for producing images of good quality from the viewpoint of displaying the density distribution in the 3-D space clearly and discriminating lesions from normal tissues. The following two kinds of processing are studied. (1) Projection: To generate fastly projections of good quality, the following subjects are examined. 1. Computation method of density values on a projected image from an original slice image. 2. Methods for projection of multiple slices. 3. Interpolation of slices between original neighbouring slices. 4. Composition of several sets of multiple slices in different directions. (2) Image enahancement: To enhance depth feeling of slices and density values in lesions, the following methods are studied. 1. Enhancement of depth feeling by a weighted sum of slices. 2. Slice enhancement by multiplying the particular slices by weights. 3. Lesion enhancement by thresholding. 4. Lesion enhancement by operations between images with different imaging parameters. The following are the results ; projected images of the quality good enough for constructing a multiplex hologram can be obtained by the simple method proposed in this paper, using four sets of multiple slices in four different directions. The enhancement technique mentioned above was proved to be effective for improving the understandability of 3-D information. (author)

Opportunities and Challenges of Multiplex Assays: A Machine Learning Perspective.

Science.gov (United States)

Chen, Junfang; Schwarz, Emanuel

2017-01-01

Multiplex assays that allow the simultaneous measurement of multiple analytes in small sample quantities have developed into a widely used technology. Their implementation spans across multiple assay systems and can provide readouts of similar quality as the respective single-plex measures, albeit at far higher throughput. Multiplex assay systems are therefore an important element for biomarker discovery and development strategies but analysis of the derived data can face substantial challenges that may limit the possibility of identifying meaningful biological markers. This chapter gives an overview of opportunities and challenges of multiplexed biomarker analysis, in particular from the perspective of machine learning aimed at identification of predictive biological signatures.

Multiplexed lateral flow biosensors: Technological advances for radically improving point-of-care diagnoses.

Science.gov (United States)

Li, Jia; Macdonald, Joanne

2016-09-15

Lateral flow biosensors are a leading technology in point-of-care diagnostics due to their simplicity, rapidness and low cost. Their primacy in this arena continues through technological breakthroughs such as multiplexing: the detection of more than one biomarker in a single assay. Multiplexing capacity is critical for improving diagnostic efficiency, enhancing the diagnostic precision for specific diseases and reducing diagnostic cost. Here we review, for the first time, the various types and strategies employed for creating multiplexed lateral flow biosensors. These are classified into four main categories in terms of specific application or multiplexing level, namely linear, parameter, spatial and conceptual. We describe the practical applications and implications for each approach and compare their advantages and disadvantages. Importantly, multiplexing is still subject to limitations of the traditional lateral flow biosensor, such as sensitivity and specificity. However, by pushing the limitations of the traditional medium into the multiplex arena, several technological breakthroughs are emerging with novel solutions that further expand the utility of lateral flow biosensing for point-of-care applications. Copyright © 2016 Elsevier B.V. All rights reserved.

M.U.M.M. - a micro-controlled universal message multiplexer

International Nuclear Information System (INIS)

Fontaine, G.; Guglielmi, L.; Jaeger, J.J.; Szafran, S.

1981-01-01

Based on the Motorola 6800, this multiplexer is designed to provide a microprocessor development tool in the specific environment of a high energy physics laboratory. The basic philosophy of this device is to allow communication of a target (prototype) processor with a host computer under control of a human operator. The host can be an experimental on-line computer or any remote machine with a time-sharing network. It is thus possible to speed up design and debugging of a physics application program by taking advantage of the sophisticated resources usually available in a computer centre (powerful editor, large disk space, source management via 'Patchy' etc...). In addition to the classical cross-macroassembler, a loader is available on the host for down-line loading binary code, via the multiplexer, into the prototype memory. Such a scheme is easily extended to the communication of any host interactive processing program with a data acquisition microprocessor, and provides the latter with a convenient and easily portable extension of its computing power. A typical application of this mode is described in a separate paper. (orig.)

Evaluation of HOPG mounting possibilities for multiplexing spectrometers

Energy Technology Data Exchange (ETDEWEB)

Groitl, Felix, E-mail: felix.groitl@psi.ch [Laboratory for Quantum Magnetism, École Polytechnique Fédérale de Lausanne, 1015 Lausanne (Switzerland); Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen (Switzerland); Bartkowiak, Marek [Laboratory for Scientific Developments and Novel Materials, Paul Scherrer Institut, 5232 Villigen (Switzerland); Bergmann, Ryan M. [Division Large Research Facilities, Paul Scherrer Institut, 5232 Villigen (Switzerland); Birk, Jonas Okkels [Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen (Switzerland); Department of Physics, Technical University of Denmark (DTU), 2800 Kgs. Lyngby (Denmark); Markó, Márton [Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen (Switzerland); Wigner Research Centre for Physics, Neutron Spectroscopy Department, 1525 Budapest (Hungary); Bollhalder, Alex; Graf, Dieter [Laboratory for Scientific Developments and Novel Materials, Paul Scherrer Institut, 5232 Villigen (Switzerland); Niedermayer, Christof [Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen (Switzerland); Rüegg, Christian [Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen (Switzerland); Department of Quantum Matter Physics, University of Geneva, 1211 Geneva (Switzerland); Rønnow, Henrik M. [Laboratory for Quantum Magnetism, École Polytechnique Fédérale de Lausanne, 1015 Lausanne (Switzerland); Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark)

2017-06-21

Four different methods for mounting HOPG analyzer crystals on Si holders have been evaluated in the design process of the new multiplexing spectrometer CAMEA. Contrary to neutron optics used in standard spectrometers, the new instrument concept employs a series of analyzer segments behind each other where the neutrons have to pass through the bonding compound of the different analyzer crystals. The different methods, namely screws, shellac, indium soldering and clips, have been evaluated with regards to background, transmission, cooling, activation and handling. The results presented here will give valuable input for future CAMEA-type spectrometers currently planned and designed at various neutron sources.

Evaluation of HOPG mounting possibilities for multiplexing spectrometers

International Nuclear Information System (INIS)

Groitl, Felix; Bartkowiak, Marek; Bergmann, Ryan M.; Birk, Jonas Okkels; Markó, Márton; Bollhalder, Alex; Graf, Dieter; Niedermayer, Christof; Rüegg, Christian; Rønnow, Henrik M.

2017-01-01

Four different methods for mounting HOPG analyzer crystals on Si holders have been evaluated in the design process of the new multiplexing spectrometer CAMEA. Contrary to neutron optics used in standard spectrometers, the new instrument concept employs a series of analyzer segments behind each other where the neutrons have to pass through the bonding compound of the different analyzer crystals. The different methods, namely screws, shellac, indium soldering and clips, have been evaluated with regards to background, transmission, cooling, activation and handling. The results presented here will give valuable input for future CAMEA-type spectrometers currently planned and designed at various neutron sources.

Multiplexed Neurochemical Signaling by Neurons of the Ventral Tegmental Area

Science.gov (United States)

Barker, David J.; Root, David H.; Zhang, Shiliang; Morales, Marisela

2016-01-01

The ventral tegmental area (VTA) is an evolutionarily conserved structure that has roles in reward-seeking, safety-seeking, learning, motivation, and neuropsychiatric disorders such as addiction and depression. The involvement of the VTA in these various behaviors and disorders is paralleled by its diverse signaling mechanisms. Here we review recent advances in our understanding of neuronal diversity in the VTA with a focus on cell phenotypes that participate in ‘multiplexed’ neurotransmission involving distinct signaling mechanisms. First, we describe the cellular diversity within the VTA, including neurons capable of transmitting dopamine, glutamate or GABA as well as neurons capable of multiplexing combinations of these neurotransmitters. Next, we describe the complex synaptic architecture used by VTA neurons in order to accommodate the transmission of multiple transmitters. We specifically cover recent findings showing that VTA multiplexed neurotransmission may be mediated by either the segregation of dopamine and glutamate into distinct microdomains within a single axon or by the integration of glutamate and GABA into a single axon terminal. In addition, we discuss our current understanding of the functional role that these multiplexed signaling pathways have in the lateral habenula and the nucleus accumbens. Finally, we consider the putative roles of VTA multiplexed neurotransmission in synaptic plasticity and discuss how changes in VTA multiplexed neurons may relate to various psychopathologies including drug addiction and depression. PMID:26763116

Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

Directory of Open Access Journals (Sweden)

K. Kurta

2017-12-01

Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

Multiplex amplification of large sets of human exons.

Science.gov (United States)

Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay

2007-11-01

A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.

The consequences of multiplexing and limited view angle in coded-aperture imaging

International Nuclear Information System (INIS)

Smith, W.E.; Barrett, H.H.; Paxman, R.G.

1984-01-01

Coded-aperture imaging (CAI) is a method for reconstructing distributions of radionuclide tracers that offers advantages over ECT and PET; namely, many views can be taken simultaneously without detector motion, and large numbers of photons are utilized since collimators are not required. However, because of this type of data acquisition, the coded image suffers from multiplexing; i.e., more than one object point may be mapped to each detector in the coded image. To investigate the dependence of the reconstruction on multiplexing, the authors reconstruct a simulated two-dimensional circular object from multiplexed one-dimensional coded-image data, then perform the reconstruction from un-multiplexed data. Each of these reconstructions are produced both from noise-free and noisy simulated data. To investigate the dependence on view angle, the authors reconstruct two simulated three-dimensional objects; a spherical phantom, and a series of point-like objects arranged nearly in a plane. Each of these reconstructions are from multiplexed two-dimensional coded-image data, first using two orthogonal views, and then a single viewing direction. The two-dimensional reconstructions demonstrate that, in the noise-free case, the multiplexing of the data does not seriously affect the reconstruction equality and that in the noisy-data case, the multiplexing helps, due to the fact that more photons are collected. Also, for point-like objects confined to a near-planar region of space, the authors show that restricted views can give satisfactory results, but that, for a large, three-dimensional object, a more complete viewing geometry is required

Cross-talk free selective reconstruction of individual objects from multiplexed optical field data

Science.gov (United States)

Zea, Alejandro Velez; Barrera, John Fredy; Torroba, Roberto

2018-01-01

In this paper we present a data multiplexing method for simultaneous storage in a single package composed by several optical fields of tridimensional (3D) objects, and their individual cross-talk free retrieval. Optical field data are extracted from off axis Fourier holograms, and then sampled by multiplying them with random binary masks. The resulting sampled optical fields can be used to reconstruct the original objects. Sampling causes a loss of quality that can be controlled by the number of white pixels in the binary masks and by applying a padding procedure on the optical field data. This process can be performed using a different binary mask for each optical field, and then added to form a multiplexed package. With the adequate choice of sampling and padding, we can achieve a volume reduction in the multiplexed package over the addition of all individual optical fields. Moreover, the package can be multiplied by a binary mask to select a specific optical field, and after the reconstruction procedure, the corresponding 3D object is recovered without any cross-talk. We demonstrate the effectiveness of our proposal for data compression with a comparison with discrete cosine transform filtering. Experimental results confirm the validity of our proposal.

THESEUS: A wavelength division multiplexed/microwave subcarrier multiplexed optical network, its ATM switch applications and device requirements

Science.gov (United States)

Xin, Wei

1997-10-01

A Terabit Hybrid Electro-optical /underline[Se]lf- routing Ultrafast Switch (THESEUS) has been proposed. It is a self-routing wavelength division multiplexed (WDM) / microwave subcarrier multiplexed (SCM) asynchronous transfer mode (ATM) switch for the multirate ATM networks. It has potential to be extended to a large ATM switch as 1000 x 1000 without internal blocking. Among the advantages of the hybrid implementation are flexibility in service upgrade, relaxed tolerances on optical filtering, protocol simplification and less processing overhead. For a small ATM switch, the subcarrier can be used as output buffers to solve output contention. A mathematical analysis was conducted to evaluate different buffer configurations. A testbed has been successfully constructed. Multirate binary data streams have been switched through the testbed and error free reception ([<]10-9 bit error rate) has been achieved. A simple, intuitive theoretical model has been developed to describe the heterodyne optical beat interference. A new concept of interference time and interference length has been introduced. An experimental confirmation has been conducted. The experimental results match the model very well. It shows that a large portion of optical bandwidth is wasted due to the beat interference. Based on the model, several improvement approaches have been proposed. The photo-generated carrier lifetime of silicon germanium has been measured using time-resolved reflectivity measurement. Via oxygen ion implantation, the carrier lifetime has been reduced to as short as 1 ps, corresponding to 1 THz of photodetector bandwidth. It has also been shown that copper dopants act as recombination centers in the silicon germanium.

DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

Science.gov (United States)

Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

2004-01-01

Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

Time-division multiplexing vs network calculus: A comparison

DEFF Research Database (Denmark)

Puffitsch, Wolfgang; Sørensen, Rasmus Bo; Schoeberl, Martin

2015-01-01

that time-division multiplexing leads to better worst-case latencies, while network calculus supports higher bandwidths. Furthermore, time-division multiplexing leads to a simpler hardware implementation, while dynamically scheduled networks-on-chip allow the integration of best-effort traffic in the on......Networks-on-chip are increasingly common in modern multicore architectures. However, general-purpose networks-on-chip are not always well suited for real-time applications that require bandwidth and latency guarantees. Two approaches to provide real-time guarantees have emerged: time......-chip network in a more natural way....

Quantitative Modeling of Earth Surface Processes

Science.gov (United States)

Pelletier, Jon D.

This textbook describes some of the most effective and straightforward quantitative techniques for modeling Earth surface processes. By emphasizing a core set of equations and solution techniques, the book presents state-of-the-art models currently employed in Earth surface process research, as well as a set of simple but practical research tools. Detailed case studies demonstrate application of the methods to a wide variety of processes including hillslope, fluvial, aeolian, glacial, tectonic, and climatic systems. Exercises at the end of each chapter begin with simple calculations and then progress to more sophisticated problems that require computer programming. All the necessary computer codes are available online at www.cambridge.org/9780521855976. Assuming some knowledge of calculus and basic programming experience, this quantitative textbook is designed for advanced geomorphology courses and as a reference book for professional researchers in Earth and planetary science looking for a quantitative approach to Earth surface processes. More details...

Comparison of multiplex reverse transcription-PCR-enzyme ...

African Journals Online (AJOL)

Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

Multitasking versus multiplexing: Toward a normative account of limitations in the simultaneous execution of control-demanding behaviors.

Science.gov (United States)

Feng, S F; Schwemmer, M; Gershman, S J; Cohen, J D

2014-03-01

Why is it that behaviors that rely on control, so striking in their diversity and flexibility, are also subject to such striking limitations? Typically, people cannot engage in more than a few-and usually only a single-control-demanding task at a time. This limitation was a defining element in the earliest conceptualizations of controlled processing; it remains one of the most widely accepted axioms of cognitive psychology, and is even the basis for some laws (e.g., against the use of mobile devices while driving). Remarkably, however, the source of this limitation is still not understood. Here, we examine one potential source of this limitation, in terms of a trade-off between the flexibility and efficiency of representation ("multiplexing") and the simultaneous engagement of different processing pathways ("multitasking"). We show that even a modest amount of multiplexing rapidly introduces cross-talk among processing pathways, thereby constraining the number that can be productively engaged at once. We propose that, given the large number of advantages of efficient coding, the human brain has favored this over the capacity for multitasking of control-demanding processes.

Phase division multiplexed EIT for enhanced temporal resolution.

Science.gov (United States)

Dowrick, T; Holder, D

2018-03-29

The most commonly used EIT paradigm (time division multiplexing) limits the temporal resolution of impedance images due to the need to switch between injection electrodes. Advances have previously been made using frequency division multiplexing (FDM) to increase temporal resolution, but in cases where a fixed range of frequencies is available, such as imaging fast neural activity, an upper limit is placed on the total number of simultaneous injections. The use of phase division multiplexing (PDM) where multiple out of phase signals can be injected at each frequency is investigated to increase temporal resolution. TDM, FDM and PDM were compared in head tank experiments, to compare transfer impedance measurements and spatial resolution between the three techniques. A resistor phantom paradigm was established to investigate the imaging of one-off impedance changes, of magnitude 1% and with durations as low as 500 µs (similar to those seen in nerve bundles), using both PDM and TDM approaches. In head tank experiments, a strong correlation (r  >  0.85 and p  EIT injections.

Multiplex congruity: friendship networks and perceived popularity as correlates of adolescent alcohol use.

Science.gov (United States)

Fujimoto, Kayo; Valente, Thomas W

2015-01-01

Adolescents interact with their peers in multiple social settings and form various types of peer relationships that affect drinking behavior. Friendship and popularity perceptions constitute critical relationships during adolescence. These two relations are commonly measured by asking students to name their friends, and this network is used to construct drinking exposure and peer status variables. This study takes a multiplex network approach by examining the congruity between friendships and popularity as correlates of adolescent drinking. Using data on friendship and popularity nominations among high school adolescents in Los Angeles, California (N = 1707; five schools), we examined the associations between an adolescent's drinking and drinking by (a) their friends only; (b) multiplexed friendships, friends also perceived as popular; and (c) congruent, multiplexed-friends, close friends perceived as popular. Logistic regression results indicated that friend-only drinking, but not multiplexed-friend drinking, was significantly associated with self-drinking (AOR = 3.51, p < 0.05). However, congruent, multiplexed-friend drinking also was associated with self-drinking (AOR = 3.10, p < 0.05). This study provides insight into how adolescent health behavior is predicated on the multiplexed nature of peer relationships. The results have implications for the design of health promotion interventions for adolescent drinking. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

New multiplexes for Europe-amendments and clarification of strategic development

DEFF Research Database (Denmark)

Gill, Peter; Fereday, Lyn; Morling, Niels

2006-01-01

benefits to detect degraded samples. We subsequently recommended adoption of three new mini-STR loci to improve the success rate of degraded DNA markers, concurrent with the reduction in size of the existing STR markers in current use. This also improves the discriminating power of the system which...... to provide smaller amplicons combined with an additional two loci of high discriminating power. Eventually, the two strategies will converge to provide a single multiplex of 15 STR loci. The process will be guided by the ENFSI/EDNAP groups....

Radon transport processes below the earth's surface

International Nuclear Information System (INIS)

Wilkening, M.

1980-01-01

Processes by which 222 Rn is transported from the soil to the earth's surface are reviewed. The mechanisms effective in transporting 222 Rn to the surface are related to the size and configuration of the spaces occupied by the soil gas which may vary from molecular interstices to large underground caverns. The near-surface transport processes are divided into two categories: (1) a microscopic process that includes molecular diffusion and viscous flow in fine capillaries and (2) macroscopic flow in fissures and channels. Underground air rich in 222 Rn can also reach the surface through cracks, fissures, and underground channels. This type of transport is shown for (1) a horizontal tunnel penetrating a fractured hillside, (2) a large underground cave, and (3) volcanic activity. Pressure differentials having various natural origins and thermal gradients are responsible for the transport in these examples. 222 Rn transport by ordinary molecular diffusion appears to be the dominant process

Differentiating Authentic Adenophorae Radix from Its Adulterants in Commercially-Processed Samples Using Multiplexed ITS Sequence-Based SCAR Markers

Directory of Open Access Journals (Sweden)

Byeong Cheol Moon

2017-06-01

Full Text Available Determining the precise botanical origin of a traditional herbal medicine is important for basic quality control. In both the Chinese and Korean herbal pharmacopoeia, authentic Adenophorae Radix is defined as the roots of Adenophora stricta and Adenophora triphylla. However, the roots of Codonopsis lanceolata, Codonopsis pilosula, and Glehnia littoralis are frequently distributed as Adenophorae Radix in Korean herbal markets. Unfortunately, correctly identifying dried roots is difficult using conventional methods because the roots of those species are morphologically similar. Therefore, we developed DNA-based markers for the identification of authentic Adenophorae Radix and its common adulterants in commercially-processed samples. To develop a reliable method to discriminate between Adenophorae Radix and its adulterants, we sequenced the nuclear ribosomal DNA internal transcribed spacers (nrDNA-ITS and designed sequence-characterized amplified region (SCAR primers specific to the authentic and adulterant species. Using these primers, we developed SCAR markers for each species and established a multiplex-PCR method that can authenticate the four herbal medicines in a single PCR reaction. Furthermore, we confirmed that commercially-processed herbal medicines, which often have degraded DNA, could be assessed with our method. Therefore, our method is a reliable genetic tool to protect against adulteration and to standardize the quality of Adenophorae Radix.

Surface-Assisted Dynamic Search Processes.

Science.gov (United States)

Shin, Jaeoh; Kolomeisky, Anatoly B

2018-03-01

Many chemical and biological systems exhibit intermittent search phenomena when participating particles alternate between dynamic regimes with different dimensionalities. Here we investigate theoretically a dynamic search process of finding a small target on a two-dimensional surface starting from a bulk solution, which is an example of such an intermittent search process. Both continuum and discrete-state stochastic descriptions are developed. It is found that depending on the scanning length λ, which describes the area visited by the reacting molecule during one search cycle, the system can exhibit three different search regimes: (i) For small λ values, the reactant finds the target mostly via three-dimensional bulk diffusion; (ii) for large λ values, the reactant molecule associates to the target mostly via surface diffusion; and (iii) for intermediate λ values, the reactant reaches the target via a combination of three-dimensional and two-dimensional search cycles. Our analysis also shows that the mean search times have different scalings as a function of the size of the surface segment depending on the nature of the dynamic search regime. Search dynamics are also sensitive to the position of the target for large scanning lengths. In addition, it is argued that the continuum description underestimates mean search times and does not always correctly describe the most optimal conditions for the surface-assisted dynamic processes. The importance of our findings for real natural systems is discussed.

Plasma surface interaction processes and possible synergisms

International Nuclear Information System (INIS)

Behrisch, R.; Roberto, J.B.

1984-08-01

The process determining the plasma surface interaction in today's high temperature plasma experiments are investigated following several lines. First, in plasma devices, the particle and energy fluxes to the different first wall areas the fluxes from the walls back into the plasma are measured and the boundary plasma parameters are determined. The surface composition and structure of the walls, limiters and divertor plates are analyzed following exposure to many discharges. Secondly, the different surface processes which are expected to contribute to the plasma surface interaction (particularly to hydrogen particle balance and impurity introduction) are studied in simulation experiments using well defined particle beams

A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

Science.gov (United States)

Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

2014-01-01

Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

Development of a multiplexed readout with high position resolution for positron emission tomography

Energy Technology Data Exchange (ETDEWEB)

Lee, Sangwon; Choi, Yong [Molecular Imaging Research & Education (MiRe) Laboratory, Department of Electronic Engineering, Sogang University, Seoul 04107 (Korea, Republic of); Kang, Jihoon [Department of Biomedical Engineering, Chonnam National University, Yeosu 550-749 (Korea, Republic of); Jung, Jin Ho [Molecular Imaging Research & Education (MiRe) Laboratory, Department of Electronic Engineering, Sogang University, Seoul 04107 (Korea, Republic of)

2017-04-01

Detector signals for positron emission tomography (PET) are commonly multiplexed to reduce the number of digital processing channels so that the system can remain cost effective while also maintaining imaging performance. In this work, a multiplexed readout combining Anger position estimation algorithm and position decoder circuit (PDC) was developed to reduce the number of readout channels by a factor of 24, 96-to-4. The data acquisition module consisted of a TDC (50 ps resolution), 4-channel ADCs (12 bit, 105 MHz sampling rate), 2 GB SDRAM and USB3.0. The performance of the multiplexed readout was assessed with a high-resolution PET detector block composed of 2×3 detector modules, each consisting of an 8×8 array of 1.52×1.52×6 mm{sup 3} LYSO, a 4×4 array of 3×3 mm{sup 2} silicon photomultiplier (SiPM) and 13.4×13.4 mm{sup 2} light guide with 0.7 mm thickness. The acquired flood histogram showed that all 384 crystals could be resolved. The average energy resolution at 511 keV was 13.7±1.6% full-width-at-half-maximum (FWHM) and the peak-to-valley ratios of the flood histogram on the horizontal and vertical lines were 18.8±0.8 and 22.8±1.3, respectively. The coincidence resolving time of a pair of detector blocks was 6.2 ns FWHM. The reconstructed phantom image showed that rods down to a diameter of 1.6 mm could be resolved. The results of this study indicate that the multiplexed readout would be useful in developing a PET with a spatial resolution less than the pixel size of the photosensor, such as a SiPM array.

High core count single-mode multicore fiber for dense space division multiplexing

DEFF Research Database (Denmark)

Aikawa, K.; Sasaki, Y.; Amma, Y.

2016-01-01

Multicore fibers and few-mode fibers have the potential to realize dense-space-division multiplexing systems. Several dense-space-division multiplexing system transmission experiments over multicore fibers and few-mode fibers have been demonstrated so far. Multicore fibers, including recent resul...

Multiplex Recurrence Networks

Science.gov (United States)

Eroglu, Deniz; Marwan, Norbert

2017-04-01

The complex nature of a variety of phenomena in physical, biological, or earth sciences is driven by a large number of degrees of freedom which are strongly interconnected. Although the evolution of such systems is described by multivariate time series (MTS), so far research mostly focuses on analyzing these components one by one. Recurrence based analyses are powerful methods to understand the underlying dynamics of a dynamical system and have been used for many successful applications including examples from earth science, economics, or chemical reactions. The backbone of these techniques is creating the phase space of the system. However, increasing the dimension of a system requires increasing the length of the time series in order get significant and reliable results. This requirement is one of the challenges in many disciplines, in particular in palaeoclimate, thus, it is not easy to create a phase space from measured MTS due to the limited number of available obervations (samples). To overcome this problem, we suggest to create recurrence networks from each component of the system and combine them into a multiplex network structure, the multiplex recurrence network (MRN). We test the MRN by using prototypical mathematical models and demonstrate its use by studying high-dimensional palaeoclimate dynamics derived from pollen data from the Bear Lake (Utah, US). By using the MRN, we can distinguish typical climate transition events, e.g., such between Marine Isotope Stages.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

Science.gov (United States)

Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

2015-01-01

We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods

Directory of Open Access Journals (Sweden)

Nelly eDatukishvili

2015-07-01

Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

Mechanisms and energetics of surface atomic processes

International Nuclear Information System (INIS)

Tsong, T.T.

1991-01-01

The energies involved in various surface atomic processes such as surface diffusion, the binding of small atomic clusters on the surface, the interaction between two adsorbed atoms, the dissociation of an atom from a small cluster or from a surface layer, the binding of kink size atoms or atoms at different adsorption sites to the surface etc., can be derived from an analysis of atomically resolved field ion microscope images and a kinetic energy measurement of low temperature field desorbed ions using the time-of-flight atom-probe field ion microscope. These energies can be used to compare with theories and to understand the transport of atoms on the surface in atomic reconstructions, epitaxial growth of surface layers and crystal growth, adsorption layer superstructure formation, and also why an atomic ordering or atomic reconstruction at the surface is energetically favored. Mechanisms of some of the surface atomic processes are also clarified from these quantitative, atomic resolution studies. In this paper work in this area is bris briefly reviewed

Microfluidic platform for multiplexed detection in single cells and methods thereof

Science.gov (United States)

Wu, Meiye; Singh, Anup K.

2018-05-01

The present invention relates to a microfluidic device and platform configured to conduct multiplexed analysis within the device. In particular, the device allows multiple targets to be detected on a single-cell level. Also provided are methods of performing multiplexed analyses to detect one or more target nucleic acids, proteins, and post-translational modifications.

Topology optimized mode multiplexing in silicon-on-insulator photonic wire waveguides

DEFF Research Database (Denmark)

Frellsen, Louise Floor; Ding, Yunhong; Sigmund, Ole

2016-01-01

We design and experimentally verify a topology optimized low-loss and broadband two-mode (de-)multiplexer, which is (de-)multiplexing the fundamental and the first-order transverse-electric modes in a silicon photonic wire. The device has a footprint of 2.6 μm x 4.22 μm and exhibits a loss 14 d...

An alarm multiplexer communication system

International Nuclear Information System (INIS)

Herrera, G.V.

1986-01-01

A low cost Alarm Multiplexer Communication System (AMCS) has been developed to perform the security sensor monitoring and control functions and to provide remote relay control capability for integrated security systems. AMCS has a distributed multiplexer/repeater architecture with up to four dual communication loops and dual control computers that guarantee total system operation under any single point failure condition. Each AMCS can control up to 4096 sensors and 2048 remote relays. AMCS reports alarm status information to and is controlled by either one or two Host computers. This allows for independent operation of primary and backup security command centers. AMCS communicates with the Host computers over an asynchronous serial communication link and has a message protocol which allows AMCS to fully recover from lost messages or large blocks of data communication errors. This paper describes the AMCS theory of operation, AMCS fault modes, and AMCS system design methodology. Also, cost and timing information is presented. AMCS is being used and considered for several DOE and DOD facilities

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Silicon Photonic Integrated Circuit Mode Multiplexer

DEFF Research Database (Denmark)

Ding, Yunhong; Ou, Haiyan; Xu, Jing

2013-01-01

We propose and demonstrate a novel silicon photonic integrated circuit enabling multiplexing of orthogonal modes in a few-mode fiber (FMF). By selectively launching light to four vertical grating couplers, all six orthogonal spatial and polarization modes supported by the FMF are successfully...

Tumor specific lung cancer diagnostics with multiplexed FRET immunoassays

Science.gov (United States)

Geißler, D.; Hill, D.; Löhmannsröben, H.-G.; Thomas, E.; Lavigne, A.; Darbouret, B.; Bois, E.; Charbonnière, L. J.; Ziessel, R. F.; Hildebrandt, N.

2010-02-01

An optical multiplexed homogeneous (liquid phase) immunoassay based on FRET from a terbium complex to eight different fluorescent dyes is presented. We achieved highly sensitive parallel detection of four different lung cancer specific tumor markers (CEA, NSE, SCC and CYFRA21-1) within a single assay and show a proof-of-principle for 5- fold multiplexing. The method is well suited for fast and low-cost miniaturized point-of-care testing as well as for highthroughput screening in a broad range of in-vitro diagnostic applications.

Safety considerations for various applications of remote multiplexing in nuclear power plants

International Nuclear Information System (INIS)

Leary, J.E.

1978-01-01

There is increasing interest in the application of remote multiplexing systems (RMS) for power plant applications. Remote multiplexing can replace the majority of conventional control and instrumentation signal cables. In addition, the RMS can perform control logic functions presently implemented by discrete hardwired circuit elements. The background and trends in the use of RMS and the attendant advantages and concerns are reviewed. Classifications of multiplexed digital systems are presented to show the evolution of this technology in power plant applications. Nuclear safety-related applications of RMS are discussed with emphasis on the impact of selected NRC Regulatory Guides on such applications. (author)

On-chip two-mode division multiplexing using tapered directional coupler-based mode multiplexer and demultiplexer

DEFF Research Database (Denmark)

Ding, Yunhong; Xu, Jing; Da Ros, Francesco

2013-01-01

), and large fabrication tolerance (20 nm) are measured. An on-chip mode multiplexing experiment is carried out on the fabricated circuit with non return-to-zero (NRZ) on-off keying (OOK) signals at 40 Gbit/s. The experimental results show clear eye diagrams and moderate power penalty for both TE0 and TE1...

On-chip multiplexed solid-phase nucleic acid hybridization assay using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

Science.gov (United States)

Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J

2013-07-25

A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

More ethical and more efficient clinical research: multiplex trial design.

Science.gov (United States)

Keus, Frederik; van der Horst, Iwan C C; Nijsten, Maarten W

2014-08-14

Today's clinical research faces challenges such as a lack of clinical equipoise between treatment arms, reluctance in randomizing for multiple treatments simultaneously, inability to address interactions and increasingly restricted resources. Furthermore, many trials are biased by extensive exclusion criteria, relatively small sample size and less appropriate outcome measures. We propose a 'Multiplex' trial design that preserves clinical equipoise with a continuous and factorial trial design that will also result in more efficient use of resources. This multiplex design accommodates subtrials with appropriate choice of treatment arms within each subtrial. Clinical equipoise should increase consent rates while the factorial design is the best way to identify interactions. The multiplex design may evolve naturally from today's research limitations and challenges, while principal objections seem absent. However this new design poses important infrastructural, organisational and psychological challenges that need in depth consideration.

Multiplexing symbolic dynamics-based chaos communications using synchronization

Energy Technology Data Exchange (ETDEWEB)

Blakely, Jonathan N; Corron, Ned J [US Army RDECOM, AMSRD-AMR-WS-ST, Redstone Arsenal, Huntsville, AL 35898 (United States)

2005-01-01

A novel form of multiplexing information-bearing chaotic waveforms is demonstrated experimentally. This scheme dramatically increases the information carrying capacity of a chaotic communication system. In the transmitter, information is encoded in the chaotic waveforms of two electronic circuits using small perturbations to induce the symbolic dynamics to follow a prescribed symbol sequence. Waveforms from each of the drive oscillators are summed to form a single scalar signal that is transmitted to the receiver. Identical oscillators in the receiver synchronize to their counterparts in the drive system, effectively de-multiplexing the transmitted signal. The transmitted information in each channel is extracted from simple return maps of the receiver oscillators.

Multiplexing symbolic dynamics-based chaos communications using synchronization

International Nuclear Information System (INIS)

Blakely, Jonathan N; Corron, Ned J

2005-01-01

A novel form of multiplexing information-bearing chaotic waveforms is demonstrated experimentally. This scheme dramatically increases the information carrying capacity of a chaotic communication system. In the transmitter, information is encoded in the chaotic waveforms of two electronic circuits using small perturbations to induce the symbolic dynamics to follow a prescribed symbol sequence. Waveforms from each of the drive oscillators are summed to form a single scalar signal that is transmitted to the receiver. Identical oscillators in the receiver synchronize to their counterparts in the drive system, effectively de-multiplexing the transmitted signal. The transmitted information in each channel is extracted from simple return maps of the receiver oscillators

Long-term desorption of trichloroethylene from flint clay using multiplexed optical detection

International Nuclear Information System (INIS)

Stager, M.P.; Perram, G.P.

1999-01-01

The long-term desorption of trichloroethylene (TCE) from powdered flint clay was examined using a multiplexed, phase sensitive infrared technique which provided a gas phase detection limit of 0.0045 torr for continuous monitoring of the desorption process for at least 3 days. The vapor phase TCE concentrations as a function of desorption time exhibit a significant deviation from Langmuir kinetics. The desorption process is adequately described by bonding sites with a gamma distribution for the desorption rate coefficients. The mean desorption rate for powdered flint clay at 25°C is k d = 0.50 ± 0.02 h −1 . (author)

Interferometric crosstalk suppression using polarization multiplexing technique and an SOA

DEFF Research Database (Denmark)

Liu, Fenghai; Xueyan, Zheng; Pedersen, Rune Johan Skullerud

2000-01-01

Interferometric crosstalk can be greatly suppressed at 10Gb/s and 20Gb/s by using a gain saturated SOA and a polarization multiplexing technique that eliminates impairments like waveform and extinction ratio degradation from the SOA.......Interferometric crosstalk can be greatly suppressed at 10Gb/s and 20Gb/s by using a gain saturated SOA and a polarization multiplexing technique that eliminates impairments like waveform and extinction ratio degradation from the SOA....

Centralized light-source optical access network based on polarization multiplexing.

Science.gov (United States)

Grassi, Fulvio; Mora, José; Ortega, Beatriz; Capmany, José

2010-03-01

This paper presents and demonstrates a centralized light source optical access network based on optical polarization multiplexing technique. By using two optical sources emitting light orthogonally polarized in the Central Node for downstream and upstream operations, the Remote Node is kept source-free. EVM values below telecommunication standard requirements have been measured experimentally when bidirectional digital signals have been transmitted over 10 km of SMF employing subcarrier multiplexing technique in the electrical domain.

Coherence-Multiplexed Optical RF Feeder Networks

NARCIS (Netherlands)

Meijerink, Arjan; Taniman, R.O.; van Etten, Wim

2007-01-01

An optical RF feeding system for wireless access is proposed, in which the radio access points are distinguished by means of coherence multiplexing (CM). CM is a rather unknown and potentially inexpensive optical code division multiple access technique, which is particularly suitable for relatively

Typing of Y chromosome SNPs with multiplex PCR methods

DEFF Research Database (Denmark)

Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

2005-01-01

We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

Mode Division Multiplexing Exploring Hollow-Core Photonic Bandgap Fibers

DEFF Research Database (Denmark)

Xu, Jing; Lyngso, Jens Kristian; Leick, Lasse

2013-01-01

We review our recent exploratory investigations on mode division multiplexing using hollow-core photonic bandgap fibers (HC-PBGFs). Compared with traditional multimode fibers, HC-PBGFs have several attractive features such as ultra-low nonlinearities, low-loss transmission window around 2 µm etc....... After having discussed the potential and challenges of using HC-PBGFs as transmission fibers for mode multiplexing applications, we will report a number of recent proof-of-concept results obtained in our group using direct detection receivers. The first one is the transmission of two 10.7 Gbit/s non...

In-plane wavelength division de-multiplexing using photonic crystals

DEFF Research Database (Denmark)

Frandsen, Lars Hagedorn; Harpøth, Anders; Hede, K. K.

We demonstrate a novel concept for in-plane coarse wavelength division de-multiplexing in integrated photonic circuits utilizing planar photonic crystal waveguides (PhCWs) fabricated in a silicon-on-insulator material. The filtering of wavelength channels is realized by shifting the cut......-off frequency of the fundamental photonic bandgap mode. The shift is obtained by modifying the size of the border holes in consecutive sections of the PhCW1. Simulations and experimental proof-of-principle of the four-channel de-multiplexer will be presented. 1A. Adibi et al., Electron. Lett. 36, 1376...

Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.

Science.gov (United States)

Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva

2007-01-01

Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.

A laser ablation ICP-MS based method for multiplexed immunoblot analysis

DEFF Research Database (Denmark)

de Bang, Thomas Christian; Petersen, Jørgen; Pedas, Pai Rosager

2015-01-01

developed a multiplexed antibody-based assay and analysed selected PSII subunits in barley (Hordeum vulgare L.). A selection of antibodies were labelled with specific lanthanides and immunoreacted with thylakoids exposed to Mn deficiency after western blotting. Subsequently, western blot membranes were...... analysed by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), which allowed selective and relative quantitative analysis via the different lanthanides. The method was evaluated against established liquid chromatography electrospray ionization tandem mass spectrometry (LC...... by more than one technique. The developed method enables a higher number of proteins to be multiplexed in comparison to existing immunoassays. Furthermore, multiplexed protein analysis by LA-ICP-MS provides an analytical platform with high throughput appropriate for screening large collections of plants....

Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens

Directory of Open Access Journals (Sweden)

Mehmet Sarıer

2017-03-01

Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion

Multi-surface topography targeted plateau honing for the processing of cylinder liner surfaces of automotive engines

Science.gov (United States)

Lawrence, K. Deepak; Ramamoorthy, B.

2016-03-01

Cylinder bores of automotive engines are 'engineered' surfaces that are processed using multi-stage honing process to generate multiple layers of micro geometry for meeting the different functional requirements of the piston assembly system. The final processed surfaces should comply with several surface topographic specifications that are relevant for the good tribological performance of the engine. Selection of the process parameters in three stages of honing to obtain multiple surface topographic characteristics simultaneously within the specification tolerance is an important module of the process planning and is often posed as a challenging task for the process engineers. This paper presents a strategy by combining the robust process design and gray-relational analysis to evolve the operating levels of honing process parameters in rough, finish and plateau honing stages targeting to meet multiple surface topographic specifications on the final running surface of the cylinder bores. Honing experiments were conducted in three stages namely rough, finish and plateau honing on cast iron cylinder liners by varying four honing process parameters such as rotational speed, oscillatory speed, pressure and honing time. Abbott-Firestone curve based functional parameters (Rk, Rpk, Rvk, Mr1 and Mr2) coupled with mean roughness depth (Rz, DIN/ISO) and honing angle were measured and identified as the surface quality performance targets to be achieved. The experimental results have shown that the proposed approach is effective to generate cylinder liner surface that would simultaneously meet the explicit surface topographic specifications currently practiced by the industry.

A Perron–Frobenius theory for block matrices associated to a multiplex network

International Nuclear Information System (INIS)

Romance, Miguel; Solá, Luis; Flores, Julio; García, Esther; García del Amo, Alejandro; Criado, Regino

2015-01-01

The uniqueness of the Perron vector of a nonnegative block matrix associated to a multiplex network is discussed. The conclusions come from the relationships between the irreducibility of some nonnegative block matrix associated to a multiplex network and the irreducibility of the corresponding matrices to each layer as well as the irreducibility of the adjacency matrix of the projection network. In addition the computation of that Perron vector in terms of the Perron vectors of the blocks is also addressed. Finally we present the precise relations that allow to express the Perron eigenvector of the multiplex network in terms of the Perron eigenvectors of its layers

A Perron-Frobenius theory for block matrices associated to a multiplex network

Science.gov (United States)

Romance, Miguel; Solá, Luis; Flores, Julio; García, Esther; García del Amo, Alejandro; Criado, Regino

2015-03-01

The uniqueness of the Perron vector of a nonnegative block matrix associated to a multiplex network is discussed. The conclusions come from the relationships between the irreducibility of some nonnegative block matrix associated to a multiplex network and the irreducibility of the corresponding matrices to each layer as well as the irreducibility of the adjacency matrix of the projection network. In addition the computation of that Perron vector in terms of the Perron vectors of the blocks is also addressed. Finally we present the precise relations that allow to express the Perron eigenvector of the multiplex network in terms of the Perron eigenvectors of its layers.

Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

Science.gov (United States)

Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

2018-01-01

Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

Statistical Multiplexing of Computations in C-RAN with Tradeoffs in Latency and Energy

DEFF Research Database (Denmark)

Kalør, Anders Ellersgaard; Agurto Agurto, Mauricio Ignacio; Pratas, Nuno

2017-01-01

frame duration, then this may result in additional access latency and limit the energy savings. In this paper we investigate the tradeoff by considering two extreme time-scales for the resource multiplexing: (i) long-term, where the computational resources are adapted over periods much larger than...... the access frame durations; (ii) short-term, where the adaption is below the access frame duration.We develop a general C-RAN queuing model that models the access latency and show, for Poisson arrivals, that long-term multiplexing achieves savings comparable to short-term multiplexing, while offering low...

Development and standardization of multiplexed antibody microarrays for use in quantitative proteomics

Directory of Open Access Journals (Sweden)

Sorette M

2004-12-01

Full Text Available Abstract Background Quantitative proteomics is an emerging field that encompasses multiplexed measurement of many known proteins in groups of experimental samples in order to identify differences between groups. Antibody arrays are a novel technology that is increasingly being used for quantitative proteomics studies due to highly multiplexed content, scalability, matrix flexibility and economy of sample consumption. Key applications of antibody arrays in quantitative proteomics studies are identification of novel diagnostic assays, biomarker discovery in trials of new drugs, and validation of qualitative proteomics discoveries. These applications require performance benchmarking, standardization and specification. Results Six dual-antibody, sandwich immunoassay arrays that measure 170 serum or plasma proteins were developed and experimental procedures refined in more than thirty quantitative proteomics studies. This report provides detailed information and specification for manufacture, qualification, assay automation, performance, assay validation and data processing for antibody arrays in large scale quantitative proteomics studies. Conclusion The present report describes development of first generation standards for antibody arrays in quantitative proteomics. Specifically, it describes the requirements of a comprehensive validation program to identify and minimize antibody cross reaction under highly multiplexed conditions; provides the rationale for the application of standardized statistical approaches to manage the data output of highly replicated assays; defines design requirements for controls to normalize sample replicate measurements; emphasizes the importance of stringent quality control testing of reagents and antibody microarrays; recommends the use of real-time monitors to evaluate sensitivity, dynamic range and platform precision; and presents survey procedures to reveal the significance of biomarker findings.

76 FR 48169 - Advancing Regulatory Science for Highly Multiplexed Microbiology/Medical Countermeasure Devices...

Science.gov (United States)

2011-08-08

... microbiology/MCM device, their clinical application and public health/clinical needs and quality criteria for... topics: 1. Clinical Application of Highly Multiplexed Microbiology Devices: Their clinical application... to evaluate the analytical and clinical performance of highly multiplexed microbiology devices...

Triadic closure dynamics drives scaling laws in social multiplex networks

International Nuclear Information System (INIS)

Klimek, Peter; Thurner, Stefan

2013-01-01

Social networks exhibit scaling laws for several structural characteristics, such as degree distribution, scaling of the attachment kernel and clustering coefficients as a function of node degree. A detailed understanding if and how these scaling laws are inter-related is missing so far, let alone whether they can be understood through a common, dynamical principle. We propose a simple model for stationary network formation and show that the three mentioned scaling relations follow as natural consequences of triadic closure. The validity of the model is tested on multiplex data from a well-studied massive multiplayer online game. We find that the three scaling exponents observed in the multiplex data for the friendship, communication and trading networks can simultaneously be explained by the model. These results suggest that triadic closure could be identified as one of the fundamental dynamical principles in social multiplex network formation. (paper)

PLC-based mode multi/demultiplexers for mode division multiplexing

Science.gov (United States)

Saitoh, Kunimasa; Hanzawa, Nobutomo; Sakamoto, Taiji; Fujisawa, Takeshi; Yamashita, Yoko; Matsui, Takashi; Tsujikawa, Kyozo; Nakajima, Kazuhide

2017-02-01

Recently developed PLC-based mode multi/demultiplexers (MUX/DEMUXs) for mode division multiplexing (MDM) transmission are reviewed. We firstly show the operation principle and basic characteristics of PLC-based MUX/DEMUXs with an asymmetric directional coupler (ADC). We then demonstrate the 3-mode (2LP-mode) multiplexing of the LP01, LP11a, and LP11b modes by using fabricated PLC-based mode MUX/DEMUX on one chip. In order to excite LP11b mode in the same plane, a PLC-based LP11 mode rotator is introduced. Finally, we show the PLC-based 6-mode (4LP-mode) MUX/DEMUX with a uniform height by using ADCs, LP11 mode rotators, and tapered waveguides. It is shown that the LP21a mode can be excited from the LP11b mode by using ADC, and the two nearly degenerated LP21b and LP02 modes can be (de)multiplexed separately by using tapered mode converter from E13 (E31) mode to LP21b (LP02) mode.

Performance of Multiplexed XY Resistive Micromegas detectors in a high intensity beam

Science.gov (United States)

Banerjee, D.; Burtsev, V.; Chumakov, A.; Cooke, D.; Depero, E.; Dermenev, A. V.; Donskov, S. V.; Dubinin, F.; Dusaev, R. R.; Emmenegger, S.; Fabich, A.; Frolov, V. N.; Gardikiotis, A.; Gninenko, S. N.; Hösgen, M.; Karneyeu, A. E.; Ketzer, B.; Kirsanov, M. M.; Konorov, I. V.; Kramarenko, V. A.; Kuleshov, S. V.; Levchenko, E.; Lyubovitskij, V. E.; Lysan, V.; Mamon, S.; Matveev, V. A.; Mikhailov, Yu. V.; Myalkovskiy, V. V.; Peshekhonov, V. D.; Peshekhonov, D. V.; Polyakov, V. A.; Radics, B.; Rubbia, A.; Samoylenko, V. D.; Tikhomirov, V. O.; Tlisov, D. A.; Toropin, A. N.; Vasilishin, B.; Arenas, G. Vasquez; Ulloa, P.; Crivelli, P.

2018-02-01

We present the performance of multiplexed XY resistive Micromegas detectors tested in the CERN SPS 100 GeV/c electron beam at intensities up to 3 . 3 × 105e- /(s ṡcm2) . So far, all studies with multiplexed Micromegas have only been reported for tests with radioactive sources and cosmic rays. The use of multiplexed modules in high intensity environments was not explored due to the effect of ambiguities in the reconstruction of the hit point caused by the multiplexing feature. For the specific mapping and beam intensities analyzed in this work with a multiplexing factor of five, more than 50% level of ambiguity is introduced due to particle pile-up as well as fake clusters due to the mapping feature. Our results prove that by using the additional information of cluster size and integrated charge from the signal clusters induced on the XY strips, the ambiguities can be reduced to a level below 2%. The tested detectors are used in the CERN NA64 experiment for tracking the incoming particles bending in a magnetic field in order to reconstruct their momentum. The average hit detection efficiency of each module was found to be ∼96% at the highest beam intensities. By using four modules a tracking resolution of 1.1% was obtained with ∼85% combined tracking efficiency.

Processing and finishing of granite surfaces

OpenAIRE

Klich, J. (Jiří); Hlaváček, P. (Petr); Ščučka, J. (Jiří); Sitek, L. (Libor); Foldyna, J. (Josef); Georgiovská, L. (Lucie); Souček, K. (Kamil); Staš, L. (Lubomír); Bortolussi, A.

2013-01-01

The article deals with granite surface processing and finishing by various methods including bush hammering, flaming, polishing, continuous and pulsating water jetting. Both optical and CT X-ray methods are used for analysis of surface and subsurface areas of tested samples. Advantages of pulsating water jetting compared to other techniques are discussed.

A review of spectrally coded multiplexing techniques for fibre grating sensor systems

International Nuclear Information System (INIS)

Childs, Paul; Wong, Allan C L; Yan, Binbin; Li, Mo; Peng, Gang-Ding

2010-01-01

We review recent work and progress on spectrally coded multiplexing (SCM). SCM is a generic multiplexing technique that provides more efficient data usage, additional flexibility and greater channel capability for fibre and fibre grating based sensor systems. We show a few examples of newly developed SCM techniques based on specially designed fibre gratings

2x2 MIMO-OFDM Gigabit fiber-wireless access system based on polarization division multiplexed WDM-PON

DEFF Research Database (Denmark)

Deng, Lei; Pang, Xiaodan; Zhao, Ying

2012-01-01

We propose a spectral efficient radio over wavelength division multiplexed passive optical network (WDM-PON) system by combining optical polarization division multiplexing (PDM) and wireless multiple input multiple output (MIMO) spatial multiplexing techniques. In our experiment, a training-based...

Time multiplexing for increased FOV and resolution in virtual reality

Science.gov (United States)

Miñano, Juan C.; Benitez, Pablo; Grabovičkić, Dejan; Zamora, Pablo; Buljan, Marina; Narasimhan, Bharathwaj

2017-06-01

We introduce a time multiplexing strategy to increase the total pixel count of the virtual image seen in a VR headset. This translates into an improvement of the pixel density or the Field of View FOV (or both) A given virtual image is displayed by generating a succession of partial real images, each representing part of the virtual image and together representing the virtual image. Each partial real image uses the full set of physical pixels available in the display. The partial real images are successively formed and combine spatially and temporally to form a virtual image viewable from the eye position. Partial real images are imaged through different optical channels depending of its time slot. Shutters or other schemes are used to avoid that a partial real image be imaged through the wrong optical channels or at the wrong time slot. This time multiplexing strategy needs real images be shown at high frame rates (>120fps). Available display and shutters technologies are discussed. Several optical designs for achieving this time multiplexing scheme in a compact format are shown. This time multiplexing scheme allows increasing the resolution/FOV of the virtual image not only by increasing the physical pixel density but also by decreasing the pixels switching time, a feature that may be simpler to achieve in certain circumstances.

FEATURES OF MULTIPLEXED HOLOGRAMS RECORDING IN PHOTO-THERMO-REFRACTIVE GLASS

Directory of Open Access Journals (Sweden)

S. A. Ivanov

2016-05-01

Full Text Available We have carried out calculations of recording conditions for multiplexed holograms in photo-thermo-refractive (PTR glass. The proposed calculation sets the link between such parameters as: the angle between recording beams and the angle of sample rotation, operating wavelength, the angle of incidence on the element, output angle. To study recording features of multiplexed holograms on PTR glass several elements was made. Six holograms in each element were recorded with various exposures. All samples were heat-treated at one temperature around glass transition temperature. It has been demonstrated that at the recording of several gratings with a total exposure exceeding an optimal value for a given material, the total value of the refractive index modulation amplitude (n1 reaches the maximum attainable magnitude that is equivalent to a value of a single hologram with optimal exposure. It has been found that refractive index dynamic range of the material distributes between the gratings in accordance with the ratio between exposure times if holograms exposures have significant differences. In the present paper six-channel multiplexer was recorded for a wavelength equal to 632.8 nm (He-Ne laser. The diffraction angles correspond to calculations mentioned above. The n1 value in each grating is equal to the value of the highest attainable value of the value of n1 divided by the total number of multiplexed holograms.

SP-100 Position Multiplexer and Analog Input Processor

International Nuclear Information System (INIS)

Syed, A.; Gilliland, K.; Shukla, J.N.

1992-01-01

This paper describes the design, implementation, and performance test results of an engineering model of the Position Multiplexer (MUX)-Analog Input Processor (AIP) System for the transmission and continuous measurements of Reflector Control Drive position in SP-100. This paper describes the work performed to determine the practical circuit limitations, investigate the circuit/component degradation of the multiplexer due to radiation, develop an interference cancellation technique, and evaluate the measurement accuracy as a function of resolver angle, temperature, radiation, and interference. The system developed performs a complex cross-correlation between the resolver excitation and the resolver sine cosine outputs, from which the precise resolver amplitude and phase can be determined while simultaneously eliminating virtually all uncorrelated interference

Design and numerical optimization of a mode multiplexer based on few-mode fiber couplers

International Nuclear Information System (INIS)

Xie, Yiwei; Fu, Songnian; Liu, Hai; Zhang, Hailiang; Tang, Ming; Liu, Deming; Shum, P

2013-01-01

Mode division multiplexing (MDM) transmission based on few-mode fibers (FMFs) appears to be an alternative solution for overcoming the capacity limit of single-mode fibers (SMFs). A FMF coupler-based mode division multiplexer/demultiplexer (MMUX/DeMMUX) is proposed and theoretically investigated after the fabricated FMF is characterized. MMUXs/DeMMUXs with a mode contrast ratio (MCR) of more than 20 dB can be obtained for two-mode multiplexing and three-mode multiplexing over a wavelength span of 60 and 10 nm, respectively. We numerically verify the proposed MMUX/DeMMUX which has the advantages of high MCR, easy fabrication and maintenance, and low wavelength dependence. (paper)

NIST mixed stain study 3: signal intensity balance in commercial short tandem repeat multiplexes.

Science.gov (United States)

Duewer, David L; Kline, Margaret C; Redman, Janette W; Butler, John M

2004-12-01

Short-tandem repeat (STR) allelic intensities were collected from more than 60 forensic laboratories for a suite of seven samples as part of the National Institute of Standards and Technology-coordinated 2001 Mixed Stain Study 3 (MSS3). These interlaboratory challenge data illuminate the relative importance of intrinsic and user-determined factors affecting the locus-to-locus balance of signal intensities for currently used STR multiplexes. To varying degrees, seven of the eight commercially produced multiplexes used by MSS3 participants displayed very similar patterns of intensity differences among the different loci probed by the multiplexes for all samples, in the hands of multiple analysts, with a variety of supplies and instruments. These systematic differences reflect intrinsic properties of the individual multiplexes, not user-controllable measurement practices. To the extent that quality systems specify minimum and maximum absolute intensities for data acceptability and data interpretation schema require among-locus balance, these intrinsic intensity differences may decrease the utility of multiplex results and surely increase the cost of analysis.

Evaluation of Multiplexed Foot-and-Mouth Disease Nonstructural Protein Antibody Assay Against Standardized Bovine Serum Panel

Energy Technology Data Exchange (ETDEWEB)

Perkins, J; Parida, S; Clavijo, A

2007-05-14

Liquid array technology has previously been used to show proof-of-principle of a multiplexed non structural protein serological assay to differentiate foot-and-mouth infected and vaccinated animals. The current multiplexed assay consists of synthetically produced peptide signatures 3A, 3B and 3D and recombinant protein signature 3ABC in combination with four controls. To determine diagnostic specificity of each signature in the multiplex, the assay was evaluated against a naive population (n = 104) and a vaccinated population (n = 94). Subsequently, the multiplexed assay was assessed using a panel of bovine sera generated by the World Reference Laboratory for foot-and-mouth disease in Pirbright, UK. This sera panel has been used to assess the performance of other singleplex ELISA-based non-structural protein antibody assays. The 3ABC signature in the multiplexed assay showed comparative performance to a commercially available non-structural protein 3ABC ELISA (Cedi test{reg_sign}) and additional information pertaining to the relative diagnostic sensitivity of each signature in the multiplex is acquired in one experiment. The encouraging results of the evaluation of the multiplexed assay against a panel of diagnostically relevant samples promotes further assay development and optimization to generate an assay for routine use in foot-and-mouth disease surveillance.

Dense wavelength division multiplexing devices for metropolitan-area datacom and telecom networks

Science.gov (United States)

DeCusatis, Casimer M.; Priest, David G.

2000-12-01

Large data processing environments in use today can require multi-gigabyte or terabyte capacity in the data communication infrastructure; these requirements are being driven by storage area networks with access to petabyte data bases, new architecture for parallel processing which require high bandwidth optical links, and rapidly growing network applications such as electronic commerce over the Internet or virtual private networks. These datacom applications require high availability, fault tolerance, security, and the capacity to recover from any single point of failure without relying on traditional SONET-based networking. These requirements, coupled with fiber exhaust in metropolitan areas, are driving the introduction of dense optical wavelength division multiplexing (DWDM) in data communication systems, particularly for large enterprise servers or mainframes. In this paper, we examine the technical requirements for emerging nextgeneration DWDM systems. Protocols for storage area networks and computer architectures such as Parallel Sysplex are presented, including their fiber bandwidth requirements. We then describe two commercially available DWDM solutions, a first generation 10 channel system and a recently announced next generation 32 channel system. Technical requirements, network management and security, fault tolerant network designs, new network topologies enabled by DWDM, and the role of time division multiplexing in the network are all discussed. Finally, we present a description of testing conducted on these networks and future directions for this technology.

Packaged mode multiplexer based on silicon photonics

NARCIS (Netherlands)

Chen, H.; Koonen, A.M.J.; Snyder, B.; Raz, O.; Boom, van den H.P.A.; Chen, X.

2012-01-01

A silicon photonics based mode multiplexer is proposed. Four chirped grating couplers structure can support all 6 channels in a two-mode fiber and realize LP01 and LP11 mode selective exciting. The packaged device is tested.

Characterization of highly multiplexed monolithic PET / gamma camera detector modules

DEFF Research Database (Denmark)

Pierce, L. A.; Pedemonte, Stefano; Dewitt, Sharon

2018-01-01

tube with 8 × 8 position-outputs and one channel that is the sum of the other 64. The 65-channel signal was multiplexed in a resistive circuit, with 65:5 or 65:7 multiplexing. A 0.9 mm beam of 511 keV photons was scanned across the face of the crystal in a 1.52 mm grid pattern in order to characterize...... and scatter-rejection capabilities of the detector were analyzed. We found that using a 7-channel multiplexing scheme (65:7 compression ratio) with 1.67 mm depth bins had the best performance with a beam-contour of 1.2 mm FWHM (from the 0.9 mm beam) near the center of the crystal and 1.9 mm FWHM near the edge...... the detector response. New methods are developed to reject scattered events and perform depthestimation to characterize the detector response of the calibration data. Photon interaction position estimation of the testing data was performed using a Gaussian Maximum Likelihood estimator and the resolution...

Combining spatial domain multiplexing and orbital angular momentum of photon-based multiplexing to increase the bandwidth of optical fiber communication systems

Science.gov (United States)

Murshid, Syed; Alanzi, Saud; Hridoy, Arnob; Lovell, Gregory L.; Parhar, Gurinder; Chakravarty, Abhijit; Chowdhury, Bilas

2016-06-01

Spatial domain multiplexing/space division multiplexing (SDM) can increase the bandwidth of existing and futuristic optical fibers by an order of magnitude or more. In the SDM technique, we launch multiple single-mode pigtail laser sources of the same wavelength into a carrier multimode fiber at different angles. The launching angles decide the output of the carrier fiber by allocating separate spatial locations for each channel. Each channel follows a helical trajectory while traversing the length of the carrier fiber, thereby allowing spatial reuse of optical frequencies. We launch light from five different single-mode pigtail laser sources (of same wavelength) at different angles (with respect to the axis of the carrier fiber) into the carrier fiber. Owing to helical propagation, five distinct concentric donut-shaped rings with negligible crosstalk at the output end of the fiber were obtained. These SDM channels also exhibit orbital angular momentum (OAM), thereby adding an extradegree of photon freedom. We present the experimental data of five spatially multiplexed channels and compare them with simulated results to show that this technique can potentially improve the data capacity of optical fibers by an order of magnitude: A factor of five using SDM and another factor of two using OAM.

16-channel analog store and multiplexer unit

Energy Technology Data Exchange (ETDEWEB)

Brossard, M; Kulka, Z [Clermont-Ferrand-2 Univ., 63 - Aubiere (France). Lab. de Physique Corpusculaire

1979-03-15

A 16-channel analog store and multiplexer unit is described. The unit enables storing and selection of analog information which is then digitally encoded by single ADC. This solution becomes economically attractive particularly in multidetector pulse height analysis systems.

Mode division multiplexing over 19-cell hollow-core photonic bandgap fibre by employing integrated mode multiplexer

NARCIS (Netherlands)

Chen, H.; Uden, van R.G.H.; Okonkwo, C.M.; Jung, Y.; Wheeler, N.V.; Fokoua, E.N.; Baddela, N.; Petrovich, M.N.; Poletti, F.; Richardson, D.J.; Raz, O.; Waardt, de H.; Koonen, A.M.J.

2014-01-01

A photonic integrated mode coupler based on silicon-on-insulator is employed for mode division multiplexing (MDM) over a 193 m 19-cell hollow-core photonic bandgap fibre (HC-PBGF) with a -3 dB bandwidth >120 nm. Robust MDM transmissions using LP01 and LP11 modes, and two degenerate LP11 modes (LP11a

A capillary-based multiplexed isothermal nucleic acid-based test for sexually transmitted diseases in patients.

Science.gov (United States)

Xu, Gaolian; Zhao, Hang; Cooper, Jonathan M; Reboud, Julien

2016-10-06

We demonstrate a multiplexed loop mediated isothermal amplification (LAMP) assay for infectious disease diagnostics, where the analytical process flow of target pathogens genomic DNA is performed manually by moving magnetic beads through a series of plugs in a capillary. Heat is provided by a water bath and the results are read by the naked eye, enabling applications in low resource settings.

Air plasma processing of poly(methyl methacrylate) micro-beads: Surface characterisations

International Nuclear Information System (INIS)

Liu Chaozong; Cui Naiyi; Osbeck, Susan; Liang He

2012-01-01

Highlights: ► PMMA micro-beads were processed using a rotary air plasma reactor. ► Surface chemistry and surface texture of PMMA micro-beads were characterised. ► Surface wettability was evaluated using “floating” water contact angle method. ► Surface oxidation and texture changes induced by air plasma attributed to the improvement of surface wettability. - Abstract: This paper reports the surface processing of poly(methyl methacrylate) (PMMA) micro-beads by using a rotary air plasma reactor, and its effects on surface properties. The surface properties, including surface wettability, surface chemistry and textures of the PMMA beads, were characterised. It was observed that the air plasma processing can improve the surface wettability of the PMMA microbeads significantly. A 15 min plasma processing can reduce the surface water contact angle of PMMA beads to about 50° from its original value of 80.3°. This was accompanied by about 8% increase in surface oxygen concentration as confirmed by XPS analysis. The optical profilometry examination revealed the air plasma processing resulted in a rougher surface that has a “delicate” surface texture. It is concluded that the surface chemistry and texture, induced by air plasma processing, co-contributed to the surface wettability improvement of PMMA micro-beads.

Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

Science.gov (United States)

Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

2013-05-01

This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

Electrolytic plasma processing of steel surfaces

International Nuclear Information System (INIS)

Bejar, M.A; Araya, R.N; Baeza, B

2006-01-01

The thermo-chemical treatments of steels with plasma is normally carried out in low-pressure ionized gaseous atmospheres. Among the treatments used most often are: nitruration, carburization and boronized. A plasma can also generate at atmospheric pressure. One way to produce it is with an electrochemical cell that works at a relatively high inter-electrode voltage and under conditions of heavy gas generation. This type of plasma is known as electrolytic plasma. This work studies the feasibility of using electrolytic plasma for the surface processing of steels. Two processes were selected: boronized and nitruration., for the hardening of two types of steel: one with low carbon (1020) and one with low alloy (4140). In the case of the nitruration, the 1020 steel was first aluminized. The electrolytes were aqueous solutions of borax for the boronizing and urea for the nitruration. The electrolytic plasmas were classified qualitatively, in relation with their luminosity by low, medium and high intensity. The boronizing was carried out with low intensity plasmas for a period of one hour. The nitruration was performed with plasmas of different intensities and for period of a few minutes to half an hour. The test pieces processed by electrolytic plasma were characterized by micro-hardness tests and X-ray diffraction. The maximum surface hardnesses obtained for the 1020 and 4140 steels were the following: 300 and 700 HV for the boronizing, and 1650 and 1200 HV for the nitruration, respectively. The utilization of an electrolytic plasma permits the surface processing of steels, noticeably increasing their hardness. With this type of plasma some thermo-chemical surface treatments can be done very rapidly as well (CW)

Front-end multiplexing—applied to SQUID multiplexing: Athena X-IFU and QUBIC experiments

Science.gov (United States)

Prele, D.

2015-08-01

As we have seen for digital camera market and a sensor resolution increasing to "megapixels", all the scientific and high-tech imagers (whatever the wave length - from radio to X-ray range) tends also to always increases the pixels number. So the constraints on front-end signals transmission increase too. An almost unavoidable solution to simplify integration of large arrays of pixels is front-end multiplexing. Moreover, "simple" and "efficient" techniques allow integration of read-out multiplexers in the focal plane itself. For instance, CCD (Charge Coupled Device) technology has boost number of pixels in digital camera. Indeed, this is exactly a planar technology which integrates both the sensors and a front-end multiplexed readout. In this context, front-end multiplexing techniques will be discussed for a better understanding of their advantages and their limits. Finally, the cases of astronomical instruments in the millimeter and in the X-ray ranges using SQUID (Superconducting QUantum Interference Device) will be described.

Front-end multiplexing—applied to SQUID multiplexing: Athena X-IFU and QUBIC experiments

International Nuclear Information System (INIS)

Prele, D.

2015-01-01

As we have seen for digital camera market and a sensor resolution increasing to 'megapixels', all the scientific and high-tech imagers (whatever the wave length - from radio to X-ray range) tends also to always increases the pixels number. So the constraints on front-end signals transmission increase too. An almost unavoidable solution to simplify integration of large arrays of pixels is front-end multiplexing. Moreover, 'simple' and 'efficient' techniques allow integration of read-out multiplexers in the focal plane itself. For instance, CCD (Charge Coupled Device) technology has boost number of pixels in digital camera. Indeed, this is exactly a planar technology which integrates both the sensors and a front-end multiplexed readout. In this context, front-end multiplexing techniques will be discussed for a better understanding of their advantages and their limits. Finally, the cases of astronomical instruments in the millimeter and in the X-ray ranges using SQUID (Superconducting QUantum Interference Device) will be described

Surface processing: existing and potential applications of ultraviolet light.

Science.gov (United States)

Manzocco, Lara; Nicoli, Maria Cristina

2015-01-01

Solid foods represent optimal matrices for ultraviolet processing with effects well beyond nonthermal surface disinfection. UV radiation favors hormetic response in plant tissues and degradation of toxic compound on the product surface. Photoinduced reactions can also provide unexplored possibilities to steer structure and functionality of food biopolymers. The possibility to extensively exploit this technology will depend on availability of robust information about efficacious processing conditions and adequate strategies to completely and homogeneously process food surface.

Recent Progress in Space-Division Multiplexed Transmission Technologies

DEFF Research Database (Denmark)

Morioka, Toshio

2013-01-01

Recent development of transmission technologies based on space-division multiplexing is described with future perspectives including a recent achievement of one Pb/s transmission in a single strand of fiber....

All-Optical Regeneration System for Optical Wavelength Division Multiplexed Communication Systems

DEFF Research Database (Denmark)

2014-01-01

The invention relates to an all-optical regeneration system for regeneration of optical wavelength division multiplexed WDM data signals in an optical WDM communication system. The system comprises a WDM-to-Optical time domain multiplexing OTDM, WDM-to-OTDM, converter, capable of converting....... The system additionally comprises an OTDM-to-WDM converter for converting the output OTDM data signal to an output WDM data signal. An input of the all-optical regenerator unit is in optical communication with an output of the WDM-to-OTDM converter, and an output of the all-optical regenerator unit...... an input WDM data signal comprising multiple wavelength channels into an input OTDM data signal comprising multiple time multiplexed time channels. The system further comprises an all-optical regenerator unit being configured for regenerating the input OTDM data signal into an output OTDM data signal...

Infrared spectral reflectances of asteroid surfaces

Science.gov (United States)

Larson, H. P.; Veeder, G. J.

1979-01-01

This review compares the types of compositional information produced by three complementary techniques used in infrared observations of asteroid surfaces: broadband JHKL photometry, narrow band photometry, and multiplex spectroscopy. The high information content of these infrared observations permits definitive interpretations of asteroid surface compositions in terms of the major meteoritic minerals (olivine, pyroxene, plagioclase feldspar, hydrous silicates, and metallic Ni-Fe). These studies emphasize the individuality of asteroid surface compositions, the inadequacy of simple comparisons with spectra of meteorites, and the need to coordinate spectral measurements of all types to optimize diagnostic capabilities.

Multiplex engineering of industrial yeast genomes using CRISPRm.

Science.gov (United States)

Ryan, Owen W; Cate, Jamie H D

2014-01-01

Global demand has driven the use of industrial strains of the yeast Saccharomyces cerevisiae for large-scale production of biofuels and renewable chemicals. However, the genetic basis of desired domestication traits is poorly understood because robust genetic tools do not exist for industrial hosts. We present an efficient, marker-free, high-throughput, and multiplexed genome editing platform for industrial strains of S. cerevisiae that uses plasmid-based expression of the CRISPR/Cas9 endonuclease and multiple ribozyme-protected single guide RNAs. With this multiplex CRISPR (CRISPRm) system, it is possible to integrate DNA libraries into the chromosome for evolution experiments, and to engineer multiple loci simultaneously. The CRISPRm tools should therefore find use in many higher-order synthetic biology applications to accelerate improvements in industrial microorganisms.

Chasing halorespirers: High throughput multiplex detection of dechlorinating bacteria using Pri-Lock probes

Energy Technology Data Exchange (ETDEWEB)

Maphosa, F.; Doorn, R. van; Vos, W. de; Cor Schoen, C.; Smidt, H.

2009-07-01

Bioremediation management strategies for sites contaminated with chlorinated compounds require monitoring technologies that enable simultaneous detection and quantification of a wide range of microorganisms involved in reductive dechlorination. Many multiplex, quantitative detection methods available suffer from compromises between the level of multiplexing, throughput and accuracy of quantification. (Author)

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

Directory of Open Access Journals (Sweden)

Zhiyuan Wu

2014-01-01

Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

Science.gov (United States)

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

Distributed MIMO chaotic radar based on wavelength-division multiplexing technology.

Science.gov (United States)

Yao, Tingfeng; Zhu, Dan; Ben, De; Pan, Shilong

2015-04-15

A distributed multiple-input multiple-output chaotic radar based on wavelength-division multiplexing technology (WDM) is proposed and demonstrated. The wideband quasi-orthogonal chaotic signals generated by different optoelectronic oscillators (OEOs) are emitted by separated antennas to gain spatial diversity against the fluctuation of a target's radar cross section and enhance the detection capability. The received signals collected by the receive antennas and the reference signals from the OEOs are delivered to the central station for joint processing by exploiting WDM technology. The centralized signal processing avoids precise time synchronization of the distributed system and greatly simplifies the remote units, which improves the localization accuracy of the entire system. A proof-of-concept experiment for two-dimensional localization of a metal target is demonstrated. The maximum position error is less than 6.5 cm.

Authentication of Meat Species in Sucuk by Multiplex PCR

Directory of Open Access Journals (Sweden)

Osman İrfan İLHAK

2015-01-01

Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

Multiplexed Western Blotting Using Microchip Electrophoresis.

Science.gov (United States)

Jin, Shi; Furtaw, Michael D; Chen, Huaxian; Lamb, Don T; Ferguson, Stephen A; Arvin, Natalie E; Dawod, Mohamed; Kennedy, Robert T

2016-07-05

Western blotting is a commonly used protein assay that combines the selectivity of electrophoretic separation and immunoassay. The technique is limited by long time, manual operation with mediocre reproducibility, and large sample consumption, typically 10-20 μg per assay. Western blots are also usually used to measure only one protein per assay with an additional housekeeping protein for normalization. Measurement of multiple proteins is possible; however, it requires stripping membranes of antibody and then reprobing with a second antibody. Miniaturized alternatives to Western blot based on microfluidic or capillary electrophoresis have been developed that enable higher-throughput, automation, and greater mass sensitivity. In one approach, proteins are separated by electrophoresis on a microchip that is dragged along a polyvinylidene fluoride membrane so that as proteins exit the chip they are captured on the membrane for immunoassay. In this work, we improve this method to allow multiplexed protein detection. Multiple injections made from the same sample can be deposited in separate tracks so that each is probed with a different antibody. To further enhance multiplexing capability, the electrophoresis channel dimensions were optimized for resolution while keeping separation and blotting times to less than 8 min. Using a 15 μm deep × 50 μm wide × 8.6 cm long channel, it is possible to achieve baseline resolution of proteins that differ by 5% in molecular weight, e.g., ERK1 (44 kDa) from ERK2 (42 kDa). This resolution allows similar proteins detected by cross-reactive antibodies in a single track. We demonstrate detection of 11 proteins from 9 injections from a single Jurkat cell lysate sample consisting of 400 ng of total protein using this procedure. Thus, multiplexed Western blots are possible without cumbersome stripping and reprobing steps.

Multiplex serology of paraneoplastic antineuronal antibodies.

Science.gov (United States)

Maat, Peter; Brouwer, Eric; Hulsenboom, Esther; VanDuijn, Martijn; Schreurs, Marco W J; Hooijkaas, Herbert; Smitt, Peter A E Sillevis

2013-05-31

Paraneoplastic neurological syndromes (PNS) are devastating neurological disorders secondary to cancer, associated with onconeural autoantibodies. Such antibodies are directed against neuronal antigens aberrantly expressed by the tumor. The detection of onconeural antibodies in a patient is extremely important in diagnosing a neurological syndrome as paraneoplastic (70% is not yet known to have cancer) and in directing the search for the underlying neoplasm. At present six onconeural antibodies are considered 'well characterized' and recognize the antigens HuD, CDR62 (Yo), amphiphysin, CRMP-5 (CV2), NOVA-1 (Ri), and Ma2. The gold standard of detection is the characteristic immunohistochemical staining pattern on brain tissue sections combined with confirmation by immunoblotting using recombinant purified proteins. Since all six onconeural antibodies are usually analyzed simultaneously and objective cut-off values for these analyses are warranted, we developed a multiplex assay based on Luminex technology. Reaction of serial dilutions of six onconeural standard sera with microsphere-bound antigens showed lower limits of detection than with Western blotting. Using the six standard sera at a dilution of 1:200, the average within-run coefficient of variation (CV) was 4% (range 1.9-7.3%). The average between-run within-day CV was 5.1% (range 2.9-6.7%) while the average between-day CV was 8.1% (range 2.8-11.6%). The shelf-life of the antigen coupled microspheres was at least two months. The sensitivity of the multiplex assay ranged from 83% (Ri) to 100% (Yo, amphiphysin, CV2) and the specificity from 96% (CV2) to 100% (Ri). In conclusion, Luminex-based multiplex serology is highly reproducible with high sensitivity and specificity for the detection of onconeural antibodies. Conventional immunoblotting for diagnosis of onconeural antibodies in the setting of a routine laboratory may be replaced by this novel, robust technology. Copyright © 2013 Elsevier B.V. All rights

Highly efficient volume hologram multiplexing in thick dye-doped jelly-like gelatin.

Science.gov (United States)

Katarkevich, Vasili M; Rubinov, Anatoli N; Efendiev, Terlan Sh

2014-08-01

Dye-doped jelly-like gelatin is a thick-layer self-developing photosensitive medium that allows single and multiplexed volume phase holograms to be successfully recorded using pulsed laser radiation. In this Letter, we present a method for multiplexed recording of volume holograms in a dye-doped jelly-like gelatin, which provides significant increase in their diffraction efficiency. The method is based on the recovery of the photobleached dye molecule concentration in the hologram recording zone of gel, thanks to molecule diffusion from other unexposed gel areas. As an example, an optical recording of a multiplexed hologram consisting of three superimposed Bragg gratings with mean values of the diffraction efficiency and angular selectivity of ∼75% and ∼21', respectively, is demonstrated by using the proposed method.

A high-throughput multiplex method adapted for GMO detection.

Science.gov (United States)

Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique

2008-12-24

A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.

Non-identical multiplexing promotes chimera states

Science.gov (United States)

Ghosh, Saptarshi; Zakharova, Anna; Jalan, Sarika

2018-01-01

We present the emergence of chimeras, a state referring to coexistence of partly coherent, partly incoherent dynamics in networks of identical oscillators, in a multiplex network consisting of two non-identical layers which are interconnected. We demonstrate that the parameter range displaying the chimera state in the homogeneous first layer of the multiplex networks can be tuned by changing the link density or connection architecture of the same nodes in the second layer. We focus on the impact of the interconnected second layer on the enlargement or shrinking of the coupling regime for which chimeras are displayed in the homogeneous first layer. We find that a denser homogeneous second layer promotes chimera in a sparse first layer, where chimeras do not occur in isolation. Furthermore, while a dense connection density is required for the second layer if it is homogeneous, this is not true if the second layer is inhomogeneous. We demonstrate that a sparse inhomogeneous second layer which is common in real-world complex systems can promote chimera states in a sparse homogeneous first layer.

Opinion formation on multiplex scale-free networks

Science.gov (United States)

Nguyen, Vu Xuan; Xiao, Gaoxi; Xu, Xin-Jian; Li, Guoqi; Wang, Zhen

2018-01-01

Most individuals, if not all, live in various social networks. The formation of opinion systems is an outcome of social interactions and information propagation occurring in such networks. We study the opinion formation with a new rule of pairwise interactions in the novel version of the well-known Deffuant model on multiplex networks composed of two layers, each of which is a scale-free network. It is found that in a duplex network composed of two identical layers, the presence of the multiplexity helps either diminish or enhance opinion diversity depending on the relative magnitudes of tolerance ranges characterizing the degree of openness/tolerance on both layers: there is a steady separation between different regions of tolerance range values on two network layers where multiplexity plays two different roles, respectively. Additionally, the two critical tolerance ranges follow a one-sum rule; that is, each of the layers reaches a complete consensus only if the sum of the tolerance ranges on the two layers is greater than a constant approximately equaling 1, the double of the critical bound on a corresponding isolated network. A further investigation of the coupling between constituent layers quantified by a link overlap parameter reveals that as the layers are loosely coupled, the two opinion systems co-evolve independently, but when the inter-layer coupling is sufficiently strong, a monotonic behavior is observed: an increase in the tolerance range of a layer causes a decline in the opinion diversity on the other layer regardless of the magnitudes of tolerance ranges associated with the layers in question.

Pilot-multiplexed continuous-variable quantum key distribution with a real local oscillator

Science.gov (United States)

Wang, Tao; Huang, Peng; Zhou, Yingming; Liu, Weiqi; Zeng, Guihua

2018-01-01

We propose a pilot-multiplexed continuous-variable quantum key distribution (CVQKD) scheme based on a local local oscillator (LLO). Our scheme utilizes time-multiplexing and polarization-multiplexing techniques to dramatically isolate the quantum signal from the pilot, employs two heterodyne detectors to separately detect the signal and the pilot, and adopts a phase compensation method to almost eliminate the multifrequency phase jitter. In order to analyze the performance of our scheme, a general LLO noise model is constructed. Besides the phase noise and the modulation noise, the photon-leakage noise from the reference path and the quantization noise due to the analog-to-digital converter (ADC) are also considered, which are first analyzed in the LLO regime. Under such general noise model, our scheme has a higher key rate and longer secure distance compared with the preexisting LLO schemes. Moreover, we also conduct an experiment to verify our pilot-multiplexed scheme. Results show that it maintains a low level of the phase noise and is expected to obtain a 554-Kbps secure key rate within a 15-km distance under the finite-size effect.

High-throughput screening of cellulase F mutants from multiplexed plasmid sets using an automated plate assay on a functional proteomic robotic workcell

Directory of Open Access Journals (Sweden)

Qureshi Nasib

2006-05-01

Full Text Available Abstract Background The field of plasmid-based functional proteomics requires the rapid assay of proteins expressed from plasmid libraries. Automation is essential since large sets of mutant open reading frames are being cloned for evaluation. To date no integrated automated platform is available to carry out the entire process including production of plasmid libraries, expression of cloned genes, and functional testing of expressed proteins. Results We used a functional proteomic assay in a multiplexed setting on an integrated plasmid-based robotic workcell for high-throughput screening of mutants of cellulase F, an endoglucanase from the anaerobic fungus Orpinomyces PC-2. This allowed us to identify plasmids containing optimized clones expressing mutants with improved activity at lower pH. A plasmid library of mutagenized clones of the celF gene with targeted variations in the last four codons was constructed by site-directed PCR mutagenesis and transformed into Escherichia coli. A robotic picker integrated into the workcell was used to inoculate medium in a 96-well deep well plate, combining the transformants into a multiplexed set in each well, and the plate was incubated on the workcell. Plasmids were prepared from the multiplexed culture on the liquid handler component of the workcell and used for in vitro transcription/translation. The multiplexed expressed recombinant proteins were screened for improved activity and stability in an azo-carboxymethylcellulose plate assay. The multiplexed wells containing mutants with improved activity were identified and linked back to the corresponding multiplexed cultures stored in glycerol. Spread plates were prepared from the glycerol stocks and the workcell was used to pick single colonies from the spread plates, prepare plasmid, produce recombinant protein, and assay for activity. The screening assay and subsequent deconvolution of the multiplexed wells resulted in identification of improved Cel

Graphene nano-ink biosensor arrays on a microfluidic paper for multiplexed detection of metabolites

Energy Technology Data Exchange (ETDEWEB)

Labroo, Pratima; Cui, Yue, E-mail: yue.cui@usu.edu

2014-02-01

Graphical abstract: - Highlights: • We report graphene-ink biosensor arrays on a microfluidic paper for metabolites. • The device is able to detect multiple metabolites sensitively and rapidly. • The device fabrication process is simple and inexpensive. - Abstract: The development of a miniaturized and low-cost platform for the highly sensitive, selective and rapid detection of multiplexed metabolites is of great interest for healthcare, pharmaceuticals, food science, and environmental monitoring. Graphene is a delicate single-layer, two-dimensional network of carbon atoms with extraordinary electrical sensing capability. Microfluidic paper with printing technique is a low cost matrix. Here, we demonstrated the development of graphene-ink based biosensor arrays on a microfluidic paper for the multiplexed detection of different metabolites, such as glucose, lactate, xanthine and cholesterol. Our results show that the graphene biosensor arrays can detect multiple metabolites on a microfluidic paper sensitively, rapidly and simultaneously. The device exhibits a fast measuring time of less than 2 min, a low detection limit of 0.3 μM, and a dynamic detection range of 0.3–15 μM. The process is simple and inexpensive to operate and requires a low consumption of sample volume. We anticipate that these results could open exciting opportunities for a variety of applications.

An investigation of laser processing of silica surfaces

International Nuclear Information System (INIS)

Weber, A.J.; Stewart, A.F.; Exarhos, G.J.; Stowell, W.K.

1988-01-01

An initial set of experiments has been conducted to determine the practicality of laser processing of optical substrates. In contrast to earlier work, a high average power CO 2 laser was used to flood load the entire surface of each test sample. Fused silica substrates were laser polished on both surfaces at power densities ranging from 150 to 350 W/cm 2 . During each test sequence sample surface temperatures were recorded using a thermal imaging system. Extensive pre- and post-test characterization revealed that surface roughness and scattering of bare silica surfaces were reduced while internal stress increased. Laser damage thresholds were found to increase only for certain conditions. Changes in the microstructure were observed. These preliminary experiments demonstrate that laser processing can dramatically improve the optical properties of fused silica substrates

Multiplex network analysis of employee performance and employee social relationships

Science.gov (United States)

Cai, Meng; Wang, Wei; Cui, Ying; Stanley, H. Eugene

2018-01-01

In human resource management, employee performance is strongly affected by both formal and informal employee networks. Most previous research on employee performance has focused on monolayer networks that can represent only single categories of employee social relationships. We study employee performance by taking into account the entire multiplex structure of underlying employee social networks. We collect three datasets consisting of five different employee relationship categories in three firms, and predict employee performance using degree centrality and eigenvector centrality in a superimposed multiplex network (SMN) and an unfolded multiplex network (UMN). We use a quadratic assignment procedure (QAP) analysis and a regression analysis to demonstrate that the different categories of relationship are mutually embedded and that the strength of their impact on employee performance differs. We also use weighted/unweighted SMN/UMN to measure the predictive accuracy of this approach and find that employees with high centrality in a weighted UMN are more likely to perform well. Our results shed new light on how social structures affect employee performance.

Bridging online and offline social networks: Multiplex analysis

Science.gov (United States)

Filiposka, Sonja; Gajduk, Andrej; Dimitrova, Tamara; Kocarev, Ljupco

2017-04-01

We show that three basic actor characteristics, namely normalized reciprocity, three cycles, and triplets, can be expressed using an unified framework that is based on computing the similarity index between two sets associated with the actor: the set of her/his friends and the set of those considering her/him as a friend. These metrics are extended to multiplex networks and then computed for two friendship networks generated by collecting data from two groups of undergraduate students. We found that in offline communication strong and weak ties are (almost) equally presented, while in online communication weak ties are dominant. Moreover, weak ties are much less reciprocal than strong ties. However, across different layers of the multiplex network reciprocities are preserved, while triads (measured with normalized three cycles and triplets) are not significant.

Mirror node correlations tuning synchronization in multiplex networks

Science.gov (United States)

Kumar, Anil; Baptista, Murilo S.; Zaikin, Alexey; Jalan, Sarika

2017-12-01

We show that the degree-degree correlations have a major impact on global synchronizability (GS) of multiplex networks, enabling the specification of synchronizability by only changing the degree-degree correlations of the mirror nodes while maintaining the connection architecture of the individual layer unaltered. If individual layers have nodes that are mildly correlated, the multiplex network is best synchronizable when the mirror degrees are strongly negatively correlated. If individual layers have nodes with strong degree-degree correlations, mild correlations among the degrees of mirror nodes are the best strategy for the optimization of GS. Global synchronization also depend on the density of connections, a phenomenon not observed in a single layer network. The results are crucial to understand, predict, and specify behavior of systems having multiple types of connections among the interacting units.

Roles of the spreading scope and effectiveness in spreading dynamics on multiplex networks

Science.gov (United States)

Li, Ming; Liu, Run-Ran; Peng, Dan; Jia, Chun-Xiao; Wang, Bing-Hong

2018-02-01

Comparing with single networks, the multiplex networks bring two main effects on the spreading process among individuals. First, the pathogen or information can be transmitted to more individuals through different layers at one time, which enlarges the spreading scope. Second, through different layers, an individual can also transmit the pathogen or information to the same individuals more than once at one time, which makes the spreading more effective. To understand the different roles of the spreading scope and effectiveness, we propose an epidemic model on multiplex networks with link overlapping, where the spreading effectiveness of each interaction as well as the variety of channels (spreading scope) can be controlled by the number of overlapping links. We find that for Poisson degree distribution, increasing the epidemic scope (the first effect) is more efficient than enhancing epidemic probability (the second effect) to facilitate the spreading process. However, for power-law degree distribution, the effects of the two factors on the spreading dynamics become complicated. Enhancing epidemic probability makes pathogen or rumor easier to outbreak in a finite system. But after that increasing epidemic scopes is still more effective for a wide spreading. Theoretical results along with reasonable explanation for these phenomena are all given in this paper, which indicates that the epidemic scope could play an important role in the spreading dynamics.

A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

Science.gov (United States)

Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

2016-08-01

A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

Science.gov (United States)

Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

2017-01-01

Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Angular multiplexing holograms of four images recorded on photopolymer films with recording-film-thickness-dependent holographic characteristics

Science.gov (United States)

Osabe, Keiichi; Kawai, Kotaro

2017-03-01

In this study, angular multiplexing hologram recording photopolymer films were studied experimentally. The films contained acrylamide as a monomer, eosin Y as a sensitizer, and triethanolamine as a promoter in a polyvinyl alcohol matrix. In order to determine the appropriate thickness of the photopolymer films for angular multiplexing, photopolymer films with thicknesses of 29-503 μm were exposed to two intersecting beams of a YVO laser at a wavelength of 532 nm to form a holographic grating with a spatial frequency of 653 line/mm. The diffraction efficiencies as a function of the incident angle of reconstruction were measured. A narrow angular bandwidth and high diffraction efficiency are required for angular multiplexing; hence, we define the Q value, which is the diffraction efficiency divided by half the bandwidth. The Q value of the films depended on the thickness of the films, and was calculated based on the measured diffraction efficiencies. The Q value of a 297-μm-thick film was the highest of the all films. Therefore, the angular multiplexing experiments were conducted using 300-μm-thick films. In the angular multiplexing experiments, the object beam transmitted by a square aperture was focused by a Fourier transform lens and interfered with a reference beam. The maximum order of angular multiplexing was four. The signal intensity that corresponds to the squared-aperture transmission and the noise intensity that corresponds to transmission without the square aperture were measured. The signal intensities decreased as the order of angular multiplexing increased, and the noise intensities were not dependent on the order of angular multiplexing.

Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples

Science.gov (United States)

Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris

2002-01-01

A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951

Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

Science.gov (United States)

Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

2012-11-14

DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

Method for assessing the reliability of molecular diagnostics based on multiplexed SERS-coded nanoparticles.

Directory of Open Access Journals (Sweden)

Steven Y Leigh

Full Text Available Surface-enhanced Raman scattering (SERS nanoparticles have been engineered to generate unique fingerprint spectra and are potentially useful as bright contrast agents for molecular diagnostics. One promising strategy for biomedical diagnostics and imaging is to functionalize various particle types ("flavors", each emitting a unique spectral signature, to target a large multiplexed panel of molecular biomarkers. While SERS particles emit narrow spectral features that allow them to be easily separable under ideal conditions, the presence of competing noise sources and background signals such as detector noise, laser background, and autofluorescence confounds the reliability of demultiplexing algorithms. Results obtained during time-constrained in vivo imaging experiments may not be reproducible or accurate. Therefore, our goal is to provide experimentalists with a metric that may be monitored to enforce a desired bound on accuracy within a user-defined confidence level. We have defined a spectral reliability index (SRI, based on the output of a direct classical least-squares (DCLS demultiplexing routine, which provides a measure of the reliability of the computed nanoparticle concentrations and ratios. We present simulations and experiments to demonstrate the feasibility of this strategy, which can potentially be utilized for a range of instruments and biomedical applications involving multiplexed SERS nanoparticles.

Flow Cytometry Enables Multiplexed Measurements of Genetically Encoded Intramolecular FRET Sensors Suitable for Screening.

Science.gov (United States)

Doucette, Jaimee; Zhao, Ziyan; Geyer, Rory J; Barra, Melanie M; Balunas, Marcy J; Zweifach, Adam

2016-07-01

Genetically encoded sensors based on intramolecular FRET between CFP and YFP are used extensively in cell biology research. Flow cytometry has been shown to offer a means to measure CFP-YFP FRET; we suspected it would provide a unique way to conduct multiplexed measurements from cells expressing different FRET sensors, which is difficult to do with microscopy, and that this could be used for screening. We confirmed that flow cytometry accurately measures FRET signals using cells transiently transfected with an ERK activity reporter, comparing responses measured with imaging and cytometry. We created polyclonal long-term transfectant lines, each expressing a different intramolecular FRET sensor, and devised a way to bar-code four distinct populations of cells. We demonstrated the feasibility of multiplexed measurements and determined that robust multiplexed measurements can be conducted in plate format. To validate the suitability of the method for screening, we measured responses from a plate of bacterial extracts that in unrelated experiments we had determined contained the protein kinase C (PKC)-activating compound teleocidin A-1. The multiplexed assay correctly identifying the teleocidin A-1-containing well. We propose that multiplexed cytometric FRET measurements will be useful for analyzing cellular function and for screening compound collections. © 2016 Society for Laboratory Automation and Screening.

Spin and wavelength multiplexed nonlinear metasurface holography

Science.gov (United States)

Ye, Weimin; Zeuner, Franziska; Li, Xin; Reineke, Bernhard; He, Shan; Qiu, Cheng-Wei; Liu, Juan; Wang, Yongtian; Zhang, Shuang; Zentgraf, Thomas

2016-06-01

Metasurfaces, as the ultrathin version of metamaterials, have caught growing attention due to their superior capability in controlling the phase, amplitude and polarization states of light. Among various types of metasurfaces, geometric metasurface that encodes a geometric or Pancharatnam-Berry phase into the orientation angle of the constituent meta-atoms has shown great potential in controlling light in both linear and nonlinear optical regimes. The robust and dispersionless nature of the geometric phase simplifies the wave manipulation tremendously. Benefitting from the continuous phase control, metasurface holography has exhibited advantages over conventional depth controlled holography with discretized phase levels. Here we report on spin and wavelength multiplexed nonlinear metasurface holography, which allows construction of multiple target holographic images carried independently by the fundamental and harmonic generation waves of different spins. The nonlinear holograms provide independent, nondispersive and crosstalk-free post-selective channels for holographic multiplexing and multidimensional optical data storages, anti-counterfeiting, and optical encryption.

Interplay of delay and multiplexing: Impact on cluster synchronization

Science.gov (United States)

Singh, Aradhana; Jalan, Sarika; Boccaletti, Stefano

2017-04-01

Communication delays and multiplexing are ubiquitous features of real-world network systems. We here introduce a simple model where these two features are simultaneously present and report the rich phenomenology which is actually due to their interplay on cluster synchronization. A delay in one layer has non trivial impacts on the collective dynamics of the other layers, enhancing or suppressing synchronization. At the same time, multiplexing may also enhance cluster synchronization of delayed layers. We elucidate several nontrivial (and anti-intuitive) scenarios, which are of interest and potential application in various real-world systems, where the introduction of a delay may render synchronization of a layer robust against changes in the properties of the other layers.

Telemetry Standards, RCC Standard 106-17. Chapter 3. Frequency Division Multiplexing Telemetry Standards

Science.gov (United States)

2017-07-01

Standard 106-17 Chapter 3, July 2017 3-5 Table 3-4. Constant-Bandwidth FM Subcarrier Channels Frequency Criteria\\Channels: A B C D E F G H Deviation ...Telemetry Standards , RCC Standard 106-17 Chapter 3, July 2017 3-i CHAPTER 3 Frequency Division Multiplexing Telemetry Standards Acronyms...Frequency Division Multiplexing Telemetry Standards ................................ 3-1 3.1 General

Ultra high speed optical transmission using subcarrier-multiplexed four-dimensional LDPC-coded modulation.

Science.gov (United States)

Batshon, Hussam G; Djordjevic, Ivan; Schmidt, Ted

2010-09-13

We propose a subcarrier-multiplexed four-dimensional LDPC bit-interleaved coded modulation scheme that is capable of achieving beyond 480 Gb/s single-channel transmission rate over optical channels. Subcarrier-multiplexed four-dimensional LDPC coded modulation scheme outperforms the corresponding dual polarization schemes by up to 4.6 dB in OSNR at BER 10(-8).

A robust and scalable neuromorphic communication system by combining synaptic time multiplexing and MIMO-OFDM.

Science.gov (United States)

Srinivasa, Narayan; Zhang, Deying; Grigorian, Beayna

2014-03-01

This paper describes a novel architecture for enabling robust and efficient neuromorphic communication. The architecture combines two concepts: 1) synaptic time multiplexing (STM) that trades space for speed of processing to create an intragroup communication approach that is firing rate independent and offers more flexibility in connectivity than cross-bar architectures and 2) a wired multiple input multiple output (MIMO) communication with orthogonal frequency division multiplexing (OFDM) techniques to enable a robust and efficient intergroup communication for neuromorphic systems. The MIMO-OFDM concept for the proposed architecture was analyzed by simulating large-scale spiking neural network architecture. Analysis shows that the neuromorphic system with MIMO-OFDM exhibits robust and efficient communication while operating in real time with a high bit rate. Through combining STM with MIMO-OFDM techniques, the resulting system offers a flexible and scalable connectivity as well as a power and area efficient solution for the implementation of very large-scale spiking neural architectures in hardware.

Superhydrophobic coatings for aluminium surfaces synthesized by chemical etching process

Directory of Open Access Journals (Sweden)

Priya Varshney

2016-10-01

Full Text Available In this paper, the superhydrophobic coatings on aluminium surfaces were prepared by two-step (chemical etching followed by coating and one-step (chemical etching and coating in a single step processes using potassium hydroxide and lauric acid. Besides, surface immersion time in solutions was varied in both processes. Wettability and surface morphologies of treated aluminium surfaces were characterized using contact angle measurement technique and scanning electron microscopy, respectively. Microstructures are formed on the treated aluminium surfaces which lead to increase in contact angle of the surface (>150°. Also on increasing immersion time, contact angle further increases due to increase in size and depth of microstructures. Additionally, these superhydrophobic coatings show excellent self-cleaning and corrosion-resistant behavior. Water jet impact, floatation on water surface, and low temperature condensation tests assert the excellent water-repellent nature of coatings. Further, coatings are to be found mechanically, thermally, and ultraviolet stable. Along with, these coatings are found to be excellent regeneration ability as verified experimentally. Although aforesaid both processes generate durable and regenerable superhydrophobic aluminium surfaces with excellent self-cleaning, corrosion-resistant, and water-repellent characteristics, but one-step process is proved more efficient and less time consuming than two-step process and promises to produce superhydrophobic coatings for industrial applications.

Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods†

Science.gov (United States)

Jean, Julie; D'Souza, Doris H.; Jaykus, Lee-Ann

2004-01-01

Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10−1 reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 100 to 102 reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods. PMID:15528524

Multiplex nucleic acid sequence-based amplification for simultaneous detection of several enteric viruses in model ready-to-eat foods.

Science.gov (United States)

Jean, Julie; D'Souza, Doris H; Jaykus, Lee-Ann

2004-11-01

Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10(-1) reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 10(0) to 10(2) reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods.

Multiplex diagnosis of viral infectious diseases (AIDS, hepatitis C, and hepatitis A) based on point of care lateral flow assay using engineered proteinticles.

Science.gov (United States)

Lee, Jong-Hwan; Seo, Hyuk Seong; Kwon, Jung-Hyuk; Kim, Hee-Tae; Kwon, Koo Chul; Sim, Sang Jun; Cha, Young Joo; Lee, Jeewon

2015-07-15

Lateral flow assay (LFA) is an attractive method for rapid, simple, and cost-effective point of care diagnosis. For LFA-based multiplex diagnosis of three viral intractable diseases (acquired immune deficiency syndrome and hepatitis C and A), here we developed proteinticle-based 7 different 3D probes that display different viral antigens on their surface, which were synthesized in Escherichia coli by self-assembly of human ferritin heavy chain that was already engineered by genetically linking viral antigens to its C-terminus. Each of the three test lines on LFA strip contains the proteinticle probes to detect disease-specific anti-viral antibodies. Compared to peptide probes, the proteinticle probes were evidently more sensitive, and the proteinticle probe-based LFA successfully diagnosed all the 20 patient sera per each disease without a false negative signal, whereas the diagnostic sensitivities in the peptide probe-based LFAs were 65-90%. Duplex and triplex assays performed with randomly mixed patient sera gave only true positive signals for all the 20 serum mixtures without any false positive signals, indicating 100% sensitivity and 100% specificity. It seems that on the proteinticle surface the antigenic peptides have homogeneous orientation and conformation without inter-peptide clustering and hence lead to the enhanced diagnostic performance with solving the problems of traditional diagnostic probes. Although the multiplex diagnosis of three viral diseases above was demonstrated as proof-of-concept here, the proposed LFA system can be applied to multiplex point of care diagnosis of other intractable diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

Directory of Open Access Journals (Sweden)

V Hallur

2015-01-01

Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

Science.gov (United States)

Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

2016-01-25

We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

Science.gov (United States)

Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

2010-12-01

Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

A Novel Multiplex HRM Assay to Detect Clopidogrel Resistance.

Science.gov (United States)

Zhang, Lichen; Ma, Xiaowei; You, Guoling; Zhang, Xiaoqing; Fu, Qihua

2017-11-22

Clopidogrel is an antiplatelet medicine used to prevent blood clots in patients who have had a heart attack, stroke, or other symptoms. Variability in the clinical response to clopidogrel treatment has been attributed to genetic factors. In particular, five SNPs of rs4244285, rs4986893, rs12248560, rs662 and rs1045642 have been associated with resistance to clopidogrel therapy in Chinese population. This work involves the development of a multiplex high-resolution melting (HRM) assay to genotype all five of these loci in 2 tubes. Amplicons corresponding to distinct SNPs in a common tube were designed with the aid of uMelt prediction software to have different melting temperatures Tm by addition of a GC-rich tail to the 5' end of the certain primers. Two kinds of commercial methods, Digital Fluorescence Molecular Hybridization (DFMH) and Sanger sequencing, were used as a control. Three hundred sixteen DFMH pretested samples from consecutive acute coronary syndrome patients were used for a blinded study of multiplex HRM. The sensitivity of HRM was 100% and the specificity was 99.93% reflecting detection of variants other than the known resistance SNPs. Multiplex HRM is an effective closed-tube, highly accurate, fast, and inexpensive method for genotyping the 5 clopidogrel resistance associated SNPs.

Plasma nitriding - an eco friendly surface hardening process

International Nuclear Information System (INIS)

Mukherjee, S.

2015-01-01

Surface hardening is a process of heating the metal such that the surface gets only hardened. This process is adopted for many components like gears, cams, and crankshafts, which desire high hardness on the outer surface with a softer core to withstand the shocks. So, to attain such properties processes like carburising, nitriding, flame hardening and induction hardening are employed. Amongst these processes nitriding is the most commonly used process by many industries. In nitriding process the steel material is heated to a temperature of around 550 C and then exposed to atomic nitrogen. This atomic nitrogen reacts with iron and other alloying elements and forms nitrides, which are very hard in nature. By this process both wear resistance and hardness of the product can be increased. The atomic nitrogen required for this process can be obtained using ammonia gas (gas nitriding), cyanide based salt bath (liquid nitriding) and plasma medium (plasma nitriding). However, plasma nitriding has recently received considerable industrial interest owing to its characteristic of faster nitrogen penetration, short treatment time, low process temperature, minimal distortion, low energy use and easier control of layer formation compared with conventional techniques such as gas and liquid nitriding. This process can be used for all ferrous materials including stainless steels. Plasma nitriding is carried out using a gas mixture of nitrogen and hydrogen gas at sub atmospheric pressures hence, making it eco-friendly in nature. Plasma nitriding allows modification of the surface layers and hardness profiles by changing the gas mixture and temperature. The wide applicable temperature range enables a multitude of applications, beyond the possibilities of gas or salt bath processes. This has led to numerous applications of this process in industries such as the manufacture of machine parts for plastics and food processing, packaging and tooling as well as pumps and hydraulic, machine

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

Forensic typing of autosomal SNPs with a 29 SNP-multiplex--results of a collaborative EDNAP exercise.

Science.gov (United States)

Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N

2008-06-01

We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.

EDRN Pre-Validation of Multiplex Biomarker in Urine — EDRN Public Portal

Science.gov (United States)

The goal of this proposal is to begin to establish an EDRN “pre-validation” trial of a multiplex set of transcripts, including the ETS gene fusions, in post-DRE urine sediments. As can be evidenced by our preliminary data, we have established the utility of this multiplex urine test (which includes TMPRSS-ERG, SPINK1, PCA3 and GOLPH2) in a cohort of prospectively collected urine sediments from the University of Michigan EDRN CEVC site (collected by co-I, Dr. John Wei). In this proposal, we will run this multiplex assay on prospectively collected post-DRE urines collected from other EDRN sites. The idea is to couple this “pre-validation” study with an EDRN validation trial under consideration for the Gen-Probe PCA3 urine test (directed by Drs. John Wei and Harry Rittenhouse).

Carcinoma multiplex

International Nuclear Information System (INIS)

Shah, S. A.; Riaz, U.; Zahoor, I.; Jalil, A.; Zubair, M.

2013-01-01

Multiple primaries in a single patient are uncommon, though not very rare. The existence of such cancers in two un-related, non-paired organs is even more un-common. Here, we present a case of 55 years old male who presented to us with a mucoepidermoid carcinoma of the parotid gland and was operated. Later on, he presented with a large cystic swelling in the pelvis which turned out to be pseudomyxoma peritonei. A review of slides and immunohistochemistry indicated it to be adenocarcinoma colon. He presented again with recurrent mucoepidermoid carcinoma of the parotid which was operated successfully with the use of myocutaneous flap for wound closure. He is currently undergoing chemotherapy. In order to establish a separate mono-clonal etiology of both tumours, immunohistochemistry was performed. To the best of our knowledge, carcinoma multiplex in the colon and the parotid has never been reported before. (author)

Multiplexed Dosing Assays by Digitally Definable Hydrogel Volumes

DEFF Research Database (Denmark)

Faralli, Adele; Melander, Fredrik; Larsen, Esben Kjær Unmack

2016-01-01

Stable and low-cost multiplexed drug sensitivity assays using small volumes of cells or tissue are in demand for personalized medicine, including patientspecific combination chemotherapy. Spatially defined projected light photopolymerization of hydrogels with embedded active compounds is introduc...

Remote online process measurements by a fiber optic diode array spectrometer

International Nuclear Information System (INIS)

Van Hare, D.R.; Prather, W.S.; O'Rourke, P.E.

1986-01-01

The development of remote online monitors for radioactive process streams is an active research area at the Savannah River Laboratory (SRL). A remote offline spectrophotometric measurement system has been developed and used at the Savannah River Plant (SRP) for the past year to determine the plutonium concentration of process solution samples. The system consists of a commercial diode array spectrophotometer modified with fiber optic cables that allow the instrument to be located remotely from the measurement cell. Recently, a fiber optic multiplexer has been developed for this instrument, which allows online monitoring of five locations sequentially. The multiplexer uses a motorized micrometer to drive one of five sets of optical fibers into the optical path of the instrument. A sixth optical fiber is used as an external reference and eliminates the need to flush out process lines to re-reference the spectrophotometer. The fiber optic multiplexer has been installed in a process prototype facility to monitor uranium loading and breakthrough of ion exchange columns. The design of the fiber optic multiplexer is discussed and data from the prototype facility are presented to demonstrate the capabilities of the measurement system

A biplex approach to PageRank centrality: From classic to multiplex networks.

Science.gov (United States)

Pedroche, Francisco; Romance, Miguel; Criado, Regino

2016-06-01

In this paper, we present a new view of the PageRank algorithm inspired by multiplex networks. This new approach allows to introduce a new centrality measure for classic complex networks and a new proposal to extend the usual PageRank algorithm to multiplex networks. We give some analytical relations between these new approaches and the classic PageRank centrality measure, and we illustrate the new parameters presented by computing them on real underground networks.

A biplex approach to PageRank centrality: From classic to multiplex networks

Science.gov (United States)

Pedroche, Francisco; Romance, Miguel; Criado, Regino

2016-06-01

In this paper, we present a new view of the PageRank algorithm inspired by multiplex networks. This new approach allows to introduce a new centrality measure for classic complex networks and a new proposal to extend the usual PageRank algorithm to multiplex networks. We give some analytical relations between these new approaches and the classic PageRank centrality measure, and we illustrate the new parameters presented by computing them on real underground networks.

Beyond Multiplexing Gain in Large MIMO Systems

DEFF Research Database (Denmark)

Cakmak, Burak; Müller, Ralf R.; Fleury, Bernard Henri

growth (multiplexing gain). Even when the channel entries are i.i.d. the deviation from the linear growth is significant. We also find an additive property of the deviation for a concatenated MIMO system. Finally, we quantify the deviation of the large SNR capacity from the exact capacity and find...

Conversion of asynchronous 10 Gbit/s Ethernet NRZ frame into a synchronous RZ frame and multiplexing to 170 Gbit/s

DEFF Research Database (Denmark)

Laguardia Areal, Janaina; Hu, Hao; Palushani, Evarist

2010-01-01

This paper presents an optical circuit for frame synchronization and pulse compression of 10G Ethernet frames with 12000 bits and multiplexing to a 170 Gbit/s optical time division multiplexed data stream.......This paper presents an optical circuit for frame synchronization and pulse compression of 10G Ethernet frames with 12000 bits and multiplexing to a 170 Gbit/s optical time division multiplexed data stream....

Longitudinal Multiplexed Measurement of Quantitative Proteomic Signatures in Mouse Lymphoma Models Using Magneto-Nanosensors.

Science.gov (United States)

Lee, Jung-Rok; Appelmann, Iris; Miething, Cornelius; Shultz, Tyler O; Ruderman, Daniel; Kim, Dokyoon; Mallick, Parag; Lowe, Scott W; Wang, Shan X

2018-01-01

Cancer proteomics is the manifestation of relevant biological processes in cancer development. Thus, it reflects the activities of tumor cells, host-tumor interactions, and systemic responses to cancer therapy. To understand the causal effects of tumorigenesis or therapeutic intervention, longitudinal studies are greatly needed. However, most of the conventional mouse experiments are unlikely to accommodate frequent collection of serum samples with a large enough volume for multiple protein assays towards single-object analysis. Here, we present a technique based on magneto-nanosensors to longitudinally monitor the protein profiles in individual mice of lymphoma models using a small volume of a sample for multiplex assays. Methods: Drug-sensitive and -resistant cancer cell lines were used to develop the mouse models that render different outcomes upon the drug treatment. Two groups of mice were inoculated with each cell line, and treated with either cyclophosphamide or vehicle solution. Serum samples taken longitudinally from each mouse in the groups were measured with 6-plex magneto-nanosensor cytokine assays. To find the origin of IL-6, experiments were performed using IL-6 knock-out mice. Results: The differences in serum IL-6 and GCSF levels between the drug-treated and untreated groups were revealed by the magneto-nanosensor measurement on individual mice. Using the multiplex assays and mouse models, we found that IL-6 is secreted by the host in the presence of tumor cells upon the drug treatment. Conclusion: The multiplex magneto-nanosensor assays enable longitudinal proteomic studies on mouse tumor models to understand tumor development and therapy mechanisms more precisely within a single biological object.

RAPID DETECTION OF -THALASSEMIA MUTATIONS IN THAILAND USING MULTIPLEX ARMS

Directory of Open Access Journals (Sweden)

D. Shimbhu

2017-11-01

Full Text Available The number of mutations underlining b-thalassemia generate a wide variety of different clinical phenotypes. An understanding of the genotype is important for medical personnel in order to provide proper counseling to patients and their families. Characterization of these mutations should aid the planning of a prenatal diagnosis program for bthalassemia. The heterogeneity of the mutations makes it difficult and time consuming to identify the mutation in some individuals. We developed a single-tube multiplex amplification refractory mutation system (multiplex ARMS to identify common ethnic- specific b-thalassemia mutations. Confirmation of multiplex ARMS results was carried out using direct sequencing. Three thousand three hundred twenty two people from Phitsanulok province were screened for the b-thalassemia trait by quantitation of HbA2 with microcolumn chromatography and the genotypes of mutations were characterized using multiplex ARMS and direct sequencing. We found that the deletion at codons 41/42 (-TCTT was the most frequent (48%, codon 17 (A®T (30%, -28 (A®G (6% and IVS-I-1(G®T (6% were the second and third in frequency respectively. A -87 (C®A mutation (4%, IVS II-654 (C®T (2%, codons 71/72 (+A (2% and codon 35 (C®A mutations (2% were also found. These techniques were found to be a valuable tool for analysis of b-thalassemia mutations because they are accurate, simple, and speedy in operation. The application for the diagnosis of severe thalassemia in high-risk pregnancies is promising.

Process for cleaning radioactively contaminated metal surfaces

International Nuclear Information System (INIS)

Mihram, R.G.; Snyder, G.A.

1975-01-01

A process is described for removing radioactive scale from a ferrous metal surface, including the steps of initially preconditioning the surface by contacting it with an oxidizing solution (such as an aqueous solution of an alkali metal permanganate or hydrogen peroxide), then, after removal or decomposition of the oxidizing solution, the metallic surface is contacted with a cleaning solution which is a mixture of a mineral acid and a complexing agent (such as sulfuric acid and oxalic acid), and which preferably contains a corrosion inhibitor. A final step in the process is the treatment of the spent cleaning solution containing radioactive waste materials in solution by adding a reagent selected from the group consisting of calcium hydroxide or potassium permanganate and an alkali metal hydroxide to thereby form easily recovered metallic compounds containing substantially all of the dissolved metals and radioactivity. (auth)

Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

Directory of Open Access Journals (Sweden)

Chung Hyun-Jae

2010-09-01

Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

Multiplexed measurements by time resolved spectroscopy using colloidal CdSe/ZnS quantum dots

Energy Technology Data Exchange (ETDEWEB)

Kaiser, U.; Jimenez de Aberasturi, D.; Malinowski, R.; Amin, F.; Parak, W. J.; Heimbrodt, W., E-mail: Wolfram.Heimbrodt@physik.uni-marburg.de [Department of Physics and Materials Sciences Center, Philipps-University of Marburg, Renthof 5, D-35032 Marburg (Germany)

2014-01-27

Multiplexed measurements of analytes in parallel is a topical demand in bioanalysis and bioimaging. An interesting alternative to commonly performed spectral multiplexing is lifetime multiplexing. In this Letter, we present a proof of principle of single-color lifetime multiplexing by coupling the same fluorophore to different nanoparticles. The effective lifetime of the fluorophores can be tuned by more than one order of magnitude due to resonance energy transfer from donor states. Measurements have been done on a model systems consisting of ATTO-590 dye molecules linked to either gold particles or to CdSe/ZnS core shell quantum dots. Both systems show the same luminescence spectrum of ATTO-590 dye emission in continuous wave excitation, but can be distinguished by means of time resolved measurements. The dye molecules bound to gold particles exhibit a mono-exponential decay with a lifetime of 4.5 ns, whereas the dye molecules bound to CdSe/ZnS dots show a nonexponential decay with a slow component of about 135 ns due to the energy transfer from the quantum dots. We demonstrate the fundamental possibility to determine the mixing ratio for dyes with equal luminescence spectra but very different transients. This opens up a pathway independent of the standard optical multiplexing with many different fluorophores emitting from the near ultraviolet to the near infrared spectral region.

Recent advances in high-capacity free-space optical and radio-frequency communications using orbital angular momentum multiplexing

Science.gov (United States)

Ren, Yongxiong; Xie, Guodong; Yan, Yan; Li, Long; Zhao, Zhe; Wang, Jian; Tur, Moshe; Molisch, Andreas F.; Ashrafi, Solyman

2017-01-01

There is a continuing growth in the demand for data bandwidth, and the multiplexing of multiple independent data streams has the potential to provide the needed data capacity. One technique uses the spatial domain of an electromagnetic (EM) wave, and space division multiplexing (SDM) has become increasingly important for increased transmission capacity and spectral efficiency of a communication system. A subset of SDM is mode division multiplexing (MDM), in which multiple orthogonal beams each on a different mode can be multiplexed. A potential modal basis set to achieve MDM is to use orbital angular momentum (OAM) of EM waves. In such a system, multiple OAM beams each carrying an independent data stream are multiplexed at the transmitter, propagate through a common medium and are demultiplexed at the receiver. As a result, the total capacity and spectral efficiency of the communication system can be multiplied by a factor equal to the number of transmitted OAM modes. Over the past few years, progress has been made in understanding the advantages and limitations of using multiplexed OAM beams for communication systems. In this review paper, we highlight recent advances in the use of OAM multiplexing for high-capacity free-space optical and millimetre-wave communications. We discuss different technical challenges (e.g. atmospheric turbulence and crosstalk) as well as potential techniques to mitigate such degrading effects. This article is part of the themed issue ‘Optical orbital angular momentum’. PMID:28069770

Equalizer complexity of mode division multiplexed coherent receivers

NARCIS (Netherlands)

Inan, B.; Spinnler, B.; Ferreira, F.; Lobato, A.; Adhikari, S.; Sleiffer, V.A.J.M.; Borne, van den D.; Hanik, N.; Jansen, S.L.

2012-01-01

We show that OFDM requires the lowest equalizer complexity for crosstalk compensation in a mode-division-multiplexing receiver. For a 2000-km transmission distance and less than 10% ODFM-specific overhead, the modal dispersion must be below 12 ps/km

Turbulence mitigation scheme based on multiple-user detection in an orbital-angular-momentum multiplexed system

Science.gov (United States)

Zou, Li; Wang, Le; Zhao, Sheng-Mei; Chen, Han-Wu

2016-11-01

Atmospheric turbulence (AT) induced crosstalk can significantly impair the performance of a free-space optical (FSO) communication link using orbital angular momentum (OAM) multiplexing. In this paper, we propose a multiple-user detection (MUD) turbulence mitigation scheme in an OAM-multiplexed FSO communication link. First, we present a MUD equivalent communication model for an OAM-multiplexed FSO communication link under AT. In the equivalent model, each input bit stream represents one user’s information. The deformed OAM spatial modes caused by AT, instead of the pure OAM spatial modes, are used as information carriers, and the overlapping between the deformed OAM spatial modes are computed as the correlation coefficients between the users. Then, we present a turbulence mitigation scheme based on MUD idea to enhance AT tolerance of the OAM-multiplexed FSO communication link. In the proposed scheme, the crosstalk caused by AT is used as a useful component to deduce users’ information. The numerical results show that the performance of the OAM-multiplexed communication link has greatly improved by the proposed scheme. When the turbulence strength is 1 × 10-15 m-2/3, the transmission distance is 1000 m and the channel signal-to-noise ratio (SNR) is 26 dB, the bit-error-rate (BER) performance of four spatial multiplexed OAM modes lm = +1,+2,+3,+4 are all close to 10-5, and there is a 2-3 fold increase in the BER performance in comparison with those results without the proposed scheme. In addition, the proposed scheme is more effective for an OAM-multiplexed FSO communication link with a larger OAM mode topological charge interval. The proposed scheme is a promising direction for compensating the interference caused by AT in the OAM-multiplexed FSO communication link. Project supported by the National Natural Science Foundation of China (Grant Nos. 61271238 and 61475075), the Open Research Fund of Key Lab of Broadband Wireless Communication and Sensor Network

Programming cells by multiplex genome engineering and accelerated evolution.

Science.gov (United States)

Wang, Harris H; Isaacs, Farren J; Carr, Peter A; Sun, Zachary Z; Xu, George; Forest, Craig R; Church, George M

2009-08-13

The breadth of genomic diversity found among organisms in nature allows populations to adapt to diverse environments. However, genomic diversity is difficult to generate in the laboratory and new phenotypes do not easily arise on practical timescales. Although in vitro and directed evolution methods have created genetic variants with usefully altered phenotypes, these methods are limited to laborious and serial manipulation of single genes and are not used for parallel and continuous directed evolution of gene networks or genomes. Here, we describe multiplex automated genome engineering (MAGE) for large-scale programming and evolution of cells. MAGE simultaneously targets many locations on the chromosome for modification in a single cell or across a population of cells, thus producing combinatorial genomic diversity. Because the process is cyclical and scalable, we constructed prototype devices that automate the MAGE technology to facilitate rapid and continuous generation of a diverse set of genetic changes (mismatches, insertions, deletions). We applied MAGE to optimize the 1-deoxy-D-xylulose-5-phosphate (DXP) biosynthesis pathway in Escherichia coli to overproduce the industrially important isoprenoid lycopene. Twenty-four genetic components in the DXP pathway were modified simultaneously using a complex pool of synthetic DNA, creating over 4.3 billion combinatorial genomic variants per day. We isolated variants with more than fivefold increase in lycopene production within 3 days, a significant improvement over existing metabolic engineering techniques. Our multiplex approach embraces engineering in the context of evolution by expediting the design and evolution of organisms with new and improved properties.

Fluorescence-intensity multiplexing: simultaneous seven-marker, two-color immunophenotyping using flow cytometry.

Science.gov (United States)

Bradford, Jolene A; Buller, Gayle; Suter, Michael; Ignatius, Michael; Beechem, Joseph M

2004-10-01

Conventional immuno-based multiparameter flow cytometric analysis has been limited by the requirement of a dedicated detection channel for each antibody-fluorophore set. To address the need to resolve multiple biological targets simultaneously, flow cytometers with as many as 10-15 detection channels have been developed. In this study, a new Zenon immunolabeling technology is developed that allows for multiple antigen detection per detection channel using a single fluorophore, through a unique method of fluorescence-intensity multiplexing. By varying the Zenon labeling reagent-to-antibody molar ratio, the fluorescence intensity of the antibody-labeled cellular targets can be used as a unique identifier. Although demonstrated in the present study with lymphocyte immunophenotyping, this approach is broadly applicable for any immuno-based multiplexed flow cytomety assay. Lymphocyte immunophenotyping of 38 clinical blood specimens using CD3, CD4, CD8, CD16, CD56, CD19, and CD20 antibodies was performed using conventional flow cytometric analysis and fluorescence-intensity multiplexing analysis. Conventional analysis measures a single antibody-fluorophore per photomultiplier tube (PMT). Fluorescence-intensity multiplex analysis simultaneously measures seven markers with two PMTs, using Zenon labeling reagent-antibody complexes in a single tube: CD19, CD4, CD8, and CD16 antibodies labeled with Zenon Alexa Fluor 488 Mouse IgG(1) labeling reagent and CD56, CD3, and CD20 antibodies labeled with Zenon R-Phycoerythrin (R-PE) Mouse IgG(1) or IgG(2b) labeling reagents. The lymphocyte immunophenotyping results from fluorescence-intensity multiplexing using Zenon labeling reagents in a single tube were comparable to results from conventional flow cytometric analysis. Simultaneous evaluation of multiple antigens using a single fluorophore can be performed using antibodies labeled with varying ratios of a Zenon labeling reagent. Labeling two sets of antibodies with different Zenon

Capacity of Wavelength and Time Division Multiplexing for Quasi-Distributed Measurement Using Fiber Bragg Gratings

Directory of Open Access Journals (Sweden)

Marcel Fajkus

2015-01-01

Full Text Available In this paper, an analysis of the use of wavelength and time division multiplexing techniques for quasi-distributed measurement in uniform fiber Bragg gratings is presented. To date, publications have concentrated on the determination of the maximum number of fiber Bragg gratings on one optical fiber using wavelength and time division multiplexing. In this paper, these techniques will be extended to determine the spectral width of wavelength division multiplexing in terms of the spectral width of the light emitting diode, the spectral width of the Bragg gratings, the measurement ranges of the individual sensors, and the guard band between two adjacent Bragg gratings. For time division multiplexing, a description of the time and power conditions are given. In particular the reflected power, first order crosstalk and chromatic dispersion have been considered. Finally, these relationships were applied to verify a design in a simulation using OptiSystem software.

A 50 SNP-multiplex mass spectrometry assay for human identification

DEFF Research Database (Denmark)

Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus

2008-01-01

We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...

Nanoscale processes on insulating surfaces

National Research Council Canada - National Science Library

Gnecco, Enrico; Szymoński, Marek

2009-01-01

... the group of Prof. Ernst Meyer in Basel, where he investigated friction processes on alkali halide surfaces in ultra high vacuum (UHV). The main result was the observation of a logarithmic velocity dependence of atomic friction, which was interpreted within a combination of the classical Tomlinson and Eyring models. After his Ph.D. he joined the ...

Quantitative, multiplexed workflow for deep analysis of human blood plasma and biomarker discovery by mass spectrometry.

Science.gov (United States)

Keshishian, Hasmik; Burgess, Michael W; Specht, Harrison; Wallace, Luke; Clauser, Karl R; Gillette, Michael A; Carr, Steven A

2017-08-01

Proteomic characterization of blood plasma is of central importance to clinical proteomics and particularly to biomarker discovery studies. The vast dynamic range and high complexity of the plasma proteome have, however, proven to be serious challenges and have often led to unacceptable tradeoffs between depth of coverage and sample throughput. We present an optimized sample-processing pipeline for analysis of the human plasma proteome that provides greatly increased depth of detection, improved quantitative precision and much higher sample analysis throughput as compared with prior methods. The process includes abundant protein depletion, isobaric labeling at the peptide level for multiplexed relative quantification and ultra-high-performance liquid chromatography coupled to accurate-mass, high-resolution tandem mass spectrometry analysis of peptides fractionated off-line by basic pH reversed-phase (bRP) chromatography. The overall reproducibility of the process, including immunoaffinity depletion, is high, with a process replicate coefficient of variation (CV) of 4,500 proteins are detected and quantified per patient sample on average, with two or more peptides per protein and starting from as little as 200 μl of plasma. The approach can be multiplexed up to 10-plex using tandem mass tags (TMT) reagents, further increasing throughput, albeit with some decrease in the number of proteins quantified. In addition, we provide a rapid protocol for analysis of nonfractionated depleted plasma samples analyzed in 10-plex. This provides ∼600 quantified proteins for each of the ten samples in ∼5 h of instrument time.

Fast reconstruction of off-axis digital holograms based on digital spatial multiplexing.

Science.gov (United States)

Sha, Bei; Liu, Xuan; Ge, Xiao-Lu; Guo, Cheng-Shan

2014-09-22

A method for fast reconstruction of off-axis digital holograms based on digital multiplexing algorithm is proposed. Instead of the existed angular multiplexing (AM), the new method utilizes a spatial multiplexing (SM) algorithm, in which four off-axis holograms recorded in sequence are synthesized into one SM function through multiplying each hologram with a tilted plane wave and then adding them up. In comparison with the conventional methods, the SM algorithm simplifies two-dimensional (2-D) Fourier transforms (FTs) of four N*N arrays into a 1.25-D FTs of one N*N arrays. Experimental results demonstrate that, using the SM algorithm, the computational efficiency can be improved and the reconstructed wavefronts keep the same quality as those retrieved based on the existed AM method. This algorithm may be useful in design of a fast preview system of dynamic wavefront imaging in digital holography.

An ultra-high discrimination Y chromosome short tandem repeat multiplex DNA typing system.

Directory of Open Access Journals (Sweden)

Erin K Hanson

Full Text Available In forensic casework, Y chromosome short tandem repeat markers (Y-STRs are often used to identify a male donor DNA profile in the presence of excess quantities of female DNA, such as is found in many sexual assault investigations. Commercially available Y-STR multiplexes incorporating 12-17 loci are currently used in forensic casework (Promega's PowerPlex Y and Applied Biosystems' AmpFlSTR Yfiler. Despite the robustness of these commercial multiplex Y-STR systems and the ability to discriminate two male individuals in most cases, the coincidence match probabilities between unrelated males are modest compared with the standard set of autosomal STR markers. Hence there is still a need to develop new multiplex systems to supplement these for those cases where additional discriminatory power is desired or where there is a coincidental Y-STR match between potential male participants. Over 400 Y-STR loci have been identified on the Y chromosome. While these have the potential to increase the discrimination potential afforded by the commercially available kits, many have not been well characterized. In the present work, 91 loci were tested for their relative ability to increase the discrimination potential of the commonly used 'core' Y-STR loci. The result of this extensive evaluation was the development of an ultra high discrimination (UHD multiplex DNA typing system that allows for the robust co-amplification of 14 non-core Y-STR loci. Population studies with a mixed African American and American Caucasian sample set (n = 572 indicated that the overall discriminatory potential of the UHD multiplex was superior to all commercial kits tested. The combined use of the UHD multiplex and the Applied Biosystems' AmpFlSTR Yfiler kit resulted in 100% discrimination of all individuals within the sample set, which presages its potential to maximally augment currently available forensic casework markers. It could also find applications in human evolutionary

A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

Science.gov (United States)

Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

2015-07-07

Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

Energy Technology Data Exchange (ETDEWEB)

Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

2000-05-05

Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

Potential of remote multiplexing systems in reducing cabling cost and complexity in nuclear power stations

International Nuclear Information System (INIS)

Stirling, A.J.; L'Archeveque, J.V.R.

1977-03-01

Control and instrumentation cabling accounts for nearly 1% of the capital cost of a CANDU generating station. This study of cabling requirements, methods and costs for nuclear reactors, shows that efficient design and scale economies make CANDU wiring costs (per field point) among the lowest for comparable applications. Although attractive in other reactors, commercially available remote multiplexing systems are not, as yet, cost effective for general use in CANDU stations. The report, with its comprehensive tabulation of remote multiplexing equipment, and analysis of cabling procedures describes an approach for re-evaluating the tradeoff between remote multiplexing and conventional wiring as conditions change. (author)

Multiplexing of ChIP-Seq Samples in an Optimized Experimental Condition Has Minimal Impact on Peak Detection.

Directory of Open Access Journals (Sweden)

Thadeous J Kacmarczyk

Full Text Available Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads. Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal.

Multiplexing of ChIP-Seq Samples in an Optimized Experimental Condition Has Minimal Impact on Peak Detection

Science.gov (United States)

Kacmarczyk, Thadeous J.; Bourque, Caitlin; Zhang, Xihui; Jiang, Yanwen; Houvras, Yariv; Alonso, Alicia; Betel, Doron

2015-01-01

Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input) at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads). Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal. PMID:26066343

Multiplexing of ChIP-Seq Samples in an Optimized Experimental Condition Has Minimal Impact on Peak Detection.

Science.gov (United States)

Kacmarczyk, Thadeous J; Bourque, Caitlin; Zhang, Xihui; Jiang, Yanwen; Houvras, Yariv; Alonso, Alicia; Betel, Doron

2015-01-01

Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input) at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads). Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal.

Remote (250 km Fiber Bragg Grating Multiplexing System

Directory of Open Access Journals (Sweden)

Manuel Lopez-Amo

2011-09-01

Full Text Available We propose and demonstrate two ultra-long range fiber Bragg grating (FBG sensor interrogation systems. In the first approach four FBGs are located 200 km from the monitoring station and a signal to noise ratio of 20 dB is obtained. The second improved version is able to detect the four multiplexed FBGs placed 250 km away, offering a signal to noise ratio of 6–8 dB. Consequently, this last system represents the longest range FBG sensor system reported so far that includes fiber sensor multiplexing capability. Both simple systems are based on a wavelength swept laser to scan the reflection spectra of the FBGs, and they are composed by two identical-lengths optical paths: the first one intended to launch the amplified laser signal by means of Raman amplification and the other one is employed to guide the reflection signal to the reception system.

Capacity analysis of spectrum sharing spatial multiplexing MIMO systems

KAUST Repository

Yang, Liang

2014-12-01

This paper considers a spectrum sharing (SS) multiple-input multiple-output (MIMO) system operating in a Rayleigh fading environment. First the capacity of a single-user SS spatial multiplexing system is investigated in two scenarios that assume different receivers. To explicitly show the capacity scaling law of SS MIMO systems, some approximate capacity expressions for the two scenarios are derived. Next, we extend our analysis to a multiple user system with zero-forcing receivers (ZF) under spatially-independent scheduling and analyze the sum-rate. Furthermore, we provide an asymptotic sum-rate analysis to investigate the effects of different parameters on the multiuser diversity gain. Our results show that the secondary system with a smaller number of transmit antennas Nt and a larger number of receive antennas Nr can achieve higher capacity at lower interference temperature Q, but at high Q the capacity follows the scaling law of the conventional MIMO systems. However, for a ZF SS spatial multiplexing system, the secondary system with small Nt and large Nr can achieve the highest capacity throughout the entire region of Q. For a ZF SS spatial multiplexing system with scheduling, the asymptotic sum-rate scales like Ntlog2(Q(KNtNp-1)/Nt), where Np denotes the number of antennas of the primary receiver and K represents the number of secondary transmitters.

An order of magnitude improvement in optical fiber bandwidth using spatial domain multiplexing/space division multiplexing (SDM) in conjunction with orbital angular momentum (OAM)

Science.gov (United States)

Murshid, Syed; Alanzi, Saud; Hridoy, Arnob; Lovell, Greg; Parhar, Gurinder; Chakravarty, Abhijit; Chowdhury, Bilas

2014-09-01

Spatial Domain Multiplexing/Space Division Multiplexing (SDM) can increase the bandwidth of existing and futuristic optical fibers by an order of magnitude or more. In the SDM technique, we launch multiple single mode pigtail laser sources of same wavelength into a carrier fiber at different angles. The launching angles decide the output of the carrier fiber by allocating separate spatial locations for each channel. Each channel follows a helical trajectory while traversing the length of the carrier fiber, thereby allowing spatial reuse of optical frequencies. In this endeavor we launch light from five different single mode pigtail laser sources at different angles (with respect to the axis of the carrier fiber) into the carrier fiber. Owing to helical propagation we get five distinct concentric donut shaped rings with negligible crosstalk at the output end of the fiber. These SDM channels also exhibit Orbital Angular Momentum (OAM), thereby adding an extra degree of photon freedom. We present the experimental data of five spatially multiplexed channels and compare them with simulated results to show that this technique can potentially improve the data capacity of optical fibers by an order of magnitude: A factor of five using SDM and another factor of two using OAM.

Nanoscale Test Strips for Multiplexed Blood Analysis, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — The goal of our nanoscale test strips, or nanostrips, is to provide rapid, low-cost, powerful multiplexed analyses in a diminutive form so that whole body health...

Trinary Encoder, Decoder, Multiplexer and Demultiplexer Using Savart Plate and Spatial Light Modulator

Science.gov (United States)

Ghosh, Amal K.; Singha Roy, Souradip; Mandal, Sudipta; Basuray, Amitabha

Optoelectronic processors have already been developed with the strong potentiality of optics in information and data processing. Encoder, Decoder, Multiplexers and Demultiplexers are the most important components in modern system designs and in communications. We have implemented the same using trinary logic gates with signed magnitude defined as Modified Trinary Number (MTN). The Spatial Light Modulator (SLM) based optoelectronic circuit is suitable for high speed data processing and communications using photon as carrier. We also presented here a possible method of implementing the same using light with photon as carrier of information. The importance of the method is that all the basic gates needed may be fabricated based on basic building block.

Experimental demonstration of optical stealth transmission over wavelength-division multiplexing network.

Science.gov (United States)

Zhu, Huatao; Wang, Rong; Pu, Tao; Fang, Tao; Xiang, Peng; Zheng, Jilin; Tang, Yeteng; Chen, Dalei

2016-08-10

We propose and experimentally demonstrate an optical stealth transmission system over a 200 GHz-grid wavelength-division multiplexing (WDM) network. The stealth signal is processed by spectral broadening, temporal spreading, and power equalizing. The public signal is suppressed by multiband notch filtering at the stealth channel receiver. The interaction between the public and stealth channels is investigated in terms of public-signal-to-stealth-signal ratio, data rate, notch-filter bandwidth, and public channel number. The stealth signal can transmit over 80 km single-mode fiber with no error. Our experimental results verify the feasibility of optical steganography used over the existing WDM-based optical network.

Interplay between social influence and competitive strategical games in multiplex networks.

Science.gov (United States)

Amato, Roberta; Díaz-Guilera, Albert; Kleineberg, Kaj-Kolja

2017-08-01

We present a model that takes into account the coupling between evolutionary game dynamics and social influence. Importantly, social influence and game dynamics take place in different domains, which we model as different layers of a multiplex network. We show that the coupling between these dynamical processes can lead to cooperation in scenarios where the pure game dynamics predicts defection. In addition, we show that the structure of the network layers and the relation between them can further increase cooperation. Remarkably, if the layers are related in a certain way, the system can reach a polarized metastable state. These findings could explain the prevalence of polarization observed in many social dilemmas.

Multiplex families with epilepsy

Science.gov (United States)

Afawi, Zaid; Oliver, Karen L.; Kivity, Sara; Mazarib, Aziz; Blatt, Ilan; Neufeld, Miriam Y.; Helbig, Katherine L.; Goldberg-Stern, Hadassa; Misk, Adel J.; Straussberg, Rachel; Walid, Simri; Mahajnah, Muhammad; Lerman-Sagie, Tally; Ben-Zeev, Bruria; Kahana, Esther; Masalha, Rafik; Kramer, Uri; Ekstein, Dana; Shorer, Zamir; Wallace, Robyn H.; Mangelsdorf, Marie; MacPherson, James N.; Carvill, Gemma L.; Mefford, Heather C.; Jackson, Graeme D.; Scheffer, Ingrid E.; Bahlo, Melanie; Gecz, Jozef; Heron, Sarah E.; Corbett, Mark; Mulley, John C.; Dibbens, Leanne M.; Korczyn, Amos D.

2016-01-01

Objective: To analyze the clinical syndromes and inheritance patterns of multiplex families with epilepsy toward the ultimate aim of uncovering the underlying molecular genetic basis. Methods: Following the referral of families with 2 or more relatives with epilepsy, individuals were classified into epilepsy syndromes. Families were classified into syndromes where at least 2 family members had a specific diagnosis. Pedigrees were analyzed and molecular genetic studies were performed as appropriate. Results: A total of 211 families were ascertained over an 11-year period in Israel. A total of 169 were classified into broad familial epilepsy syndrome groups: 61 generalized, 22 focal, 24 febrile seizure syndromes, 33 special syndromes, and 29 mixed. A total of 42 families remained unclassified. Pathogenic variants were identified in 49/211 families (23%). The majority were found in established epilepsy genes (e.g., SCN1A, KCNQ2, CSTB), but in 11 families, this cohort contributed to the initial discovery (e.g., KCNT1, PCDH19, TBC1D24). We expand the phenotypic spectrum of established epilepsy genes by reporting a familial LAMC3 homozygous variant, where the predominant phenotype was epilepsy with myoclonic-atonic seizures, and a pathogenic SCN1A variant in a family where in 5 siblings the phenotype was broadly consistent with Dravet syndrome, a disorder that usually occurs sporadically. Conclusion: A total of 80% of families were successfully classified, with pathogenic variants identified in 23%. The successful characterization of familial electroclinical and inheritance patterns has highlighted the value of studying multiplex families and their contribution towards uncovering the genetic basis of the epilepsies. PMID:26802095

Comparison of Multiplex Suspension Array Large-Panel Kits for Profiling Cytokines and Chemokines in Rheumatoid Arthritis Patients

Science.gov (United States)

Khan, Imran H.; Krishnan, V.V.; Ziman, Melanie; Janatpour, Kim; Wun, Ted; Luciw, Paul A.; Tuscano, Joseph

2015-01-01

Background Multiplex analysis allows measurements of a large number of analytes simultaneously in each sample. Based on the Luminex multiplex technology (xMAP), kits for measuring multiple cytokines and chemokines (immunomodulators) are commercially available and are useful in investigations on inflammatory diseases. This study evaluated four multiplex kits (Bio-Plex, LINCOplex, Fluorokine, and Beadlyte) that contained 27, 29, 20 and 22 analytes each, respectively, for the analysis of immunomodulators in plasma of rheumatoid arthritis (RA) patients who underwent treatment with antibody against CD20 (rituximab), a B-cell reductive therapy. Methods Multiplex kits were tested on serial plasma samples obtained from six RA patients at baseline and multiple time points (3, 6, and 9 months) post-treatment with rituximab. The RA patients included in this study had previously failed therapy with disease modifying anti-arthritis drugs (DMARD) and treatment with anti-TNFα antibody (infliximab). Results Computer modeling and hierarchical cluster analysis of the multiplex data allowed a comparison of the performance of multiplex assay kits and revealed profiles of immunomodulators in the RA patients. Conclusions In plasma of RA patients who appeared to have benefited from rituximab treatment the profile of significantly elevated immunomodulators by at least two of the three kits (BioPlex, LINCOplex, Beadlyte), is as follows: IL-12p70, Eotaxin, IL-4, TNFα, Il-9, IL-1β, IFNγ, IL-10, IL-6, and IL-13. Immunomodulator profiling by multiplex analysis may provide useful plasma biomarkers for monitoring response to B-cell reductive therapy in RA patients. PMID:18823005

Surface modification of the metal plates using continuous electron beam process (CEBP)

International Nuclear Information System (INIS)

Kim, Jisoo; Kim, Jin-Seok; Kang, Eun-Goo; Park, Hyung Wook

2014-01-01

Highlights: • We performed surface modification of SM20C, SUS303, and Al6061 using CEBP. • We analyzed surface properties and microstructure after electron-beam irradiation. • The surface quality was improved after electron-beam irradiation. • The surface hardness for SM20C was increased by ∼50% after CEBP irradiation. - Abstract: The finishing process is an important component of the quality-control procedure for final products in manufacturing applications. In this study, we evaluated the performance of continuous electron-beam process as the final process for finishing SM20C (steel alloy), SUS303 (stainless steel alloy), and Al6061 (aluminum alloy) surfaces both on the initially smooth and rough surfaces. Surface modification of the metals was carried out by varying the feed and frequency of the continuous electron-beam irradiation procedure. The resulting surface roughness was examined with respect to the initial surface roughness of the metals. SM20C and SUS303 experienced an improvement in surface roughness, particularly for initially rough surfaces. Continuous electron-beam process produced craters during the process and the effect of this phenomenon on the resulting surface roughness was relatively large with the initially smooth SM20C and SUS303 alloy surfaces. For Al6061, the continuous electron-beam process was effective at improving its surface roughness even with the initially smooth surface under the optimized conditions of process; this was attributed to its low melting point. Scanning electron microscopy was used to identify metallurgical variation within the thin melted and re-solidification layers of the tested alloys. Changes in the surface contact angle and hardness before and after electron-beam irradiation were also examined

Surface modification of the metal plates using continuous electron beam process (CEBP)

Energy Technology Data Exchange (ETDEWEB)

Kim, Jisoo, E-mail: kimjisu16@unist.ac.kr [School of Mechanical and Advanced Materials Engineering, Ulsan National Institute of Science and Technology, UNIST-gil 50, Eonyang-eup, Ulju-gun, Ulsan Metropolitan City 689-798 (Korea, Republic of); Kim, Jin-Seok, E-mail: totoro22@kitech.re.kr [Korea Institute of Industrial Technology (KITECH), KITECH Cheonan Headquarters 35-3 Hongcheon-ri, Ipjang-myeon, Cheonan-si, Chungcheongnam-do 330-825 (Korea, Republic of); Kang, Eun-Goo, E-mail: egkang@kitech.re.kr [Korea Institute of Industrial Technology (KITECH), KITECH Cheonan Headquarters 35-3 Hongcheon-ri, Ipjang-myeon, Cheonan-si, Chungcheongnam-do 330-825 (Korea, Republic of); Park, Hyung Wook, E-mail: hwpark@unist.ac.kr [School of Mechanical and Advanced Materials Engineering, Ulsan National Institute of Science and Technology, UNIST-gil 50, Eonyang-eup, Ulju-gun, Ulsan Metropolitan City 689-798 (Korea, Republic of)

2014-08-30

Highlights: • We performed surface modification of SM20C, SUS303, and Al6061 using CEBP. • We analyzed surface properties and microstructure after electron-beam irradiation. • The surface quality was improved after electron-beam irradiation. • The surface hardness for SM20C was increased by ∼50% after CEBP irradiation. - Abstract: The finishing process is an important component of the quality-control procedure for final products in manufacturing applications. In this study, we evaluated the performance of continuous electron-beam process as the final process for finishing SM20C (steel alloy), SUS303 (stainless steel alloy), and Al6061 (aluminum alloy) surfaces both on the initially smooth and rough surfaces. Surface modification of the metals was carried out by varying the feed and frequency of the continuous electron-beam irradiation procedure. The resulting surface roughness was examined with respect to the initial surface roughness of the metals. SM20C and SUS303 experienced an improvement in surface roughness, particularly for initially rough surfaces. Continuous electron-beam process produced craters during the process and the effect of this phenomenon on the resulting surface roughness was relatively large with the initially smooth SM20C and SUS303 alloy surfaces. For Al6061, the continuous electron-beam process was effective at improving its surface roughness even with the initially smooth surface under the optimized conditions of process; this was attributed to its low melting point. Scanning electron microscopy was used to identify metallurgical variation within the thin melted and re-solidification layers of the tested alloys. Changes in the surface contact angle and hardness before and after electron-beam irradiation were also examined.

Sample-hold and analog multiplexer for multidetector systems

Energy Technology Data Exchange (ETDEWEB)

Goswami, G C; Ghoshdostidar, M R; Ghosh, B; Chaudhuri, N [North Bengal Univ., Darjeeling (India). Dept. of Physics

1982-08-15

A new sample-hold circuit with an analog multiplexer system is described. Designed for multichannel acquistion of data from an air shower array, the system is being used for accurate measurements of pulse heights from 16 channels by the use of a single ADC.

Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

Science.gov (United States)

Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

2017-12-01

Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

Surface photo reaction processes using synchrotron radiation; Hoshako reiki ni yoru hyomenko hanno process

Energy Technology Data Exchange (ETDEWEB)

Imaizumi, Y. [Tohoku University, Sendai (Japan). Institute for Materials Research; Yoshigoe, A. [Toyohashi University of Technology, Aichi (Japan); Urisu, T. [Toyohashi University of Technology, Aichi (Japan). Institute for Molecular Science

1997-08-20

This paper introduces the surface photo reaction processes using synchrotron radiation, and its application. A synchrotron radiation process using soft X-rays contained in electron synchrotron radiated light as an excited light source has a possibility of high-resolution processing because of its short wave length. The radiated light can excite efficiently the electronic state of a substance, and can induce a variety of photochemical reactions. In addition, it can excite inner shell electrons efficiently. In the aspect of its application, it has been found that, if radiated light is irradiated on surfaces of solids under fluorine-based reaction gas or Cl2, the surfaces can be etched. This technology is utilized practically. With regard to radiated light excited CVD process, it may be said that anything that can be deposited by the ordinary plasma CVD process can be deposited. Its application to epitaxial crystal growth may be said a nano processing application in thickness direction, such as forming an ultra-lattice structure, the application being subjected to expectation. In micromachine fabricating technologies, a possibility is searched on application of a photo reaction process of the radiated light. 5 refs., 6 figs.

Research on copying system of dynamic multiplex holographic stereograms

Science.gov (United States)

Fu, Huaiping; Yang, Hong; Zheng, Tong

2003-05-01

The most important advantage of holographic stereograms over conventional hologram is that they can produce 3D images at any desired scale with movement, holographers in many countries involved in the studies towards it. We began our works in the early 80's and accomplished two research projects automatic system for making synthetic holograms and multiplex synthetic rainbow holograms, Based on these works, a large scale holographic stereogram of an animated goldfish was made by us for practical advertisement. In order to meet the needs of the market, a copying system for making multiplex holographic stereograms, and a special kind of silver halide holographic film developed by us recently. The characteristic of the copying system and the property of the special silver-halide emulsion are introduced in this paper.

Aptamer-based multiplexed proteomic technology for biomarker discovery.

Directory of Open Access Journals (Sweden)

Larry Gold

2010-12-01

Full Text Available The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine.We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states.We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

Aptamer-based multiplexed proteomic technology for biomarker discovery.

Science.gov (United States)

Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N; Carter, Jeff; Dalby, Andrew B; Eaton, Bruce E; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R; Kim, Nancy; Koch, Tad H; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D; Vrkljan, Mike; Walker, Jeffrey J; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K; Wolfson, Alexey; Wolk, Steven K; Zhang, Chi; Zichi, Dom

2010-12-07

The interrogation of proteomes ("proteomics") in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (~100 fM-1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae

Directory of Open Access Journals (Sweden)

Kor-jent van Dijk

2014-11-01

Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.

Angular Spacing Control for Segmented Data Pages in Angle-Multiplexed Holographic Memory

Science.gov (United States)

Kinoshita, Nobuhiro; Muroi, Tetsuhiko; Ishii, Norihiko; Kamijo, Koji; Kikuchi, Hiroshi; Shimidzu, Naoki; Ando, Toshio; Masaki, Kazuyoshi; Shimizu, Takehiro

2011-09-01

To improve the recording density of angle-multiplexed holographic memory, it is effective to increase the numerical aperture of the lens and to shorten the wavelength of the laser source as well as to increase the multiplexing number. The angular selectivity of a hologram, which determines the multiplexing number, is dependent on the incident angle of not only the reference beam but also the signal beam to the holographic recording medium. The actual signal beam, which is a convergent or divergent beam, is regarded as the sum of plane waves that have different propagation directions, angular selectivities, and optimal angular spacings. In this paper, focusing on the differences in the optimal angular spacing, we proposed a method to control the angular spacing for each segmented data page. We investigated the angular selectivity of a hologram and crosstalk for segmented data pages using numerical simulation. The experimental results showed a practical bit-error rate on the order of 10-3.

A Comparative Study of Multiplexing Schemes for Next Generation Optical Access Networks

Science.gov (United States)

Imtiaz, Waqas A.; Khan, Yousaf; Shah, Pir Mehar Ali; Zeeshan, M.

2014-09-01

Passive optical network (PON) is a high bandwidth, economical solution which can provide the necessary bandwidth to end-users. Wavelength division multiplexed passive optical networks (WDM PONs) and time division multiplexed passive optical networks (TDM PONs) are considered as an evolutionary step for next-generation optical access (NGOA) networks. However they fail to provide highest transmission capacity, efficient bandwidth access, and robust dispersion tolerance. Thus future PONs are considered on simpler, efficient and potentially scalable, optical code division multiplexed (OCDM) PONs. This paper compares the performance of existing PONs with OCDM PON to determine a suitable scheme for NGOA networks. Two system parameter are used in this paper: fiber length, and bit rate. Performance analysis using Optisystem shows that; for a sufficient system performance parameters i.e. bit error rate (BER) ≤ 10-9, and maximum quality factor (Q) ≥ 6, OCDMA PON efficiently performs upto 50 km with 10 Gbit/s per ONU.

Surface processing for bulk niobium superconducting radio frequency cavities

Science.gov (United States)

Kelly, M. P.; Reid, T.

2017-04-01

The majority of niobium cavities for superconducting particle accelerators continue to be fabricated from thin-walled (2-4 mm) polycrystalline niobium sheet and, as a final step, require material removal from the radio frequency (RF) surface in order to achieve performance needed for use as practical accelerator devices. More recently bulk niobium in the form of, single- or large-grain slices cut from an ingot has become a viable alternative for some cavity types. In both cases the so-called damaged layer must be chemically etched or electrochemically polished away. The methods for doing this date back at least four decades, however, vigorous empirical studies on real cavities and more fundamental studies on niobium samples at laboratories worldwide have led to seemingly modest improvements that, when taken together, constitute a substantial advance in the reproducibility for surface processing techniques and overall cavity performance. This article reviews the development of niobium cavity surface processing, and summarizes results of recent studies. We place some emphasis on practical details for real cavity processing systems which are difficult to find in the literature but are, nonetheless, crucial for achieving the good and reproducible cavity performance. New approaches for bulk niobium surface treatment which aim to reduce cost or increase performance, including alternate chemical recipes, barrel polishing and ‘nitrogen doping’ of the RF surface, continue to be pursued and are closely linked to the requirements for surface processing.

Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

Science.gov (United States)

Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

2016-03-12

Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens

Directory of Open Access Journals (Sweden)

Denis A. Kleymenov

2017-11-01

Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.

Multiplexed detection of mycotoxins in foods with a regenerable array.

Science.gov (United States)

Ngundi, Miriam M; Shriver-Lake, Lisa C; Moore, Martin H; Ligler, Frances S; Taitt, Chris R

2006-12-01

The occurrence of different mycotoxins in cereal products calls for the development of a rapid, sensitive, and reliable detection method that is capable of analyzing samples for multiple toxins simultaneously. In this study, we report the development and application of a multiplexed competitive assay for the simultaneous detection of ochratoxin A (OTA) and deoxynivalenol (DON) in spiked barley, cornmeal, and wheat, as well as in naturally contaminated maize samples. Fluoroimmunoassays were performed with the Naval Research Laboratory array biosensor, by both a manual and an automated version of the system. This system employs evanescent-wave fluorescence excitation to probe binding events as they occur on the surface of a waveguide. Methanolic extracts of the samples were diluted threefold with buffer containing a mixture of fluorescent antibodies and were then passed over the arrays of mycotoxins immobilized on a waveguide. Fluorescent signals of the surface-bound antibody-antigen complexes decreased with increasing concentrations of free mycotoxins in the extract. After sample analysis was completed, surfaces were regenerated with 6 M guanidine hydrochloride in 50 mM glycine, pH 2.0. The limits of detection determined by the manual biosensor system were as follows: 1, 180, and 65 ng/g for DON and 1, 60, and 85 ng/g for OTA in cornmeal, wheat, and barley, respectively. The limits of detection in cornmeal determined with the automated array biosensor were 15 and 150 ng/g for OTA and DON, respectively.

Integrated optical delay lines for time-division multiplexers

NARCIS (Netherlands)

Stopinski, S.T.; Malinowski, M.; Piramidowicz, R.; Kleijn, E.; Smit, M.K.; Leijtens, X.J.M.

2013-01-01

In this paper, we present a study of integrated optical delay lines (DLs) for application in optical time-division multiplexers. The investigated DLs are formed by spirally folded waveguides. The components were designed in a generic approach and fabricated in multi-project wafer runs on an

Plasma assisted surface coating/modification processes: An emerging technology

Science.gov (United States)

Spalvins, T.

1986-01-01

A broad understanding of the numerous ion or plasma assisted surface coating/modification processes is sought. An awareness of the principles of these processes is needed before discussing in detail the ion nitriding technology. On the basis of surface modifications arising from ion or plasma energizing and interactions, it can be broadly classified as deposition of distinct overlay coatings (sputtering-dc, radio frequency, magnetron, reactive; ion plating-diode, triode) and surface property modification without forming a discrete coating (ion implantation, ion beam mixing, laser beam irradiation, ion nitriding, ion carburizing, plasma oxidation). These techniques offer a great flexibility and are capable in tailoring desirable chemical and structural surface properties independent of the bulk properties.

Plasma assisted surface coating/modification processes - An emerging technology

Science.gov (United States)

Spalvins, T.

1987-01-01

A broad understanding of the numerous ion or plasma assisted surface coating/modification processes is sought. An awareness of the principles of these processes is needed before discussing in detail the ion nitriding technology. On the basis of surface modifications arising from ion or plasma energizing and interactions, it can be broadly classified as deposition of distinct overlay coatings (sputtering-dc, radio frequency, magnetron, reactive; ion plating-diode, triode) and surface property modification without forming a discrete coating (ion implantation, ion beam mixing, laser beam irradiation, ion nitriding, ion carburizing, plasma oxidation. These techniques offer a great flexibility and are capable in tailoring desirable chemical and structural surface properties independent of the bulk properties.

Surface modification by electrolytic plasma processing for high Nb-TiAl alloys

Science.gov (United States)

Gui, Wanyuan; Hao, Guojian; Liang, Yongfeng; Li, Feng; Liu, Xiao; Lin, Junpin

2016-12-01

Metal surface modification by electrolytic plasma processing (EPP) is an innovative treatment widely commonly applied to material processing and pretreatment process of coating and galvanization. EPP involves complex processes and a great deal of parameters, such as preset voltage, current, solution temperature and processing time. Several characterization methods are presented in this paper for evaluating the micro-structure surfaces of Ti45Al8Nb alloys: SEM, EDS, XRD and 3D topography. The results showed that the oxide scale and other contaminants on the surface of Ti45Al8Nb alloys can be effectively removed via EPP. The typical micro-crater structure of the surface of Ti45Al8Nb alloys were observed by 3D topography after EPP to find that the mean diameter of the surface structure and roughness value can be effectively controlled by altering the processing parameters. The mechanical properties of the surface according to nanomechanical probe testing exhibited slight decrease in microhardness and elastic modulus after EPP, but a dramatic increase in surface roughness, which is beneficial for further processing or coating.

Multiplexed, high density electrophysiology with nanofabricated neural probes.

Directory of Open Access Journals (Sweden)

Jiangang Du

Full Text Available Extracellular electrode arrays can reveal the neuronal network correlates of behavior with single-cell, single-spike, and sub-millisecond resolution. However, implantable electrodes are inherently invasive, and efforts to scale up the number and density of recording sites must compromise on device size in order to connect the electrodes. Here, we report on silicon-based neural probes employing nanofabricated, high-density electrical leads. Furthermore, we address the challenge of reading out multichannel data with an application-specific integrated circuit (ASIC performing signal amplification, band-pass filtering, and multiplexing functions. We demonstrate high spatial resolution extracellular measurements with a fully integrated, low noise 64-channel system weighing just 330 mg. The on-chip multiplexers make possible recordings with substantially fewer external wires than the number of input channels. By combining nanofabricated probes with ASICs we have implemented a system for performing large-scale, high-density electrophysiology in small, freely behaving animals that is both minimally invasive and highly scalable.

Multiplex real-time PCR assay for Legionella species.

Science.gov (United States)

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

61.3-Gbps hybrid fiber-wireless in-home network enabled by optical heterodyne and polarization multiplexing

NARCIS (Netherlands)

Cao, Z.; Li, F.; Liu, Y.; Yu, J.; Wang, Q.; Oh, C.W.; Jiao, Y.; Tran, N.C.; Boom, van den H.P.A.; Tangdiongga, E.; Koonen, A.M.J.

2014-01-01

A hybrid fiber-wireless in-home network is proposed to support high-speed multiple input and multiple output (MIMO) orthogonal frequency division multiplexing systems operating at millimeter wave (mm-wave) band by employing optical heterodyne (OH) and polarization multiplexing (PolMux). OH enables

Capacity analysis of spectrum sharing spatial multiplexing MIMO systems

KAUST Repository

Yang, Liang; Qaraqe, Khalid A.; Serpedin, Erchin; Alouini, Mohamed-Slim

2014-01-01

This paper considers a spectrum sharing (SS) multiple-input multiple-output (MIMO) system operating in a Rayleigh fading environment. First the capacity of a single-user SS spatial multiplexing system is investigated in two scenarios that assume

Array processing for seismic surface waves

Energy Technology Data Exchange (ETDEWEB)

Marano, S.

2013-07-01

This dissertation submitted to the Swiss Federal Institute of Technology ETH in Zurich takes a look at the analysis of surface wave properties which allows geophysicists to gain insight into the structure of the subsoil, thus avoiding more expensive invasive techniques such as borehole drilling. This thesis aims at improving signal processing techniques for the analysis of surface waves in various directions. One main contribution of this work is the development of a method for the analysis of seismic surface waves. The method also deals with the simultaneous presence of multiple waves. Several computational approaches to minimize costs are presented and compared. Finally, numerical experiments that verify the effectiveness of the proposed cost function and resulting array geometry designs are presented. These lead to greatly improved estimation performance in comparison to arbitrary array geometries.

Array processing for seismic surface waves

International Nuclear Information System (INIS)

Marano, S.

2013-01-01

This dissertation submitted to the Swiss Federal Institute of Technology ETH in Zurich takes a look at the analysis of surface wave properties which allows geophysicists to gain insight into the structure of the subsoil, thus avoiding more expensive invasive techniques such as borehole drilling. This thesis aims at improving signal processing techniques for the analysis of surface waves in various directions. One main contribution of this work is the development of a method for the analysis of seismic surface waves. The method also deals with the simultaneous presence of multiple waves. Several computational approaches to minimize costs are presented and compared. Finally, numerical experiments that verify the effectiveness of the proposed cost function and resulting array geometry designs are presented. These lead to greatly improved estimation performance in comparison to arbitrary array geometries

Comprehensive protein profiling by multiplexed capillary zone electrophoresis using cross-linked polyacrylamide coated capillaries.

Science.gov (United States)

Liu, Shaorong; Gao, Lin; Pu, Qiaosheng; Lu, Joann J; Wang, Xingjia

2006-02-01

We have recently developed a new process to create cross-linked polyacrylamide (CPA) coatings on capillary walls to suppress protein-wall interactions. Here, we demonstrate CPA-coated capillaries for high-efficiency (>2 x 10(6) plates per meter) protein separations by capillary zone electrophoresis (CZE). Because CPA virtually eliminates electroosmotic flow, positive and negative proteins cannot be analyzed in a single run. A "one-sample-two-separation" approach is developed to achieve a comprehensive protein analysis. High throughput is achieved through a multiplexed CZE system.

Diversity-Multiplexing-Nulling Trade-Off Analysis of Multiuser MIMO System for Intercell Interference Coordination

Directory of Open Access Journals (Sweden)

Jinwoo Kim

2017-01-01

Full Text Available A fundamental performance trade-off of multicell multiuser multiple-input multiple-output (MU-MIMO systems is explored for achieving intercell and intracell interference-free conditions. In particular, we analyze the three-dimensional diversity-multiplexing-nulling trade-off (DMNT among the diversity order (i.e., the slope of the error performance curve, multiplexing order (i.e., the number of users that are simultaneously served by MU-MIMO, and nulling order (i.e., the number of users with zero interference in a victim cell. This trade-off quantifies the performance of MU-MIMO in terms of its diversity and multiplexing order, while nulling the intercell interference toward the victim cell in the neighbor. First, we design a precoding matrix to mitigate both intercell and intracell interference for a linear precoding-based MU-MIMO system. Then, the trade-off relationship is obtained by analyzing the distribution of the signal-to-noise ratio (SNR at the user terminals. Furthermore, we demonstrate how DMNT can be applied to estimate the long-term throughput for each mobile station, which allows for determining the optimal number of multiplexing order and throughput loss due to the interference nulling.

Estimation of surface absorptivity in laser surface heating process with experimental data

International Nuclear Information System (INIS)

Chen, H-T; Wu, X-Y

2006-01-01

This study applies a hybrid technique of the Laplace transform and finite-difference methods in conjunction with the least-squares method and experimental temperature data inside the test material to predict the unknown surface temperature, heat flux and absorptivity for various surface conditions in the laser surface heating process. In this study, the functional form of the surface temperature is unknown a priori and is assumed to be a function of time before performing the inverse calculation. In addition, the whole time domain is divided into several analysis sub-time intervals and then these unknown estimates on each analysis interval can be predicted. In order to show the accuracy of the present inverse method, comparisons are made among the present estimates, direct results and previous results, showing that the present estimates agree with the direct results for the simulated problem. However, the present estimates of the surface absorptivity deviate slightly from previous estimated results under the assumption of constant thermal properties. The effect of the surface conditions on the surface absorptivity and temperature is not negligible

Multiplex detection of tumor markers with photonic suspension array

Energy Technology Data Exchange (ETDEWEB)

Zhao Yuanjin; Zhao Xiangwei [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Pei Xiaoping [Department of Hematology, Affiliated Zhongda Hospital, Southeast University, Nanjing 210009 (China); Hu Jing; Zhao Wenju [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Chen Baoan [Department of Hematology, Affiliated Zhongda Hospital, Southeast University, Nanjing 210009 (China); Gu Zhongze [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Laboratory of Environment and Biosafety, Research Institute of Southeast University in Suzhou, Dushu Lake Higher Education Town, Suzhou 215123 (China)], E-mail: gu@seu.edu.cn

2009-02-02

A novel photonic suspension array was developed for multiplex immunoassay. The carries of this array were silica colloidal crystal beads (SCCBs). The codes of these carriers are the characteristic reflection peak originated from their structural periodicity, and therefore they do not suffer from fading, bleaching, quenching, and chemical instability. In addition, because no dyes or materials related with fluorescence are included, the fluorescence background of SCCBs is very low. With a sandwich format, the proposed suspension array was used for simultaneous multiplex detection of tumor markers in one test tube. The results showed that the four tumor markers, {alpha}-fetoprotein (AFP), carcinoembryonic antigen (CEA), carcinoma antigen 125 (CA 125) and carcinoma antigen 19-9 (CA 19-9) could be assayed in the ranges of 1.0-500 ng mL{sup -1}, 1.0-500 ng mL{sup -1}, 1.0-500 U mL{sup -1} and 3.0-500 U mL{sup -1} with limits of detection of 0.68 ng mL{sup -1}, 0.95 ng mL{sup -1}, 0.99 U mL{sup -1} and 2.30 U mL{sup -1} at 3{sigma}, respectively. The proposed array showed acceptable accuracy, detection reproducibility, storage stability and the results obtained were in acceptable agreement with those from parallel single-analyte test of practical clinical sera. This technique provides a new strategy for low cost, automated, and simultaneous multiplex immunoassay.

Multiplexing of spatial modes in the mid-IR region

CSIR Research Space (South Africa)

Gailele, Lucas M

2017-02-01

Full Text Available ceiling in the near future. Communications using orbital angular momentum (OAM) carrying modes offers in finite dimensional states, providing means to increase link capacity by multiplexing spatially overlapping modes in both the azimuthal and radial...

Surface analytical techniques applied to minerals processing

International Nuclear Information System (INIS)

Smart, R.St.C.

1991-01-01

An understanding of the chemical and physical forms of the chemically altered layers on the surfaces of base metal sulphides, particularly in the form of hydroxides, oxyhydroxides and oxides, and the changes that occur in them during minerals processing lies at the core of a complete description of flotation chemistry. This paper reviews the application of a variety of surface-sensitive techniques and methodologies applied to the study of surface layers on single minerals, mixed minerals, synthetic ores and real ores. Evidence from combined XPS/SAM/SEM studies have provided images and analyses of three forms of oxide, oxyhydroxide and hydroxide products on the surfaces of single sulphide minerals, mineral mixtures and complex sulphide ores. 4 refs., 2 tabs., 4 figs

Forensic typing of autosomal SNPs with a 29 SNP-multiplex--results of a collaborative EDNAP exercise

DEFF Research Database (Denmark)

Sanchez, Juan Jose; Børsting, C; Balogh, K

2008-01-01

base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA...

Computer assisted multiplex sequencing. Performance report, August 1, 1992--July 15, 1993

Energy Technology Data Exchange (ETDEWEB)

1993-07-01

The objectives of this project are automation for optimization of multiplex sequencing. We have integrated direct transfer electrophoresis, automated multiplex hybridizations and automated film reading and applied this toward sequencing of E. coli and human DNA. Primers for the directed dideoxy sequence walking and sequence confirmation steps are synthesized to include DNA tags complementary to an alkaline phosphatase conjugate. A higher throughput synthesis device is well along in testing as are new automated hybridization devices. We have developed software for automatically annotating ORFs and databases of precise termini of proteins and RNA.

Quantum key distribution for 10 Gb/s dense wavelength division multiplexing networks

International Nuclear Information System (INIS)

Patel, K. A.; Dynes, J. F.; Lucamarini, M.; Choi, I.; Sharpe, A. W.; Yuan, Z. L.; Shields, A. J.; Penty, R. V.

2014-01-01

We demonstrate quantum key distribution (QKD) with bidirectional 10 Gb/s classical data channels in a single fiber using dense wavelength division multiplexing. Record secure key rates of 2.38 Mbps and fiber distances up to 70 km are achieved. Data channels are simultaneously monitored for error-free operation. The robustness of QKD is further demonstrated with a secure key rate of 445 kbps over 25 km, obtained in the presence of data lasers launching conventional 0 dBm power. We discuss the fundamental limit for the QKD performance in the multiplexing environment

Spatial Frequency Multiplexing of Fiber-Optic Interferometric Refractive Index Sensors Based on Graded-Index Multimode Fibers

Science.gov (United States)

Liu, Li; Gong, Yuan; Wu, Yu; Zhao, Tian; Wu, Hui-Juan; Rao, Yun-Jiang

2012-01-01

Fiber-optic interferometric sensors based on graded-index multimode fibers have very high refractive-index sensitivity, as we previously demonstrated. In this paper, spatial-frequency multiplexing of this type of fiber-optic refractive index sensors is investigated. It is estimated that multiplexing of more than 10 such sensors is possible. In the multiplexing scheme, one of the sensors is used to investigate the refractive index and temperature responses. The fast Fourier transform (FFT) of the combined reflective spectra is analyzed. The intensity of the FFT spectra is linearly related with the refractive index and is not sensitive to the temperature.

Parallel image-acquisition in continuous-wave electron paramagnetic resonance imaging with a surface coil array: Proof-of-concept experiments

Science.gov (United States)

Enomoto, Ayano; Hirata, Hiroshi

2014-02-01

This article describes a feasibility study of parallel image-acquisition using a two-channel surface coil array in continuous-wave electron paramagnetic resonance (CW-EPR) imaging. Parallel EPR imaging was performed by multiplexing of EPR detection in the frequency domain. The parallel acquisition system consists of two surface coil resonators and radiofrequency (RF) bridges for EPR detection. To demonstrate the feasibility of this method of parallel image-acquisition with a surface coil array, three-dimensional EPR imaging was carried out using a tube phantom. Technical issues in the multiplexing method of EPR detection were also clarified. We found that degradation in the signal-to-noise ratio due to the interference of RF carriers is a key problem to be solved.

Parallel segmented outlet flow high performance liquid chromatography with multiplexed detection

International Nuclear Information System (INIS)

Camenzuli, Michelle; Terry, Jessica M.; Shalliker, R. Andrew; Conlan, Xavier A.; Barnett, Neil W.; Francis, Paul S.

2013-01-01

Graphical abstract: -- Highlights: •Multiplexed detection for liquid chromatography. •‘Parallel segmented outlet flow’ distributes inner and outer portions of the analyte zone. •Three detectors were used simultaneously for the determination of opiate alkaloids. -- Abstract: We describe a new approach to multiplex detection for HPLC, exploiting parallel segmented outlet flow – a new column technology that provides pressure-regulated control of eluate flow through multiple outlet channels, which minimises the additional dead volume associated with conventional post-column flow splitting. Using three detectors: one UV-absorbance and two chemiluminescence systems (tris(2,2′-bipyridine)ruthenium(III) and permanganate), we examine the relative responses for six opium poppy (Papaver somniferum) alkaloids under conventional and multiplexed conditions, where approximately 30% of the eluate was distributed to each detector and the remaining solution directed to a collection vessel. The parallel segmented outlet flow mode of operation offers advantages in terms of solvent consumption, waste generation, total analysis time and solute band volume when applying multiple detectors to HPLC, but the manner in which each detection system is influenced by changes in solute concentration and solution flow rates must be carefully considered

A multiplex branched DNA assay for parallel quantitative gene expression profiling.

Science.gov (United States)

Flagella, Michael; Bui, Son; Zheng, Zhi; Nguyen, Cung Tuong; Zhang, Aiguo; Pastor, Larry; Ma, Yunqing; Yang, Wen; Crawford, Kimberly L; McMaster, Gary K; Witney, Frank; Luo, Yuling

2006-05-01

We describe a novel method to quantitatively measure messenger RNA (mRNA) expression of multiple genes directly from crude cell lysates and tissue homogenates without the need for RNA purification or target amplification. The multiplex branched DNA (bDNA) assay adapts the bDNA technology to the Luminex fluorescent bead-based platform through the use of cooperative hybridization, which ensures an exceptionally high degree of assay specificity. Using in vitro transcribed RNA as reference standards, we demonstrated that the assay is highly specific, with cross-reactivity less than 0.2%. We also determined that the assay detection sensitivity is 25,000 RNA transcripts with intra- and interplate coefficients of variance of less than 10% and less than 15%, respectively. Using three 10-gene panels designed to measure proinflammatory and apoptosis responses, we demonstrated sensitive and specific multiplex gene expression profiling directly from cell lysates. The gene expression change data demonstrate a high correlation coefficient (R(2)=0.94) compared with measurements obtained using the single-plex bDNA assay. Thus, the multiplex bDNA assay provides a powerful means to quantify the gene expression profile of a defined set of target genes in large sample populations.

Parallel segmented outlet flow high performance liquid chromatography with multiplexed detection

Energy Technology Data Exchange (ETDEWEB)

Camenzuli, Michelle [Australian Centre for Research on Separation Science (ACROSS), School of Science and Health, University of Western Sydney (Parramatta), Sydney, NSW (Australia); Terry, Jessica M. [Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences, Deakin University, Geelong, Victoria 3216 (Australia); Shalliker, R. Andrew, E-mail: r.shalliker@uws.edu.au [Australian Centre for Research on Separation Science (ACROSS), School of Science and Health, University of Western Sydney (Parramatta), Sydney, NSW (Australia); Conlan, Xavier A.; Barnett, Neil W. [Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences, Deakin University, Geelong, Victoria 3216 (Australia); Francis, Paul S., E-mail: paul.francis@deakin.edu.au [Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences, Deakin University, Geelong, Victoria 3216 (Australia)

2013-11-25

Graphical abstract: -- Highlights: •Multiplexed detection for liquid chromatography. •‘Parallel segmented outlet flow’ distributes inner and outer portions of the analyte zone. •Three detectors were used simultaneously for the determination of opiate alkaloids. -- Abstract: We describe a new approach to multiplex detection for HPLC, exploiting parallel segmented outlet flow – a new column technology that provides pressure-regulated control of eluate flow through multiple outlet channels, which minimises the additional dead volume associated with conventional post-column flow splitting. Using three detectors: one UV-absorbance and two chemiluminescence systems (tris(2,2′-bipyridine)ruthenium(III) and permanganate), we examine the relative responses for six opium poppy (Papaver somniferum) alkaloids under conventional and multiplexed conditions, where approximately 30% of the eluate was distributed to each detector and the remaining solution directed to a collection vessel. The parallel segmented outlet flow mode of operation offers advantages in terms of solvent consumption, waste generation, total analysis time and solute band volume when applying multiple detectors to HPLC, but the manner in which each detection system is influenced by changes in solute concentration and solution flow rates must be carefully considered.

Multiplexing storage using angular variation in a transmission holographic polymer dispersed liquid crystal

Energy Technology Data Exchange (ETDEWEB)

Kim, Eun-Hee; Jung, Yeon-Gil, E-mail: jungyg@changwon.ac.kr

2015-12-01

Simultaneous angular multiplexing of transmission gratings in a holographic polymer dispersed liquid crystal (HPDLC) film as a function of resin and film compositions, irradiation intensity, and cell thickness has been studied by exposing the material to three coherent laser beams. It was found that the diffraction efficiency monotonically increases with irradiation intensity and cell gap, whereas a maximum of 43% is obtained at specific compositions of trimethylolpropane triacrylate (TMPTA)/N-vinylpyrrolidone (NVP) = 8/1 and polymer/LC = 65/35. The multiplexed gratings have been captured using SEM imaging and the reconstructed images using a charge-coupled device camera, showing successful reconstructed images of gratings. - Highlights: • Multiplex images were well recorded using simultaneous angular method. • The periodic structures of the LC and polymer regions were well prepared. • The angular selectivity was variable nevertheless fabrication by three beams. • The images were successfully reconstructed in gratings of same spot.

Multiplexing storage using angular variation in a transmission holographic polymer dispersed liquid crystal

International Nuclear Information System (INIS)

Kim, Eun-Hee; Jung, Yeon-Gil

2015-01-01

Simultaneous angular multiplexing of transmission gratings in a holographic polymer dispersed liquid crystal (HPDLC) film as a function of resin and film compositions, irradiation intensity, and cell thickness has been studied by exposing the material to three coherent laser beams. It was found that the diffraction efficiency monotonically increases with irradiation intensity and cell gap, whereas a maximum of 43% is obtained at specific compositions of trimethylolpropane triacrylate (TMPTA)/N-vinylpyrrolidone (NVP) = 8/1 and polymer/LC = 65/35. The multiplexed gratings have been captured using SEM imaging and the reconstructed images using a charge-coupled device camera, showing successful reconstructed images of gratings. - Highlights: • Multiplex images were well recorded using simultaneous angular method. • The periodic structures of the LC and polymer regions were well prepared. • The angular selectivity was variable nevertheless fabrication by three beams. • The images were successfully reconstructed in gratings of same spot.

Surface quality in rapid prototype MMD process

Directory of Open Access Journals (Sweden)

Lisandro Vargas Henríquez

2004-09-01

Full Text Available This article summarises a Manufacturing Materials and Processes MSc thesis written for the Mechanical and Electrical Engineering Department. The paper shows the interaction of process, gap (deposition distance and extursion terminal velocity modelled process parameters for CEIF's (Centro de Equipos Interfacultades rapid prototype molten material deposit (MMD Titan SH-1 machine by analysing prototupes improved surface quality and resistence to tension and characterising material. The project applies experimental design criteria for orientating the selection of experimental process parameters. Acrylonitrile-buttadin-styrene (ABS had alredy been mechanically and physicochemically characterised (i.e the material used in the MMD process.

Coherent optical DFT-spread OFDM transmission using orthogonal band multiplexing.

Science.gov (United States)

Yang, Qi; He, Zhixue; Yang, Zhu; Yu, Shaohua; Yi, Xingwen; Shieh, William

2012-01-30

Coherent optical OFDM (CO-OFDM) combined with orthogonal band multiplexing provides a scalable and flexible solution for achieving ultra high-speed rate. Among many CO-OFDM implementations, digital Fourier transform spread (DFT-S) CO-OFDM is proposed to mitigate fiber nonlinearity in long-haul transmission. In this paper, we first illustrate the principle of DFT-S OFDM. We then experimentally evaluate the performance of coherent optical DFT-S OFDM in a band-multiplexed transmission system. Compared with conventional clipping methods, DFT-S OFDM can reduce the OFDM peak-to-average power ratio (PAPR) value without suffering from the interference of the neighboring bands. With the benefit of much reduced PAPR, we successfully demonstrate 1.45 Tb/s DFT-S OFDM over 480 km SSMF transmission.

Zerodur polishing process for high surface quality and high efficiency

International Nuclear Information System (INIS)

Tesar, A.; Fuchs, B.

1992-08-01

Zerodur is a glass-ceramic composite importance in applications where temperature instabilities influence optical and mechanical performance, such as in earthbound and spaceborne telescope mirror substrates. Polished Zerodur surfaces of high quality have been required for laser gyro mirrors. Polished surface quality of substrates affects performance of high reflection coatings. Thus, the interest in improving Zerodur polished surface quality has become more general. Beyond eliminating subsurface damage, high quality surfaces are produced by reducing the amount of hydrated material redeposited on the surface during polishing. With the proper control of polishing parameters, such surfaces exhibit roughnesses of < l Angstrom rms. Zerodur polishing was studied to recommend a high surface quality polishing process which could be easily adapted to standard planetary continuous polishing machines and spindles. This summary contains information on a polishing process developed at LLNL which reproducibly provides high quality polished Zerodur surfaces at very high polishing efficiencies

Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

Science.gov (United States)

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

Science.gov (United States)

Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

2012-11-01

In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

Simultaneous measurements of auto-immune and infectious disease specific antibodies using a high throughput multiplexing tool.

Directory of Open Access Journals (Sweden)

Atul Asati

Full Text Available Considering importance of ganglioside antibodies as biomarkers in various immune-mediated neuropathies and neurological disorders, we developed a high throughput multiplexing tool for the assessment of gangliosides-specific antibodies based on Biolpex/Luminex platform. In this report, we demonstrate that the ganglioside high throughput multiplexing tool is robust, highly specific and demonstrating ∼100-fold higher concentration sensitivity for IgG detection than ELISA. In addition to the ganglioside-coated array, the high throughput multiplexing tool contains beads coated with influenza hemagglutinins derived from H1N1 A/Brisbane/59/07 and H1N1 A/California/07/09 strains. Influenza beads provided an added advantage of simultaneous detection of ganglioside- and influenza-specific antibodies, a capacity important for the assay of both infectious antigen-specific and autoimmune antibodies following vaccination or disease. Taken together, these results support the potential adoption of the ganglioside high throughput multiplexing tool for measuring ganglioside antibodies in various neuropathic and neurological disorders.

Link prediction in multiplex online social networks

Science.gov (United States)

Jalili, Mahdi; Orouskhani, Yasin; Asgari, Milad; Alipourfard, Nazanin; Perc, Matjaž

2017-02-01

Online social networks play a major role in modern societies, and they have shaped the way social relationships evolve. Link prediction in social networks has many potential applications such as recommending new items to users, friendship suggestion and discovering spurious connections. Many real social networks evolve the connections in multiple layers (e.g. multiple social networking platforms). In this article, we study the link prediction problem in multiplex networks. As an example, we consider a multiplex network of Twitter (as a microblogging service) and Foursquare (as a location-based social network). We consider social networks of the same users in these two platforms and develop a meta-path-based algorithm for predicting the links. The connectivity information of the two layers is used to predict the links in Foursquare network. Three classical classifiers (naive Bayes, support vector machines (SVM) and K-nearest neighbour) are used for the classification task. Although the networks are not highly correlated in the layers, our experiments show that including the cross-layer information significantly improves the prediction performance. The SVM classifier results in the best performance with an average accuracy of 89%.

Space division multiplexing chip-to-chip quantum key distribution

DEFF Research Database (Denmark)

Bacco, Davide; Ding, Yunhong; Dalgaard, Kjeld

2017-01-01

nodes of the quantum keys to their respective destinations. In this paper we present an experimental demonstration of a photonic integrated silicon chip quantum key distribution protocols based on space division multiplexing (SDM), through multicore fiber technology. Parallel and independent quantum...

A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

Science.gov (United States)

Reich, J D; Alexander, T W; Chatterton, S

2016-05-01

Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

Functional characterization of Gram-negative bacteria from different genera as multiplex cadmium biosensors.

Science.gov (United States)

Bereza-Malcolm, Lara; Aracic, Sanja; Kannan, Ruban; Mann, Gülay; Franks, Ashley E

2017-08-15

Widespread presence of cadmium in soil and water systems is a consequence of industrial and agricultural processes. Subsequent accumulation of cadmium in food and drinking water can result in accidental consumption of dangerous concentrations. As such, cadmium environmental contamination poses a significant threat to human health. Development of microbial biosensors, as a novel alternative method for in situ cadmium detection, may reduce human exposure by complementing traditional analytical methods. In this study, a multiplex cadmium biosensing construct was assembled by cloning a single-output cadmium biosensor element, cadRgfp, and a constitutively expressed mrfp1 onto a broad-host range vector. Incorporation of the duplex fluorescent output [green and red fluorescence proteins] allowed measurement of biosensor functionality and viability. The biosensor construct was tested in several Gram-negative bacteria including Pseudomonas, Shewanella and Enterobacter. The multiplex cadmium biosensors were responsive to cadmium concentrations ranging from 0.01 to 10µgml -1 , as well as several other heavy metals, including arsenic, mercury and lead at similar concentrations. The biosensors were also responsive within 20-40min following exposure to 3µgml -1 cadmium. This study highlights the importance of testing biosensor constructs, developed using synthetic biology principles, in different bacterial genera. Copyright © 2017 Elsevier B.V. All rights reserved.

Digital frequency domain multiplexing readout electronics for the next generation of millimeter telescopes

Science.gov (United States)

Bender, Amy N.; Cliche, Jean-François; de Haan, Tijmen; Dobbs, Matt A.; Gilbert, Adam J.; Montgomery, Joshua; Rowlands, Neil; Smecher, Graeme M.; Smith, Ken; Wilson, Andrew

2014-07-01

Frequency domain multiplexing (fMux) is an established technique for the readout of transition-edge sensor (TES) bolometers in millimeter-wavelength astrophysical instrumentation. In fMux, the signals from multiple detectors are read out on a single pair of wires reducing the total cryogenic thermal loading as well as the cold component complexity and cost of a system. The current digital fMux system, in use by POLARBEAR, EBEX, and the South Pole Telescope, is limited to a multiplexing factor of 16 by the dynamic range of the Superconducting Quantum Interference Device pre-amplifier and the total system bandwidth. Increased multiplexing is key for the next generation of large format TES cameras, such as SPT-3G and POLARBEAR2, which plan to have on the of order 15,000 detectors. Here, we present the next generation fMux readout, focusing on the warm electronics. In this system, the multiplexing factor increases to 64 channels per module (2 wires) while maintaining low noise levels and detector stability. This is achieved by increasing the system bandwidth, reducing the dynamic range requirements though active feedback, and digital synthesis of voltage biases with a novel polyphase filter algorithm. In addition, a version of the new fMux readout includes features such as low power consumption and radiation-hard components making it viable for future space-based millimeter telescopes such as the LiteBIRD satellite.

THE PRODUCT DESIGN PROCESS USING STYLISTIC SURFACES

Directory of Open Access Journals (Sweden)

Arkadiusz Gita

2017-06-01

Full Text Available The increasing consumer requirements for the way what everyday use products look like, forces manufacturers to put more emphasis on product design. Constructors, apart from the functional aspects of the parts created, are forced to pay attention to the aesthetic aspects. Software for designing A-class surfaces is very helpful in this case. Extensive quality analysis modules facilitate the work and allow getting models with specific visual features. The authors present a design process of the product using stylistic surfaces based on the front panel of the moped casing. In addition, methods of analysis of the design surface and product technology are presented.

Tribological investigations of the applicability of surface functionalization for dry extrusion processes

Science.gov (United States)

Teller, Marco; Prünte, Stephan; Ross, Ingo; Temmler, André; Schneider, Jochen M.; Hirt, Gerhard

2017-10-01

Cold extrusion processes are characterized by large relative contact stresses combined with a severe surface enlargement of the workpiece. Under these process conditions a high risk for galling of workpiece material to the tool steel occurs especially in processing of aluminum and aluminum alloys. In order to reduce adhesive wear lubricants for separation of workpiece and tool surfaces are used. As a consequence additional process steps (e.g. preparation and cleaning of workpieces) are necessary. Thus, the realization of a dry forming process is aspired from an environmental and economic perspective. In this paper a surface functionalization with self-assembled-monolayers (SAM) of the tool steels AISI D2 (DIN 1.2379) and AISI H11 (DIN 1.2343) is evaluated by a process-oriented tribological test. The tribological experiment is able to resemble and scale the process conditions of cold extrusion related to relative contact stress and surface enlargement for the forming of pure aluminum (Al99.5). The effect of reduced relative contact stress, surface enlargement and relative velocity on adhesive wear and tool lifetime is evaluated. Similar process conditions are achievable by different die designs with decreased extrusion ratios and adjusted die angles. The effect of surface functionalization critically depends on the substrate material. The different microstructure and the resulting differences in surface chemistry of the two tested tool steels appear to affect the performance of the tool surface functionalization with SAM.

Choice of Illumination System & Fluorophore for Multiplex Immunofluorescence on FFPE Tissue Sections.

Directory of Open Access Journals (Sweden)

Sandrine Prost

Full Text Available The recent availability of novel dyes and alternative light sources to facilitate complex tissue immunofluorescence studies such as multiplex labelling has not been matched by reports critically evaluating the considerations and relative benefits of these new tools, particularly in combination. Product information is often limited to wavelengths used for older fluorophores (FITC, TRITC & corresponding Alexa dyes family. Consequently, novel agents such as Quantum dots are not widely appreciated or used, despite highly favourable properties including extremely bright emission, stability and potentially reduced tissue autofluorescence at the excitation wavelength. Using spectral analysis, we report here a detailed critical appraisal and comparative evaluation of different light sources and fluorophores in multiplex immunofluorescence of clinical biopsy sections. The comparison includes mercury light, metal halide and 3 different LED-based systems, using 7 Qdots (525, 565, 585, 605, 625, 705, Cy3 and Cy5. We discuss the considerations relevant to achieving the best combination of light source and fluorophore for accurate multiplex fluorescence quantitation. We highlight practical limitations and confounders to quantitation with filter-based approaches.

Monitoring bacterial faecal contamination in waters using multiplex ...

African Journals Online (AJOL)

Monitoring of sanitary quality or faecal pollution in water is currently based on quantifying some bacterial indicators such as Escherichia coli and faecal enterococci. Using a multiplex real-time PCR assay for faecal enterococci and Bacteroides spp., the detection of faecal contamination in non-treated water can be done in a ...

Photopolymerization of complex emulsions with irregular shapes fabricated by multiplex coaxial flow focusing

Science.gov (United States)

Wu, Qiang; Yang, Chaoyu; Yang, Jianxin; Huang, Fangsheng; Liu, Guangli; Zhu, Zhiqiang; Si, Ting; Xu, Ronald X.

2018-02-01

We fabricate complex emulsions with irregular shapes in the microscale by a simple but effective multiplex coaxial flow focusing process. A multiphase cone-jet structure is steadily formed, and the compound liquid jet eventually breaks up into Janus microdroplets due to the perturbations propagating along the jet interfaces. The microdroplet shapes can be exclusively controlled by interfacial tensions of adjacent phases. Crescent-moon-shaped microparticles and microcapsules with designated structural characteristics are further produced under ultraviolet light of photopolymerization after removing one hemisphere of the Janus microdroplets. These complex emulsions have potential applications in bioscience, food, functional materials, and controlled drug delivery.

Rapid, Time-Division Multiplexed, Direct Absorption- and Wavelength Modulation-Spectroscopy

Directory of Open Access Journals (Sweden)

Alexander Klein

2014-11-01

Full Text Available We present a tunable diode laser spectrometer with a novel, rapid time multiplexed direct absorption- and wavelength modulation-spectroscopy operation mode. The new technique allows enhancing the precision and dynamic range of a tunable diode laser absorption spectrometer without sacrificing accuracy. The spectroscopic technique combines the benefits of absolute concentration measurements using calibration-free direct tunable diode laser absorption spectroscopy (dTDLAS with the enhanced noise rejection of wavelength modulation spectroscopy (WMS. In this work we demonstrate for the first time a 125 Hz time division multiplexed (TDM-dTDLAS-WMS spectroscopic scheme by alternating the modulation of a DFB-laser between a triangle-ramp (dTDLAS and an additional 20 kHz sinusoidal modulation (WMS. The absolute concentration measurement via the dTDLAS-technique allows one to simultaneously calibrate the normalized 2f/1f-signal of the WMS-technique. A dTDLAS/WMS-spectrometer at 1.37 µm for H2O detection was built for experimental validation of the multiplexing scheme over a concentration range from 50 to 3000 ppmV (0.1 MPa, 293 K. A precision of 190 ppbV was achieved with an absorption length of 12.7 cm and an averaging time of two seconds. Our results show a five-fold improvement in precision over the entire concentration range and a significantly decreased averaging time of the spectrometer.

Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

Science.gov (United States)

Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

2011-01-01

Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

Error-free 320 Gb/s simultaneous add-drop multiplexing

DEFF Research Database (Denmark)

Mulvad, Hans Christian Hansen; Oxenløwe, Leif Katsuo; Clausen, Anders

2007-01-01

We report on the first demonstration of error-free time-division add-drop multiplexing at 320 Gb/s. The add- and drop-operations are performed simultaneously in a non-linear optical loop mirror with only 100 m of highly non-linear fibre....

Novel CNC Grinding Process Control for Nanometric Surface Roughness for Aspheric Space Optical Surfaces

Directory of Open Access Journals (Sweden)

Jeong-Yeol Han

2004-06-01

Full Text Available Optics fabrication process for precision space optical parts includes bound abrasive grinding, loose abrasive lapping and polishing. The traditional bound abrasive grinding with bronze bond cupped diamond wheel leaves the machine marks of about 20 μm rms in height and the subsurface damage of about 1 μm rms in height to be removed by subsequent loose abrasive lapping. We explored an efficient quantitative control of precision CNC grinding. The machining parameters such as grain size, work-piece rotation speed and feed rate were altered while grinding the work-piece surfaces of 20-100 mm in diameter. The input grinding variables and the resulting surface quality data were used to build grinding prediction models using empirical and multi-variable regression analysis. The effectiveness of such grinding prediction models was then examined by running a series of precision CNC grinding operation with a set of controlled input variables and predicted output surface quality indicators. The experiment achieved the predictability down to ±20 nm in height and the surface roughness down to 36 nm in height. This study contributed to improvement of the process efficiency reaching directly the polishing and figuring process without the need for the loose abrasive lapping stage.

Acoustic emission-based in-process monitoring of surface generation in robot-assisted polishing

DEFF Research Database (Denmark)

Pilny, Lukas; Bissacco, Giuliano; De Chiffre, Leonardo

2016-01-01

The applicability of acoustic emission (AE) measurements for in-process monitoring of surface generation in the robot-assisted polishing (RAP) was investigated. Surface roughness measurements require interruption of the process, proper surface cleaning and measurements that sometimes necessitate...... automatic detection of optimal process endpoint allow intelligent process control, creating fundamental elements in development of robust fully automated RAP process for its widespread industrial application....... removal of the part from the machine tool. In this study, stabilisation of surface roughness during polishing rotational symmetric surfaces by the RAP process was monitored by AE measurements. An AE sensor was placed on a polishing arm in direct contact with a bonded abrasive polishing tool...

Multiplexed displacement fiber sensor using thin core fiber exciter.

Science.gov (United States)

Chen, Zhen; Hefferman, Gerald; Wei, Tao

2015-06-01

This letter reports a multiplexed optical displacement sensor using a thin core fiber (TCF) exciter. The TCF exciter is followed by a stripped single mode optical fiber. A small section of buffer is used as the movable component along the single mode fiber. Ultra-weak cladding mode reflection (< - 75 dB) was employed to probe the refractive index discontinuity between the air and buffer coating boundary. The position change of the movable buffer segment results in a delay change of the cladding mode reflection. Thus, it is a measure of the displacement of the buffer segment with respect to the glass fiber. The insertion loss of one sensor was measured to be less than 3 dB. A linear relationship was evaluated between the measurement position and absolute position of the moving actuator. Multiplexed capability was demonstrated and no cross talk was found between the sensors.

Simultaneous multiplexed materials characterization using a high-precision hard X-ray micro-slit array

International Nuclear Information System (INIS)

Zhang, Fan; Allen, Andrew J.; Levine, Lyle E.; Mancini, Derrick C.; Ilavsky, Jan

2015-01-01

A novel measurement scheme that allows multiplexed simultaneous measurements from multiple nearby sample volumes is reported. The needs both for increased experimental throughput and for in operando characterization of functional materials under increasingly realistic experimental conditions have emerged as major challenges across the whole of crystallography. A novel measurement scheme that allows multiplexed simultaneous measurements from multiple nearby sample volumes is presented. This new approach enables better measurement statistics or direct probing of heterogeneous structure, dynamics or elemental composition. To illustrate, the submicrometer precision that optical lithography provides has been exploited to create a multiplexed form of ultra-small-angle scattering based X-ray photon correlation spectroscopy (USAXS-XPCS) using micro-slit arrays fabricated by photolithography. Multiplexed USAXS-XPCS is applied to follow the equilibrium dynamics of a simple colloidal suspension. While the dependence of the relaxation time on momentum transfer, and its relationship with the diffusion constant and the static structure factor, follow previous findings, this measurements-in-parallel approach reduces the statistical uncertainties of this photon-starved technique to below those associated with the instrument resolution. More importantly, we note the potential of the multiplexed scheme to elucidate the response of different components of a heterogeneous sample under identical experimental conditions in simultaneous measurements. In the context of the X-ray synchrotron community, this scheme is, in principle, applicable to all in-line synchrotron techniques. Indeed, it has the potential to open a new paradigm for in operando characterization of heterogeneous functional materials, a situation that will be even further enhanced by the ongoing development of multi-bend achromat storage ring designs as the next evolution of large-scale X-ray synchrotron facilities around

High-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor array

Science.gov (United States)

Guss, Paul; Rabin, Michael; Croce, Mark; Hoteling, Nathan; Schwellenbach, David; Kruschwitz, Craig; Mocko, Veronika; Mukhopadhyay, Sanjoy

2017-09-01

We demonstrate very high-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor (TES) array. The readout circuit consists of superconducting microwave resonators coupled to radio frequency superconducting-quantum-interference devices (RF-SQUIDs) and transduces changes in input current to changes in phase of a microwave signal. We used a flux-ramp modulation to linearize the response and avoid low-frequency noise. The result is a very high-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor array. We performed and validated a small-scale demonstration and test of all the components of our concept system, which encompassed microcalorimetry, microwave multiplexing, RF-SQUIDs, and software-defined radio (SDR). We shall display data we acquired in the first simultaneous combination of all key innovations in a 4-pixel demonstration, including microcalorimetry, microwave multiplexing, RF-SQUIDs, and SDR. We present the energy spectrum of a gadolinium-153 (153Gd) source we measured using our 4-pixel TES array and the RF-SQUID multiplexer. For each pixel, one can observe the two 97.4 and 103.2 keV photopeaks. We measured the 153Gd photon source with an achieved energy resolution of 70 eV, full width half maximum (FWHM) at 100 keV, and an equivalent readout system noise of 90 pA/pHz at the TES. This demonstration establishes a path for the readout of cryogenic x-ray and gamma ray sensor arrays with more elements and spectral resolving powers. We believe this project has improved capabilities and substantively advanced the science useful for missions such as nuclear forensics, emergency response, and treaty verification through the explored TES developments.

A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

Energy Technology Data Exchange (ETDEWEB)

Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

2007-04-11

We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

ENVISAT Land Surface Processes. Phase 2

Science.gov (United States)

vandenHurk, B. J. J. M.; Su, Z.; Verhoef, W.; Menenti, M.; Li, Z.-L.; Wan, Z.; Moene, A. F.; Roerink, G.; Jia, I.

2002-01-01

This is a progress report of the 2nd phase of the project ENVISAT- Land Surface Processes, which has a 3-year scope. In this project, preparative research is carried out aiming at the retrieval of land surface characteristics from the ENVISAT sensors MERIS and AATSR, for assimilation into a system for Numerical Weather Prediction (NWP). Where in the 1st phase a number of first shot experiments were carried out (aiming at gaining experience with the retrievals and data assimilation procedures), the current 2nd phase has put more emphasis on the assessment and improvement of the quality of the retrieved products. The forthcoming phase will be devoted mainly to the data assimilation experiments and the assessment of the added value of the future ENVISAT products for NWP forecast skill. Referring to the retrieval of albedo, leaf area index and atmospheric corrections, preliminary radiative transfer calculations have been carried out that should enable the retrieval of these parameters once AATSR and MERIS data become available. However, much of this work is still to be carried out. An essential part of work in this area is the design and implementation of software that enables an efficient use of MODTRAN(sub 4) radiative transfer code, and during the current project phase familiarization with these new components has been achieved. Significant progress has been made with the retrieval of component temperatures from directional ATSR-images, and the calculation of surface turbulent heat fluxes from these data. The impact of vegetation cover on the retrieved component temperatures appears manageable, and preliminary comparison of foliage temperature to air temperatures were encouraging. The calculation of surface fluxes using the SEBI concept,which includes a detailed model of the surface roughness ratio, appeared to give results that were in reasonable agreement with local measurements with scintillometer devices. The specification of the atmospheric boundary conditions

Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

Science.gov (United States)

Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

2015-01-01

To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Epidemic spreading and immunization strategy in multiplex networks

Science.gov (United States)

Alvarez Zuzek, Lucila G.; Buono, Camila; Braunstein, Lidia A.

2015-09-01

A more connected world has brought major consequences such as facilitate the spread of diseases all over the world to quickly become epidemics, reason why researchers are concentrated in modeling the propagation of epidemics and outbreaks in multilayer networks. In this networks all nodes interact in different layers with different type of links. However, in many scenarios such as in the society, a multiplex network framework is not completely suitable since not all individuals participate in all layers. In this paper, we use a partially overlapped, multiplex network where only a fraction of the individuals are shared by the layers. We develop a mitigation strategy for stopping a disease propagation, considering the Susceptible-Infected- Recover model, in a system consisted by two layers. We consider a random immunization in one of the layers and study the effect of the overlapping fraction in both, the propagation of the disease and the immunization strategy. Using branching theory, we study this scenario theoretically and via simulations and find a lower epidemic threshold than in the case without strategy.

Chaotic, informational and synchronous behaviour of multiplex networks

Science.gov (United States)

Baptista, M. S.; Szmoski, R. M.; Pereira, R. F.; Pinto, S. E. De Souza

2016-03-01

The understanding of the relationship between topology and behaviour in interconnected networks would allow to charac- terise and predict behaviour in many real complex networks since both are usually not simultaneously known. Most previous studies have focused on the relationship between topology and synchronisation. In this work, we provide analytical formulas that shows how topology drives complex behaviour: chaos, information, and weak or strong synchronisation; in multiplex net- works with constant Jacobian. We also study this relationship numerically in multiplex networks of Hindmarsh-Rose neurons. Whereas behaviour in the analytically tractable network is a direct but not trivial consequence of the spectra of eigenvalues of the Laplacian matrix, where behaviour may strongly depend on the break of symmetry in the topology of interconnections, in Hindmarsh-Rose neural networks the nonlinear nature of the chemical synapses breaks the elegant mathematical connec- tion between the spectra of eigenvalues of the Laplacian matrix and the behaviour of the network, creating networks whose behaviour strongly depends on the nature (chemical or electrical) of the inter synapses.

Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

Directory of Open Access Journals (Sweden)

Ki Young Yoo

2010-03-01

Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

Scaling behaviour of randomly alternating surface growth processes

International Nuclear Information System (INIS)

Raychaudhuri, Subhadip; Shapir, Yonathan

2002-01-01

The scaling properties of the roughness of surfaces grown by two different processes randomly alternating in time are addressed. The duration of each application of the two primary processes is assumed to be independently drawn from given distribution functions. We analytically address processes in which the two primary processes are linear and extend the conclusions to nonlinear processes as well. The growth scaling exponent of the average roughness with the number of applications is found to be determined by the long time tail of the distribution functions. For processes in which both mean application times are finite, the scaling behaviour follows that of the corresponding cyclical process in which the uniform application time of each primary process is given by its mean. If the distribution functions decay with a small enough power law for the mean application times to diverge, the growth exponent is found to depend continuously on this power-law exponent. In contrast, the roughness exponent does not depend on the timing of the applications. The analytical results are supported by numerical simulations of various pairs of primary processes and with different distribution functions. Self-affine surfaces grown by two randomly alternating processes are common in nature (e.g., due to randomly changing weather conditions) and in man-made devices such as rechargeable batteries

Towards effective visual analytics on multiplex and multilayer networks

DEFF Research Database (Denmark)

Rossi, Luca; Magnani, Matteo

2015-01-01

In this article we discuss visualisation strategies for multiplex networks. Since Moreno’s early works on network analysis, visualisation has been one of the main ways to understand networks thanks to its ability to summarise a complex structure into a single representation highlighting multiple...

SIMULATION OF MULTIPLEXING OF TWO PHASE SOIL IN CASE OF COMPRESSION COMPRESSION

Directory of Open Access Journals (Sweden)

G. E. Agakhanov

2016-01-01

Full Text Available Aim.The article is devoted to solving the problem of finding metodoa seal a two phase soil layer under compression compression uniformly distributed load.Methods.On estimated model of a continuous isotropic body with linear and hereditary creep in case of invariance of the environment and a persistence of coefficient of Poisson in time, and also taking into account different resilience of a skeleton of soil when multiplexing and demultiplexing the decision of the task of multiplexing of a layer of two-phase soil in case of compression is received by a uniformly distributed load. Special cases of the intense deformed status are considered.Results.The analysis of the received decision shows that in case of a persistence in time of coefficient of Poisson of the environment, creep doesn't influence tension, and only affects deformation or relocation (settling that corresponds to earlier set provisions. In case of a persistence of coefficient of Poisson the intense deformed status of the environment can be determined also by method of elastic analogy, solving the appropriate uprugomgnovenny problem. The solution of the equation for pore pressure is executed by Fourier method. According to the received analytical decision the flowchart and the program in Matlab packet with use of the built-in programming language of the Matlab system is made.Conclusion. For two options of conditions of drainage calculation of function of pore pressure, function of a side raspor and level of consolidation of a layer taking into account and without creep is executed and their surfaces of distribution and a graphics of change are constructed.

Synchronization, retiming and time-division multiplexing of an asynchronous 10 gigabit NRZ Ethernet packet to Terabit Ethernet

DEFF Research Database (Denmark)

Hu, Hao; Laguardia Areal, Janaina; Mulvad, Hans Christian Hansen

2011-01-01

An asynchronous 10 Gb/s Ethernet packet with maximum packet size of 1518 bytes is synchronized and retimed to a master clock with 200 kHz frequency offset using a time lens. The NRZ packet is simultaneously converted into an RZ packet, then further pulse compressed to a FWHM of 400 fs and finally...... time-division multiplexed with a serial 1.28 Tb/s signal including a vacant time slot, thus forming a 1.29 Tb/s time-division multiplexed serial signal. Error-free performance of synchronizing, retiming, time-division multiplexing to a Terabit data stream and finally demultiplexing back to 10 Gb...

Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

Directory of Open Access Journals (Sweden)

Mahnaz Mahmoudi Rad

2012-01-01

Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

SQUID multiplexing using baseband feedback for space application of transition-edge sensor microcalorimeters

Energy Technology Data Exchange (ETDEWEB)

Takei, Y; Yamasaki, N Y; Hirakoso, W; Kimura, S; Mitsuda, K, E-mail: takei@astro.isas.jaxa.j [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Sagamihara, 229-8510 (Japan)

2009-11-15

A microcalorimeter array based on a transition-edge sensor (TES) thermometer is a promising imaging spectrometer for use in future x-ray astronomy missions. A TES microcalorimeter achieves {approx}<5 eV energy resolution and an array of >100 pixels also provides a moderate imaging capability. For a large format array, signal multiplexing at the low temperature stage is mandatory in order to reduce heat loads from cold stage preamplifiers and through wirings. We are developing frequency division multiplexing (FDM). In FDM, each TES is ac-biased with a different carrier frequency. Signals from several pixels are summed and then read out by one dc SQUID (superconducting quantum interference device). The maximum number of multiplexed pixels is limited by the bandwidth of a SQUID in a flux-locked loop. Assuming 1 m cable length between the room temperature and the cold stage, the bandwidth is only <1 MHz with a standard flux-locked loop, due to the delay and phase shift of wirings. We report our development of baseband feedback, a new feedback scheme that overcomes the bandwidth limitation. In baseband feedback, the signal ({approx}<10 kHz) from the TES is sent back to the SQUID after the phase of carrier frequency ({approx}1 MHz) has been adjusted. We demonstrated open-loop gain of 8 for 10 kHz signal at 5 MHz carrier frequency, which indicates the possibility of {approx}40-pixel multiplexing of the TES signal.

Multiplex detection of pathogen biomarkers in human blood, serum, and saliva using silicon photonic microring resonators

Science.gov (United States)

Estrada, I. A.; Burlingame, R. W.; Wang, A. P.; Chawla, K.; Grove, T.; Wang, J.; Southern, S. O.; Iqbal, M.; Gunn, L. C.; Gleeson, M. A.

2015-05-01

Genalyte has developed a multiplex silicon photonic chip diagnostics platform (MaverickTM) for rapid detection of up to 32 biological analytes from a drop of sample in just 10 to 20 minutes. The chips are manufactured with waveguides adjacent to ring resonators, and probed with a continuously variable wavelength laser. A shift in the resonant wavelength as mass binds above the ring resonators is measured and is directly proportional to the amount of bound macromolecules. We present here the ability to multiplex the detection of hemorrhagic fever antigens in whole blood, serum, and saliva in a 16 minute assay. Our proof of concept testing of a multiplex antigencapture chip has the ability to detect Zaire Ebola (ZEBOV) recombinant soluble glycoprotein (rsGP), Marburg virus (MARV) Angola recombinant glycoprotein (rGP) and dengue nonstructural protein I (NS1). In parallel, detection of 2 malaria antigens has proven successful, but has yet to be incorporated into multiplex with the others. Each assay performs with sensitivity ranging from 1.6 ng/ml to 39 ng/ml depending on the antigen detected, and with minimal cross-reactivity.

Dynamics of gas-surface interactions atomic-level understanding of scattering processes at surfaces

CERN Document Server

Díez Muniño, Ricardo

2013-01-01

This book gives a representative survey of the state of the art of research on gas-surface interactions. It provides an overview of the current understanding of gas surface dynamics and, in particular, of the reactive and non-reactive processes of atoms and small molecules at surfaces. Leading scientists in the field, both from the theoretical and the experimental sides, write in this book about their most recent advances. Surface science grew as an interdisciplinary research area over the last decades, mostly because of new experimental technologies (ultra-high vacuum, for instance), as well as because of a novel paradigm, the ‘surface science’ approach. The book describes the second transformation which is now taking place pushed by the availability of powerful quantum-mechanical theoretical methods implemented numerically. In the book, experiment and theory progress hand in hand with an unprecedented degree of accuracy and control. The book presents how modern surface science targets the atomic-level u...

SURFACE CAST IRON STRENGTHENING USING COMBINED LASER AND ULTRASONIC PROCESSING

Directory of Open Access Journals (Sweden)

O. G. Devojno

2013-01-01

Full Text Available The paper provides an analysis of ultrasonic surface plastic deformation and subsequent laser thermal strengthening of gray cast iron parts in the regime of hardening from a solid state with the purpose to obtain strengthened surface layers of bigger depth and less roughness of the processed surface. Program complex ANSYS 11.0 has been used for calculation of temperature fields induced by laser exposure.  The appropriate regime of laser processing without surface fusion has been selected on the basis of the applied complex. The possibility of displacement in the bottom boundary of α–γ-transformation temperature  for СЧ20 with 900 °С up to 800 °С is confirmed due to preliminary ultrasonic surface plastic deformation of the surface that allows to expand technological opportunities of laser quenching  of gray  cast iron from a solid state. 

Multi-directional plasmonic surface-wave splitters with full bandwidth isolation

International Nuclear Information System (INIS)

Gao, Zhen; Gao, Fei; Zhang, Baile

2016-01-01

We present a multidirectional plasmonic surface-wave splitter with full bandwidth isolation experimentally based on coupled defect surface modes in a surface-wave photonic crystal. In contrast to conventional plasmonic surface-wave frequency splitters with polaritonic dispersion relations that overlap at low frequencies, this multidirectional plasmonic surface-wave splitter based on coupled defect surface modes can split different frequency bands into different waveguide branches without bandwidth overlap. Transmission spectra and near-field imaging measurements have been implemented in the microwave frequencies to verify the performance of the multidirectional plasmonic surface-wave splitter. This surface wave structure can be used as a plasmonic wavelength-division multiplexer that may find potential applications in the surface-wave integrated circuits from microwave to terahertz frequencies.

Multiplexed Imaging of Protein Phosphorylation on Membranes Based on Ti(IV) Functionalized Nanopolymers.

Science.gov (United States)

Iliuk, Anton; Li, Li; Melesse, Michael; Hall, Mark C; Tao, W Andy

2016-05-17

Accurate protein phosphorylation analysis reveals dynamic cellular signaling events not evident from protein expression levels. The most dominant biochemical assay, western blotting, suffers from the inadequate availability and poor quality of phospho-specific antibodies for phosphorylated proteins. Furthermore, multiplexed assays based on antibodies are limited by steric interference between the antibodies. Here we introduce a multifunctionalized nanopolymer for the universal detection of phosphoproteins that, in combination with regular antibodies, allows multiplexed imaging and accurate determination of protein phosphorylation on membranes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiplexed microsatellite recovery using massively parallel sequencing

Science.gov (United States)

Jennings, T.N.; Knaus, B.J.; Mullins, T.D.; Haig, S.M.; Cronn, R.C.

2011-01-01

Conservation and management of natural populations requires accurate and inexpensive genotyping methods. Traditional microsatellite, or simple sequence repeat (SSR), marker analysis remains a popular genotyping method because of the comparatively low cost of marker development, ease of analysis and high power of genotype discrimination. With the availability of massively parallel sequencing (MPS), it is now possible to sequence microsatellite-enriched genomic libraries in multiplex pools. To test this approach, we prepared seven microsatellite-enriched, barcoded genomic libraries from diverse taxa (two conifer trees, five birds) and sequenced these on one lane of the Illumina Genome Analyzer using paired-end 80-bp reads. In this experiment, we screened 6.1 million sequences and identified 356958 unique microreads that contained di- or trinucleotide microsatellites. Examination of four species shows that our conversion rate from raw sequences to polymorphic markers compares favourably to Sanger- and 454-based methods. The advantage of multiplexed MPS is that the staggering capacity of modern microread sequencing is spread across many libraries; this reduces sample preparation and sequencing costs to less than $400 (USD) per species. This price is sufficiently low that microsatellite libraries could be prepared and sequenced for all 1373 organisms listed as 'threatened' and 'endangered' in the United States for under $0.5M (USD).

High-Resolution Spin-on-Patterning of Perovskite Thin Films for a Multiplexed Image Sensor Array.

Science.gov (United States)

Lee, Woongchan; Lee, Jongha; Yun, Huiwon; Kim, Joonsoo; Park, Jinhong; Choi, Changsoon; Kim, Dong Chan; Seo, Hyunseon; Lee, Hakyong; Yu, Ji Woong; Lee, Won Bo; Kim, Dae-Hyeong

2017-10-01

Inorganic-organic hybrid perovskite thin films have attracted significant attention as an alternative to silicon in photon-absorbing devices mainly because of their superb optoelectronic properties. However, high-definition patterning of perovskite thin films, which is important for fabrication of the image sensor array, is hardly accomplished owing to their extreme instability in general photolithographic solvents. Here, a novel patterning process for perovskite thin films is described: the high-resolution spin-on-patterning (SoP) process. This fast and facile process is compatible with a variety of spin-coated perovskite materials and perovskite deposition techniques. The SoP process is successfully applied to develop a high-performance, ultrathin, and deformable perovskite-on-silicon multiplexed image sensor array, paving the road toward next-generation image sensor arrays. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiplexed profiling of GPCR activities by combining split TEV assays and EXT-based barcoded readouts.

Science.gov (United States)

Galinski, Sabrina; Wichert, Sven P; Rossner, Moritz J; Wehr, Michael C

2018-05-25

G protein-coupled receptors (GPCRs) are the largest class of cell surface receptors and are implicated in the physiological regulation of many biological processes. The high diversity of GPCRs and their physiological functions make them primary targets for therapeutic drugs. For the generation of novel compounds, however, selectivity towards a given target is a critical issue in drug development as structural similarities between members of GPCR subfamilies exist. Therefore, the activities of multiple GPCRs that are both closely and distantly related to assess compound selectivity need to be tested simultaneously. Here, we present a cell-based multiplexed GPCR activity assay, termed GPCRprofiler, which uses a β-arrestin recruitment strategy and combines split TEV protein-protein interaction and EXT-based barcode technologies. This approach enables simultaneous measurements of receptor activities of multiple GPCR-ligand combinations by applying massively parallelized reporter assays. In proof-of-principle experiments covering 19 different GPCRs, both the specificity of endogenous agonists and the polypharmacological effects of two known antipsychotics on GPCR activities were demonstrated. Technically, normalization of barcode reporters across individual assays allows quantitative pharmacological assays in a parallelized manner. In summary, the GPCRprofiler technique constitutes a flexible and scalable approach, which enables simultaneous profiling of compound actions on multiple receptor activities in living cells.

Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

Science.gov (United States)

Singh, Prashant; Mustapha, Azlin

2013-09-02

Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs.

Science.gov (United States)

Yin, Linlin; Maddison, Lisette A; Li, Mingyu; Kara, Nergis; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Patton, James G; Chen, Wenbiao

2015-06-01

Determining the mechanism of gene function is greatly enhanced using conditional mutagenesis. However, generating engineered conditional alleles is inefficient and has only been widely used in mice. Importantly, multiplex conditional mutagenesis requires extensive breeding. Here we demonstrate a system for one-generation multiplex conditional mutagenesis in zebrafish (Danio rerio) using transgenic expression of both cas9 and multiple single guide RNAs (sgRNAs). We describe five distinct zebrafish U6 promoters for sgRNA expression and demonstrate efficient multiplex biallelic inactivation of tyrosinase and insulin receptor a and b, resulting in defects in pigmentation and glucose homeostasis. Furthermore, we demonstrate temporal and tissue-specific mutagenesis using transgenic expression of Cas9. Heat-shock-inducible expression of cas9 allows temporal control of tyr mutagenesis. Liver-specific expression of cas9 disrupts insulin receptor a and b, causing fasting hypoglycemia and postprandial hyperglycemia. We also show that delivery of sgRNAs targeting ascl1a into the eye leads to impaired damage-induced photoreceptor regeneration. Our findings suggest that CRISPR/Cas9-based conditional mutagenesis in zebrafish is not only feasible but rapid and straightforward. Copyright © 2015 by the Genetics Society of America.

Effect of different machining processes on the tool surface integrity and fatigue life

Energy Technology Data Exchange (ETDEWEB)

Cao, Chuan Liang [College of Mechanical and Electrical Engineering, Nanchang University, Nanchang (China); Zhang, Xianglin [School of Materials Science and Engineering, Huazhong University of Science and Technology, Wuhan (China)

2016-08-15

Ultra-precision grinding, wire-cut electro discharge machining and lapping are often used to machine the tools in fine blanking industry. And the surface integrity from these machining processes causes great concerns in the research field. To study the effect of processing surface integrity on the fine blanking tool life, the surface integrity of different tool materials under different processing conditions and its influence on fatigue life were thoroughly analyzed in the present study. The result shows that the surface integrity of different materials was quite different on the same processing condition. For the same tool material, the surface integrity on varying processing conditions was quite different too and deeply influenced the fatigue life.

An Experimental Study of the Dropwise Condensation on Physically Processed Surface

International Nuclear Information System (INIS)

Choi, Jaeyoung; Chang, Soonheung; Watanabe, N.; Sambuichi, T.; Shiota, D.; Aritomi, M.

2013-01-01

Recent research by Kawakubo et al. derived empirical condensation heat transfer correlation suitable for wider range of operating condition in presence of non-condensable gas. However, their proposals of PCCS are focused on plane tube surface. To design better PCCS heat exchanger with high heat transfer coefficient new treatment on condensation surface can be considered in order to maintain dropwise condensation, the heat transfer coefficient of which has an order of magnitude larger than those of film condensation. Advanced research measure dropwise condensation heat transfer coefficient of Au and Cr coated surface based on number of droplet and droplet growth rate. However, coated surface is not desirable in power plant due to its duration of few years. On the other hand, physical processing (micro holes and patterns) on stainless steel and titanium surface is expected to perform better heat transfer, also is durable for the whole reactor lifetime. Since there is no published research about dropwise condensation for physically processed surface on SUS and Ti, the purposes of this research are to measure the condensation heat transfer coefficient and analyze its mechanism of enhanced heat transfer of treated SUS and Ti commonly used to nuclear plant. In the comparison of theoretical equation and experiment, it shows same result that heat transfer coefficient is proportional to maximum droplet diameter power to -0.321. Moreover, in the comparison of bare and processed surface, heat transfer coefficient decreases in processed surface

A polarization-division multiplexing SSB-OFDM system with beat interference cancellation receivers

Science.gov (United States)

Yang, Peiling; Ma, Jianxin; Zhang, Junyi

2018-06-01

In this paper, we have proposed a polarization-division multiplexing (PDM) single-sideband optical orthogonal frequency division multiplexing (SSB-OOFDM) scheme with signal-signal beat interference cancellation receivers with balanced detection (ICRBD). This system can double channel capacity and improve spectrum efficiency (SE) with the reduced guard band (GB) due to the PDM. Multiple input multiple output (MIMO) technique is used to solve polarization mode dispersion (PMD) associated with channel estimation and equalization. By simulation, we demonstrate the efficacy of the proposed technique for a 2 ×40 Gbit/s 16-QAM SSB-PDM-OOFDM system according to the error vector magnitude (EVM) and the constellation diagrams.

The RHIC general purpose multiplexed analog to digital converter system

International Nuclear Information System (INIS)

Michnoff, R.

1995-01-01

A general purpose multiplexed analog to digital converter system is currently under development to support acquisition of analog signals for the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory. The system consists of a custom intelligent VME based controller module (V113) and a 14-bit 64 channel multiplexed A/D converter module (V114). The design features two independent scan groups, where one scan group is capable of acquiring 64 channels at 60 Hz, concurrently with the second scan group acquiring data at an aggregate rate of up to 80 k samples/second. An interface to the RHIC serially encoded event line is used to synchronize acquisition. Data is stored in a circular static RAM buffer on the controller module, then transferred to a commercial VMEbus CPU board and higher level workstations for plotting, report Generation, analysis and storage

Steroid responsive mononeuritis multiplex in the Cronkhite-Canada syndrome

Directory of Open Access Journals (Sweden)

YL Lo

2016-11-01

Full Text Available The Cronkhite-Canada syndrome (CCS is a rare disorder of unknown origin characterized by generalized gastrointestinal polyposis, alopecia, hyperpigmentation and onychodystrophy. We report a case of CCS with concomitant presentation of mononeuritis multiplex. The electrophysiological findings and steroid responsiveness suggests presence of an autoimmune mechanism.

Surface plasmon resonance biosensors for highly sensitive detection in real samples

Science.gov (United States)

Sepúlveda, B.; Carrascosa, L. G.; Regatos, D.; Otte, M. A.; Fariña, D.; Lechuga, L. M.

2009-08-01

In this work we summarize the main results obtained with the portable surface plasmon resonance (SPR) device developed in our group (commercialised by SENSIA, SL, Spain), highlighting its applicability for the real-time detection of extremely low concentrations of toxic pesticides in environmental water samples. In addition, we show applications in clinical diagnosis as, on the one hand, the real-time and label-free detection of DNA hybridization and single point mutations at the gene BRCA-1, related to the predisposition in women to develop an inherited breast cancer and, on the other hand, the analysis of protein biomarkers in biological samples (urine, serum) for early detection of diseases. Despite the large number of applications already proven, the SPR technology has two main drawbacks: (i) not enough sensitivity for some specific applications (where pM-fM or single-molecule detection are needed) (ii) low multiplexing capabilities. In order solve such drawbacks, we work in several alternative configurations as the Magneto-optical Surface Plasmon Resonance sensor (MOSPR) based on a combination of magnetooptical and ferromagnetic materials, to improve the SPR sensitivity, or the Localized Surface Plasmon Resonance (LSPR) based on nanostructures (nanoparticles, nanoholes,...), for higher multiplexing capabilities.

High surface area carbon and process for its production

Energy Technology Data Exchange (ETDEWEB)

Romanos, Jimmy; Burress, Jacob; Pfeifer, Peter; Rash, Tyler; Shah, Parag; Suppes, Galen

2016-12-13

Activated carbon materials and methods of producing and using activated carbon materials are provided. In particular, biomass-derived activated carbon materials and processes of producing the activated carbon materials with prespecified surface areas and pore size distributions are provided. Activated carbon materials with preselected high specific surface areas, porosities, sub-nm (<1 nm) pore volumes, and supra-nm (1-5 nm) pore volumes may be achieved by controlling the degree of carbon consumption and metallic potassium intercalation into the carbon lattice during the activation process.

Multiplex real-time PCR for identification of canine parvovirus antigenic types.

Science.gov (United States)

Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

2016-07-01

Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

Science.gov (United States)

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Spatial Multiplexing of Atom-Photon Entanglement Sources using Feedforward Control and Switching Networks.

Science.gov (United States)

Tian, Long; Xu, Zhongxiao; Chen, Lirong; Ge, Wei; Yuan, Haoxiang; Wen, Yafei; Wang, Shengzhi; Li, Shujing; Wang, Hai

2017-09-29

The light-matter quantum interface that can create quantum correlations or entanglement between a photon and one atomic collective excitation is a fundamental building block for a quantum repeater. The intrinsic limit is that the probability of preparing such nonclassical atom-photon correlations has to be kept low in order to suppress multiexcitation. To enhance this probability without introducing multiexcitation errors, a promising scheme is to apply multimode memories to the interface. Significant progress has been made in temporal, spectral, and spatial multiplexing memories, but the enhanced probability for generating the entangled atom-photon pair has not been experimentally realized. Here, by using six spin-wave-photon entanglement sources, a switching network, and feedforward control, we build a multiplexed light-matter interface and then demonstrate a ∼sixfold (∼fourfold) probability increase in generating entangled atom-photon (photon-photon) pairs. The measured compositive Bell parameter for the multiplexed interface is 2.49±0.03 combined with a memory lifetime of up to ∼51  μs.

Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

Science.gov (United States)

Raghav, Sunil Kumar; Deplancke, Bart

2012-01-01

Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

Rapid spectro-polarimetry to probe molecular symmetry in multiplex coherent anti-Stokes Raman scattering.

Science.gov (United States)

Würthwein, Thomas; Brinkmann, Maximilian; Hellwig, Tim; Fallnich, Carsten

2017-11-21

We present the simultaneous detection of the spectrum and the complete polarization state of a multiplex coherent anti-Stokes Raman scattering signal with a fast division-of-amplitude spectro-polarimeter. The spectro-polarimeter is based on a commercial imaging spectrograph, a birefringent wedge prism, and a segmented polarizer. Compared to the standard rotating-retarder fixed-analyzer spectro-polarimeter, only a single measurement is required and an up to 21-fold reduced acquisition time is shown. The measured Stokes parameters allow us to differentiate between vibrational symmetries and to determine the depolarization ratio ρ by data post-processing.

Single-exposure two-dimensional superresolution in digital holography using a vertical cavity surface-emitting laser source array.

Science.gov (United States)

Granero, Luis; Zalevsky, Zeev; Micó, Vicente

2011-04-01

We present a new implementation capable of producing two-dimensional (2D) superresolution (SR) imaging in a single exposure by aperture synthesis in digital lensless Fourier holography when using angular multiplexing provided by a vertical cavity surface-emitting laser source array. The system performs the recording in a single CCD snapshot of a multiplexed hologram coming from the incoherent addition of multiple subholograms, where each contains information about a different 2D spatial frequency band of the object's spectrum. Thus, a set of nonoverlapping bandpass images of the input object can be recovered by Fourier transformation (FT) of the multiplexed hologram. The SR is obtained by coherent addition of the information contained in each bandpass image while generating an enlarged synthetic aperture. Experimental results demonstrate improvement in resolution and image quality.

Two photon processes in surface photovoltage spectroscopy

International Nuclear Information System (INIS)

Craig, R.P.; Thurgate, S.M.

1996-01-01

Full text: A significant mid-gap effect has been found in Surface Photovoltage Spectroscopy measurements of cleaved GaAs, InP and Si wafer which is normally interpreted as arising from transitions between surface states and band edges. This large mid-gap effect common to various materials is puzzling as such a high proportion of mid-gap states seems unlikely. Most theories of surface states predict states that tail from the band edges into the gap or states that have a well defined energy in the gap. None propose a large state exactly at E G /2. We recently investigated the variation in SPS spectra with flux density. We find a non-linear correlation in the magnitude of Band-Bending arising from mid-gap and band-gap photon energies. We suggest that the mid-gap feature is due to a two photon absorption process leading to carrier pair generation mediated by mid-gap states in the continuum of band-gap surface states

Quantification of chemical transport processes from the soil to surface runoff.

Science.gov (United States)

Tian, Kun; Huang, Chi-Hua; Wang, Guang-Qian; Fu, Xu-Dong; Parker, Gary

2013-01-01

There is a good conceptual understanding of the processes that govern chemical transport from the soil to surface runoff, but few studies have actually quantified these processes separately. Thus, we designed a laboratory flow cell and experimental procedures to quantify the chemical transport from soil to runoff water in the following individual processes: (i) convection with a vertical hydraulic gradient, (ii) convection via surface flow or the Bernoulli effect, (iii) diffusion, and (iv) soil loss. We applied different vertical hydraulic gradients by setting the flow cell to generate different seepage or drainage conditions. Our data confirmed the general form of the convection-diffusion equation. However, we now have additional quantitative data that describe the contribution of each individual chemical loading process in different surface runoff and soil hydrological conditions. The results of this study will be useful for enhancing our understanding of different geochemical processes in the surface soil mixing zone. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

Directory of Open Access Journals (Sweden)

Abdelfattah M. Selim

2014-12-01

Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

Science.gov (United States)

Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

2017-09-01

The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

Science.gov (United States)

Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

2015-06-01

The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Surface topography of parallel grinding process for nonaxisymmetric aspheric lens

International Nuclear Information System (INIS)

Zhang Ningning; Wang Zhenzhong; Pan Ri; Wang Chunjin; Guo Yinbiao

2012-01-01

Workpiece surface profile, texture and roughness can be predicted by modeling the topography of wheel surface and modeling kinematics of grinding process, which compose an important part of precision grinding process theory. Parallel grinding technology is an important method for nonaxisymmetric aspheric lens machining, but there is few report on relevant simulation. In this paper, a simulation method based on parallel grinding for precision machining of aspheric lens is proposed. The method combines modeling the random surface of wheel and modeling the single grain track based on arc wheel contact points. Then, a mathematical algorithm for surface topography is proposed and applied in conditions of different machining parameters. The consistence between the results of simulation and test proves that the algorithm is correct and efficient. (authors)

Extending the Effective Ranging Depth of Spectral Domain Optical Coherence Tomography by Spatial Frequency Domain Multiplexing

Directory of Open Access Journals (Sweden)

Tong Wu

2016-11-01

Full Text Available We present a spatial frequency domain multiplexing method for extending the imaging depth range of a spectral domain optical coherence tomography (SDOCT system without any expensive device. This method uses two galvo scanners with different pivot-offset distances in two independent reference arms for spatial frequency modulation and multiplexing. The spatial frequency contents corresponding to different depth regions of the sample can be shifted to different frequency bands. The spatial frequency domain multiplexing SDOCT system provides an approximately 1.9-fold increase in the effective ranging depth compared with that of a conventional full-range SDOCT system. The reconstructed images of phantom and biological tissue demonstrate the expected increase in ranging depth. The parameters choice criterion for this method is discussed.

The Role of Multiplex Polymerase Chain Reaction in Detecting Etiological Causes of Bacterial Prostatitis Associated Benign Prostatic Hyperplasia

Directory of Open Access Journals (Sweden)

Bramastha Rosadi

2015-01-01

Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease. 

A Versatile Multichannel Digital Signal Processing Module for Microcalorimeter Arrays

Science.gov (United States)

Tan, H.; Collins, J. W.; Walby, M.; Hennig, W.; Warburton, W. K.; Grudberg, P.

2012-06-01

Different techniques have been developed for reading out microcalorimeter sensor arrays: individual outputs for small arrays, and time-division or frequency-division or code-division multiplexing for large arrays. Typically, raw waveform data are first read out from the arrays using one of these techniques and then stored on computer hard drives for offline optimum filtering, leading not only to requirements for large storage space but also limitations on achievable count rate. Thus, a read-out module that is capable of processing microcalorimeter signals in real time will be highly desirable. We have developed multichannel digital signal processing electronics that are capable of on-board, real time processing of microcalorimeter sensor signals from multiplexed or individual pixel arrays. It is a 3U PXI module consisting of a standardized core processor board and a set of daughter boards. Each daughter board is designed to interface a specific type of microcalorimeter array to the core processor. The combination of the standardized core plus this set of easily designed and modified daughter boards results in a versatile data acquisition module that not only can easily expand to future detector systems, but is also low cost. In this paper, we first present the core processor/daughter board architecture, and then report the performance of an 8-channel daughter board, which digitizes individual pixel outputs at 1 MSPS with 16-bit precision. We will also introduce a time-division multiplexing type daughter board, which takes in time-division multiplexing signals through fiber-optic cables and then processes the digital signals to generate energy spectra in real time.

Characterization of a group unrelated patients with arthrogryposis multiplex congenita

Directory of Open Access Journals (Sweden)

Margarita Valdés-Flores

2016-01-01

Full Text Available Objective: Arthrogryposis multiplex congenita is a relatively rare neuromuscular syndrome, with a prevalence of 1:3000–5000 newborns. In this study, the authors describe the clinical features of a group of 50 unrelated Mexican patients with arthrogryposis multiplex congenita. Methods: Patients were diagnosed by physical and radiographic examination and the family history was evaluated. Results: Of the 50 cases, nine presented other features (pectum excavatum, cleft palate, mental retardation, ulnar agenesis, etc.. Environmental factors, as well as prenatal and family history, were analyzed. The chromosomal anomalies and clinical entities associated with arthrogryposis multiplex congenita were reported. No chromosomal aberrations were present in the cases with mental retardation. Three unrelated familial cases with arthrogryposis multiplex congenita were observed in which autosomal recessive, autosomal dominant and X-linked inheritance patterns are possible. A literature review regarding arthrogryposis multiplex congenita was also conducted. Conclusions: It is important to establish patient-specific physical therapy and rehabilitation programs. A multidisciplinary approach is necessary, with medical, surgical, rehabilitation, social and psychological care, including genetic counseling. Resumo: Objetivo: A Artrogripose múltipla congênita é uma síndrome neuromuscular relativamente rara, com prevalência de 1:3000-5000 recém-nascidos. É por isso que, neste estudo, descrevemos as características clínicas de um grupo de 50 casos de pacientes mexicanos não relacionados com Artrogripose múltipla congênita. Métodos: Os pacientes foram diagnosticados por exame físico e radiográfico, e o histórico familiar foi avaliado. Resultados: Descrevemos 50 pacientes não relacionados com Artrogripose múltipla congênita.Nove deles apresentaram outras características (pectus excavatum, fissura palatina, retardo mental, agenesia da ulna, etc.. Foram

Simulation of dynamic processes when machining transition surfaces of stepped shafts

Science.gov (United States)

Maksarov, V. V.; Krasnyy, V. A.; Viushin, R. V.

2018-03-01

The paper addresses the characteristics of stepped surfaces of parts categorized as "solids of revolution". It is noted that in the conditions of transition modes during the switch to end surface machining, there is cutting with varied load intensity in the section of the cut layer, which leads to change in cutting force, onset of vibrations, an increase in surface layer roughness, a decrease of size precision, and increased wear of a tool's cutting edge. This work proposes a method that consists in developing a CNC program output code that allows one to process complex forms of stepped shafts with only one machine setup. The authors developed and justified a mathematical model of a technological system for mechanical processing with consideration for the resolution of tool movement at the stages of transition processes to assess the dynamical stability of a system in the process of manufacturing stepped surfaces of parts of “solid of revolution” type.

The theory of development of surface morphology by sputter erosion processes

International Nuclear Information System (INIS)

Carter, G.; Nobes, M.J.

1984-01-01

When a surface is bombarded by an energetic ion flux a rich variety of surface structures are observed to develop at the atomic, microscopic and macroscopic scales. Such structures include elevated, with respect to the surrounding surface, features such as mesas or plateaux, ridges, cones and pyramids and depressed features such as etch pits and cavities. These elementary features may be isolated or in profusion and frequently repetitive patterns of coordinated pyramidal structures, etch pits, surface ledges or facets and ripple or wave-like structures occur. The majority of the features arise rather directly from the erosion action of the sputtering process, particularly from differential erosion processes at different surface localities. The authors outline a general approach to sputter erosion induced surface morphology development based on the concept of the surface as an advancing wave. (Auth.)

All-Optical Regenerative OTDM Add-Drop Multiplexing at 40 Gb/s using Monolithic InP Mach-Zehnder Interferometer

DEFF Research Database (Denmark)

Fischer, St.; Dülk, M.; Gamper, E.

2000-01-01

We present a novel method for all-optical add-drop multiplexing having regenerative capability for 40-Gb/s optical time-division multiplexed (OTDM) data using a semiconductor optical amplifier (SOA) based, monolithic Mach-Zehnder interferometer (MZI). Simultaneous dropping of one 10-Gb/s channel ...

Spatial-phase code-division multiple-access system with multiplexed Fourier holography switching for reconfigurable optical interconnection

Science.gov (United States)

Takasago, Kazuya; Takekawa, Makoto; Shirakawa, Atsushi; Kannari, Fumihiko

2000-05-01

A new, to our knowledge, space-variant optical interconnection system based on a spatial-phase code-division multiple-access technique with multiplexed Fourier holography is described. In this technique a signal beam is spread over wide spatial frequencies by an M -sequence pseudorandom phase code. At a receiver side a selected signal beam is properly decoded, and at the same time its spatial pattern is shaped with a Fourier hologram, which is recorded by light that is encoded with the same M -sequence phase mask as the desired signal beam and by light whose spatial beam pattern is shaped to a signal routing pattern. Using the multiplexed holography, we can simultaneously route multisignal flows into individually specified receiver elements. The routing pattern can also be varied by means of switching the encoding phase code or replacing the hologram. We demonstrated a proof-of-principle experiment with a doubly multiplexed hologram that enables simultaneous routing of two signal beams. Using a numerical model, we showed that the proposed scheme can manage more than 250 routing patterns for one signal flow with one multiplexed hologram at a signal-to-noise ratio of 5.

Simulation of path delay multiplexing-based Fourier transform spectrometer for fiber Bragg grating interrogation.

Science.gov (United States)

Chelliah, Pandian; Sahoo, Trilochan; Singh, Sheela; Sujatha, Annie

2015-10-20

A Fourier transform spectrometer (FTS) used for interrogating a fiber Bragg grating (FBG) consists of a scanning-type interferometer. The FTS has a broad wavelength range of operation and good multiplexing capability. However, it has poor wavelength resolution and interrogation speed. We propose a modification to the FTS using path delay multiplexing to improve the same. Using this method, spatial resolution and interrogation time can be improved by n times by using n path delays. In this paper, simulation results for n=2, 5 are shown.