WorldWideScience

Sample records for multiplex rt-pcr method

  1. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  2. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  3. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  4. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  5. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  6. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  7. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  8. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  9. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  10. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacteria and Viruses in Pepper and Tomato Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this study was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant seed infection pathogenic bacteria and virus, Xanthomonns campestris pv. vesicatoria (Xcv, Clavibacter michiganensis subsp. michiganensis (Cmm, Erwinia carotovora subsp. carotovora (Ecc, Pepper mild mottle virus (PMMoV and Tobacco mild green mosaic virus (TMGMV in pepper and tomato seeds. Most of pepper and tomato bacterial and virus diseases are responsible for germination and growth obstruction. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcv, Cmm, Ecc, PMMoV and TMGMV in pepper and tomato seeds, five pairs (Cmm-F/R, Ecc-F/R, Xcv-F/R, PMMoV-F/R, TMGMV-F/R of specific primer were synthesized by primer-blast program. The multiplex PCR for the five pathogens in pepper and tomato seeds could detect specially without interference among primers and/or cDNA of plant seeds and other plant pathogens. The PCR result for pathogen detection using 20 commercial pepper and 10 tomato seed samples, Ecc was detected from 4 pepper and 2 tomato seed samples, PMMoV was detected from 1 pepper seed sample, and PMMoV and TMGMV were simultaneously detected from 1 pepper seed sample.

  11. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  12. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  13. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  14. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  15. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  16. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Science.gov (United States)

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  17. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  18. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  19. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  20. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  1. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  3. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  4. Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

    Science.gov (United States)

    Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

    2013-10-01

    A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  6. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  9. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Directory of Open Access Journals (Sweden)

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  10. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis

  11. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.

    Science.gov (United States)

    Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon

    2017-01-01

    A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.

  13. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  14. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  15. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  16. One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

    Science.gov (United States)

    Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

    2015-03-01

    A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

  18. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  19. A strain-specific multiplex RT-PCR for Australian rabbit haemorrhagic disease viruses uncovers a new recombinant virus variant in rabbits and hares.

    Science.gov (United States)

    Hall, R N; Mahar, J E; Read, A J; Mourant, R; Piper, M; Huang, N; Strive, T

    2018-04-01

    Rabbit haemorrhagic disease virus (RHDV, or GI.1) is a calicivirus in the genus Lagovirus that has been widely utilized in Australia as a biological control agent for the management of overabundant wild European rabbit (Oryctolagus cuniculus) populations since 1996. Recently, two exotic incursions of pathogenic lagoviruses have been reported in Australia; GI.1a-Aus, previously called RHDVa-Aus, is a GI.1a virus detected in January 2014, and the novel lagovirus GI.2 (previously known as RHDV2). Furthermore, an additional GI.1a strain, GI.1a-K5 (also known as 08Q712), was released nationwide in March 2017 as a supplementary tool for wild rabbit management. To discriminate between these lagoviruses, a highly sensitive strain-specific multiplex RT-PCR assay was developed, which allows fast, cost-effective and sensitive detection of the four pathogenic lagoviruses currently known to be circulating in Australia. In addition, we developed a universal RT-qPCR assay to be used in conjunction with the multiplex assay that broadly detects all four viruses and facilitates quantification of viral RNA load in samples. These assays enable rapid detection, identification and quantification of pathogenic lagoviruses in the Australian context. Using these assays, a novel recombinant lagovirus was detected in rabbit tissue samples, which contained the non-structural genes of GI.1a-Aus and the structural genes of GI.2. This variant was also recovered from the liver of a European brown hare (Lepus europaeus). The impact of this novel recombinant on Australian wild lagomorph populations and its competitiveness in relation to circulating field strains, particularly GI.2, requires further studies. © 2017 Blackwell Verlag GmbH.

  20. Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2.

    Science.gov (United States)

    Chiapponi, Chiara; Moreno, Ana; Barbieri, Ilaria; Merenda, Marianna; Foni, Emanuela

    2012-09-01

    In Europe, three major swine influenza viral (SIV) subtypes (H1N1, H1N2 and H3N2) have been isolated in pigs. Developing a test that is able to detect and identify the subtype of the circulating strain rapidly during an outbreak of respiratory disease in the pig population is of essential importance. This study describes two multiplex RT-PCRs which distinguish the haemagglutinin (HA) gene and the neuraminidase (NA) gene of the three major subtypes of SIV circulating in Europe. The HA PCR was able to identify the lineage (avian or human) of the HA of H1 subtypes. The analytical sensitivity of the test, considered to be unique, was assessed using three reference viruses. The detection limit corresponded to 1×10(-1) TCID(50)/200μl for avian-like H1N1, 1×10(0) TCID(50)/200μl for human-like H1N2 and 1×10(1) TCID(50)/200μl for H3N2 SIV. The multiplex RT-PCR was first carried out on a collection of 70 isolated viruses showing 100% specificity and then on clinical samples, from which viruses had previously been isolated, resulting in an 89% positive specificity of the viral subtype. Finally, the test was able to identify the viral subtype correctly in 56% of influenza A positive samples, from which SIV had not been isolated previously. It was also possible to identify mixed viral infections and the circulation of a reassortant strain before performing genomic studies. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Evaluation of NGS and RT-PCR methods for ALK rearrangement in European NSCLC patients

    DEFF Research Database (Denmark)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota

    2018-01-01

    INTRODUCTION: The reported prevalence of ALK rearrangement in NSCLC ranges from 2%-7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proven to be a reproducible and sensitive technique. Reverse transcriptase...

  2. AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR DETECTING ENTEROVIRUS IN WATER

    Science.gov (United States)

    Echovirus and coxsackievirus can cause mild to severe disease following consumption of contaminated drinking water. However, comprehensive occurrence studies of enteroviruses in drinking water matrices are limited, in part because of the lack of available methods that are rapid, ...

  3. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  5. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Wu

    Full Text Available BACKGROUND: Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR, fluorescence in Situ hybridization (FISH and Immunohistochemical (IHC stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. RESULTS: Thirteen of the 312 patients (4.17% had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%, but very good specificity (99.32%. IHC stain had better sensitivity (91.67% than FISH, but lower specificity (79.52%, when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product, were also have high expression of ALK protein (IHC3+, and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80% of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%. Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3% was the most common type in Chinese population, while variant 1 (28/37, 75.7% was most common in Caucasian. CONCLUSIONS: Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  6. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Science.gov (United States)

    Wu, Yi-Cheng; Chang, Il-Chi; Wang, Chi-Liang; Chen, Tai-Di; Chen, Ya-Ting; Liu, Hui-Ping; Chu, Yen; Chiu, Yu-Ting; Wu, Tzu-Hua; Chou, Li-Hui; Chen, Yi-Rong; Huang, Shiu-Feng

    2013-01-01

    Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK) fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib) treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. Reverse transcriptase-polymerase chain reaction (RT-PCR), fluorescence in Situ hybridization (FISH) and Immunohistochemical (IHC) stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. Thirteen of the 312 patients (4.17%) had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%), but very good specificity (99.32%). IHC stain had better sensitivity (91.67%) than FISH, but lower specificity (79.52%), when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product), were also have high expression of ALK protein (IHC3+), and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80%) of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%). Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3%) was the most common type in Chinese population, while variant 1 (28/37, 75.7%) was most common in Caucasian. Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  7. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  9. A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

    Directory of Open Access Journals (Sweden)

    Ming-An Tsai

    2017-09-01

    Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

  10. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  11. DEVELOPMENT OF AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR THE DETECTION OF ENTEROVIRUS IN WATER

    Science.gov (United States)

    Virus contamination in environmental samples is believed to be underestimated due to the limitations in the methods available for detection. A major detection method is based upon the formation of cytopathic effect (CPE) in cell culture. The main limitations to this method are ...

  12. A real-time RT-PCR method to detect viable Giardia lamblia cysts in environmental waters.

    Science.gov (United States)

    Baque, Robert H; Gilliam, Amy O; Robles, Liza D; Jakubowski, Walter; Slifko, Theresa R

    2011-05-01

    Currently, USEPA Method 1623 is the standard assay used for simultaneous detection of Giardia cysts and Cryptosporidium oocysts in various water matrices. However, the method is unable to distinguish between species, genotype, or to assess viability. Therefore, the objective of the present study was to address the shortcomings of USEPA Method 1623 by developing a novel molecular-based method that can assess viability of Giardia cysts in environmental waters and identify genotypes that pose a human health threat (assemblage groups A and B). Primers and TaqMan(®) probes were designed to target the beta-giardin gene in order to discriminate among species and assemblages. Viability was determined by detection of de-novo mRNA synthesis after heat induction. The beta-giardin primer/probe sets were able to detect and differentiate between Giardia lamblia assemblages A and B, and did not detect Giardia muris (mouse species) or G. lamblia assemblages C, D, E and F (non-human), with the exception of Probe A which did detect G. lamblia assemblage F DNA. Additionally, DNA or cDNA of other waterborne organisms were not detected, suggesting that the method is specific to Giardia assemblages. Assay applicability was demonstrated by detection of viable G. lamblia cysts in spiked (assemblage B) and unspiked (assemblage A and B) reclaimed water samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

    Directory of Open Access Journals (Sweden)

    Timotijević Gordana S.

    2015-01-01

    Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

  14. A practical tissue sampling method using ordinary paper for molecular detection of infectious bursal disease virus RNA by RT-PCR.

    Science.gov (United States)

    Maw, Min Thein; Yamaguchi, Tsuyoshi; Kasanga, Christopher J; Terasaki, Kaori; Fukushi, Hideto

    2006-12-01

    A practical sampling method for bursal tissue using ordinary paper for molecular diagnosis of infectious bursal disease (IBD) was established. IBD virus-infected bursa was directly smeared on chromatography paper, filter paper, or stationery copy paper and was then fixed with absolute ethanol, Tris-HCl-saturated phenol, or phenol:chloroform:isoamyl alcohol (25:24:1). Flinders Technology Associates (FTA) card, which is designed for the collection of biological samples for molecular detection, was also used. After storage at 37 C for up to 30 days, total RNA directly extracted from the tissue fixed on the papers and FTA card were subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) for detection of IBD virus (IBDV) RNA. In addition, the ability of each chemical used in the fixation and the FTA card to inactivate IBDV was evaluated. Regardless of the paper quality, storage period, and fixation method, IBDV RNA was consistently detected in all of the samples. IBDV in the bursal tissue was inactivated with phenol but not with ethanol or the unknown chemicals in FTA card. These results show that ordinary papers sustain the viral RNA, as does FTA card, but phenol fixation is superior to FTA card in inactivating IBDV. The new sampling method using ordinary paper with phenol fixation is safe, inexpensive, simple, and easy, and is thus suitable for conducting a global survey of IBD even where laboratory resources are limited. This practical method should contribute to the control of IBD worldwide.

  15. Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

    Science.gov (United States)

    Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

    2012-03-01

    Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Multiplex RT-PCR detection of four aphid-borne strawberry viruses in Fragaria spp. in combination with a plant mRNA specific internal control

    Czech Academy of Sciences Publication Activity Database

    Thompson, J. R.; Wetzel, S.; Klerks, M. M.; Vašková, Dana; Schoen, C. D.; Špak, Josef; Jelkmann, W.

    2003-01-01

    Roč. 111, - (2003), s. 85-93 ISSN 0166-0934 Grant - others:GA-(EU) QRLT-PL99-1553 Institutional research plan: CEZ:AV0Z5051902 Keywords : virus diseases * strawberry * detection methods Subject RIV: EE - Microbiology, Virology Impact factor: 1.826, year: 2003

  17. Examining the hemagglutinin subtype diversity among wild duck-origin influenza A viruses using ethanol-fixed cloacal swabs and a novel RT-PCR method.

    Science.gov (United States)

    Wang, Ruixue; Soll, Lindsey; Dugan, Vivien; Runstadler, Jonathan; Happ, George; Slemons, Richard D; Taubenberger, Jeffery K

    2008-05-25

    This study presents an interconnected approach for circumventing two inherent limitations associated with studies defining the natural history of influenza A viruses in wild birds. The first limiting factor is the ability to maintain a cold chain from specimen collection to the laboratory when study sites are in more remote locations. The second limiting factor is the ability to identify all influenza A virus HA subtypes present in an original sample. We report a novel method for molecular subtyping of avian influenza A virus hemagglutinin genes using degenerate primers designed to amplify all known hemagglutinin subtypes. It was shown previously that templates larger than 200 bp were not consistently amplifiable from ethanol-fixed cloacal swabs. For this study, new primer sets were designed within these constraints. This method was used to perform subtyping RT-PCR on 191 influenza RNA-positive ethanol-fixed cloacal swabs obtained from 880 wild ducks in central Alaska in 2005. Seven different co-circulating hemagglutinin subtypes were identified in this study set, including H1, H3, H4, H5, H6, H8, and H12. In addition, 16% of original cloacal samples showed evidence of mixed infection, with samples yielding from two-to-five different hemagglutinin subtypes. This study further demonstrates the complex ecobiology of avian influenza A viruses in wild birds.

  18. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Foot-and-mouth disease virus: A first inter-laboratory comparison trial to evaluate virus isolation and RT-PCR detection methods.

    NARCIS (Netherlands)

    Ferris, N.P.; King, D.P.; Reid, S.M.; Hutchings, G.H.; Shawa, A.E.; Paton, D.J.; Goris, N.; Haas, B.; Hoffmann, B.; Brocchi, E.; Bugnetti, M.; Dekker, A.; Clerq, De K.

    2006-01-01

    Five European reference laboratories participated in an exercise to evaluate the sensitivity and specificity of their routinely employed RT-PCR tests and cell cultures for the detection and isolation of foot-and-mouth disease (FMD) virus. Five identical sets of 20 coded samples were prepared from 10

  20. Evaluation of Susceptibility of Strains of Candida Albicans Isolated from AIDS Patients to Fluconazole and Determination of CDR2 Resistance Gene in Resistant Strains by RT-PCR Method

    Directory of Open Access Journals (Sweden)

    E Farahbakhsh

    2011-08-01

    Full Text Available Introduction & Objective: Nowadays, opportunistic fungi especially Candida albicans are the most common cause of life-threatening infections in immunodeficiency patients. Increasing Azole-resistant strains of C.albicans are a main problem in human immunodeficiency virus-infected patients. The aim of this study was to evaluate the CDR2 gene in C.albicans azole resistant strains, isolated from AIDS patients with oropharyngeal candidiasis by RT-PCR method. Materials & Methods: The present experimental study was conducted at Tarbiat Modares University of Medical Sciences in 2009. C. albicans isolates from HIV infected patients were identified by standard procedures, including germ tube formation, clamidospor and color of colonies on CHROM agar. At first, susceptibility of C. albicans isolates was assessed by disk diffusion agar technique. Then, CDR2 resistance gene was analyzed by RT-PCR and electrophoresis of the PCR products. Finally, patterns of the resulted bands were compared with standard fluconazole resistant strains. The collected data was analyzed using the SPSS software. Results: The results of drug sensitivity of 66 C. albicans isolates from AIDS patients revealed that 62.6% were susceptible, 8.6% were susceptible-dose dependent (SDD and 28.7% were resistant. In RT-PCR analysis, 6% of patients had the CDR2 gene. Conclusion: The use of phenotypic methods like disk diffusion agar, which is cheaper, along with genotypic methods, like RT-PCR, which provide the possibility of studying the mechanism of drug resistance, is recommended.

  1. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  2. A combined RT-PCR and dot-blot hybridization method reveals the coexistence of SJNNV and RGNNV betanodavirus genotypes in wild meagre (Argyrosomus regius).

    Science.gov (United States)

    Lopez-Jimena, B; Cherif, N; Garcia-Rosado, E; Infante, C; Cano, I; Castro, D; Hammami, S; Borrego, J J; Alonso, M C

    2010-10-01

    To detect the possible coexistence of striped jack nervous necrosis virus (SJNNV) and red-spotted grouper nervous necrosis virus (RGNNV) genotypes in a single fish, a methodology based on the combination of PCR amplification and blot hybridization has been developed and applied in this study. The degenerate primers designed for the PCR procedure target the T4 region within the capsid gene, resulting in the amplification of both genotypes. The subsequent hybridization of these amplification products with two different specific digoxigenin-labelled probes resulted in the identification of both genotypes separately. The application of the RT-PCR protocol to analyse blood samples from asymptomatic wild meagre (Argyrosomus regius) specimens has shown a 46.87% of viral nervous necrosis virus carriers. The combination of RT-PCR and blot hybridization increases the detection rate up to 90.62%, and, in addition, it has shown the coexistence of both genotypes in 18 out of the 32 specimens analysed (56.25%). This study reports the coexistence of betanodaviruses belonging to two different genotypes (SJNNV and RGNNV) in wild fish specimens. This is the first report demonstrating the presence of SJNNV and RGNNV genotypes in the same specimen. This study also demonstrates a carrier state in this fish species for the first time. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  3. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  4. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  5. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  6. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    . METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...

  7. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  8. TaqMan探针荧光定量PCR检测花生油中掺入棕榈油的研究%Determination of palm oil adulterated in peanut oil with the TaqMan probe -based RT- PCR method

    Institute of Scientific and Technical Information of China (English)

    周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛

    2011-01-01

    The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.

  9. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  10. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  11. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  12. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  14. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  15. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  16. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  18. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Science.gov (United States)

    Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

    2017-01-01

    Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

  1. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2017-01-01

    Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

  2. RT-PCR for detection of all seven genotypes of Lyssavirus genus.

    Science.gov (United States)

    Vázquez-Morón, S; Avellón, A; Echevarría, J E

    2006-08-01

    The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.

  3. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  4. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    Science.gov (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  5. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  6. Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR.

    Science.gov (United States)

    Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P

    2002-01-01

    Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

  7. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  8. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  9. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  10. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  11. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  12. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  13. Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

    Science.gov (United States)

    Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

    2017-06-01

    Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  15. Simultaneous VENTANA IHC and RT-PCR testing of ALK status in Chinese non-small cell lung cancer patients and response to crizotinib.

    Science.gov (United States)

    Xu, Chun-Wei; Wang, Wen-Xian; Chen, Yan-Ping; Chen, Yu; Liu, Wei; Zhong, Li-Hua; Chen, Fang-Fang; Zhuang, Wu; Song, Zheng-Bo; Chen, Xiao-Hui; Huang, Yun-Jian; Guan, Yan-Fang; Yi, Xin; Lv, Tang-Feng; Zhu, Wei-Feng; Lu, Jian-Ping; Wang, Xiao-Jiang; Shi, Yi; Lin, Xian-Dong; Chen, Gang; Song, Yong

    2018-04-11

    ALK rearrangement-advanced NSCLC patients respond to crizotinib. ALK rearrangement is currently determined with RT-PCR. VENTANA IHC is a standard method to identify ALK protein overexpression in NSCLC; however, VENTANA IHC has rarely been used to determine the response to crizotinib in Chinese patients with NSCLC and ALK overexpression. To better clarify the clinical implication of VENTANA IHC to detect ALK rearrangements, we conducted this study to analyze VENTANA IHC and RT-PCR in a large cohort of Chinese patients with NSCLC undergoing screening for ALK rearrangements. A total of 1720 patients with NSCLC who had ALK rearrangements detected by VENTANA IHC and/or RT-PCR were included in this analysis. We compared the efficacy and survival of ALK-positive patients detected by VENTANA IHC and RT-PCR. We used NGS to identify patients in whom the two methods were inconsistent. Among 1720 patients, 187 (10.87%) were shown to be ALK-positive by VENTANA IHC and/or RT-PCR, and 66 received crizotinib treatment. We identified 10.27% (172/1674) of patients as ALK-positive by the VENTANA IHC method, and 12.73% (41/322) of patients had ALK rearrangements by the RT-PCR method. Twenty-nine of 276 (10.51%) ALK-positive patients were simultaneously analyzed using VENTANA IHC and RT-PCR. The overall response rates were 65.90% (29/44) by VENTANA IHC and 55.88% (19/34) by RT-PCR. The disease control rates were 86.36% (38/44) by VENTANA IHC and 76.47% (26/34) by RT-PCR. In contrast, the median progression-free survival for VENTANA IHC and RT-PCR was 8.5 and 9.2 months, respectively. The VENTANA IHC and RT-PCR results obtained for 6 of 17 ALK-positive patients were inconsistent based on NGS; specifically, 4 patients had EML4-ALK fusions, 2 patients had non EML4-ALK fusions, 1 patient had a KCL1-ALK fusion, and one patient had a FBXO36-ALK fusion. VENTANA IHC is a reliable and rapid screening tool used in routine pathologic laboratories for the identification of suitable candidates for

  16. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  17. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  18. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

    Science.gov (United States)

    Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

    2001-01-01

    Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

  20. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  1. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    Science.gov (United States)

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  2. European interlaboratory comparison of Schmallenberg virus (SBV) real-time RT-PCR detection in experimental and field samples: The method of extraction is critical for SBV RNA detection in semen

    NARCIS (Netherlands)

    Schulz, C.; Poel, van der W.H.M.; Ponsart, C.; Cay, A.B.; Steinbach, F.; Zientara, S.; Beer, M.; Hoffmann, B.

    2015-01-01

    Molecular methods for the detection of Schmallenberg virus (SBV) RNA were rapidly developed after the emergence of this novel orthobunyavirus in Europe. The SBV epizootic wave has declined, but infectious SBV in SBV RNA–positive semen remains a possible risk for the distribution of SBV. However, the

  3. Detection of Potato Leaf Roll Virus (PLRV), Potato Virus Y (PVY) and Potato Virus X (PVX) on Five Potato Varieties by Using of DAS-ELISA and RT-PCR Methods

    OpenAIRE

    Kuswinanti, Tutik

    2012-01-01

    Potato is a staple food crop that widely grown around the world. Virus infection is main factor that affects great loss of the potato production. Potato virus X(PVX), potato virus Y(PVY),and potato leaf roll virus(PLRV) are top three viruses that result in decreased yield of potato in Indonesia. Therefore, the rapid methods of DAS-ELISA was studied to test tuber samples of five potato varieties, Granola, Atlantik, Raja, Super John, Kalosi, and Masalle. Two simple, rapid, sensitive, reliable...

  4. A simple RT-PCR-based strategy for screening connexin identity

    Directory of Open Access Journals (Sweden)

    M. Urban

    1999-08-01

    Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

  5. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  6. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  7. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  8. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  9. RT-PCR protocols [Methods in molecular biology, v. 193

    National Research Council Canada - National Science Library

    O'Connell, Joseph

    2002-01-01

    .... Here the newcomer will find readily reproducible protocols for highly sensitive detection and quantification of gene expression, the in situ localization of gene expression in tissue, and the cloning...

  10. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  11. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  12. Epidemiology of Human Parechovirus Type1 in Clinical Samples from Children with Gastroenteritis Using RT-PCR

    Directory of Open Access Journals (Sweden)

    Dabirmanesh B

    2011-03-01

    Full Text Available Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR. Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5′untranslated region (5′ UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid detection of HPeV1 by RT-PCR can decrease both the unnecessary use of antibiotics and the costs in clinical practice

  13. Epidemiology of Human Parechovirus Type1 in Clinical Samples from Children with Gastroenteritis Using RT-PCR

    Directory of Open Access Journals (Sweden)

    F Ghazi

    2012-05-01

    Full Text Available

    Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR.

     

    Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5untranslated region (5 UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.

     

    Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.

     

    Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid

  14. RT-PCR analysis of dystrophin mRNA in DND/BMD patients

    Energy Technology Data Exchange (ETDEWEB)

    Ciafaloni, E.; Silva, H.A.R. de; Roses, A.D. [Duke Univ. Medical Center, Durham, NC (United States)

    1994-09-01

    Duchenne and Becker muscular dystrophies (DMD, BMD) are X-linked recessive disorders caused by mutations in the dystrophin (dys) gene. The majority of these mutations are intragenic deletions of duplications routinely detected by Southern biots and multiplex PCR. The remainder are very likely, smaller mutations, mostly point-mutations. Detection of these mutations is very difficult due to the size and complexity of the dys gene. We applied RT-PCR to analyse the entire dys mRNA of three DMD patients with no detectable genomic defect. In two unrelated patients, a duplication of the 62 bp exon 2 was identified. This causes a frameshift sufficient to explain the DMD phenotype. In the third patient, who had congenital DMD and severe mental retardation, a complex pattern of aberrant splicing at the 3-prime exons 67-79 was observed. Sural nerve biopsy in this patient showed the complete absence of Dp116. PCR-SSCP studies are presently in progress to identify the mutations responsible for the aberrant splicing patterns.

  15. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    2009-01-01

    research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  16. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  17. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  18. An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

  19. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  20. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  1. Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR

    Directory of Open Access Journals (Sweden)

    Marcello Gatti

    2010-06-01

    Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91

  2. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  3. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    Science.gov (United States)

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  4. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  5. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  6. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  7. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  8. Diagnosis of intestinal parasites in a rural community of Venezuela: Advantages and disadvantages of using microscopy or RT-PCR.

    Science.gov (United States)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia; Pinelli, Elena

    2017-03-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular anthelminthic treatments. A total of 228 participants were included in this study. A multiplex RT-PCR was used for the detection of Dientamoeba fragilis, Giardia intestinalis, Cryptosporidium sp. and a monoplex RT-PCR for Entamoeba histolytica. Furthermore, a multiplex PCR was performed for detection of Ascaris lumbricoides, Strongyloides stercoralis, Necator americanus and Ancylostoma duodenale. Combined microscopy-PCR revealed prevalences of 49.3% for A. lumbricoides, 10.1% for N. americanus (no A. duodenale was detected), 2.0% for S. stercoralis, 40.4% for D. fragilis, 35.1% for G. intestinalis, and 7.9% for E. histolytica/dispar. Significant increases in prevalence at PCR vs. microscopy were found for A. lumbricoides, G. intestinalis and D. fragilis. Other parasites detected by microscopy alone were Trichuris trichiura (25.7%), Enterobius vermicularis (3.4%), Blastocystis sp. (65.8%), and the non-pathogenic Entamoeba coli (28.9%), Entamoeba hartmanni (12.3%), Endolimax nana (19.7%) and Iodamoeba bütschlii (7.5%). Age- but no gender-related differences in prevalences were found for A. lumbricoides, T. trichiura, G. intestinalis, and E. histolytica/dispar. The persistently high prevalences of intestinal helminths are probably related to the high faecal pollution as also evidenced by the high prevalences of non-pathogenic intestinal protozoans. These results highlight the importance of using sensitive diagnostic techniques in combination with microscopy to better estimate the prevalence of intestinal parasites, especially in the case of D. fragilis trophozoites, which deteriorate very rapidly and would be missed by microscopy. In addition, the differentiation between

  9. Análise de citocinas pela RT-PCR em pacientes com rinite alérgica RT-PCR cytokine study in patients with allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Tarcimara Moreira da Silva

    2009-02-01

    knowing the cytokine expressions during this period. MATERIALS AND METHODS: Another prospective and transversal study was carried out, selecting 30 patients, 13 of these patients were pauci-symptomatic and 17 were non atopic. The groups were selected by means of a medical interview, an otolaryngologic clinical exam and allergy skin tests - Prick Test. The cytokines were investigated in fragments of the nasal mucosa, using RT-PCR - chosen because it has good reproducibility and specificity. RESULTS: IL-5, IL-8, IFN-gama cytokine values were kept homogeneous in relation to the control group. Only IL-4 presented significant statistic differences. CONCLUSION: Asymptomatic patients with allergic rhinitis presented with normalization of cytokine expression in the nasal mucosa, with exception of IL-4.

  10. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  11. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    Science.gov (United States)

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  12. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  13. FIRST MOLECULAR DETECTION AND VP7 (G GENOTYPING OF GROUP A ROTAVIRUS BY SEMI-NESTED RT-PCR FROM SEWAGE IN NIGERIA

    Directory of Open Access Journals (Sweden)

    Babatunde Olanrewaju MOTAYO

    Full Text Available SUMMARY Rotavirus is the leading cause of viral gastroenteritis worldwide, and sewage is a major source of the virus dissemination in the environment. Our aim was to detect and genotype rotaviruses from sewages in Nigeria. One hundred and ninety sewage samples were collected between June 2014 and January 2015. The two phase concentration method using PEG 6000 and dextran was used to concentrate sewage samples following WHO protocols. Molecular detection was performed by RT-PCR, and VP7 genotyping by semi-nested multiplex PCR. A total of 14.2% (n = 27 samples tested positive. Monthly distribution showed that June to September had a lower rate (3.7% to 7.4%, while October to January recorded 11% to 26%. Genotype G1 predominated followed by G8, G9, G4 and lastly G2, 7.4% (n = 2 of isolates were nontypeable. This is the first report of rotavirus detection in sewages from Nigeria. Genotype G1 remains the most prevalent genotype. This observation calls for an effort by the governmental authorities to implement a molecular surveillance, both clinical and environmental, in order to provide vital information for the control and the vaccine efficacy not only in Nigeria, but globally.

  14. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  15. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. A comparison of the sensitivities of detection of Plasmodium falciparum gametocytes by magnetic fractionation, thick blood film microscopy, and RT-PCR

    Directory of Open Access Journals (Sweden)

    St-Pierre Tim G

    2009-05-01

    Full Text Available Abstract Background The magnetic properties of Plasmodium-infected erythrocytes have been exploited for different clinical and research purposes. A recent study in a rural clinical setting in Papua New Guinea has demonstrated that Plasmodium falciparum gametocyte detection is facilitated by magnetic deposition microscopy but no study has yet determined the relative sensitivity and limit of detection of a magnetic fractionation technique. The present study compares the detection limit and sensitivity of a technique based on the use of commercially available magnetic fractionation columns with those for thick blood film microscopy and reverse transcriptase polymerase chain reaction (RT-PCR methods. Methods Gametocyte detection in six series of dilutions of cultured P. falciparum parasites with known gametocytaemia was conducted using magnetic fractionation, thick blood film, and RT-PCR techniques. Results The preparations obtained by the magnetic fractionation method were of thin film quality allowing easy gametocyte identification by light microscopy. Magnetic fractionation had a higher sensitivity and approximately two orders of magnitude better limit of detection than thick blood film microscopy. Gametocytes were also more readily detectable on the magnetically fractionated preparations. Magnetic fractionation had a similar limit of detection to that of RT-PCR. Conclusion Magnetic fractionation is a highly sensitive and convenient method for gametocyte detection in comparison with the standard thick blood film and RT-PCR methods, and could readily be adapted to field application.

  17. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  18. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    DEFF Research Database (Denmark)

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

  19. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  20. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Polio Vaccine into Vaccine-Derived Poliovirus still continue. Since 1991, WHO has developedAcute Flaccid Paralysis (AFP laboratory based surveillance. In 2014, the polioviruses identification by real-timeReverse Transcriptase Polymerase Chain Reaction (rRT-PCR, has been introduced to National Polio Laboratory(NPL Center for Biomedical and Basic Technology of Health. The objective of the rRT-PCR application is to havefaster and better diagnostic methods to monitor the circulation and mutation of polio viruses.Methods: Isolate tested by rRT-PCR using a combination of primers and probe mentioned by WHO manual.The viral RNA is converted to cDNA using reverse transcriptase and amplified in a PCR reaction using Taqpolymerase. The PCR products are detected and identified by hybridization with specific probes. The combinationof primers and probes will result in the serotype identification and intratypic differentiation of poliovirus isolates.Results: In 2014 NPL Jakarta received 604 AFP cases through the surveillance system, five cases foundpositive for polio viruses by culture. All of the specimens were positive for polio vaccine viruses. Twocases were polio virus type P2 (40%, one cases polio virus type P1 (20%, 1 case polio virus type P3(20% and one case mix polio viruses type P1+P2 (20%.Conclusion: The real-time PCR assay was able to help the identification of polio viruses rapidly in Jakartalab. The test can be utilized for monitoring the population routinely immunized with OPV. (Health ScienceJournal of Indonesia 2016;7:27-31Keywords: ITD, Poliovirus, Identification, rRT-PCR

  1. Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

    Science.gov (United States)

    Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

    2008-08-01

    Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

  2. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real

  3. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  4. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  5. Detecting the Presence of Nora Virus in "Drosophila" Utilizing Single Fly RT-PCR

    Science.gov (United States)

    Munn, Bethany; Ericson, Brad; Carlson, Darby J.; Carlson, Kimberly A.

    2015-01-01

    A single fly RT-PCR protocol has recently been developed to detect the presence of the persistent, horizontally transmitted Nora virus in "Drosophila." Wild-caught flies from Ohio were tested for the presence of the virus, with nearly one-fifth testing positive. The investigation presented can serve as an ideal project for biology…

  6. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  7. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  8. A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

    Science.gov (United States)

    Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

    2016-06-01

    Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  10. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  11. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  12. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    Science.gov (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  13. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection.

    NARCIS (Netherlands)

    Vlems, F.A.; Diepstra, J.H.S.; Cornelissen, I.M.; Ligtenberg, M.J.L.; Wobbes, Th.; Punt, C.J.A.; Krieken, J.H.J.M. van; Ruers, T.J.M.; Muijen, G.N.P. van

    2003-01-01

    BACKGROUND: In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth

  14. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection

    NARCIS (Netherlands)

    Vlems, F. A.; Diepstra, J. H. S.; Cornelissen, I. M. H. A.; Ligtenberg, M. J. L.; Wobbes, Th; Punt, C. J. A.; van Krieken, J. H. J. M.; Ruers, T. J. M.; van Muijen, G. N. P.

    2003-01-01

    In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth factor receptor

  15. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Real-Time RT-PCR for the Detection of Lyssavirus Species

    Directory of Open Access Journals (Sweden)

    A. Deubelbeiss

    2014-01-01

    Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

  17. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  18. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  19. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  20. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  1. Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Rudnick Stephen

    2003-01-01

    Full Text Available Abstract Background Rhinovirus, the most common cause of upper respiratory tract infections, has been implicated in asthma exacerbations and possibly asthma deaths. Although the method of transmission of rhinoviruses is disputed, several studies have demonstrated that aerosol transmission is a likely method of transmission among adults. As a first step in studies of possible airborne rhinovirus transmission, we developed methods to detect aerosolized rhinovirus by extending existing technology for detecting infectious agents in nasal specimens. Methods We aerosolized rhinovirus in a small aerosol chamber. Experiments were conducted with decreasing concentrations of rhinovirus. To determine the effect of UV irradiation on detection of rhinoviral aerosols, we also conducted experiments in which we exposed aerosols to a UV dose of 684 mJ/m2. Aerosols were collected on Teflon filters and rhinovirus recovered in Qiagen AVL buffer using the Qiagen QIAamp Viral RNA Kit (Qiagen Corp., Valencia, California followed by semi-nested RT-PCR and detection by gel electrophoresis. Results We obtained positive results from filter samples that had collected at least 1.3 TCID50 of aerosolized rhinovirus. Ultraviolet irradiation of airborne virus at doses much greater than those used in upper-room UV germicidal irradiation applications did not inhibit subsequent detection with the RT-PCR assay. Conclusion The air sampling and extraction methodology developed in this study should be applicable to the detection of rhinovirus and other airborne viruses in the indoor air of offices and schools. This method, however, cannot distinguish UV inactivated virus from infectious viral particles.

  2. Application of F⁺RNA Coliphages as Source Tracking Enteric Viruses on Parsley and Leek Using RT-PCR.

    Science.gov (United States)

    Shahrampour, Dina; Yavarmanesh, Masoud; Najafi, Mohammad Bagher Habibi; Mohebbi, Mohebbat

    2015-12-01

    The objective of this study was to identify sources of fecal contamination in leek and parsley, by using four different F(+)RNA coliphage genogroups (IV, I indicate animal fecal contamination and II, III indicate human fecal contamination). Three different concentrations (10(2), 10(4), 10(6) pfu/ml) of MS2 coliphage were inoculated on the surface of parsley and leek samples for detection of phage recovery efficiency among two methods of elution concentration (PEG-precipitation and Ultracentrifugation) by performing double agar layer (DAL) assay in three replications. Highest recovery of MS2 was observed in PEG method and in 10(6) inoculation concentration. Accordingly, the PEG method was used for washing and isolation of potentially contaminated phages of 30 collected samples (15 samples from the market and 15 samples from the farm). The final solutions of PEG method were tested for the enumeration of plaques by DAL assay. Total RNA was then extracted from recovered phages, and RT-PCR was performed by using four primer sets I, II, III, and IV. Incidence of F(+)RNA coliphages was observed in 12/15 (80 %) and 10/15 (66/6 %) of samples were obtained from farm and market, respectively, using both DAL and RT-PCR test methods. Different genotypes (I, II, and IV) of F(+)RNA coliphages were found in farm samples, while only genotype I was detected in market samples by using the primer sets. Due to the higher frequency of genotype I and IV, the absence of genotype III, and also the low frequency of genotype II, it is concluded that the contamination of vegetable (parsley and leek) in Neyshabour, Iran is most likely originated from animal sources.

  3. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Directory of Open Access Journals (Sweden)

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  4. An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

  5. Evaluation of 793/B-like and Mass-like vaccine strain kinetics in experimental and field conditions by real-time RT-PCR quantification.

    Science.gov (United States)

    Tucciarone, C M; Franzo, G; Berto, G; Drigo, M; Ramon, G; Koutoulis, K C; Catelli, E; Cecchinato, M

    2018-01-01

    Infectious bronchitis virus (IBV) is a great economic burden both for productive losses and costs of the control strategies. Many different vaccination protocols are applied in the same region and even in consecutive cycles on the same farm in order to find the perfect balance between costs and benefits. In Northern Italy, the usual second vaccination is more and more often moved up to the chick's first d of life. The second strain administration together with the common Mass priming by spray at the hatchery allows saving money and time and reducing animal stress. The present work compared the different vaccine strains (Mass-like or B48, and 1/96) kinetics both in field conditions and in a 21-day-long experimental trial in broilers, monitoring the viral replication by upper respiratory tract swabbing and vaccine specific real time reverse transcription PCR (RT-PCR) quantification. In both field and experimental conditions, titers for all the vaccines showed an increasing trend in the first 2 wk and then a decrease, though still remaining detectable during the whole monitored period. IBV field strain and avian Metapneumovirus (aMPV) presence also was also investigated by RT-PCR and sequencing, and by multiplex real-time RT-PCR, respectively, revealing a consistency in the pathogen introduction timing at around 30 d, in correspondence with the vaccine titer's main decrease. These findings suggest the need for an accurate knowledge of live vaccine kinetics, whose replication can compete with the other pathogen one, providing additional protection to be added to what is conferred by the adaptive immune response. © 2017 Poultry Science Association Inc.

  6. Localisation of Abundant and Organ-Specific Genes Expressed in Rosa hybrida Leaves and Flower Buds by Direct In Situ RT-PCR

    Directory of Open Access Journals (Sweden)

    Agata Jedrzejuk

    2012-01-01

    Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.

  7. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and

  9. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  10. Detection of poliovirus type 2 in oysters by using cell culture and RT-PCR Detecção de poliovírus tipo 2 em ostras através de cultura celular e RT-PCR

    Directory of Open Access Journals (Sweden)

    Cecília E.B. Vinatea

    2006-03-01

    Full Text Available Shellfish are readily contaminated with viruses present in water containing sewage due to the concentrating effect of filter feeding. Enteroviruses are generally used as a model for the detection of viruses from shellfish due to their public health significance. In the present work, oysters were placed in glass aquaria containing seawater plus unicellular algae. Two experiments were performed: 1 oysters bioaccumulating four different poliovirus type 2 concentrations: 5 x 10(4, 2.5 x 10(4, 5 x 10³ and 5 x 10² PFU/mL during 20h; 2 oyster tissues directly inoculated with 6.0 x 10(5 and 1.0 x 10(5 PFU/mL. After viruses seeding, tissue samples were processed by an adsorption-elution-precipitation method. Positive controls were performed by seeding 6.0 x 10(5 PFU/mL of poliovirus type 2 directly on the final oyster tissue extracts. Oyster extracts were assayed for viruses recovery by plaque assay, RT-PCR and integrated cell culture-PCR methodologies (ICC/PCR. The last one was based on the inoculation of the samples onto VERO cell monolayer followed by RT-PCR analysis of the infected cell fluid. In the first experiment (20h bioaccumulation until 5 x 10³ PFU were detected after 24 and 48h growth on VERO cells. Direct RT-PCR and ICC/PCR were able to detect 3 and 0.04 PFU of poliovirus, respectively, when bioaccumulation assay was used. When direct tissue virus seeding was performed, the plaque assays showed that polioviruses were recovered in all tested concentrations. Based on these results, it is possible to conclude that viable polioviruses can be detected in oysters after bioaccumulation and these techniques can be directly applied for monitoring virus contamination in environmental samples.Devido ao hábito alimentar filtrante, os moluscos bivalves são contaminados por vírus presentes em águas contaminadas por esgoto. Os enterovírus são geralmente usados como modelos para a detecção de vírus em moluscos bivalves devido a sua import

  11. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes C. Gomes

    Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.

  13. Correlation of immune activation with HIV-1 RNA levels assayed by real-time RT-PCR in HIV-1 Subtype C infected patients in Northern India

    Science.gov (United States)

    Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya

    2014-01-01

    Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068

  14. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    Science.gov (United States)

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  15. [Disappearance of residual disease confirmed by RT-PCR following induction chemotherapy in two hypoplastic leukemia patients with t(8;21)].

    Science.gov (United States)

    Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H

    1999-04-01

    Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.

  16. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  17. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  18. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  19. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  20. Strategy for the maximization of clinically relevant information from hepatitis C virus, RT-PCR quantification.

    LENUS (Irish Health Repository)

    Levis, J

    2012-02-03

    BACKGROUND: The increasing clinical application of viral load assays for monitoring viral infections has been an incentive for the development of standardized tests for the hepatitis C virus. OBJECTIVE: To develop a simple model for the prediction of baseline viral load in individuals infected with the hepatitis C virus. METHODOLOGY: Viral load quantification of each patient\\'s first sample was assessed by RT-PCR-ELISA using the Roche MONITOR assay in triplicate. Genotype of the infecting virus was identified by reverse line probe hybridization, using amplicons resulting from the qualitative HCV Roche AMPLICOR assay. RESULTS: Retrospective evaluation of first quantitative values suggested that 82.4% (n=168\\/204) of individuals had a viral load between 4.3 and 6.7 log(10) viral copies per ml. A few patients (3.4%; n=7\\/204) have a serum viremia less than the lower limit of the linear range of the RT-PCR assay. Subsequent, prospective evaluation of hepatitis C viral load of all new patients using a model based on the dynamic range of viral load in the retrospective group correctly predicted the dynamic range in 75.9% (n=33\\/54). CONCLUSION: The dynamic range of hepatitis C viremia extends beyond the linear range of the Roche MONITOR assay. Accurate determination of serum viremia is substantially improved by dilution of specimens prior to quantification.

  1. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  2. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  3. Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

    Science.gov (United States)

    Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

    2009-10-01

    Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

  4. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  5. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  6. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  7. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  8. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    International Nuclear Information System (INIS)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs

  9. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs.

  10. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  11. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  12. Emulating a crowded intracellular environment in vitro dramatically improves RT-PCR performance

    International Nuclear Information System (INIS)

    Lareu, Ricky R.; Harve, Karthik S.; Raghunath, Michael

    2007-01-01

    The polymerase chain reaction's (PCR) phenomenal success in advancing fields as diverse as Medicine, Agriculture, Conservation, or Paleontology is based on the ability of using isolated prokaryotic thermostable DNA polymerases in vitro to copy DNA irrespective of origin. This process occurs intracellularly and has evolved to function efficiently under crowded conditions, namely in an environment packed with macromolecules. However, current in vitro practice ignores this important biophysical parameter of life. In order to more closely emulate conditions of intracellular biochemistry in vitro we added inert macromolecules into reverse transcription (RT) and PCR. We show dramatic improvements in all parameters of RT-PCR including 8- to 10-fold greater sensitivity, enhanced polymerase processivity, higher specific amplicon yield, greater primer annealing and specificity, and enhanced DNA polymerase thermal stability. The faster and more efficient reaction kinetics was a consequence of the cumulative molecular and thermodynamic effects of the excluded volume effect created by macromolecular crowding

  13. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  14. Combination of RT-PCR and proteomics for the identification of Crimean-Congo hemorrhagic fever virus in ticks

    Directory of Open Access Journals (Sweden)

    Isabel G. Fernández de Mera

    2017-07-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.

  15. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  16. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  17. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

  19. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  20. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  1. Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

    Science.gov (United States)

    Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

    2010-01-01

    The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  2. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions

    DEFF Research Database (Denmark)

    Svingen, Terje; Letting, Heidi; Hadrup, Niels

    2015-01-01

    In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or...... ‘housekeeping’) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a...

  3. Assessment of six commercial plasma small RNA isolation kits using qRT-PCR and electrophoretic separation

    DEFF Research Database (Denmark)

    Meerson, Ari; Ploug, Thorkil

    2016-01-01

    of specific miRNAs in different samples varied considerably between the tested extraction methods. Of all kits tested, the QIAGEN miRNeasy kits (Mini and Serum/Plasma kits) and the Macherey-Nagel NucleoSpin kit produced the highest RNA yields. The QIAGEN Exo kit produced lesser yields than what could...... be extracted from the UC fraction using the QIAGEN miRNeasy kits and the Macherey-Nagel NucleoSpin kit. Bioanalyzer results showed an average correlation of R2¼0.8 with endogenous miRNA qRT-PCR results, for sample concentrations >40 pg/ml. The levels of the endogenous miRNAs measured in the two volunteer...... samples were compared with those in a larger group of subjects (n¼10) and found to be typical. Our comparison favors the use of the QIAGEN Serum/Plasma kit and the Macherey-Nagel NucleoSpin kit for plasma miRNA applications. Furthermore, extraction of miRNAs from the UC fraction results in higher yield...

  4. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  5. Detection of potato mop-top virus in soils and potato tubers using bait-plant bioassay, ELISA and RT-PCR.

    Science.gov (United States)

    Arif, Muhammad; Ali, Murad; Rehman, Anayatur; Fahim, Muhammad

    2014-01-01

    The hilly region of Northwest of Pakistan is leading seed potato producing areas of the country. Soil and plant samples were collected from the region and tested for PMTV using both conventional and molecular techniques. The bait plants exhibited PMTV-characteristic v-shaped yellow leaf markings in Nicotiana debneyi plants grown in putative viruliferious soils from 20/26 locations. The results were confirmed by back inoculation of sap from both roots and leaves of bait plant on indicator hosts (N. debneyi, Nicotiana benthamiana). The root samples of bait plants grown in soils of 25 locations and leaves of 24 locations reproduced systemic infection on indicator hosts upon back inoculation. The virus was identified in bait plants grown in soils from 25/26 locations using double antibody sandwich-enzyme linked immunosorbent assay (DAS)-ELISA and reverse transcription and polymerase chain reaction (RT-PCR) methods. The products of the 566bp were amplified from coat protein region of PMTV RNA 3 in both root and leaf samples of baited plants. The virus was detected in 10 potato cultivars commercially grown in the region using DAS-ELISA and RT-PCR. The virus was also detected in zoospores of Spongospora subterranea derived from the peels of selected scabby tubers using triple antibody sandwich (TAS)-ELISA. The results indicate that a bait plant bioassay, infectivity assay, ELISA and RT-PCR can detect PMTV in roots and leaves of baited plants, field samples, zoospores of S. subterranea and tubers of 10 potato cultivars commercially grown in the region. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East.

    Science.gov (United States)

    Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P

    2014-10-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  8. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Science.gov (United States)

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  9. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2018-04-01

    Full Text Available Background Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. Method In this study, 10 candidate RGs namely, 18S, 60S, CYP, GAPCP1, GAPDH2, EF1B, MDH, SAND, TUA1, and TUA6, were singled out from the transcriptome database of S. chamaejasme, and their expression stability under three abiotic stresses (drought, cold, and salt and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH were estimated with the programs geNorm, NormFinder, and BestKeeper. Result Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND, TUA1 and CYP, GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes (P5CS2 and GI further verified that the RGs that we selected were suitable for gene expression normalization. Discussion

  10. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  11. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  12. Molecular detection of infectious bronchitis and Newcastle disease viruses in broiler chickens with respiratory signs using Duplex RT-PCR.

    Science.gov (United States)

    Saba Shirvan, Aylar; Mardani, Karim

    2014-01-01

    Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA was extracted from vaccinal and reference strains of infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) and then cDNA was synthesized. Using two universal primer sets for detection of IBV and NDV, the duplex-RT-PCR was developed. In order to assess the efficiency of the developed duplex RT-PCR, a number of 12 broiler farms with the symptoms of respiratory tract infection was sampled (trachea, lung and kidney were sampled from affected birds suspicious for IBV and NDV infections). After RNA extraction from tissues and cDNA synthesis, the presence of IBV and NDV genome were investigated using duplex-PCR. The results showed that three of twelve examined broiler farms were positive for IBV and two farms were positive for NDV and IBV. The results revealed that the duplex-RT-PCR is a quick and sensitive procedure for simultaneously detecting IBV and NDV in birds with respiratory infections.

  13. Effect of specific or random c-DNA priming on sensitivity of tyrosinase nested RT-PCR : Potential clinical relevance

    NARCIS (Netherlands)

    Calogero, A; Hospers, GAP; Timmer-Bosscha, H; Mulder, NH; Schraffordt Koops, H.

    2000-01-01

    The reverse transcriptase polymerase chain reaction (RT-PCR) can be of clinical relevance in identifying malignant melanoma cells in blood or tissues of patients at risk for disseminated melanoma. The diagnostic value of this marker however, is still controversial. The objective of this study was to

  14. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  15. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  16. Survey of Cherry necrotic rusty mottle virus and Cherry green ring mottle virus incidence in Korea by Duplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Seung-Yeol Lee

    2014-12-01

    Full Text Available The incidence of Cherry necrotic rusty mottle virus (CNRMV and Cherry green ring mottle virus (CGRMV have recently been occurred in Korea, posing a problem for sweet cherry cultivation. Since infected trees have symptomless leaves or ring-like spots on the pericarp, it is difficult to identify a viral infection. In this study, the incidence of CNRMV and CGRMV in sweet cherry in Gyeongbuk province was surveyed using a newly developed duplex reverse transcriptase polymerase chain reaction (RT-PCR method that can detect both viruses in a single reaction. CNRMV and CGRMV co-infection rates were 29.6%, 53.6%, and 17.6%, respectively, in samples collected from three different sites (Daegu, Gyeongju and Gyeongsan in Gyeongbuk province during 2012 and 2013. This duplex RT-PCR method offers a simple, rapid, and effective way of identifying CNRMV and CGRMV simultaneously in sweet cherry trees, which can aid in the management of viral infections that could undermine yield.

  17. Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2015-12-01

    Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.

  18. Proteomic analysis and qRT-PCR verification of temperature response to Arthrospira (Spirulina platensis.

    Directory of Open Access Journals (Sweden)

    Wang Huili

    Full Text Available Arthrospira (Spirulina platensis (ASP is a representative filamentous, non-N2-fixing cyanobacterium that has great potential to enhance the food supply and possesses several valuable physiological features. ASP tolerates high and low temperatures along with highly alkaline and salty environments, and can strongly resist oxidation and irradiation. Based on genomic sequencing of ASP, we compared the protein expression profiles of this organism under different temperature conditions (15°C, 35°Cand 45°C using 2-DE and peptide mass fingerprinting techniques. A total of 122 proteins having a significant differential expression response to temperature were retrieved. Of the positively expressed proteins, the homologies of 116 ASP proteins were found in Arthrospira (81 proteins in Arthrospira platensis str. Paraca and 35 in Arthrospira maxima CS-328. The other 6 proteins have high homology with other microorganisms. We classified the 122 differentially expressed positive proteins into 14 functions using the COG database, and characterized their respective KEGG metabolism pathways. The results demonstrated that these differentially expressed proteins are mainly involved in post-translational modification (protein turnover, chaperones, energy metabolism (photosynthesis, respiratory electron transport, translation (ribosomal structure and biogenesis and carbohydrate transport and metabolism. Others proteins were related to amino acid transport and metabolism, cell envelope biogenesis, coenzyme metabolism and signal transduction mechanisms. Results implied that these proteins can perform predictable roles in rendering ASP resistance against low and high temperatures. Subsequently, we determined the transcription level of 38 genes in vivo in response to temperature and identified them by qRT-PCR. We found that the 26 differentially expressed proteins, representing 68.4% of the total target genes, maintained consistency between transcription and

  19. Development and evaluation of novel one-step TaqMan realtime RT-PCR assays for the detection and direct genotyping of genogroup I and II noroviruses

    DEFF Research Database (Denmark)

    Schultz, Anna Charlotte; Vega, Everado; Dalsgaard, Anders

    2011-01-01

    BackgroundCurrent detection and genotyping methods of genogroup (G) I and II noroviruses (NoVs) consist of a 2-step approach including detection of viral RNA by TaqMan realtime RT-PCR (RT-qPCR) followed by conventional RT-PCR and sequencing of partial regions of ORF1 or ORF2. ObjectiveTo develop ......Man RT-qPCR assays for the sensitive detection and direct genotyping of GI and GII NoVs from clinical and environmental matrices...... novel long-template one-step TaqMan assays (L-RT-qPCR) for the rapid detection and direct genotyping of GI and GII NoVs and to evaluate the sensitivity and specificity of the assays. Study designGI and GII-specific broadly reactive L-RT-qPCR assays were developed by combining existing NoV primers...... and probes targeting the open reading frame (ORF)1–ORF2 junction as well as region C at the 5′–ORF2. The assays were validated using GI and GII RNA transcripts and a coded panel of 75 stool samples containing NoV strains representing 9 GI genotypes and 12 GII genotypes, as well as sapoviruses, astroviruses...

  20. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Song

    2016-05-01

    Full Text Available Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is a rapid and sensitive method for analyzing microRNA (miRNA expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA, salicylic acid (SA and abscisic acid (ABA, respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  1. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  2. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  3. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  4. Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter

    Directory of Open Access Journals (Sweden)

    Davi de Oliveira Almeida

    2015-03-01

    Full Text Available ABSTRACT. Almeida D.O., Tortely R., Nascimento E.R., Khan M., Pereira V.L.A & Babapoor S. [Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter.] Uso das técnicas de RT-PCR e elisa no diagnóstico da bronquite infecciosa em frangos de corte ao abate. Revista Brasileira de Medicina Veterinária, 37(1:55-59, 2015. Departamento de Saúde Coletiva Veterinária e Saúde Pública, Universidade Federal Fluminense, Rua Vital Brazil Filho, 64, Santa Rosa, Niterói, RJ 24230-340, Brasil. E-mail: elmiro@vm.uff.br Avian infectious bronchitis (IB is a viral, acute and highly contagious disease caused by infectious bronchitis virus (IBV. The disease affects broilers improvement and performance causing major economic losses in the world poultry industry. Generally, IBV infections can be diagnosed by detection of IBV itself or the specific antibody response. This study aimed to detect IBV in broilers under Sanitary Inspection by RT-PCR and ELISA, comparing the results and relating them with the average weight of the flock. Samples were collected from 40 vaccinated broiler flocks under Sanitary Inspection at slaughter. Ten birds from every flock were randomly selected and blood samples were collected for ELISA as well three birds had their trachea and caecal tonsils collected for RT- -PCR test. From 40 flocks, 30 were IBV positive by ELISA and 26 by RT-PCR, in which 15 were detected simultaneously in trachea and caecal tonsil and 5 in each sample. There was no agreement between ELISA and RT-PCR results regarding IBV diagnosis as well positivity in both tests was not statistically significant with the average weight of the flock. There was an improvement on IBV diagnosis when caecal tonsils and tracheas were used instead of just one of them. Considering the only vaccine serotype allowed by Brazilian government is the Mass serotype and its persistence in broilers would only be detected up to 28 days

  5. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. DEVELOPMENT OF MULTIPLEX RT-PCR FOR THE DETECTION OF REOVIRUS, HEPATITIS A VIRUS, POLIOVIRUS, NORWALK VIRUS AND ROTAVIRUS

    Science.gov (United States)

    Water sources are often found to be contaminated by enteric viruses. This is a public health concern as food and waterborne outbreaks caused by enteric viruses such as noroviruses, rotaviruses, hepatitis A virus (HAV) and enteroviruses are a common occurrence. All of these viru...

  7. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  8. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

    OpenAIRE

    Fischer, Carlo; Torres, Maria C.; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A.; Charrel, Rémi N.; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C.; Rodrigues, Cintia D.S.; Kümmerer, Beate M.; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-01-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  9. Absolute estimation of initial concentrations of amplicon in a real-time RT-PCR process

    Directory of Open Access Journals (Sweden)

    Kohn Michael

    2007-10-01

    Full Text Available Abstract Background Since real time PCR was first developed, several approaches to estimating the initial quantity of template in an RT-PCR reaction have been tried. While initially only the early thermal cycles corresponding to exponential duplication were used, lately there has been an effort to use all of the cycles in a PCR. The efforts have included both fitting empirical sigmoid curves and more elaborate mechanistic models that explore the chemical reactions taking place during each cycle. The more elaborate mechanistic models require many more parameters than can be fit from a single amplification, while the empirical models provide little insight and are difficult to tailor to specific reactants. Results We directly estimate the initial amount of amplicon using a simplified mechanistic model based on chemical reactions in the annealing step of the PCR. The basic model includes the duplication of DNA with the digestion of Taqman probe and the re-annealing between previously synthesized DNA strands of opposite orientation. By modelling the amount of Taqman probe digested and matching that with the observed fluorescence, the conversion factor between the number of fluorescing dye molecules and observed fluorescent emission can be estimated, along with the absolute initial amount of amplicon and the rate parameter for re-annealing. The model is applied to several PCR reactions with known amounts of amplicon and is shown to work reasonably well. An expanded version of the model allows duplication of amplicon without release of fluorescent dye, by adding 1 more parameter to the model. The additional process is helpful in most cases where the initial primer concentration exceeds the initial probe concentration. Software for applying the algorithm to data may be downloaded at http://www.niehs.nih.gov/research/resources/software/pcranalyzer/ Conclusion We present proof of the principle that a mechanistically based model can be fit to observations

  10. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  11. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  12. qRT-PCR quantification of the biological control agent Trichoderma harzianum in peat and compost-based growing media.

    Science.gov (United States)

    Beaulieu, Robert; López-Mondéjar, Rubén; Tittarelli, Fabio; Ros, Margarita; Pascual, José Antonio

    2011-02-01

    To ensure proper use of Trichoderma harzianum in agriculture, accurate data must be obtained in population monitoring. The effectiveness of qRT-PCR to quantify T. harzianum in different growing media was compared to the commonly used techniques of colony counting and qPCR. Results showed that plate counting and qPCR offered similar T. harzianum quantification patterns of an initial rapid increase in fungal population that decreased over time. However, data from qRT-PCR showed a population curve of active T. harzianum with a delayed onset of initial growth which then increased throughout the experiment. Results demonstrated that T. harzianum can successfully grow in these media and that qRT-PCR can offer a more distinct representation of active T. harzianum populations. Additionally, compost amended with T. harzianum exhibited a lower Fusarium oxysporum infection rate (67%) and lower percentage of fresh weight loss (11%) in comparison to amended peat (90% infection rate, 23% fresh weight loss). Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  14. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  15. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  16. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  17. COMPARISON OF TWO TOTAL RNA EXTRACTION PROTOCOLS FROM CHO-K1 CELLS FOR RT-PCR: CUT-OFF COST FOR RESEARCHERS

    Directory of Open Access Journals (Sweden)

    Vasila Packeer Mohamed

    2014-05-01

    Full Text Available ABSTRACT: Various methods have been described to extract RNA from adherent mammalian cells. RNA isolation in conjunction with reverse transcription polymerase chain reaction (RT-PCR is a valuable tool used to study gene expression profiling. This approach is now being used in mammalian cell bioprocessing to help understand and improve the system. The objective of this study was to compare and determine the most suitable RNA extraction method for CHO-K1 cells in a setting where a relatively large amount of samples was involved. Total RNA was extracted using Total RNA purification kit (without DNase treatment; Norgen, Canada and RNeasy mini kit (with DNase treatment; Qiagen, USA respectively. The extracted RNA was then reverse transcribed, and the cDNA was subjected to PCR-amplifying 18S. Yield from RNeasy kit was significantly higher (0.316 ± 0.033 µg/µl; p=0.004 than Total RNA purification kit (0.177 ± 0.0243 µg/µl. However, RNA purity for both methods was close to 2.0 and there was no significant difference between the methods. Total RNA purification kit is less expensive than RNeasy kit. Since there is no DNase treatment step in the former, extraction time for RNA is shorter. When the extracted RNA was subjected to RT-PCR, both methods were able to show detection of 18S at 219 bp.   Therefore, this study demonstrates that both protocols are suitable for RNA extraction for CHO-K1 cells. RNeasy mini kit (Qiagen is recommended if higher yields is the primary concern and Total RNA Purification kit (Norgen is recommended if time and cost are concerned. ABSTRAK: Pelbagai kaedah telah digunakan untuk mengekstrak RNA daripada sel mamalia lekat.  Pemencilan RNA dengan menggunakan reaksi rantai polimerase transkripsi berbalik (RT-PCR merupakan kaedah penting yang digunakan dalam mengkaji pernyataan gen berprofil.  Pendekatan ini kini digunakan dalam pemprosesan bio sel mamalia untuk memahami dan menambah baik sistem.  Tujuan kajian dijalankan

  18. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Clinical utility of RT-PCR in assessing HER 2 gene expression versus traditional IHC and FISH in breast cancer patients.

    Science.gov (United States)

    Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C

    2018-02-09

    IHC and FISH are used for categorizing HER 2 status in breast cancer at the protein and DNA level, respectively. HER 2 expression at the RNA level is quantitative, cheaper, easier to standardize and free from interobserver variation. 115 consecutive patients were tested by IHC, FISH and RT-PCR (test cohort). Assuming FISH result to be the response variable, ROC curves for RT-PCR ratio were analyzed to label HER 2 negative, equivocal and positive cases as RT-PCR score 1, 2 and 3, respectively. Inter-relationships between RT-PCR, IHC and FISH were defined. 'Clinical benefit' of a test was defined as proportion of patients labeled unequivocally as HER 2 positive or negative. Population for 1 year was simulated constraint to previous reports of HER 2 positivity and IHC category distribution by a meta-analysis of previous studies that evaluated concordance between IHC and FISH to determine HER 2 status (simulation cohort). Four diagnostic pathways in the simulation cohort were defined-(1) initial IHC, followed by FISH (conventional pathway); (2) initial RT-PCR, followed by FISH; (3) initial IHC, followed by RT-PCR and then by FISH; (4) initial RT-PCR, followed by IHC and then by FISH. The clinical benefit of IHC and RT-PCR in the four pathways was analyzed and sensitivity analysis for incremental cost-effectiveness ratio and cost-benefit comapring RT-PCR against IHC, both as first-line tests and among those with IHC score 2 as a reflex second-line test was performed by the Monte Carlo technique. 115 patients comprised the study population. While none with IHC score of 0 or 1 was FISH positive for HER 2, all cases with IHC score of 3 were FISH positive. 43 cases were assigned IHC score of 2. Thus, 72 patients benefited from the initial IHC testing [clinical benefit 62.6%], with the overall concordance between IHC and FISH being 100% for those with IHC score of 0, 1 and 3 (conclusive IHC categories). For RT-PCR with 100% concordance, 15.7% (115-97 = 18) patients

  1. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  2. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

  3. Simultaneous Detection of Mixed Infection of Onion yellow dwarf virus and an Allexivirus in RT-PCR for Ensuring Virus Free Onion Bulbs.

    Science.gov (United States)

    Kumar, Sandeep; Baranwal, V K; Joshi, Subodh; Arya, Meenakshi; Majumder, S

    2010-06-01

    Reduced seed production in onion is associated with Onion yellow dwarf virus (OYDV), a filamentous Potyvirus. Onion is also infected with other filamentous virus particles suspected to be Allexivirus. RT-PCR was used to detect mixed infection of both the viruses in leaves and bulbs. A duplex RT-PCR was developed, which simultaneously detected the presence of these two viruses in winter (Rabi) onion bulb. In summer (Kharif) onion bulbs only Allexivirus was detected. The absence of OYDV in summer crop is discussed. The sequencing of RT-PCR amplified products confirmed the identity of OYDV and Allexivirus, the latter showing closer identity to Garlic virus C (GVC)/Garlic mite-borne mosaic virus. This makes the first detection of an Allexivirus in onion crop in India. The duplex RT-PCR to detect these viruses (OYDV and Allexivirus) would be an improvement for indexing of viruses in onion bulbs for seed production.

  4. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  5. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    Science.gov (United States)

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR.

    Science.gov (United States)

    Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li

    2003-09-01

    Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

  8. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  9. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  10. A high-throughput multiplex method adapted for GMO detection.

    Science.gov (United States)

    Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique

    2008-12-24

    A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.

  11. Data transformation methods for multiplexed assays

    Science.gov (United States)

    Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J

    2013-07-23

    Methods to improve the performance of an array assay are described. A correlation between fluorescence intensity-related parameters and negative control values of the assay is determined. The parameters are then adjusted as a function of the correlation. As a result, sensitivity of the assay is improved without changes in its specificity.

  12. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  13. Identification of Suitable Endogenous Normalizers for qRT- PCR Analysis of Plasma microRNA Expression in Essential Hypertension

    Science.gov (United States)

    Solayman, Mohamed Hassan M.; Langaee, Taimour; Patel, Archanakumari; El-Wakeel, Lamia; El-Hamamsy, Manal; Badary, Osama; Johnson, Julie A.

    2016-01-01

    Circulating microRNAs (miRNAs) are promising biomarkers for many diseases. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a gold standard for miRNA expression profiling that requires proper data normalization. Since there is no universal normalizer, it is recommended to evaluate normalizers under every experimental condition. This study describes the identification of suitable endogenous normalizer(s) (ENs) for plasma miRNA expression in essential hypertension. Expression levels of 5 candidate ENs and 2 plasma quality markers were determined by qRT-PCR in plasma samples from 18 hypertensive patients and 10 healthy controls. NormFinder, GeNorm, and DataAssist software programs were used to select the best EN(s). Expression levels of the 5 candidate ENs were also analyzed in urine samples from hypertensive patients and compared to the plasma samples of the hypertensive patients. Among the analyzed candidates, hsa-miR-92a-3p was identified as the best EN, and hsa-miR-21-5p and hsa-miR-16-5p as next best. Moreover, hsa-miR-92a-3p showed the most consistent expression between plasma and urine In conclusion, this study showed that hsa-miR-92a-3p, hsa-miR-21-5p, and hsa-miR-16-5p may be used as normalizers for plasma miRNA expression data in essential hypertension studies. PMID:26798072

  14. Fluorescent multiplex cell flow systems and methods

    KAUST Repository

    Merzaban, Jasmeen

    2017-06-01

    Systems and methods are provided for simultaneously assaying cell adhesion or cell rolling for multiple cell specimens. One embodiment provides a system for assaying adhesion or cell rolling of multiple cell specimens that includes a confocal imaging system containing a parallel plate flow chamber, a pump in fluid communication with the parallel plate flow chamber via a flow chamber inlet line and a cell suspension in fluid communication with the parallel plate flow chamber via a flow chamber outlet line. The system also includes a laser scanning system in electronic communication with the confocal imaging system, and a computer in communication with the confocal imaging system and laser scanning system. In certain embodiments, the laser scanning system emits multiple electromagnetic wavelengths simultaneously it cause multiple fluorescent labels having different excitation wavelength maximums to fluoresce. The system can simultaneously capture real-time fluorescence images from at least seven cell specimens in the parallel plate flow chamber.

  15. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  16. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  17. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  18. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  19. Rapid detection of bovine coronavirus by a semi-nested RT-PCR Detecção rápida do Coronavírus Bovino (BCoV por meio de uma semi-nested RT-PCR

    Directory of Open Access Journals (Sweden)

    Karen M. Asano

    2009-11-01

    Full Text Available Bovine coronavirus (BCoV is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256 in DEPC treated ultra-pure water, in fetal bovine serum (FBS and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694. The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.O Coronavírus bovino (BCoV pertence ao grupo 2 do gênero Coronavirus (Nidovirales: Coronaviridae e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doen

  20. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  1. Evaluation of a single-tube fluorogenic RT-PCR assay for detection of bovine respiratory syncytial virus in clinical samples

    DEFF Research Database (Denmark)

    Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik

    2005-01-01

    understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...

  2. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  3. Detección de virus influenza A, B y subtipos A (H1N1 pdm09, A (H3N2 por múltiple RT-PCR en muestras clínicas

    Directory of Open Access Journals (Sweden)

    Pool Marcos

    Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.

  4. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  6. Evaluation of RT-PCR and immunohistochemistry as tools for detection of enterovirus in the human pancreas and islets of Langerhans.

    Science.gov (United States)

    Skog, Oskar; Ingvast, Sofie; Korsgren, Olle

    2014-10-01

    Enteroviruses have been implicated in the etiology of type 1 diabetes, supported by immunoreactivity of enteroviral protein in islets, but presence of enteroviral genome has rarely been reported. Failure to detect enterovirus with RT-PCR has been attributed to the possible presence of PCR inhibitors and that only few cells are infected. The aim of this study was to evaluate strategies for detection of enterovirus in human islets. A scenario was modeled with defined infected islets among a large number of uninfected pancreatic cells and the sensitivity of immunohistochemistry and PCR for detection of enterovirus was evaluated. Enterovirus was detected with PCR when only one single human islet, infected in vitro with a low dose of virus, was mixed with an uninfected pancreatic biopsy. Enterovirus could not be detected by immunohistochemistry under the same conditions, demonstrating the superior sensitivity of PCR also in pancreatic tissue with only a small fraction of infected cells. In addition, we demonstrate that pancreatic cell culture supernatant does not cause degradation of enterovirus at 37°C, indicating that under normal culture conditions released virus is readily detectable. Utilizing PCR, the pancreases of two organ donors that died at onset of type 1 diabetes were found negative for enterovirus genome despite islet cells being positive using immunohistochemistry. These data suggest that PCR should be the preferred screening method for enterovirus in the pancreas and suggest cautious interpretation of immunostaining for enterovirus that cannot be confirmed with PCR. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Expression Profile of IL-35 mRNA in Gingiva of Chronic Periodontitis and Aggressive Periodontitis Patients: A Semiquantitative RT-PCR Study

    Directory of Open Access Journals (Sweden)

    Nagaraj B. Kalburgi

    2013-01-01

    Full Text Available Background. Proinflammatory and anti-inflammatory cytokines play a key role in the pathogenesis of periodontal diseases. Secretion of bioactive IL-35 has been described by T regulatory cells ( and is required for their maximal suppressive activity. are involved in the modulation of local immune response in chronic periodontitis patients. Objective. Hence, the present study was aimed to investigate the expression of IL-35 mRNA in chronic periodontitis and aggressive periodontitis patients. Materials and Methods. The present study was carried out in 60 subjects, which included 20 chronic periodontitis patients, 20 aggressive periodontitis patients, and 20 periodontally healthy controls. IL-35 mRNA expression in gingival tissue samples of all subjects was semiquantitatively analyzed using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR. Results. The present study demonstrated the expression of IL-35 mRNA in gingival tissues of all the three groups. IL-35 mRNA expression was highest in chronic periodontitis subjects ( as compared to the aggressive periodontitis group ( and least seen in healthy patients (. Conclusion. The increased expression of IL-35 in chronic and aggressive periodontitis suggests its possible role in pathogenesis of periodontitis. Future studies done on large samples with intervention will strengthen our result.

  8. Simple, quick and cost-efficient: A universal RT-PCR and sequencing strategy for genomic characterisation of foot-and-mouth disease viruses.

    Science.gov (United States)

    Dill, V; Beer, M; Hoffmann, B

    2017-08-01

    Foot-and-mouth disease (FMD) is a major contributor to poverty and food insecurity in Africa and Asia, and it is one of the biggest threats to agriculture in highly developed countries. As FMD is extremely contagious, strategies for its prevention, early detection, and the immediate characterisation of outbreak strains are of great importance. The generation of whole-genome sequences enables phylogenetic characterisation, the epidemiological tracing of virus transmission pathways and is supportive in disease control strategies. This study describes the development and validation of a rapid, universal and cost-efficient RT-PCR system to generate genome sequences of FMDV, reaching from the IRES to the end of the open reading frame. The method was evaluated using twelve different virus strains covering all seven serotypes of FMDV. Additionally, samples from experimentally infected animals were tested to mimic diagnostic field samples. All primer pairs showed a robust amplification with a high sensitivity for all serotypes. In summary, the described assay is suitable for the generation of FMDV sequences from all serotypes to allow immediate phylogenetic analysis, detailed genotyping and molecular epidemiology. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  10. A novel pancoronavirus RT-PCR assay: frequent detection of human coronavirus NL63 in children hospitalized with respiratory tract infections in Belgium

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2005-02-01

    Full Text Available Abstract Background Four human coronaviruses are currently known to infect the respiratory tract: human coronaviruses OC43 (HCoV-OC43 and 229E (HCoV-229E, SARS associated coronavirus (SARS-CoV and the recently identified human coronavirus NL63 (HCoV-NL63. In this study we explored the incidence of HCoV-NL63 infection in children diagnosed with respiratory tract infections in Belgium. Methods Samples from children hospitalized with respiratory diseases during the winter seasons of 2003 and 2004 were evaluated for the presence of HCoV-NL63 using a optimized pancoronavirus RT-PCR assay. Results Seven HCoV-NL63 positive samples were identified, six were collected during January/February 2003 and one at the end of February 2004. Conclusions Our results support the notation that HCoV-NL63 can cause serious respiratory symptoms in children. Sequence analysis of the S gene showed that our isolates could be classified into two subtypes corresponding to the two prototype HCoV-NL63 sequences isolated in The Netherlands in 1988 and 2003, indicating that these two subtypes may currently be cocirculating.

  11. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  12. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Optimization of RT-PCR reactions in studies with genes of lignin biosynthetic route in Saccharum spontaneum

    Directory of Open Access Journals (Sweden)

    JUAN P.P. LLERENA

    Full Text Available ABSTRACT Saccharum spontaneum has been used for the development of energy cane a crop aimed to be used for the production of second-generation ethanol, or lignocellulosic ethanol. Lignin is a main challenge in the conversion of cell wall sugars into ethanol. In our studies to isolate the genes the lignin biosynthesis in S. spontaneum we have had great difficulty in RT-PCR reactions. Thus, we evaluated the effectiveness of different additives in the amplification of these genes. While COMT and CCoAOMT genes did not need any additives for other genes there was no amplification (HCT, F5H, 4CL and CCR or the yield was very low (CAD and C4H. The application of supplementary cDNA was enough to overcome the non-specificity and low yield for C4H and C3H, while the addition of 0.04% BSA + 2% formamide was effective to amplify 4CL, CCR, F5H and CCR. HCT was amplified only by addition of 0.04% BSA + 2% formamide + 0.1 M trehalose and amplification of PAL was possible with addition of 2% of DMSO. Besides optimization of expression assays, the results show that additives can act independently or synergistically.

  14. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  15. Combined Metabonomic and Quantitative RT-PCR Analyses Revealed Metabolic Reprogramming Associated with Fusarium graminearum Resistance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fangfang Chen

    2018-01-01

    Full Text Available Fusarium head blight disease resulting from Fusarium graminearum (FG infection causes huge losses in global production of cereals and development of FG-resistant plants is urgently needed. To understand biochemistry mechanisms for FG resistance, here, we have systematically investigated the plant metabolomic phenotypes associated with FG resistance for transgenic Arabidopsis thaliana expressing a class-I chitinase (Chi, a Fusarium-specific recombinant antibody gene (CWP2 and fused Chi-CWP2. Plant disease indices, mycotoxin levels, metabonomic characteristics, and expression levels of several key genes were measured together with their correlations. We found that A. thaliana expressing Chi-CWP2 showed higher FG resistance with much lower disease indices and mycotoxin levels than the wild-type and the plants expressing Chi or CWP2 alone. The combined metabonomic and quantitative RT-PCR analyses revealed that such FG-resistance was closely associated with the promoted biosynthesis of secondary metabolites (phenylpropanoids, alkanoids and organic osmolytes (proline, betaine, glucose, myo-inositol together with enhanced TCA cycle and GABA shunt. These suggest that the concurrently enhanced biosyntheses of the shikimate-mediated secondary metabolites and organic osmolytes be an important strategy for A. thaliana to develop and improve FG resistance. These findings provide essential biochemical information related to FG resistance which is important for developing FG-resistant cereals.

  16. Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

    Science.gov (United States)

    Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

    2005-04-21

    Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

  17. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    International Nuclear Information System (INIS)

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang

    2005-01-01

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter

  18. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  19. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  20. Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

    Science.gov (United States)

    Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

    2017-01-01

    Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  2. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...

  3. Use of a custom RT-PCR array to analyze toxicity pathways at different life stages in Brown Norway Rat Brain following acute Toluene exposure.

    Science.gov (United States)

    To investigate the contribution of different life stages on response to toxicants, we utilized a custom designed RT-PCR array to examine the effects of acute exposure by oral gavage of the volatile organic solvent toluene (0.00, 0.65 or 1.0 glkg) in the brains of ma1e Brown Norwa...

  4. Establishment of a nanoparticle-assisted RT-PCR assay to distinguish field strains and attenuated strains of porcine epidemic diarrhea virus.

    Science.gov (United States)

    Zhu, Yu; Wang, Gui-Hua; Cui, Yu-Dong; Cui, Shang-Jin

    2016-09-01

    Porcine epidemic diarrhea virus (PEDV) can cause serious disease and even death in neonatal piglets, resulting in serious damage to the swine industry worldwide. Open reading frame 3 (ORF3) is the only accessory gene in the PEDV genome. Previous studies have indicated that PEDV vaccine strains have a partial deletion in ORF3. In this study, a nanoparticle-assisted polymerase chain reaction (nanoparticle-assisted RT-PCR) assay targeting the ORF3 of PEDV was developed to distinguish PEDV field strains from attenuated strains by using a specific pair of primers. The PCR products of field strains and attenuated strains were 264 bp and 215 bp in length, respectively. The sensitivity and specificity of this assay were also assessed. The nanoparticle-assisted RT-PCR assay was 10-100 times more sensitive than the conventional RT-PCR assay, with no cross-reactions when amplifying porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine parvovirus (PPV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine rotavirus (RV), and porcine transmissible gastroenteritis virus (TGEV). The nanoparticle-assisted RT-PCR assay we describe here can be used to distinguish field strains from vaccine strains of PEDV, and it shows promise for reducing economic loss due to PEDV infection.

  5. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  6. Development of a combined canine distemper virus specific RT-PCR protocol for the differentiation of infected and vaccinated animals (DIVA) and genetic characterization of the hemagglutinin gene of seven Chinese strains demonstrated in dogs.

    Science.gov (United States)

    Yi, Li; Cheng, Shipeng; Xu, Hongli; Wang, Jianke; Cheng, Yuening; Yang, Shen; Luo, Bin

    2012-01-01

    A combined reverse-transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of the canine distemper virus (CDV). A pair of primers (P1/P2) was used to detect both CDV wild-type strains and vaccines. Another pair (P3/P4) was used to detect only CDV wild-type strains. A 335bp fragment was amplified from the genomic RNA of the vaccine and wild-type strains. A 555bp fragment was amplified specifically from the genomic RNA of the wild-type strains. No amplification was achieved for the uninfected cells, cells infected with canine parvovirus, canine coronavirus, or canine adenovirus. The combined RT-PCR method detected effectively and differentiated the CDV wild-type and vaccine strains by two separate RT-PCRs. The method can be used for clinical detection and epidemiological surveillance. The phylogenetic analysis of the hemagglutinin gene of the local wild-type CDV strains revealed that the seven local isolates all belonged to the Asia-1 lineage, and were clustered closely with one another at the same location. These results suggested that the CDV genotype Asia-1 is circulating currently in domestic dogs in China. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Microarray-based identification and RT-PCR test screening for epithelial-specific mRNAs in peripheral blood of patients with colon cancer

    Directory of Open Access Journals (Sweden)

    Coppola Domenico

    2006-10-01

    Full Text Available Abstract Background The efficacy of screening for colorectal cancer using a simple blood-based assay for the detection of tumor cells disseminated in the circulation at an early stage of the disease is gaining positive feedback from several lines of research. This method seems able to reduce colorectal cancer mortality and may replace colonoscopy as the most effective means of detecting colonic lesions. Methods In this work, we present a new microarray-based high-throughput screening method to identifying candidate marker mRNAs for the early detection of epithelial cells diluted in peripheral blood cells. This method includes 1. direct comparison of different samples of colonic mucosa and of blood cells to identify consistent epithelial-specific mRNAs from among 20,000 cDNA assayed by microarray slides; 2. identification of candidate marker mRNAs by data analysis, which allowed selection of only 10 putative differentially expressed genes; 3. Selection of some of the most suitable mRNAs (TMEM69, RANBP3 and PRSS22 that were assayed in blood samples from normal subjects and patients with colon cancer as possible markers for the presence of epithelial cells in the blood, using reverse transcription – polymerase chain reaction (RT-PCR. Results Our present results seem to provide an indication, for the first time obtained by genome-scale screening, that a suitable and consistent colon epithelium mRNA marker may be difficult to identify. Conclusion The design of new approaches to identify such markers is warranted.

  9. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  10. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  11. Factor VIII (F8) inversions in severe hemophilia A: Male germ cell origin and diagnosis with RT-PCR

    Energy Technology Data Exchange (ETDEWEB)

    Antonarakis, S.E. [Geneva Medical School (Switzerland)]|[Johns Hopkins School of Medicine, Baltimore, MD (United States); Rossiter, J.P. [Johns Hopkins School of Medicine, Baltimore, MD (United States); Young, M. [Geneva Medical School (Switzerland)] [and others

    1994-09-01

    The Factor VIII (F8) gene, which is defective in hemophilia A, is located in the most telomeric megabase of Xq. Inversions due to intrachromosomal homologous recombination between mispaired copies of gene A located within intron 22 of the gene and about 500 kb telomeric to it account for nearly half of the cases of severe hemophilia A. We hypothesized that pairing of Xq with its homolog inhibits the inversion process, and that therefore the event originates predominantly in male germ cells. In all 21 informative cases in which the inversion originated in a maternal grandparent, DNA polymorphism analysis using markers within or very closely linked to F8, determined that it occurred in the male germline. In addition, all but one of 56 mothers of sporadic cases due to inversions were carriers. The data indicate that the F8 gene inversions leading to severe hemophilia A occur almost exclusively in male germ cells. The mean age of maternal grandfathers at the birth of their carrier daughters was 29.9 years (13 cases), i.e. not different from the mean paternal age in the general population, supporting the hypothesis that the inversions occur in meiosis. The inversions can be diagnosed by Southern blot analysis. For more rapid diagnosis we have used RT-PCR of RNA ectopically expressed in blood. Oligonucleotides were used to PCR amplify, after the initial RT reaction of RNA samples using random hexamers, either the normal transcript (F8 exons 21 to 24;312 bp product) or the novel abnormal transcript that is generated after the inversion. Both type 1 and 2 inversions can be recognized in affecteds and carriers by the presence of the diagnostic PcR product of 248 bp. Correct diagnoses were made in samples from 6 patients and 2 carriers with type 1 inversions, 2 patients and 2 carriers with type 2 inversions and 5 normal controls.

  12. Metabolic regulation analysis of an ethanologenic Escherichia coli strain based on RT-PCR and enzymatic activities

    Directory of Open Access Journals (Sweden)

    Martinez Alfredo

    2008-05-01

    Full Text Available Abstract Background A metabolic regulation study was performed, based upon measurements of enzymatic activities, fermentation performance, and RT-PCR analysis of pathways related to central carbon metabolism, in an ethanologenic Escherichia coli strain (CCE14 derived from lineage C. In comparison with previous engineered strains, this E coli derivative has a higher ethanol production rate in mineral medium, as a result of the elevated heterologous expression of the chromosomally integrated genes encoding PDCZm and ADHZm (pyruvate decarboxylase and alcohol dehydrogenase from Zymomonas mobilis. It is suggested that this behavior might be due to lineage differences between E. coli W and C. Results This study demonstrated that the glycolytic flux is controlled, in this case, by reactions outside glycolysis, i.e., the fermentative pathways. Changes in ethanol production rate in this ethanologenic strain result in low organic acid production rates, and high glycolytic and ethanologenic fluxes, that correlate with enhanced transcription and enzymatic activity levels of PDCZm and ADHZm. Furthermore, a higher ethanol yield (90% of the theoretical in glucose-mineral media was obtained with CCE14 in comparison with previous engineered E. coli strains, such as KO11, that produces a 70% yield under the same conditions. Conclusion Results suggest that a higher ethanol formation rate, caused by ahigher PDCZm and ADHZm activities induces a metabolic state that cells compensate through enhanced glucose transport, ATP synthesis, and NAD-NADH+H turnover rates. These results show that glycolytic enzymatic activities, present in E. coli W and C under fermentative conditions, are sufficient to contend with increases in glucose consumption and product formation rates.

  13. SPAM1 (PH-20 protein and mRNA expression in the epididymides of humans and macaques: utilizing laser microdissection/RT-PCR

    Directory of Open Access Journals (Sweden)

    Zhang Hong

    2003-08-01

    Full Text Available Abstract Background The Sperm Adhesion Molecule 1 (SPAM1 is an important sperm surface hyaluronidase with at least three functions in mammalian fertilization. Previously our laboratory reported that in the mouse, in addition to its expression in the testis, Spam1 is synthesized in the epididymis where it is found in membranous vesicles in the principal cells of the epithelium in all three regions. Since SPAM1 is widely conserved among mammals the aim of the study was to determine if its expression pattern in the epididymis is conserved in rodents and primates. Methods We used laser microdissection (LM/RT-PCR on frozen and paraffin-embedded epididymal sections of humans (n = 3 and macaques (n = 2 as well as in situ transcript hybridization to determine if transcripts are present in the epididymal epithelium. Western analysis and immunohistochemistry were used to detect and confirm the protein expression, and hyaluronic acid substrate gel electrophoresis analyzed its hyaluronidase activity. An in silico analysis of the proximal promoter of SPAM1 was also performed to identify relevant putative transcription binding sites for the androgen receptor. Results We demonstrate that mRNA unique to SPAM1 is present in the principal cells of the epididymal epithelium in all individuals of both species studied. SPAM1 protein is present in all three regions of the epididymis, as well as the vas deferens, and is localized similarly to the transcripts. SPAM1 was shown to have hyaluronidase activity at pH 7.0. In the proximal promoter of SPAM1 were uncovered putative epididymal transcription factor binding sites including androgen receptor elements (AREs, consistent with epididymal expression. Conclusions These findings allow us to conclude that epididymal SPAM1 is conserved in at least two mammalian classes, rodents and primates. This conservation of expression suggests that the protein is likely to play an important function, possibly in sperm maturation.

  14. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions.

    Directory of Open Access Journals (Sweden)

    Dung Tien Le

    Full Text Available Quantitative RT-PCR can be a very sensitive and powerful technique for measuring differential gene expression. Changes in gene expression induced by abiotic stresses are complex and multifaceted, which make determining stably expressed genes for data normalization difficult. To identify the most suitable reference genes for abiotic stress studies in soybean, 13 candidate genes collected from literature were evaluated for stability of expression under dehydration, high salinity, cold and ABA (abscisic acid treatments using delta CT and geNorm approaches. Validation of reference genes indicated that the best reference genes are tissue- and stress-dependent. With respect to dehydration treatment, the Fbox/ABC, Fbox/60s gene pairs were found to have the highest expression stability in the root and shoot tissues of soybean seedlings, respectively. Fbox and 60s genes are the most suitable reference genes across dehydrated root and shoot tissues. Under salt stress the ELF1b/IDE and Fbox/ELF1b are the most stably expressed gene pairs in roots and shoots, respectively, while 60s/Fbox is the best gene pair in both tissues. For studying cold stress in roots or shoots, IDE/60s and Fbox/Act27 are good reference gene pairs, respectively. With regard to gene expression analysis under ABA treatment in either roots, shoots or across these tissues, 60s/ELF1b, ELF1b/Fbox and 60s/ELF1b are the most suitable reference genes, respectively. The expression of ELF1b/60s, 60s/Fbox and 60s/Fbox genes was most stable in roots, shoots and both tissues, respectively, under various stresses studied. Among the genes tested, 60s was found to be the best reference gene in different tissues and under various stress conditions. The highly ranked reference genes identified from this study were proved to be capable of detecting subtle differences in expression rates that otherwise would be missed if a less stable reference gene was used.

  15. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  17. Microfluidic platform for multiplexed detection in single cells and methods thereof

    Science.gov (United States)

    Wu, Meiye; Singh, Anup K.

    2018-05-01

    The present invention relates to a microfluidic device and platform configured to conduct multiplexed analysis within the device. In particular, the device allows multiple targets to be detected on a single-cell level. Also provided are methods of performing multiplexed analyses to detect one or more target nucleic acids, proteins, and post-translational modifications.

  18. Diagnóstico temprano en un brote epidémico del virus Dengue en Piura usando RT-PCR y nested-PCR

    Directory of Open Access Journals (Sweden)

    Oscar Nolasco

    1997-07-01

    Full Text Available Un test de diagnóstico temprano (RT-PCR y Nested-PCR fue evaluado y comparado con métodos convencionales (cultivo in vitro, IFI y MAC-ELISA. Treinta y cuatro sueros de pacientes correspondientes de un brote epidémico de la costa norte peruana (Mancora, Piura en mayo de 1997 fueron incluidos en este estudio. Todos los sueros fueron obtenidos de pacientes que presentaron en los primeros cinco días manifestaciones clínicas siendo diagnosticados luego como dengue serotipo 1. Asimismo, RT-PCR permitió diagnosticar 82% de los sueros (28/34, sin embargo Mac-ELISA y cultivo in vitro reconocieron unicamente 41% de los sueros (14/34 y 38% de los sueros (13/34 respectivamente. Por lo tanto, el uso de esta herramienta molecular (RT-PCR y Nested-PCR permitiró dar un diagnóstico temprano a estos pacientes y actuar inmediatamente ante la presencia de un brote epidémico.

  19. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  20. Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    Directory of Open Access Journals (Sweden)

    C.M.S. Gebara

    2004-08-01

    Full Text Available A presença do vírus da cinomose canina (CDV foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR, em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1% das 87 amostras de urina provenientes de cães com sinais clínicos sugestivos de cinomose. Todas as amostras obtidas de animais assintomáticos foram negativas na RT-PCR. Amostras positivas foram encontradas nos três grupos de animais com sinais clínicos na proporção de 51,2% (24/41, 29% (11/37 e 100% (9/9 para os grupos A, B e C, respectivamente. A leucocitose foi a alteração hematológica mais freqüente nos três grupos de cães com sinais clínicos porém, não foi possível estabelecer correlação entre o resultado da RT-PCR e as alterações hematológicas. Os resultados demonstraram que, independente da forma de apresentação clínica, a técnica da RT-PCR realizada em urina pode ser utilizada no diagnóstico ante mortem da infecção pelo CDV.The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control included 20 assymptomatic dogs. A chi2

  1. An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    Directory of Open Access Journals (Sweden)

    Miyazawa Takayuki

    2010-12-01

    Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.

  2. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  3. Detection of circulating tumor cells with CK20 RT-PCR is an independent negative prognostic marker in colon cancer patients - a prospective study.

    Science.gov (United States)

    Hinz, Sebastian; Hendricks, Alexander; Wittig, Amke; Schafmayer, Clemens; Tepel, Jürgen; Kalthoff, Holger; Becker, Thomas; Röder, Christian

    2017-01-13

    Detection of circulating (CTC) or disseminated tumor cells (DTC) has been associated with negative prognosis and outcome in patients with colorectal cancer, though testing for these cells is not yet part of clinical routine. There are several different methodological approaches to detect tumor cells but standardized detection assays are not implemented so far. In this prospective monocentric study 299 patients with colon cancer were included. CTC and DTC were detected using CK20 RT-PCR as well as immunocytochemistry staining with anti-pan-keratin and anti-EpCAM antibodies. The primary endpoints were: Evaluation of CTC and DTC at the time of surgery and correlation with main tumor characteristics and overall (OS) and disease free survival (DFS). Patients with detectable CTC had a 5-year OS rate of 68% compared to a 5-year OS rate of 85% in patients without detectable CTC in the blood (p = 0.002). Detection of DTC in the bone marrow with CK20 RT-PCR was not associated with a worse OS or DFS. Detection of pan-cytokeratin positive DTC in the bone marrow correlated with a significantly reduced 5-year OS rate (p = 0.048), but detection of DTC in the bone marrow with the anti-EpCAM antibody did not significantly influence the 5-year OS rate (p = 0.958). By multivariate analyses only detection of CTC with CK20 RT-PCR in the blood was revealed to be an independent predictor of worse OS (HR1.94; 95% CI 1.0-3.7; p = 0.04) and DFS (HR 1.94; 95% CI 1.1-3.7; p = 0.044). Detection of CTC with CK20 RT-PCR is a highly specific and independent prognostic marker in colon cancer patients. Detection of DTC in the bone marrow with CK20 RT-PCR or immunohistochemistry with anti-EpCAM antibody is not associated with a negative prognostic influence.

  4. Method 1615 measurment of Enterovirus and Norovirus occurrence in water by culture and qRT-PCR

    Science.gov (United States)

    Viruses that may be present in environmental or finished drinking waters are concentrated from passage through electropositive filters. Viruses are eluted from the filters with a beef extract reagent and concentrated using organic flocculation. A portion of the concentrated eluate is then inoculated...

  5. Real-world comparison of two molecular methods for detection of respiratory viruses

    Directory of Open Access Journals (Sweden)

    Miller E Kathryn

    2011-06-01

    Full Text Available Abstract Background Molecular polymerase chain reaction (PCR based assays are increasingly used to diagnose viral respiratory infections and conduct epidemiology studies. Molecular assays have generally been evaluated by comparing them to conventional direct fluorescent antibody (DFA or viral culture techniques, with few published direct comparisons between molecular methods or between institutions. We sought to perform a real-world comparison of two molecular respiratory viral diagnostic methods between two experienced respiratory virus research laboratories. Methods We tested nasal and throat swab specimens obtained from 225 infants with respiratory illness for 11 common respiratory viruses using both a multiplex assay (Respiratory MultiCode-PLx Assay [RMA] and individual real-time RT-PCR (RT-rtPCR. Results Both assays detected viruses in more than 70% of specimens, but there was discordance. The RMA assay detected significantly more human metapneumovirus (HMPV and respiratory syncytial virus (RSV, while RT-rtPCR detected significantly more influenza A. We speculated that primer differences accounted for these discrepancies and redesigned the primers and probes for influenza A in the RMA assay, and for HMPV and RSV in the RT-rtPCR assay. The tests were then repeated and again compared. The new primers led to improved detection of HMPV and RSV by RT-rtPCR assay, but the RMA assay remained similar in terms of influenza detection. Conclusions Given the absence of a gold standard, clinical and research laboratories should regularly correlate the results of molecular assays with other PCR based assays, other laboratories, and with standard virologic methods to ensure consistency and accuracy.

  6. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  7. RT-PCR Analysis of ED-A,ED-B, and IIICS Fibronectin Domains: A New Screening Marker For Bladder Cancer

    Directory of Open Access Journals (Sweden)

    M Ahmadi Javid

    2004-12-01

    Full Text Available Background: Fibronectin seems to play a very important role in the progression and invasion of bladder cancer. EDA, EDB, and IIICS domains of fibronectin are not expressed in the adult persons but they’re expressed in different cancers. The aim of this study is to investigate the mRNA of fibronectin in transitional carcinoma cells (TCC of bladder to study these domains. Methods: A total of 20 patients with known bladder cancer were studied. Two of them excluded since their excised tissues were not enough for both the pathological examination and RNA study. Another 20 (control group were normal volunteers who needed bladder operations. The excised tissue was immediately transferred to RNAlater (Ambion,TX. RNA was extracted via RNAWIZ (Ambion, TX. cDNA was made via RevertAid First Strand cDNA Synthesis Kit (Fermentas. PCR of the cDNAs was performed using primers for EDA, EDB, and IIICS (Eurogentec,Belgium. Results: For the first time, we present the expression of the oncofetal fibronectin mRNA in the transitional cell carcinoma of bladder. The high grade muscle invasive (G3T2 tumor, expressed ED-A, ED-B, and IIICS. Expression of ED-A, ED-B, and IIICS was confirmed in the two patients with G3T1 TCC. The four patients with G2Ta and G3Ta expressed both ED-A and ED-B. The four patients with G1T1 tumor expressed ED-A only, similar to the nine patients with G1Ta tumor. None of the normal volunteers expressed the oncofetal extra domains. The sensitivity of ED-A positive fibronectin RNA for detecting TCC of any kind is 100%, and of ED-B was only 35%. The specificity of ED-B positive fibronectin RNA for the high grade TCC is 100%. Conclusion: ED-A, ED-B, and IIICS could be used as useful markers for the diagnosis and following up of bladder carcinoma. Keywords: Transitional Cell Carcinoma, bladder cancer, fibronectin, RT-PCR, oncofetal.

  8. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

    Science.gov (United States)

    Majumder, S; Baranwal, V K

    2014-06-01

    Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  10. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Directory of Open Access Journals (Sweden)

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  11. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  12. A family-wide RT-PCR assay for detection of paramyxoviruses and application to a large-scale surveillance study.

    Directory of Open Access Journals (Sweden)

    Sander van Boheemen

    Full Text Available Family-wide molecular diagnostic assays are valuable tools for initial identification of viruses during outbreaks and to limit costs of surveillance studies. Recent discoveries of paramyxoviruses have called for such assay that is able to detect all known and unknown paramyxoviruses in one round of PCR amplification. We have developed a RT-PCR assay consisting of a single degenerate primer set, able to detect all members of the Paramyxoviridae family including all virus genera within the subfamilies Paramyxovirinae and Pneumovirinae. Primers anneal to domain III of the polymerase gene, with the 3' end of the reverse primer annealing to the conserved motif GDNQ, which is proposed to be the active site for nucleotide polymerization. The assay was fully optimized and was shown to indeed detect all available paramyxoviruses tested. Clinical specimens from hospitalized patients that tested positive for known paramyxoviruses in conventional assays were also detected with the novel family-wide test. A high-throughput fluorescence-based RT-PCR version of the assay was developed for screening large numbers of specimens. A large number of samples collected from wild birds was tested, resulting in the detection of avian paramyxoviruses type 1 in both barnacle and white-fronted geese, and type 8 in barnacle geese. Avian metapneumovirus type C was found for the first time in Europe in mallards, greylag geese and common gulls. The single round family-wide RT-PCR assay described here is a useful tool for the detection of known and unknown paramyxoviruses, and screening of large sample collections from humans and animals.

  13. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  14. Immunocapture RT-PCR detection of Bean common mosaic virus and strain blackeye cowpea mosaic in common bean and black gram in India

    DEFF Research Database (Denmark)

    Udayashankar, A.C.; Nayaka, S. Chandra; Niranjana, S.R.

    2012-01-01

    The strains of Bean common mosaic virus (BCMV) and blackeye cowpea mosaic (BICM), genus Potyvirus, were detected from 25 common bean and 14 black gram seeds among 142 seed samples collected from different legume-growing regions of India. The samples were subjected to a growing-on test, an indicator...... plant test, an electron microscopic observations, an enzyme linked immunosorbent assay and an immunocapture RT-PCR. The incidence of the two tested viruses in common bean and black gram seed samples was 1–6% and 0.5–3.5%, respectively in growing-on test evaluations. Electron microscopic observations...

  15. Novel Molecular Beacon Probe-Based Real-Time RT-PCR Assay for Diagnosis of Crimean-Congo Hemorrhagic Fever Encountered in India

    Directory of Open Access Journals (Sweden)

    Aman Kamboj

    2014-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging zoonotic disease in India and requires immediate detection of infection both for preventing further transmission and for controlling the infection. The present study describes development, optimization, and evaluation of a novel molecular beacon-based real-time RT-PCR assay for rapid, sensitive, and specific diagnosis of Crimean-Congo hemorrhagic fever virus (CCHFV. The developed assay was found to be a better alternative to the reported TaqMan assay for routine diagnosis of CCHF.

  16. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets.

    Science.gov (United States)

    Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui

    2018-01-01

    Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to

  17. Detección y cuantificación del Potato mop-top virus (PMTV en Colombia mediante qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nevar García Bastidas

    2013-04-01

    Full Text Available El Potato mop-top virus (PMTV es uno de los virus re-emergentes en cultivos de papa en Colombia. Es transmitido por Spongospora subterranea, el agente causal de la sarna polvosa. La detección del PMTV presenta dificultades debido a su distribución irregular en las plantas, bajo título y movimiento sistémico como ARN desnudo. Con el fin de ampliar el rango de herramientas disponibles para detectar el PMTV en los programas de certificación de tubérculo-semilla, en este estudio se evaluó la prueba de RT-PCR en tiempo real (qRT-PCR en dos pasos: con los cebadores PMTV-1948F/PMTV-2017R y la sonda Taqman® PMTV-1970, dirigidos al gen CP-RT del ARN2 viral. Se construyó una curva estándar a partir de la transcripción in vitro de un fragmento de 1513 pb de este gen. Posteriormente, se evaluó la utilidad de la técnica a partir de tres tipos de muestras: plantas señuelo de Nicotiana benthamiana y Solanum phureja inoculadas con quistosoros de Sss, raíces de papa con síntomas de sarna polvosa del municipio de La Unión (Antioquia y tubérculos-semilla. Mediante qRT-PCR fue posible detectar el virus en 11 de las 20 muestras de raíz de plantas señuelo, mientras que 14 de las 15 muestras de raíces de papa resultaron positivas, estimándose una concentración entre 4.72 x 10(11 y 7.60 x 10(13 partículas virales/µl. Adicionalmente, en el ensayo de tubérculo-semilla se determinó la presencia del PMTV en una de las 16 muestras. Estos resultados indican la viabilidad de utilizar rutinariamente la técnica de qRT-PCR para la detección de PMTV en Colombia.

  18. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    Science.gov (United States)

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-06-01

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

  19. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  20. Pandemic preparedness in Hawaii: a multicenter verification of real-time RT-PCR for the direct detection of influenza virus types A and B.

    Science.gov (United States)

    Whelen, A Christian; Bankowski, Matthew J; Furuya, Glenn; Honda, Stacey; Ueki, Robert; Chan, Amelia; Higa, Karen; Kumashiro, Diane; Moore, Nathaniel; Lee, Roland; Koyamatsu, Terrie; Effler, Paul V

    2010-01-01

    We integrated multicenter, real-time (RTi) reverse transcription polymerase chain reaction (RT-PCR) screening into a statewide laboratory algorithm for influenza surveillance and response. Each of three sites developed its own testing strategy and was challenged with one randomized and blinded panel of 50 specimens previously tested for respiratory viruses. Following testing, each participating laboratory reported its results to the Hawaii State Department of Health, State Laboratories Division for evaluation and possible discrepant analysis. Two of three laboratories reported a 100% sensitivity and specificity, resulting in a 100% positive predictive value and a 100% negative predictive value (NPV) for influenza type A. The third laboratory showed a 71% sensitivity for influenza type A (83% NPV) with 100% specificity. All three laboratories were 100% sensitive and specific for the detection of influenza type B. Discrepant analysis indicated that the lack of sensitivity experienced by the third laboratory may have been due to the analyte-specific reagent probe used by that laboratory. Use of a newer version of the product with a secondary panel of 20 specimens resulted in a sensitivity and specificity of 100%. All three laboratories successfully verified their ability to conduct clinical testing for influenza using diverse nucleic acid extraction and RTi RT-PCR platforms. Successful completion of the verification by all collaborating laboratories paved the way for the integration of those facilities into a statewide laboratory algorithm for influenza surveillance and response.

  1. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  2. Are PEI-coated SWCNTs conjugated with hepatitis A virus? A chemical study with SEM, Z-potential, EDXD and RT-PCR

    International Nuclear Information System (INIS)

    Carbone, M; Valentini, F; Palleschi, G; Caminiti, R; Petrinca, A R; Donia, D; Divizia, M

    2010-01-01

    The conjugation between nanotubes, coated with different doses of polyethylene imine (PEI) and hepatitis A virus (HAV) was investigated by scanning electron microscopy, Z-potential, thermogravimetric and differential thermal analysis, transmission electron microscopy, energy dispersive x-ray diffraction (EDXD) and reverse transcript polymerase chain reaction (RT-PCR). For the first time, to our knowledge, evidence is obtained that conjugation between the nanotubes and the HAV occurs and that it has an (at least a partial) electrostatic character. Since all components of the conjugated systems, nanotubes, coating material and virus are characterized by different peak shapes in the selected q range, it was possible to infer that conjugation occurred. RT-PCR measurements confirmed that the conjugation of the coated nanotubes and HAV occurred and the result was stable. This opens up the prospect of probing the coated nanotubes as intra-cellular carriers in transfection processes of the virus. Further biological applications will concern a possible vaccine especially for non-replicative viruses.

  3. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM) analysis.

    Science.gov (United States)

    Hanson, Erin K; Ballantyne, Jack

    2013-01-01

    Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA) profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE) or quantitative RT-PCR (qRT-PCR) platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM) assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions), IL1F7 (skin), ALAS2 (blood), MMP10 (menstrual blood), HTN3 (saliva) and TGM4 (semen).  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green). Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively inexpensive

  4. Epidemiological, clinical and laboratory profile of scrub typhus cases detected by serology and RT-PCR in Kumaon, Uttarakhand: a hospital-based study.

    Science.gov (United States)

    Rawat, Vinita; Singh, Rajesh Kumar; Kumar, Ashok; Saxena, Sandip R; Varshney, Umesh; Kumar, Mukesh

    2018-04-01

    We analysed the epidemiology, clinical and laboratory data of the 168 scrub typhus cases confirmed by a combination of any one of the following: real time polymerase chain reaction (RT-PCR) and/or immunofluorescence assay (IFA) (IgM and/or IgG). The peak season for scrub typhus was from July to October. By multivariate binary logistic regression analysis, the risk of scrub typhus was about four times in those working in occupation related to forest work. Major clinical manifestations were fever (100%), myalgia (65%), cough (51%) and vomiting (46%); major complications were meningitis/meningoencephatilitis (12.5%) and multi-organ failure (MOF) and pneumonia (5.3% each). Laboratory investigations revealed raised aminotranferase levels and thrombocytopenia in most confirmed cases. We conclude that scrub typhus is an important cause of febrile illness in the Kumaon hills of Uttarakhand where this disease had not previously been considered to exist.

  5. Detection and confirmation of PPR virus antigen in sheep and goats by sandwich-ELISA and RT-PCR in Andhra Pradesh, India

    Directory of Open Access Journals (Sweden)

    G. Saritha

    2015-06-01

    Full Text Available Peste des petits ruminants (PPR is a highly contagious disease of domestic and wild small ruminants. Rapid and accurate laboratory assay are essential to enable the implementation of appropriate control strategies to restrict the spread of PPR. The present study was designed to detect the PPR virus (PPRV antigen (N-gene in nasal swabs and tissue samples. A total of 195 samples comprising of 138 nasal swabs from PPR suspected sheep (n=72 and goats (n=66, and 57 tissue samples comprising of lymph nodes from dead sheep (n=39 and goats (n=18 were collected from certain parts of Andhra Pradesh. The samples were subjected to sandwich-ELISA followed by RT-PCR for confirmatory diagnosis. In this study, PPRV could be detected in 27.53% (n=38/138 nasal swabs and 49.12% (n=28/57 tissue samples. Data showed that PPRV infection is widespread in the Andhra Pradesh, India.

  6. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  7. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy

    Directory of Open Access Journals (Sweden)

    Jing Cao

    2016-02-01

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (qRT-PCR is a powerful analytical technique for the measurement of gene expression, which depends on the stability of the reference gene used for data normalization. Suaeda aralocaspica, an annual halophyte with heteromorphic seeds and possessing C4 photosynthesis pathway without Kranz anatomy, is an ideal plant species to identify stress tolerance-related genes and compare relative expression at transcriptional level. So far, no molecular information is available for this species. In the present study, six traditionally used reference genes were selected and their expression stability in two types of seeds of S. aralocaspica under different experimental conditions was evaluated. Three analytical programs, geNorm, NormFinder and BestKeeper, were used to assess and rank the stability of reference gene expression. Results revealed that although some reference genes may display different transcriptional profiles between the two types of seeds, β-TUB and GAPDH appeared to be the most suitable references under different developmental stages and tissues. GAPDH was the appropriate reference gene under different germination time points and salt stress conditions, and ACTIN was suitable for various abiotic stress treatments for the two types of seeds. For all the sample pools, β-TUB served as the most stable reference gene, whereas 18S rRNA and 28S rRNA performed poorly and presented as the least stable genes in our study. UBQ seemed to be unsuitable as internal control under different salt treatments. In addition, the expression of a photosynthesis-related gene (PPDK of C4 pathway and a salt tolerance-related gene (SAT of S. aralocaspica were used to validate the best performance reference genes. This is the first systematic comparison of reference gene selection for qRT-PCR work in S. aralocaspica and these data will facilitate further studies on gene expression in this species

  8. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  9. Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome.

    Science.gov (United States)

    Shen, Haoran; Liang, Zhou; Zheng, Saihua; Li, Xuelian

    2017-11-01

    The purpose of this study was to identify promising candidate genes and pathways in polycystic ovary syndrome (PCOS). Microarray dataset GSE345269 obtained from the Gene Expression Omnibus database includes 7 granulosa cell samples from PCOS patients, and 3 normal granulosa cell samples. Differentially expressed genes (DEGs) were screened between PCOS and normal samples. Pathway enrichment analysis was conducted for DEGs using ClueGO and CluePedia plugin of Cytoscape. A Reactome functional interaction (FI) network of the DEGs was built using ReactomeFIViz, and then network modules were extracted, followed by pathway enrichment analysis for the modules. Expression of DEGs in granulosa cell samples was measured using quantitative RT-PCR. A total of 674 DEGs were retained, which were significantly enriched with inflammation and immune-related pathways. Eight modules were extracted from the Reactome FI network. Pathway enrichment analysis revealed significant pathways of each module: module 0, Regulation of RhoA activity and Signaling by Rho GTPases pathways shared ARHGAP4 and ARHGAP9; module 2, GlycoProtein VI-mediated activation cascade pathway was enriched with RHOG; module 3, Thromboxane A2 receptor signaling, Chemokine signaling pathway, CXCR4-mediated signaling events pathways were enriched with LYN, the hub gene of module 3. Results of RT-PCR confirmed the finding of the bioinformatic analysis that ARHGAP4, ARHGAP9, RHOG and LYN were significantly upregulated in PCOS. RhoA-related pathways, GlycoProtein VI-mediated activation cascade pathway, ARHGAP4, ARHGAP9, RHOG and LYN may be involved in the pathogenesis of PCOS.

  10. A laser ablation ICP-MS based method for multiplexed immunoblot analysis

    DEFF Research Database (Denmark)

    de Bang, Thomas Christian; Petersen, Jørgen; Pedas, Pai Rosager

    2015-01-01

    developed a multiplexed antibody-based assay and analysed selected PSII subunits in barley (Hordeum vulgare L.). A selection of antibodies were labelled with specific lanthanides and immunoreacted with thylakoids exposed to Mn deficiency after western blotting. Subsequently, western blot membranes were...... analysed by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), which allowed selective and relative quantitative analysis via the different lanthanides. The method was evaluated against established liquid chromatography electrospray ionization tandem mass spectrometry (LC...... by more than one technique. The developed method enables a higher number of proteins to be multiplexed in comparison to existing immunoassays. Furthermore, multiplexed protein analysis by LA-ICP-MS provides an analytical platform with high throughput appropriate for screening large collections of plants....

  11. 78 FR 16513 - Application of Advances in Nucleic Acid and Protein Based Detection Methods to Multiplex...

    Science.gov (United States)

    2013-03-15

    ... Methods to Multiplex Detection of Transfusion- Transmissible Agents and Blood Cell Antigens in Blood... Transfusion-Transmissible Agents and Blood Cell Antigens in Blood Donations; Public Workshop AGENCY: Food and... technological advances in gene based and protein based pathogen and blood cell antigen detection methods and to...

  12. Multisegment one-step RT-PCR fluorescent labeling of influenza A virus genome for use in diagnostic microarray applications

    Energy Technology Data Exchange (ETDEWEB)

    Vasin, A V; Plotnikova, M A; Klotchenko, S A; Elpaeva, E A; Komissarov, A B; Egorov, V V; Kiselev, O I [Research Institute of Influenza of the Ministry of Health and Social Development of the Russian Federation, 15/17 Prof. Popova St., St. Petersburg (Russian Federation); Sandybaev, N T; Chervyakova, O V; Strochkov, V M; Taylakova, E T; Koshemetov, J K; Mamadaliev, S M, E-mail: vasin@influenza.spb.ru [Research Institute for Biological Safety Problems of the RK NBC/SC ME and S RK, Gvardeiskiy (Kazakhstan)

    2011-04-01

    Microarray technology is one of the most challenging methods of influenza A virus subtyping, which is based on the antigenic properties of viral surface glycoproteins - hemagglutinin and neuraminidase. On the example of biochip for detection of influenza A/H5N1 virus we showed the possibility of using multisegment RTPCR method for amplification of fluorescently labeled cDNA of all possible influenza A virus subtypes with a single pair of primers in influenza diagnostic microarrays.

  13. Galectin-3 and Beclin1/Atg6 genes in human cancers: using cDNA tissue panel, qRT-PCR, and logistic regression model to identify cancer cell biomarkers.

    Directory of Open Access Journals (Sweden)

    Halliday A Idikio

    Full Text Available Cancer biomarkers are sought to support cancer diagnosis, predict cancer patient response to treatment and survival. Identifying reliable biomarkers for predicting cancer treatment response needs understanding of all aspects of cancer cell death and survival. Galectin-3 and Beclin1 are involved in two coordinated pathways of programmed cell death, apoptosis and autophagy and are linked to necroptosis/necrosis. The aim of the study was to quantify galectin-3 and Beclin1 mRNA in human cancer tissue cDNA panels and determine their utility as biomarkers of cancer cell survival.A panel of 96 cDNAs from eight (8 different normal and cancer tissue types were used for quantitative real-time polymerase chain reaction (qRT-PCR using ABI7900HT. Miner2.0, a web-based 4- and 3-parameter logistic regression software was used to derive individual well polymerase chain reaction efficiencies (E and cycle threshold (Ct values. Miner software derived formula was used to calculate mRNA levels and then fold changes. The ratios of cancer to normal tissue levels of galectin-3 and Beclin1 were calculated (using the mean for each tissue type. Relative mRNA expressions for galectin-3 were higher than for Beclin1 in all tissue (normal and cancer types. In cancer tissues, breast, kidney, thyroid and prostate had the highest galectin-3 mRNA levels compared to normal tissues. High levels of Beclin1 mRNA levels were in liver and prostate cancers when compared to normal tissues. Breast, kidney and thyroid cancers had high galectin-3 levels and low Beclin1 levels.Galectin-3 expression patterns in normal and cancer tissues support its reported roles in human cancer. Beclin1 expression pattern supports its roles in cancer cell survival and in treatment response. qRT-PCR analysis method used may enable high throughput studies to generate molecular biomarker sets for diagnosis and predicting cancer treatment response.

  14. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    Science.gov (United States)

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  15. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  16. Use of proteinase K for RT-PCR of cytokine mRNA in formalin fixed tissue

    DEFF Research Database (Denmark)

    Davies, G N; Bevan, I S; Banner, Jytte

    1996-01-01

    Fresh tissue from cases of sudden infant death syndrome is becoming increasingly scarce and therefore researchers interesting in studying the aetiology of this syndrome have had to resort to archival tissue, usually in the form of paraffin wax sections. A simple method for isolating mRNA from for...

  17. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  18. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

    Science.gov (United States)

    Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

  19. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  20. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world....

  1. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  2. In vitro and in vivo MMP gene expression localisation by In Situ-RT-PCR in cell culture and paraffin embedded human breast cancer cell line xenografts

    International Nuclear Information System (INIS)

    Haupt, Larisa M; Thompson, Erik W; Trezise, Ann EO; Irving, Rachel E; Irving, Michael G; Griffiths, Lyn R

    2006-01-01

    Members of the matrix metalloproteinase (MMP) family of proteases are required for the degradation of the basement membrane and extracellular matrix in both normal and pathological conditions. In vitro, MT1-MMP (MMP-14, membrane type-1-MMP) expression is higher in more invasive human breast cancer (HBC) cell lines, whilst in vivo its expression has been associated with the stroma surrounding breast tumours. MMP-1 (interstitial collagenase) has been associated with MDA-MB-231 invasion in vitro, while MMP-3 (stromelysin-1) has been localised around invasive cells of breast tumours in vivo. As MMPs are not stored intracellularly, the ability to localise their expression to their cells of origin is difficult. We utilised the unique in situ-reverse transcription-polymerase chain reaction (IS-RT-PCR) methodology to localise the in vitro and in vivo gene expression of MT1-MMP, MMP-1 and MMP-3 in human breast cancer. In vitro, MMP induction was examined in the MDA-MB-231 and MCF-7 HBC cell lines following exposure to Concanavalin A (Con A). In vivo, we examined their expression in archival paraffin embedded xenografts derived from a range of HBC cell lines of varied invasive and metastatic potential. Mouse xenografts are heterogenous, containing neoplastic human parenchyma with mouse stroma and vasculature and provide a reproducible in vivo model system correlated to the human disease state. In vitro, exposure to Con A increased MT1-MMP gene expression in MDA-MB-231 cells and decreased MT1-MMP gene expression in MCF-7 cells. MMP-1 and MMP-3 gene expression remained unchanged in both cell lines. In vivo, stromal cells recruited into each xenograft demonstrated differences in localised levels of MMP gene expression. Specifically, MDA-MB-231, MDA-MB-435 and Hs578T HBC cell lines are able to influence MMP gene expression in the surrounding stroma. We have demonstrated the applicability and sensitivity of IS-RT-PCR for the examination of MMP gene expression both in vitro and in

  3. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  4. Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2007-06-01

    Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

  5. DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

    Directory of Open Access Journals (Sweden)

    Bukina Y.V.

    2016-06-01

    Full Text Available Introduction. The problem of formation of bacterial resistance to glycopeptides and beta-lactam antibiotics (cephalosporins and carbapenems are used worldwide for the treatment of severe community acquired and nosocomial infections, especially caused by polymicrobial flora has become global and is a major factor limiting the effectiveness of antibiotic therapy. In this regard, the study of genetic microbial resistance determinants allows not only to carry out an effective antibiotic therapy, but also to identify two main processes leading to the development of epidemiologically significant events: the introduction of the agent in the risk population from the outside and in situ pathogen (spontaneous genetic drift targeted restructuring of the population. Therefore, the aim of our study was to investigate the resistance genes to carbapenems, cephalosporins, glycopeptides have clinically important phenotype of resistant strains of microorganisms families Enterobacteriaceae, Pseudomonadaceae, Bacteroidaceae, Enterococcaceae, Peptostreptococcaceae. Materials and methods. As a material for PCR studies 712 phenotypically resistant strains of microorganisms isolated from 80 rats "Wistar" line in microbiological study microflora of the wall were used. During the investigation 474 isolates of bacteria of the family Enterobacteriaceae, 39 - Pseudomonadaceae, 71 - Bacteroidaceae, 96 - Enterococcaceae, 32 - Peptostreptococcaceae were studied. Isolation of DNA from bacteria in the study was performed using reagents "DNA-Express" ("Litekh", Russia. For the detection of resistance genes by PCR in real time (RT-PCR reagent kits "FLUOROPOL-RV" ("Litekh", Russia were used. During the experiment, the VIM genes, OXA-48, NDM, KPC, responsible for the resistance of microorganisms to carbapenems, CTX-M - resistance to cephalosporins, as well as genes Van A and van B, the development of resistance to glycopeptides (vancomycin and teicoplanin were determined. Analysis

  6. Reference Gene Selection for qRT-PCR Normalization Analysis in kenaf (Hibiscus cannabinus L. under Abiotic Stress and Hormonal Stimuli

    Directory of Open Access Journals (Sweden)

    Xiaoping Niu

    2017-05-01

    Full Text Available Kenaf (Hibiscus cannabinus L., an environmental friendly and economic fiber crop, has a certain tolerance to abiotic stresses. Identification of reliable reference genes for transcript normalization of stress responsive genes expression by quantitative real-time PCR (qRT-PCR is important for exploring the molecular mechanisms of plants response to abiotic stresses. In this study, nine candidate reference genes were cloned, and their expression stabilities were assessed in 132 abiotic stress and hormonal stimuli samples of kenaf using geNorm, NormFinder, and BestKeeper algorithms. Results revealed that HcPP2A (Protein phosphatase 2A and HcACT7 (Actin 7 were the optimum reference genes across all samples; HcUBC (Ubiquitin-conjugating enzyme like protein was the worst reference gene for transcript normalization. The reliability of the selected reference genes was further confirmed by evaluating the expression profile of HcWRKY28 gene at different stress durations. This work will benefit future studies on discovery of stress-tolerance genes and stress-signaling pathways in this important fiber crop.

  7. Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells.

    Science.gov (United States)

    Behjati, Mohaddeseh; Hashemi, Mohammad; Kazemi, Mohammad; Salehi, Mansoor; Javanmard, Shaghayegh Haghjooy

    2017-01-01

    Decreased high-energy phosphate level is involved in endothelial cell injury and dysfunction. Reduced telomerase activity in endothelial cells in parallel with reduced energy levels might be due to altered direction of alternative splicing machine as a complication of depleted energy during the process of atherosclerosis. Isolated human umbilical vein endothelial cells (HUVECs) were treated for 24 hours by oligomycine (OM) and 2-deoxy glucose (2-DG). After 24 hours, the effect of energy depletion on telomerase splicing pattern was evaluated using RT-PCR. Indeed, in both treated and untargeted cells, nitric oxide (NO) and von Willebrand factor (vWF) were measured. ATP was depleted in treated cells by 43.9% compared with control group. We observed a slight decrease in NO levels ( P = 0.09) and vWF ( P = 0.395) in the setting of 49.36% ATP depletion. In both groups, no telomerase gene expression was seen. Telomerase and housekeeping gene expression were found in positive control group (colon cancer tissue) and sample tissue. The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.

  8. Characterization of mechanisms underlying degradation of sclerotia of Sclerotinia sclerotiorum by Aspergillus aculeatus Asp-4 using a combined qRT-PCR and proteomic approach.

    Science.gov (United States)

    Hu, Xiaojia; Qin, Lu; Roberts, Daniel P; Lakshman, Dilip K; Gong, Yangmin; Maul, Jude E; Xie, Lihua; Yu, Changbing; Li, Yinshui; Hu, Lei; Liao, Xiangsheng; Liao, Xing

    2017-08-31

    The biological control agent Aspergillus aculeatus Asp-4 colonizes and degrades sclerotia of Sclerotinia sclerotiorum resulting in reduced germination and disease caused by this important plant pathogen. Molecular mechanisms of mycoparasites underlying colonization, degradation, and reduction of germination of sclerotia of this and other important plant pathogens remain poorly understood. An RNA-Seq screen of Asp-4 growing on autoclaved, ground sclerotia of S. sclerotiorum for 48 h identified 997 up-regulated and 777 down-regulated genes relative to this mycoparasite growing on potato dextrose agar (PDA) for 48 h. qRT-PCR time course experiments characterized expression dynamics of select genes encoding enzymes functioning in degradation of sclerotial components and management of environmental conditions, including environmental stress. This analysis suggested co-temporal up-regulation of genes functioning in these two processes. Proteomic analysis of Asp-4 growing on this sclerotial material for 48 h identified 26 up-regulated and 6 down-regulated proteins relative to the PDA control. Certain proteins with increased abundance had putative functions in degradation of polymeric components of sclerotia and the mitigation of environmental stress. Our results suggest co-temporal up-regulation of genes involved in degradation of sclerotial compounds and mitigation of environmental stress. This study furthers the analysis of mycoparasitism of sclerotial pathogens by providing the basis for molecular characterization of a previously uncharacterized mycoparasite-sclerotial interaction.

  9. Characterization of bovine ruminal epithelial bacterial communities using 16S rRNA sequencing, PCR-DGGE, and qRT-PCR analysis.

    Science.gov (United States)

    Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo

    2012-02-24

    Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Inducible nitric oxide synthase (iNOS) in gingival tissues of chronic periodontitis with and without diabetes: immunohistochemistry and RT-PCR study.

    Science.gov (United States)

    Shaker, Olfat; Ghallab, Noha A; Hamdy, Ebtehal; Sayed, Safinaz

    2013-10-01

    There is few data concerning the pathogenesis and contribution of inducible nitric oxide synthase (iNOS) in the inflammatory reactions of the periodontium in the course of diabetes. This study evaluated the expression of iNOS in the gingival biopsies of periodontitis patients with and without type 2 diabetes. 80 subjects were evaluated in four groups: patients with chronic periodontitis and diabetes, patients with chronic periodontitis, periodontally healthy patients with diabetes, and systemically and periodontally healthy control subjects. Gingival biopsies were subjected to immunohistochemistry as well as reverse transcription polymerase chain reaction (RT-PCR) for determination of iNOS. All diseased gingival tissues had a significant increase in iNOS expression by immunohistochemistry (Pperiodontitis and diabetic patients regarding iNOS(+) cells. Meanwhile, these two groups had significantly increased iNOS(+) cells when compared to periodontitis patients (Pperiodontitis showed significantly higher levels of iNOS mRNA expression compared to samples from periodontitis patients and diabetic patients (Pperiodontitis, periodontitis patients and diabetic patients, the higher mRNA for iNOS observed in diabetes and periodontitis may indicate a possible involvement of this mediator in the periodontal destruction of type 2 diabetes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Development of a multiplex polymerase chain reaction assay for simultaneous identification of human enterovirus 71 and coxsackievirus A16

    Science.gov (United States)

    Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara

    2010-01-01

    Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857

  12. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting.

    Directory of Open Access Journals (Sweden)

    Jermaine Khumalo

    Full Text Available Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children.We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis.From 292 samples, bacterial DNA was detected in 12 (4.1% and viral nucleic acids in 94 (32%. Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10% of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR.In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.

  13. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  14. Multiplexed color-coded probe-based gene expression assessment for clinical molecular diagnostics in formalin-fixed paraffin-embedded human renal allograft tissue.

    Science.gov (United States)

    Adam, Benjamin; Afzali, Bahman; Dominy, Katherine M; Chapman, Erin; Gill, Reeda; Hidalgo, Luis G; Roufosse, Candice; Sis, Banu; Mengel, Michael

    2016-03-01

    Histopathologic diagnoses in transplantation can be improved with molecular testing. Preferably, molecular diagnostics should fit into standard-of-care workflows for transplant biopsies, that is, formalin-fixed paraffin-embedded (FFPE) processing. The NanoString(®) gene expression platform has recently been shown to work with FFPE samples. We aimed to evaluate its methodological robustness and feasibility for gene expression studies in human FFPE renal allograft samples. A literature-derived antibody-mediated rejection (ABMR) 34-gene set, comprised of endothelial, NK cell, and inflammation transcripts, was analyzed in different retrospective biopsy cohorts and showed potential to molecularly discriminate ABMR cases, including FFPE samples. NanoString(®) results were reproducible across a range of RNA input quantities (r = 0.998), with different operators (r = 0.998), and between different reagent lots (r = 0.983). There was moderate correlation between NanoString(®) with FFPE tissue and quantitative reverse transcription polymerase chain reaction (qRT-PCR) with corresponding dedicated fresh-stabilized tissue (r = 0.487). Better overall correlation with histology was observed with NanoString(®) (r = 0.354) than with qRT-PCR (r = 0.146). Our results demonstrate the feasibility of multiplexed gene expression quantification from FFPE renal allograft tissue. This represents a method for prospective and retrospective validation of molecular diagnostics and its adoption in clinical transplantation pathology. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

    Science.gov (United States)

    Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

    2013-05-01

    This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

  16. High-level expression of podoplanin in benign and malignant soft tissue tumors: immunohistochemical and quantitative real-time RT-PCR analysis.

    Science.gov (United States)

    Xu, Yongjun; Ogose, Akira; Kawashima, Hiroyuki; Hotta, Tetsuo; Ariizumi, Takashi; Li, Guidong; Umezu, Hajime; Endo, Naoto

    2011-03-01

    Podoplanin is a 38 kDa mucin-type transmembrane glycoprotein that was first identified in rat glomerular epithelial cells (podocytes). It is expressed in normal lymphatic endothelium, but is absent from vascular endothelial cells. D2-40 is a commercially available mouse monoclonal antibody which binds to an epitope on human podoplanin. D2-40 immunoreactivity is therefore highly sensitive and specific for lymphatic endothelium. Recent investigations have shown widespread applications of immunohistochemical staining with D2-40 in evaluating podoplanin expression as an immunohistochemical marker for diagnosis and prognosis in various tumors. To determine whether the podoplanin (D2-40) antibody may be useful for the diagnosis of soft tissue tumors, 125 cases, including 4 kinds of benign tumors, 15 kinds of malignant tumors and 3 kinds of tumor-like lesions were immunostained using the D2-40 antibody. Total RNA was extracted from frozen tumor tissue obtained from 41 corresponding soft tissue tumor patients and 12 kinds of soft tissue tumor cell lines. Quantitative real-time PCR reactions were performed. Immunohistochemical and quantitative real-time RT-PCR analyses demonstrated the expression of the podoplanin protein and mRNA in the majority of benign and malignant soft tissue tumors and tumor-like lesions examined, with the exception of alveolar soft part sarcoma, embryonal and alveolar rhabdomyosarcoma, extraskeletal Ewing's sarcoma/peripheral primitive neuro-ectodermal tumor and lipoma, which were completely negative for podoplanin. Since it is widely and highly expressed in nearly all kinds of soft tissue tumors, especially in spindle cell sarcoma, myxoid type soft tissue tumors and soft tissue tumors of the nervous system, podoplanin is considered to have little value in the differential diagnosis of soft tissue tumors.

  17. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  18. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  19. Tissue- and cell-specific expression of metallothionein genes in cadmium- and copper-exposed mussels analyzed by in situ hybridization and RT-PCR

    International Nuclear Information System (INIS)

    Zorita, I.; Bilbao, E.; Schad, A.; Cancio, I.; Soto, M.; Cajaraville, M.P.

    2007-01-01

    Metallothioneins (MTs) are metal-inducible proteins that can be used as biomarkers of metal exposure. In mussels two families of MT isoforms (MT10 and MT20) have been characterized. In this study, mussels (Mytilus galloprovincialis) were exposed to 200 ppb Cd and 40 ppb Cu for 2 and 9 days to characterize the tissue and isoform specificity of metal-induced MT expression. Non-radioactive in situ hybridization demonstrated that both MT isoforms were mainly transcribed in digestive tubule epithelial cells, especially in basophilic cells. Weaker MT expression was detected in non-ciliated duct cells, stomach and gill epithelial cells, haemocytes, adipogranular cells, spermatic follicles and oocytes. RT-PCR resulted in cloning of a novel M. galloprovincialis isoform homologous to recently cloned Mytilus edulis intron-less MT10B isoform. In gills, Cd only affected MT10 gene expression after 2 days of exposure while increases in MT protein levels occurred at day 9. In the digestive gland, a marked increase of both isoforms, but especially of MT20, was accompanied by increased levels of MT proteins and basophilic cell volume density (Vv BAS ) after 2 and 9 days and of intralysosomal metal accumulation in digestive cells after 9 days. Conversely, although metal was accumulated in digestive cells lysosomes and the Vv BAS increased in Cu-exposed mussels, Cu exposure did not produce an increase of MT gene expression or MT protein levels. These data suggest that MTs are expressed in a tissue-, cell- and isoform-specific way in response to different metals

  20. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  1. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  2. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  3. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  4. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  5. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  6. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  7. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  8. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM analysis [v1; ref status: indexed, http://f1000r.es/2hj

    Directory of Open Access Journals (Sweden)

    Erin K. Hanson

    2013-12-01

    Full Text Available Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE or quantitative RT-PCR (qRT-PCR platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions, IL1F7 (skin, ALAS2 (blood, MMP10 (menstrual blood, HTN3 (saliva and TGM4 (semen.  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green. Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively

  9. Evaluation of fecal culture and fecal RT-PCR to detect Mycobacterium avium ssp. paratuberculosis fecal shedding in dairy goats and dairy sheep using latent class Bayesian modeling.

    Science.gov (United States)

    Bauman, Cathy A; Jones-Bitton, Andria; Jansen, Jocelyn; Kelton, David; Menzies, Paula

    2016-09-20

    The study's objective was to evaluate the ability of fecal culture (FCUL) and fecal PCR (FPCR) to identify dairy goat and dairy sheep shedding Mycobacterium avium ssp. paratuberculosis. A cross-sectional study of the small ruminant populations was performed in Ontario, Canada between October 2010 and August 2011. Twenty-nine dairy goat herds and 21 dairy sheep flocks were visited, and 20 lactating females > two years of age were randomly selected from each farm resulting in 580 goats and 397 sheep participating in the study. Feces were collected per rectum and cultured using the BD BACTEC™ MGIT™ 960 system using a standard (49 days) and an extended (240 days) incubation time, and underwent RT-PCR based on the hsp-X gene (Tetracore®). Statistical analysis was performed using a 2-test latent class Bayesian hierarchical model for each species fitted in WinBUGS. Extending the fecal culture incubation time statistically improved FCUL sensitivity from 23.1 % (95 % PI: 15.9-34.1) to 42.7 % (95 % PI: 33.0-54.5) in dairy goats and from 5.8 % (95 % PI: 2.3-12.4) to 19.0 % (95 % PI: 11.9-28.9) in dairy sheep. FPCR demonstrated statistically higher sensitivity than FCUL (49 day incubation) with a sensitivity of 31.9 % (95 % PI: 22.4-43.1) in goats and 42.6 % (95 % PI: 28.8-63.3) in sheep. Fecal culture demonstrates such low sensitivity at the standard incubation time it cannot be recommended as a screening test to detect shedding of MAP in either goats or sheep. Extending the incubation time resulted in improved sensitivity; however, it is still disappointingly low for screening purposes. Fecal PCR should be the screening test of choice in both species; however, it is important to recognize that control programs should not be based on testing alone when they demonstrate such low sensitivity.

  10. Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

    Directory of Open Access Journals (Sweden)

    C Coelho

    2003-06-01

    Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

  11. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  12. A novel power and offset allocation method for spatial multiplexing MIMO Systems in optical wireless channels

    KAUST Repository

    Park, Kihong

    2011-12-01

    We consider optical wireless communication which can be utilized for illumination and communication by relying on lighting devices. Due to the limited bandwidth of optical sources, it is challenging to achieve high data rate in optical wireless systems. In order to obtain a multiplexing gain and high spectral efficiency, we design an optical multi-input multi-output (MIMO) system utilizing a singular value decomposition-based spatial multiplexing and adaptive modulation. We note that the conventional allocation method in radio frequency MIMO channels cannot be applied directly to the optical intensity channels. In this paper, we generalize the result of power allocation method in [1] for arbitrary number of transmit and receive antennas in optical wireless MIMO systems. Based on three constraints, namely, the nonnegativity, the aggregate optical power, and the bit error rate requirement, we propose a novel method to allocate the optical power, the offset value, and the modulation size for maximum sum rate. From some selected simulation results, we show that our proposed allocation method gives a better spectral efficiency than the method that allocates the optical power equally for each data stream. © 2011 IEEE.

  13. Fuzzy-logic based strategy for validation of multiplex methods: example with qualitative GMO assays.

    Science.gov (United States)

    Bellocchi, Gianni; Bertholet, Vincent; Hamels, Sandrine; Moens, W; Remacle, José; Van den Eede, Guy

    2010-02-01

    This paper illustrates the advantages that a fuzzy-based aggregation method could bring into the validation of a multiplex method for GMO detection (DualChip GMO kit, Eppendorf). Guidelines for validation of chemical, bio-chemical, pharmaceutical and genetic methods have been developed and ad hoc validation statistics are available and routinely used, for in-house and inter-laboratory testing, and decision-making. Fuzzy logic allows summarising the information obtained by independent validation statistics into one synthetic indicator of overall method performance. The microarray technology, introduced for simultaneous identification of multiple GMOs, poses specific validation issues (patterns of performance for a variety of GMOs at different concentrations). A fuzzy-based indicator for overall evaluation is illustrated in this paper, and applied to validation data for different genetically modified elements. Remarks were drawn on the analytical results. The fuzzy-logic based rules were shown to be applicable to improve interpretation of results and facilitate overall evaluation of the multiplex method.

  14. Multiplexed genome engineering and genotyping methods applications for synthetic biology and metabolic engineering.

    Science.gov (United States)

    Wang, Harris H; Church, George M

    2011-01-01

    Engineering at the scale of whole genomes requires fundamentally new molecular biology tools. Recent advances in recombineering using synthetic oligonucleotides enable the rapid generation of mutants at high efficiency and specificity and can be implemented at the genome scale. With these techniques, libraries of mutants can be generated, from which individuals with functionally useful phenotypes can be isolated. Furthermore, populations of cells can be evolved in situ by directed evolution using complex pools of oligonucleotides. Here, we discuss ways to utilize these multiplexed genome engineering methods, with special emphasis on experimental design and implementation. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Multiplex cDNA quantification method that facilitates the standardization of gene expression data

    Science.gov (United States)

    Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

    2011-01-01

    Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

  16. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  17. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    Science.gov (United States)

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-07-01

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

  18. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  19. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

    Science.gov (United States)

    Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

    1997-03-01

    ; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

  20. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  1. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  2. Low-Cost Method to Monitor Patient Adherence to HIV Antiretroviral Therapy Using Multiplex Cathepsin Zymography.

    Science.gov (United States)

    Platt, Manu O; Evans, Denise; Keegan, Philip M; McNamara, Lynne; Parker, Ivana K; Roberts, LaDeidra M; Caulk, Alexander W; Gleason, Rudolph L; Seifu, Daniel; Amogne, Wondwossen; Penny, Clement

    2016-01-01

    Monitoring patient adherence to HIV antiretroviral therapy (ART) by patient survey is inherently error prone, justifying a need for objective, biological measures affordable in low-resource settings where HIV/AIDS epidemic is highest. In preliminary studies conducted in Ethiopia and South Africa, we observed loss of cysteine cathepsin activity in peripheral blood mononuclear cells of HIV-positive patients on ART. We optimized a rapid protocol for multiplex cathepsin zymography to quantify cysteine cathepsins, and prospectively enrolled 350 HIV-positive, ART-naïve adults attending the Themba Lethu Clinic, Johannesburg, South Africa, to test if suppressed cathepsin activity could be a biomarker of ART adherence (103 patients were included in final analysis). Poor adherence was defined as detectable viral load (>400 copies/ml) or simplified medication adherence questionnaire, 4-6 months after ART initiation. 86 % of patients with undetectable viral loads after 6 months were cathepsin negative, and cathepsin-positive patients were twice as likely to have detectable viral loads (RR 2.32 95 % CI 1.26-4.29). Together, this demonstrates proof of concept that multiplex cathepsin zymography may be an inexpensive, objective method to monitor patient adherence to ART. Low cost of this electrophoresis-based assay makes it a prime candidate for implementation in resource-limited settings.

  3. Low cost method to monitor patient adherence to HIV antiretroviral therapy using multiplex cathepsin zymography

    Science.gov (United States)

    Platt, Manu O.; Evans, Denise; Keegan, Philip M.; McNamara, Lynne; Parker, Ivana K.; Roberts, LaDeidra M.; Caulk, Alexander W.; Gleason, Rudolph L.; Seifu, Daniel; Amogne, Wondwossen; Penny, Clement

    2015-01-01

    Monitoring patient adherence to HIV antiretroviral therapy (ART) by patient survey is inherently error-prone, justifying a need for objective, biological measures affordable in low resource settings where HIV/AIDS epidemic is highest. In preliminary studies conducted in Ethiopia and South Africa, we observed loss of cysteine cathepsin activity in peripheral blood mononuclear cells (PBMCs) of HIV-positive patients on ART. We optimized a rapid protocol for multiplex cathepsin zymography to quantify cysteine cathepsins, and prospectively enrolled 350 HIV-positive, ART naïve adults attending the Themba Lethu Clinic, Johannesburg, South Africa, to test if suppressed cathepsin activity could be a biomarker of ART adherence (103 patients were included in final analysis). Poor adherence was defined as detectable viral load (>400 copies/ml) or simplified medication adherence questionnaire (SMAQ), 4–6 months after ART initiation. 86% of patients with undetectable viral loads after 6 months were cathepsin negative, and cathepsin positive patients were twice as likely to have detectable viral loads (RR 2.32 95% CI 1.26–4.29). Together, this demonstrates proof of concept that multiplex cathepsin zymography may be an inexpensive, objective method to monitor patient adherence to ART. Low cost of this electrophoresis based assay makes it a prime candidate for implementation in resource limited settings. PMID:26589706

  4. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  5. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus) by qRT-PCR.

    Science.gov (United States)

    Maher, Iona E; Griffith, Joanna E; Lau, Quintin; Reeves, Thomas; Higgins, Damien P

    2014-01-01

    Investigation of the immune response of the koala (Phascolarctos cinereus) is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV), which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala's susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1) and Th2 lymphocyte responses are important to an individual's susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala's adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 10 (IL-10) and interferon gamma (IFNγ) along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A). Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not consistently up-regulated by

  6. A RT-PCR method for selective amplification and phenotypic characterization of all three serotypes of Sabin-related polioviruses from viral mixtures

    Directory of Open Access Journals (Sweden)

    Eliane Veiga da Costa

    2012-08-01

    Full Text Available Outbreaks caused by vaccine-derived polioviruses are challenging the final eradication of paralytic poliomyelitis. Therefore, the surveillance of the acute flaccid paralysis cases based on poliovirus isolation and characterization remains an essential activity. Due to the use of trivalent oral poliovirus vaccine (OPV, mixtures containing more than one serotype of Sabin-related polioviruses are frequently isolated from clinical samples. Because each poliovirus isolate needs to be individually analyzed, we designed polymerase chain reaction primers that can selectively distinguish and amplify a genomic segment of the three Sabin-related poliovirus serotypes present in mixtures, thus, optimizing the diagnosis and providing prompt information to support epidemiologic actions.

  7. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR

    DEFF Research Database (Denmark)

    Krych, Lukasz; Kot, Witold; Bendtsen, Katja M. S.

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reaction...

  8. Fine-filter method for Raman lidar based on wavelength division multiplexing and fiber Bragg grating.

    Science.gov (United States)

    Wang, Jun; Zheng, Jiao; Lu, Hong; Yan, Qing; Wang, Li; Liu, Jingjing; Hua, Dengxin

    2017-11-01

    Atmospheric temperature is one of the important parameters for the description of the atmospheric state. Most of the detection approaches to atmospheric temperature monitoring are based on rotational Raman scattering for better understanding atmospheric dynamics, thermodynamics, atmospheric transmission, and radiation. In this paper, we present a fine-filter method based on wavelength division multiplexing, incorporating a fiber Bragg grating in the visible spectrum for the rotational Raman scattering spectrum. To achieve high-precision remote sensing, the strong background noise is filtered out by using the secondary cascaded light paths. Detection intensity and the signal-to-noise ratio are improved by increasing the utilization rate of return signal form atmosphere. Passive temperature compensation is employed to reduce the temperature sensitivity of fiber Bragg grating. In addition, the proposed method provides a feasible solution for the filter system with the merits of miniaturization, high anti-interference, and high stability in the space-based platform.

  9. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  10. Modeling of three-dimensional diffusible resistors with the one-dimensional tube multiplexing method

    International Nuclear Information System (INIS)

    Gillet, Jean-Numa; Degorce, Jean-Yves; Meunier, Michel

    2009-01-01

    Electronic-behavior modeling of three-dimensional (3D) p + -π-p + and n + -ν-n + semiconducting diffusible devices with highly accurate resistances for the design of analog resistors, which are compatible with the CMOS (complementary-metal-oxide-semiconductor) technologies, is performed in three dimensions with the fast tube multiplexing method (TMM). The current–voltage (I–V) curve of a silicon device is usually computed with traditional device simulators of technology computer-aided design (TCAD) based on the finite-element method (FEM). However, for the design of 3D p + -π-p + and n + -ν-n + diffusible resistors, they show a high computational cost and convergence that may fail with fully non-separable 3D dopant concentration profiles as observed in many diffusible resistors resulting from laser trimming. These problems are avoided with the proposed TMM, which divides the 3D resistor into one-dimensional (1D) thin tubes with longitudinal axes following the main orientation of the average electrical field in the tubes. The I–V curve is rapidly obtained for a device with a realistic 3D dopant profile, since a system of three first-order ordinary differential equations has to be solved for each 1D multiplexed tube with the TMM instead of three second-order partial differential equations in the traditional TCADs. Simulations with the TMM are successfully compared to experimental results from silicon-based 3D resistors fabricated by laser-induced dopant diffusion in the gaps of MOSFETs (metal-oxide-semiconductor field-effect transistors) without initial gate. Using thin tubes with other shapes than parallelepipeds as ring segments with toroidal lateral surfaces, the TMM can be generalized to electronic devices with other types of 3D diffusible microstructures

  11. Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

    Directory of Open Access Journals (Sweden)

    Zahra Gharibi

    2017-10-01

    Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

  12. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  13. Modifying a standard method allows simultaneous extraction of RNA and protein, enabling detection of enzymes in the rat retina with low expressions and protein levels.

    Science.gov (United States)

    Agardh, Elisabet; Gustavsson, Carin; Hagert, Per; Nilsson, Marie; Agardh, Carl-David

    2006-02-01

    The aim of the study was to evaluate messenger RNA and protein expression in limited amounts of tissue with low protein content. The Chomczynski method was used for simultaneous extraction of RNA, and protein was modified in the protein isolation step. Template mass and cycling time for the complementary DNA synthesis step of real-time reverse transcription-polymerase chain reaction (RT-PCR) for analysis of catalase, copper/zinc superoxide dismutase, manganese superoxide dismutase, the catalytic subunit of glutamylcysteine ligase, glutathione peroxidase 1, and the endogenous control cyclophilin B (CypB) were optimized before PCR. Polymerase chain reaction accuracy and efficacy were demonstrated by calculating the regression (R2) values of the separate amplification curves. Appropriate antibodies, blocking buffers, and running conditions were established for Western blot, and protein detection and multiplex assays with CypB were performed for each target. During the extraction procedure, the protein phase was dissolved in a modified washing buffer containing 0.1% sodium dodecyl sulfate, followed by ultrafiltration. Enzyme expression on real-time RT-PCR was accomplished with high reliability and reproducibility (R2, 0.990-0.999), and all enzymes except for glutathione peroxidase 1 were detectable in individual retinas on Western blot. Western blot multiplexing with CypB was possible for all targets. In conclusion, connecting gene expression directly to protein levels in the individual rat retina was possible by simultaneous extraction of RNA and protein. Real-time RT-PCR and Western blot allowed accurate detection of retinal protein expressions and levels.

  14. Comparison of pre-processing methods for multiplex bead-based immunoassays.

    Science.gov (United States)

    Rausch, Tanja K; Schillert, Arne; Ziegler, Andreas; Lüking, Angelika; Zucht, Hans-Dieter; Schulz-Knappe, Peter

    2016-08-11

    High throughput protein expression studies can be performed using bead-based protein immunoassays, such as the Luminex® xMAP® technology. Technical variability is inherent to these experiments and may lead to systematic bias and reduced power. To reduce technical variability, data pre-processing is performed. However, no recommendations exist for the pre-processing of Luminex® xMAP® data. We compared 37 different data pre-processing combinations of transformation and normalization methods in 42 samples on 384 analytes obtained from a multiplex immunoassay based on the Luminex® xMAP® technology. We evaluated the performance of each pre-processing approach with 6 different performance criteria. Three performance criteria were plots. All plots were evaluated by 15 independent and blinded readers. Four different combinations of transformation and normalization methods performed well as pre-processing procedure for this bead-based protein immunoassay. The following combinations of transformation and normalization were suitable for pre-processing Luminex® xMAP® data in this study: weighted Box-Cox followed by quantile or robust spline normalization (rsn), asinh transformation followed by loess normalization and Box-Cox followed by rsn.

  15. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    Science.gov (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  16. Colloid-based multiplexed method for screening plant biomass-degrading glycoside hydrolase activities in microbial communities

    Energy Technology Data Exchange (ETDEWEB)

    Reindl, W.; Deng, K.; Gladden, J.M.; Cheng, G.; Wong, A.; Singer, S.W.; Singh, S.; Lee, J.-C.; Yao, J.-S.; Hazen, T.C.; Singh, A.K; Simmons, B.A.; Adams, P.D.; Northen, T.R.

    2011-05-01

    The enzymatic hydrolysis of long-chain polysaccharides is a crucial step in the conversion of biomass to lignocellulosic biofuels. The identification and characterization of optimal glycoside hydrolases is dependent on enzyme activity assays, however existing methods are limited in terms of compatibility with a broad range of reaction conditions, sample complexity, and especially multiplexity. The method we present is a multiplexed approach based on Nanostructure-Initiator Mass Spectrometry (NIMS) that allowed studying several glycolytic activities in parallel under diverse assay conditions. Although the substrate analogs carried a highly hydrophobic perfluorinated tag, assays could be performed in aqueous solutions due colloid formation of the substrate molecules. We first validated our method by analyzing known {beta}-glucosidase and {beta}-xylosidase activities in single and parallel assay setups, followed by the identification and characterization of yet unknown glycoside hydrolase activities in microbial communities.

  17. Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

    Science.gov (United States)

    Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

    2015-01-01

    Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  18. Development of a bead-based multiplex genotyping method for diagnostic characterization of HPV infection.

    Directory of Open Access Journals (Sweden)

    Mee Young Chung

    Full Text Available The accurate genotyping of human papillomavirus (HPV is clinically important because the oncogenic potential of HPV is dependent on specific genotypes. Here, we described the development of a bead-based multiplex HPV genotyping (MPG method which is able to detect 20 types of HPV (15 high-risk HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68 and 5 low-risk HPV types 6, 11, 40, 55, 70 and evaluated its accuracy with sequencing. A total of 890 clinical samples were studied. Among these samples, 484 were HPV positive and 406 were HPV negative by consensus primer (PGMY09/11 directed PCR. The genotyping of 484 HPV positive samples was carried out by the bead-based MPG method. The accuracy was 93.5% (95% CI, 91.0-96.0, 80.1% (95% CI, 72.3-87.9 for single and multiple infections, respectively, while a complete type mismatch was observed only in one sample. The MPG method indiscriminately detected dysplasia of several cytological grades including 71.8% (95% CI, 61.5-82.3 of ASCUS (atypical squamous cells of undetermined significance and more specific for high grade lesions. For women with HSIL (high grade squamous intraepithelial lesion and SCC diagnosis, 32 women showed a PPV (positive predictive value of 77.3% (95% CI, 64.8-89.8. Among women >40 years of age, 22 women with histological cervical cancer lesions showed a PPV of 88% (95% CI, 75.3-100. Of the highest risk HPV types including HPV-16, 18 and 31 positive women of the same age groups, 34 women with histological cervical cancer lesions showed a PPV of 77.3% (95% CI, 65.0-89.6. Taken together, the bead-based MPG method could successfully detect high-grade lesions and high-risk HPV types with a high degree of accuracy in clinical samples.

  19. Evaluation of the Xpert Flu test and comparison with in-house real-time RT-PCR assays for detection of influenza virus from 2008 to 2011 in Marseille, France.

    Science.gov (United States)

    Salez, N; Ninove, L; Thirion, L; Gazin, C; Zandotti, C; de Lamballerie, X; Charrel, R N

    2012-04-01

    Rapid documentation of respiratory specimens can have an impact on the management of patients and their relatives in terms of preventive and curative measures. We compared the results of the Xpert(®) Flu assay (Cepheid) with three real-time RT-PCR assays using 127 nasopharyngeal samples, of which 75 were positive for influenza A (with 52 identified as A/H1N1-2009) and 52 were positive for influenza B. The Xpert(®) Flu assay presented a quasi-absence of non-interpretable tests, and showed sensitivity and specificity of 100% and 100% for Flu A, 98.4% and 100% for A/H1N1-2009, and 80.7% and 100% for Flu B. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  20. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  1. Detección mediante RT-PCR en tiempo real del virus vacunal en cerdos inmunizados con la vacuna cubana contra la peste porcina clásica

    Directory of Open Access Journals (Sweden)

    Tania Campos-Cuello

    2016-08-01

    Full Text Available La peste porcina clásica (PPC es una enfermedad viral infectocontagiosa, producida por un virus ARN del género Pestivirus, familia Flaviviridae. En la actualidad es una de las causas de pérdidas económicas en la industria porcina a nivel mundial. En su prevención se han utilizado vacunas vivas atenuadas, empleando la cepa China lapinizada. La Reacción en Cadena de la Polimerasa Reverso Transcriptasa (RT-PCR ha sido uno de los métodos más sensibles aplicado en Medicina Veterinaria para la detección de virus ARN. En el caso del virus de la PPC es muy útil porque el ácido nucleico se puede detectar desde muy temprano en la infección y en periodos más largos en aquellos animales que se recuperan. El objetivo de este estudio fue aplicar la técnica de RT-PCR en tiempo real para la detección de la cepa China lapinizada de la vacuna cubana contra la PPC. Las tonsilas de los cerdos vacunados fueron el órgano más positivo en la detección del ARN del virus vacunal. Los resultados obtenidos evidenciaron una interferencia del virus vacunal en el diagnóstico, siendo el día 12 posvacunación en el que se obtiene una emisión umbral de fluorescencia más bajo.

  2. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  3. Comparison and transfer testing of multiplex ligation detection methods for GM plants

    Directory of Open Access Journals (Sweden)

    Ujhelyi Gabriella

    2012-01-01

    Full Text Available Abstract Background With the increasing number of GMOs on the global market the maintenance of European GMO regulations is becoming more complex. For the analysis of a single food or feed sample it is necessary to assess the sample for the presence of many GMO-targets simultaneously at a sensitive level. Several methods have been published regarding DNA-based multidetection. Multiplex ligation detection methods have been described that use the same basic approach: i hybridisation and ligation of specific probes, ii amplification of the ligated probes and iii detection and identification of the amplified products. Despite they all have this same basis, the published ligation methods differ radically. The present study investigated with real-time PCR whether these different ligation methods have any influence on the performance of the probes. Sensitivity and the specificity of the padlock probes (PLPs with the ligation protocol with the best performance were also tested and the selected method was initially validated in a laboratory exchange study. Results Of the ligation protocols tested in this study, the best results were obtained with the PPLMD I and PPLMD II protocols and no consistent differences between these two protocols were observed. Both protocols are based on padlock probe ligation combined with microarray detection. Twenty PLPs were tested for specificity and the best probes were subjected to further evaluation. Up to 13 targets were detected specifically and simultaneously. During the interlaboratory exchange study similar results were achieved by the two participating institutes (NIB, Slovenia, and RIKILT, the Netherlands. Conclusions From the comparison of ligation protocols it can be concluded that two protocols perform equally well on the basis of the selected set of PLPs. Using the most ideal parameters the multiplicity of one of the methods was tested and 13 targets were successfully and specifically detected. In the

  4. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  5. Establishment and application of a multiplex genetic mutation-detection method of lung cancer based on MassARRAY platform

    International Nuclear Information System (INIS)

    Tian, Hong-Xia; Zhang, Xu-Chao; Wang, Zhen; Chen, Jian-Guang; Chen, Shi-Liang; Guo, Wei-Bang; Wu, Yi-Long

    2016-01-01

    Objective: This study aims to establish a method for highly parallel multiplexed detection of genetic mutations in Chinese lung cancer samples through Agena iPLEX chemistry and matrix-assisted laser desorption ionization time-of-flight analysis on MassARRAY mass spectrometry platform. Methods: We reviewed the related literature and data on lung cancer treatments. We also identified 99 mutation hot spots in 13 target genes closely related to the pathogenesis, drug resistance, and metastasis of lung cancer. A total of 297 primers, composed of 99 paired forward and reverse amplification primers and 99 matched extension primers, were designed using Assay Design software. The detection method was established by analyzing eight cell lines and six lung cancer specimens. The proposed method was then validated through comparisons by using a LungCarta TM kit. The sensitivity and specificity of the proposed method were evaluated by directly sequencing EGFR and KRAS genes in 100 lung cancer cases. Results: The proposed method was able to detect multiplex genetic mutations in lung cancer cell lines. This finding was consistent with the observations on previously reported mutations. The proposed method can also detect such mutations in clinical lung cancer specimens. This result was consistent with the observations with LungCarta TM kit. However, an FGFR2 mutation was detected only through the proposed method. The measured sensitivity and specificity were 100% and 96.3%, respectively. Conclusions: The proposed MassARRAY technology-based multiplex method can detect genetic mutations in Chinese lung cancer patients. Therefore, the proposed method can be applied to detect mutations in other cancer tissues

  6. Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

    Science.gov (United States)

    Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

    2012-11-01

    In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

  7. Efficacy of laser capture microdissection plus RT-PCR technique in analyzing gene expression levels in human gastric cancer and colon cancer

    International Nuclear Information System (INIS)

    Makino, Hiroshi; Uetake, Hiroyuki; Danenberg, Kathleen; Danenberg, Peter V; Sugihara, Kenichi

    2008-01-01

    Thymidylate synthase, dihydropyrimidine dehydrogenase, thymidine phosphorylase, and orotate phosphoribosyltransferase gene expressions are reported to be valid predictive markers for 5-fluorouracil sensitivity to gastrointestinal cancer. For more reliable predictability, their expressions in cancer cells and stromal cells in the cancerous tissue (cancerous stroma) have been separately investigated using laser capture microdissection. Thymidylate synthase, dihydropyrimidine dehydrogenase, thymidine phosphorylase, and orotate phosphoribosyltransferase mRNA in cancer cells and cancerous stroma from samples of 47 gastric and 43 colon cancers were separately quantified by reverse transcription polymerase chain reaction after laser capture microdissection. In both gastric and colon cancers, thymidylate synthase and orotate phosphoribosyltransferase mRNA expressions were higher (p < 0.0001, p <0.0001 respectively in gastric cancer and P = 0.0002, p < 0.0001 respectively in colon cancer) and dihydropyrimidine dehydrogenase mRNA expressions were lower in cancer cells than in cancerous stroma (P = 0.0136 in gastric cancer and p < 0.0001 in colon cancer). In contrast, thymidine phosphorylase mRNA was higher in cancer cells than in cancerous stroma in gastric cancer (p < 0.0001) and lower in cancer cells than in cancerous stroma in colon cancer (P = 0.0055). By using this method, we could estimate gene expressions separately in cancer cells and stromal cells from colon and gastric cancers, in spite of the amount of stromal tissue. Our method is thought to be useful for accurately evaluating intratumoral gene expressions

  8. Real-time RT-PCR systems for CTC detection from blood samples of breast cancer and gynaecological tumour patients (Review).

    Science.gov (United States)

    Andergassen, Ulrich; Kölbl, Alexandra C; Mahner, Sven; Jeschke, Udo

    2016-04-01

    Cells, which detach from a primary epithelial tumour and migrate through lymphatic vessels and blood stream are called 'circulating tumour cells'. These cells are considered to be the main root of remote metastasis and are correlated to a worse prognosis concerning progression-free and overall survival of the patients. Therefore, the detection of the minimal residual disease is of great importance regarding therapeutic decisions. Many different detection strategies are already available, but only one method, the CellSearch® system, reached FDA approval. The present review focusses on the detection of circulating tumour cells by means of real-time PCR, a highly sensitive method based on differences in gene expression between normal and malignant cells. Strategies for an enrichment of tumour cells are mentioned, as well as a large panel of potential marker genes. Drawbacks and advantages of the technique are elucidated, whereas, the greatest advantage might be, that by selection of appropriate marker genes, also tumour cells, which have already undergone epithelial to mesenchymal transition can be detected. Finally, the application of real-time PCR in different gynaecological malignancies is described, with breast cancer being the most studied cancer entity.

  9. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    Science.gov (United States)

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  10. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Directory of Open Access Journals (Sweden)

    Shutao Zhang

    Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  11. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Science.gov (United States)

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  12. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  13. Lysophospholipid Receptors Are Differentially Expressed in Rat Terminal Schwann Cells, As Revealed by a Single Cell RT-PCR and In Situ Hybridization

    International Nuclear Information System (INIS)

    Kobashi, Hiroaki; Yaoi, Takeshi; Oda, Ryo; Okajima, Seiichiro; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Fushiki, Shinji

    2006-01-01

    Terminal Schwann cells (TSCs) that cover motor neuron terminals, are known to play an important role in maintaining neuromuscular junctions, as well as in the repair process after nerve injury. However, the molecular characteristics of TSCs remain unknown, because of the difficulties in analyzing them due to their paucity. By using our previously reported method of selectively and efficiently collecting TSCs, we have analyzed the difference in expression patterns of lysophospholipid (LPL) receptor genes (LPA 1 , LPA 2 , LPA 3 , S1P 1 , S1P 2 , S1P 3 , S1P 4 , and S1P 5 ) between TSCs and myelinating Schwann cells (MSCs). LPL, which includes lysophosphatidic acid (LPA) and sphingosine 1-phosphate (S1P), is the bioactive lipid that induces a myriad of cellular responses through specific members of G-protein coupled receptors for LPA. It turned out that LPA 3 was expressed only in TSCs, whereas S1P 1 was expressed in TSCs and skeletal muscle, but not in MSCs. Other types of LPL receptor genes, including LPA 1 , S1P 2 , S1P 3 , S1P 4 , were expressed in both types of Schwann cells. None of the LPL receptor gene family showed MSCs-specific expression

  14. RT-PCR amplification of RNA extracted from formalin-fixed, paraffin-embedded oral cancer sections: analysis of p53 pathway.

    Science.gov (United States)

    Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro

    2003-01-01

    We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.

  15. Determination of respiratory virus by RT-PCR in people with acute respiratory infection of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos 'Dr. Carlos Saenz Herrera', in the period January 2012 to September 2012

    International Nuclear Information System (INIS)

    Montero Bonilla, Andrei

    2014-01-01

    Respiratory viruses are diagnosed through reverse transcriptase polymerase chain reaction (RT-PCR) in people with acute respiratory disease of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos. The frequency of respiratory viruses are determined in the samples analyzed in the study population. The presence of viral coinfections is identified in the samples analyzed. The frequency of patients with respiratory viruses is categorized according to age in the study population. The frequency of respiratory viruses is examined between the studied geographic regions (Pavas and Paraiso). The results found by RT-PCR are compared with the frequency data reported with the direct immunofluorescence technique [es

  16. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  17. Optimization of the segmented method for optical compression and multiplexing system

    Science.gov (United States)

    Al Falou, Ayman

    2002-05-01

    Because of the constant increasing demands of images exchange, and despite the ever increasing bandwidth of the networks, compression and multiplexing of images is becoming inseparable from their generation and display. For high resolution real time motion pictures, electronic performing of compression requires complex and time-consuming processing units. On the contrary, by its inherent bi-dimensional character, coherent optics is well fitted to perform such processes that are basically bi-dimensional data handling in the Fourier domain. Additionally, the main limiting factor that was the maximum frame rate is vanishing because of the recent improvement of spatial light modulator technology. The purpose of this communication is to benefit from recent optical correlation algorithms. The segmented filtering used to store multi-references in a given space bandwidth product optical filter can be applied to networks to compress and multiplex images in a given bandwidth channel.

  18. Analogue multiplexer

    International Nuclear Information System (INIS)

    Gorshkov, V.A.; Kuznetsov, A.N.

    1980-01-01

    In systems of signal recording from several parallel spectrometric channels one can considerably reduce the total apparatus volume using a special unit - an analog multiplexer. A description of the multiplexer in the CAMAC system on the base of fast linear gating circuits which allows one analog-to-code converter to attend four spectrometric channels is given. On the example of the 4-channel spectrometer the logics of interaction of the multiple with analog-to-digital coxernver and signal recorder is shown. Electrical and functional multiplexer flow-sheets are given and its main characteristics are presented

  19. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  20. Molecular characterization of two rocio flavivirus strains isolated during the encephalitis epidemic in são paulo state, brazil and the development of a one-step rt-pcr assay for diagnosis Caracterização molecular de duas cepas do flavivírus Rocio, isoladas durante a epidemia de encefalite no Estado de São Paulo, Brasil e desenvolvimento do teste one-step RT-PCR para diagnóstico

    Directory of Open Access Journals (Sweden)

    Terezinha Lisieux Moraes Coimbra

    2008-04-01

    Full Text Available Rocio virus (ROCV was responsible for an explosive encephalitis epidemic in the 1970s affecting about 1,000 residents of 20 coastland counties in São Paulo State, Brazil. ROCV was first isolated in 1975 from the cerebellum of a fatal human case of encephalitis. Clinical manifestations of the illness are similar to those described for St. Louis encephalitis. ROCV shows intense antigenic cross-reactivity with Japanese encephalitis complex (JEC viruses, particularly with Ilheus (ILHV, St. Louis encephalitis, Murray Valley and West Nile viruses. In this study, we report a specific RT-PCR assay for ROCV diagnosis and the molecular characterization of the SPAn37630 and SPH37623 strains. Partial nucleotide sequences of NS5 and E genes determined from both strains were used in phylogenetic analysis. The results indicated that these strains are closely related to JEC viruses, but forming a distinct subclade together with ILHV, in accordance with results recently reported by Medeiros et al. (2007.O vírus Rocio (ROCV foi responsável por uma explosiva epidemia de encefalite que ocorreu nos anos 70 afetando cerca de 1.000 habitantes de 20 municípios litorâneos do Estado de São Paulo, Brasil. ROCV foi isolado em 1975 de cerebelo de caso humano fatal de encefalite. As manifestações clínicas da doença são semelhantes àquelas descritas para encefalite St. Louis. ROCV apresenta intensa reatividade cruzada com os vírus do Complexo da Encefalite Japonesa (JEV, particularmente com o vírus Ilhéus (ILHV e com os vírus das encefalites St. Louis, Murray Valley e West Nile. Neste estudo, relatamos o desenvolvimento de um teste de RT-PCR específico para diagnóstico de ROCV e a caracterização molecular das cepas SPAn37630 e SPH37623. Foi realizada a análise filogenética das seqüências parciais dos genes NS5 e E, de ambas as cepas. Os resultados indicaram que essas cepas são intimamente relacionadas ao complexo JEV, mas formando um subgrupo com o

  1. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    Science.gov (United States)

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  2. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  3. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532...

  4. Avaliação da urina e de leucócitos como amostras biológicas para a detecção ante mortem do vírus da cinomose canina por RT-PCR em cães naturalmente infectados Evaluation of the urine and leucocytes as biological samples for ante mortem detection of canine distemper virus by RT-PCR assay in naturally infected dogs

    Directory of Open Access Journals (Sweden)

    F.J. Negrão

    2007-02-01

    Full Text Available Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of the canine distemper virus (CDV by a reverse transcription-polymerase chain reaction (RT-PCR assay. One hundred and eighty eight dogs with clinical symptoms of distemper, were distributed in three groups. The group A was constituted of 93 dogs with systemic signs of distemper; the group B by 11 dogs with neurological signs, and the group C by 84 dogs that presented simultaneously systemic and neurological signs. In 66.5% (125/188 of the dogs was amplified an amplicon with 287 base pair of the CDV nucleoprotein gene. In 60.8% (76/125 of the animals the CDV was detected simultaneously in the urine and leucocytes, and in 39.2% (49/125 of the dogs just a type of clinical sample (urine: n=37; leucocytes: n=12 was positive. These results demonstrate that the different forms of clinical distemper disease can hinder the choice of only one type of clinical sample to carry out the ante mortem etiological diagnosis of CDV infection, and false-negative results can be generated.

  5. Method for assessing the reliability of molecular diagnostics based on multiplexed SERS-coded nanoparticles.

    Directory of Open Access Journals (Sweden)

    Steven Y Leigh

    Full Text Available Surface-enhanced Raman scattering (SERS nanoparticles have been engineered to generate unique fingerprint spectra and are potentially useful as bright contrast agents for molecular diagnostics. One promising strategy for biomedical diagnostics and imaging is to functionalize various particle types ("flavors", each emitting a unique spectral signature, to target a large multiplexed panel of molecular biomarkers. While SERS particles emit narrow spectral features that allow them to be easily separable under ideal conditions, the presence of competing noise sources and background signals such as detector noise, laser background, and autofluorescence confounds the reliability of demultiplexing algorithms. Results obtained during time-constrained in vivo imaging experiments may not be reproducible or accurate. Therefore, our goal is to provide experimentalists with a metric that may be monitored to enforce a desired bound on accuracy within a user-defined confidence level. We have defined a spectral reliability index (SRI, based on the output of a direct classical least-squares (DCLS demultiplexing routine, which provides a measure of the reliability of the computed nanoparticle concentrations and ratios. We present simulations and experiments to demonstrate the feasibility of this strategy, which can potentially be utilized for a range of instruments and biomedical applications involving multiplexed SERS nanoparticles.

  6. Laguerre Gaussian beam multiplexing through turbulence

    CSIR Research Space (South Africa)

    Trichili, A

    2014-08-17

    Full Text Available We analyze the effect of atmospheric turbulence on the propagation of multiplexed Laguerre Gaussian modes. We present a method to multiplex Laguerre Gaussian modes using digital holograms and decompose the resulting field after encountering a...

  7. A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

    Science.gov (United States)

    Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

    2007-11-01

    The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

  8. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  9. A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

    Science.gov (United States)

    Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

    2010-09-01

    The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

  10. A multiplexed method for kinetic measurements of apoptosis and proliferation using live-content imaging.

    Science.gov (United States)

    Artymovich, Katherine; Appledorn, Daniel M

    2015-01-01

    In vitro cell proliferation and apoptosis assays are widely used to study cancer cell biology. Commonly used methodologies are however performed at a single, user-defined endpoint. We describe a kinetic multiplex assay incorporating the CellPlayer(TM) NucLight Red reagent to measure proliferation and the CellPlayer(TM) Caspase-3/7 reagent to measure apoptosis using the two-color, live-content imaging platform, IncuCyte(TM) ZOOM. High-definition phase-contrast images provide an additional qualitative validation of cell death based on morphological characteristics. The kinetic data generated using this strategy can be used to derive informed pharmacology measurements to screen potential cancer therapeutics.

  11. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  12. Differential expression analysis of boron transporters and some stress-related genes in response to 24-epibrassinolide and boron by semi-quantitative RT-PCR in Arabidopsis thaliana (L. Heynh

    Directory of Open Access Journals (Sweden)

    Surgun Yonca

    2016-01-01

    Full Text Available Plant steroidal hormones, brassinosteroids (BRs, promote plant developmental processes and enhance tolerance to several abiotic stresses including high boron (B stress. To examine the possible role of BR in high B-induced stress at the transcriptional level, we investigated the response of B transporter genes (BOR1-4, high B-induced genes (MATE, Hsp-like, BR-induced genes (Hsp70-4, Hsp90-1 and other stress-related genes (LTI/COR78, LEA4-5 upon exogenous treatments of 24-epibrassinolide (EBL on Arabidopsis thaliana (L. Heynh exposed to high concentrations of boric acid (BA using semi-quantitative RT-PCR. BA treatments led to down regulation of BOR1 and BOR3 genes in leaf and root tissues and higher concentration of EBL further decreased expression of these genes in roots. The expression of high B-induced genes was observed to be upregulated by 1 μM EBL treatment under high B stress in both tissues of the seedlings. The upregulation of BR-induced genes were clearly evident in root tissues co-treated with 1 μM EBL and BA as compared to BA alone. Higher concentration of EBL was found to be more effective in increasing expression of LTI/COR78 gene in root and LEA4-5 gene in shoot tissues. To our knowledge, this is the first report how exogenous application of EBL modulates high B stress responses at molecular level in model plant Arabidopsis thaliana.

  13. Assessing gene expression during pathogenesis: Use of qRT-PCR to follow toxin production in the entomopathogenic fungus Beauveria bassiana during infection and immune response of the insect host Triatoma infestans.

    Science.gov (United States)

    Lobo, Luciana S; Luz, Christian; Fernandes, Éverton K K; Juárez, M Patricia; Pedrini, Nicolás

    2015-06-01

    Entomopathogenic fungi secrete toxic secondary metabolites during the invasion of the insect hemocoel as part of the infection process. Although these compounds have been frequently mentioned as virulence factors, the roles of many of them remain poorly understood, including the question of whether they are expressed during the infection process. A major hurdle to this issue remains the low sensitivity of biochemical detection techniques (e.g., HPLC) within the complex samples that may contain trace quantities of fungal molecules inside the insect. In this study, quantitative reverse transcription real-time PCR (qRT-PCR) was used to measure the transcript levels within the insect fungal pathogen Beauveria bassiana, that encode for the synthetase enzymes of the secondary metabolites tenellin (BbtenS), beauvericin (BbbeaS) and bassianolide (BbbslS) during the infection of Triatoma infestans, a Chagas disease insect vector. Absolute quantification was performed at different time periods after insect treatment with various concentrations of propagules, either by immersing the insects in conidial suspensions or by injecting them with blastospores. Both BbtenS and BbbeaS were highly expressed in conidia-treated insects at days 3 and 12 post-treatment. In blastospore-injected insects, BbtenS and BbbeaS expression peaked at 24h post-injection and were also highly expressed in insect cadavers. The levels of BbbslS transcripts were much lower in all conditions tested. The expression patterns of insect genes encoding proteins that belong to the T. infestans humoral immune system were also evaluated with the same technique. This qPCR-based methodology can contribute to decifering the dynamics of entomopathogenic fungal infection at the molecular level. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  15. An analog method of cross-talk compensation for a RGB wavelength division multiplexed optical link

    Science.gov (United States)

    Chisholm, George; Leveneur, Jérôme; Futter, John; Kennedy, John

    2018-06-01

    Pulse-width modulation (PWM) over optical fiber can be a very advantageous data transmission approach when an electrically isolated data link is required. The use of wavelength division multiplexing allows multiple data streams to be sent through a single fiber independently. The present investigation aims to demonstrate a novel approach to reduce cross-talk in a three-channel RGB optical link without the need for complex optical componentry. An op-amp circuit is developed to reduce the cross-talk so that the resolution of the PWM data is preserved. An iterative Monte-Carlo simulation approach is used to optimize the op-amp circuit. The approach is developed for a set of three PWM Hall effect magnetometers with 12-bit resolution and 128 Hz sampling rate. We show that, in these conditions, the loss of resolution due to cross-talk is prevented. We also show that the cross-talk compensation allows the RGB PWM link to outperform other transmission schemes.

  16. Developmental and internal validation of a novel 13 loci STR multiplex method for Cannabis sativa DNA profiling.

    Science.gov (United States)

    Houston, Rachel; Birck, Matthew; Hughes-Stamm, Sheree; Gangitano, David

    2017-05-01

    Marijuana (Cannabis sativa L.) is a plant cultivated and trafficked worldwide as a source of fiber (hemp), medicine, and intoxicant. The development of a validated method using molecular techniques such as short tandem repeats (STRs) could serve as an intelligence tool to link multiple cases by means of genetic individualization or association of cannabis samples. For this purpose, a 13 loci STR multiplex method was developed, optimized, and validated according to relevant ISFG and SWGDAM guidelines. The STR multiplex consists of 13 previously described C. sativa STR loci: ANUCS501, 9269, 4910, 5159, ANUCS305, 9043, B05, 1528, 3735, CS1, D02, C11, and H06. A sequenced allelic ladder consisting of 56 alleles was designed to accurately genotype 101 C. sativa samples from three seizures provided by a U.S. Customs and Border Protection crime lab. Using an optimal range of DNA (0.5-1.0ng), validation studies revealed well-balanced electropherograms (inter-locus balance range: 0.500-1.296), relatively balanced heterozygous peaks (mean peak height ratio of 0.83 across all loci) with minimal artifacts and stutter ratio (mean stutter of 0.021 across all loci). This multi-locus system is relatively sensitive (0.13ng of template DNA) with a combined power of discrimination of 1 in 55 million. The 13 STR panel was found to be species specific for C. sativa; however, non-specific peaks were produced with Humulus lupulus. The results of this research demonstrate the robustness and applicability of this 13 loci STR system for forensic DNA profiling of marijuana samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Development and preliminary evaluation of a multiplexed amplification and next generation sequencing method for viral hemorrhagic fever diagnostics.

    Directory of Open Access Journals (Sweden)

    Annika Brinkmann

    2017-11-01

    Full Text Available We describe the development and evaluation of a novel method for targeted amplification and Next Generation Sequencing (NGS-based identification of viral hemorrhagic fever (VHF agents and assess the feasibility of this approach in diagnostics.An ultrahigh-multiplex panel was designed with primers to amplify all known variants of VHF-associated viruses and relevant controls. The performance of the panel was evaluated via serially quantified nucleic acids from Yellow fever virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever (CCHF virus, Ebola virus, Junin virus and Chikungunya virus in a semiconductor-based sequencing platform. A comparison of direct NGS and targeted amplification-NGS was performed. The panel was further tested via a real-time nanopore sequencing-based platform, using clinical specimens from CCHF patients.The multiplex primer panel comprises two pools of 285 and 256 primer pairs for the identification of 46 virus species causing hemorrhagic fevers, encompassing 6,130 genetic variants of the strains involved. In silico validation revealed that the panel detected over 97% of all known genetic variants of the targeted virus species. High levels of specificity and sensitivity were observed for the tested virus strains. Targeted amplification ensured viral read detection in specimens with the lowest virus concentration (1-10 genome equivalents and enabled significant increases in specific reads over background for all viruses investigated. In clinical specimens, the panel enabled detection of the causative agent and its characterization within 10 minutes of sequencing, with sample-to-result time of less than 3.5 hours.Virus enrichment via targeted amplification followed by NGS is an applicable strategy for the diagnosis of VHFs which can be adapted for high-throughput or nanopore sequencing platforms and employed for surveillance or outbreak monitoring.

  19. Development and preliminary evaluation of a multiplexed amplification and next generation sequencing method for viral hemorrhagic fever diagnostics.

    Science.gov (United States)

    Brinkmann, Annika; Ergünay, Koray; Radonić, Aleksandar; Kocak Tufan, Zeliha; Domingo, Cristina; Nitsche, Andreas

    2017-11-01

    We describe the development and evaluation of a novel method for targeted amplification and Next Generation Sequencing (NGS)-based identification of viral hemorrhagic fever (VHF) agents and assess the feasibility of this approach in diagnostics. An ultrahigh-multiplex panel was designed with primers to amplify all known variants of VHF-associated viruses and relevant controls. The performance of the panel was evaluated via serially quantified nucleic acids from Yellow fever virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever (CCHF) virus, Ebola virus, Junin virus and Chikungunya virus in a semiconductor-based sequencing platform. A comparison of direct NGS and targeted amplification-NGS was performed. The panel was further tested via a real-time nanopore sequencing-based platform, using clinical specimens from CCHF patients. The multiplex primer panel comprises two pools of 285 and 256 primer pairs for the identification of 46 virus species causing hemorrhagic fevers, encompassing 6,130 genetic variants of the strains involved. In silico validation revealed that the panel detected over 97% of all known genetic variants of the targeted virus species. High levels of specificity and sensitivity were observed for the tested virus strains. Targeted amplification ensured viral read detection in specimens with the lowest virus concentration (1-10 genome equivalents) and enabled significant increases in specific reads over background for all viruses investigated. In clinical specimens, the panel enabled detection of the causative agent and its characterization within 10 minutes of sequencing, with sample-to-result time of less than 3.5 hours. Virus enrichment via targeted amplification followed by NGS is an applicable strategy for the diagnosis of VHFs which can be adapted for high-throughput or nanopore sequencing platforms and employed for surveillance or outbreak monitoring.

  20. Multiplex editing system

    DEFF Research Database (Denmark)

    2015-01-01

    The present invention relates to a multiplex editing system. The system allows multiple editing of nucleic acid sequences such as genomic sequences, such as knockins of genes of interest in a genome, knockouts of genomic sequences and/or allele replacement. Also provided herein are a method...... for editing nucleic acids and a cell comprising a stably integrated endonuclease....

  1. Performance Evaluation of the Bioneer AccuPower® HIV-1 Quantitative RT-PCR kit: Comparison with the Roche COBAS® AmpliPrep/COBAS TaqMan® HIV-1 Test Ver.2.0 for Quantification of HIV-1 Viral Load in Indonesia.

    Science.gov (United States)

    Kosasih, Agus Susanto; Sugiarto, Christine; Hayuanta, Hubertus Hosti; Juhaendi, Runingsih; Setiawan, Lyana

    2017-08-08

    Measurement of viral load in human immunodeficiency virus type 1 (HIV-1) infected patients is essential for the establishment of a therapeutic strategy. Several assays based on qPCR are available for the measurement of viral load; they differ in sample volume, technology applied, target gene, sensitivity and dynamic range. The Bioneer AccuPower® HIV-1 Quantitative RT-PCR is a novel commercial kit that has not been evaluated for its performance. This study aimed to evaluate the performance of the Bioneer AccuPower® HIV-1 Quantitative RT-PCR kit. In total, 288 EDTA plasma samples from the Dharmais Cancer Hospital were analyzed with the Bioneer AccuPower® HIV-1 Quantitative RT-PCR kit and the Roche COBAS? AmpliPrep/COBAS® TaqMan® HIV-1 version 2.0 (CAP/CTM v2.0). The performance of the Bioneer assay was then evaluated against the Roche CAP/CTM v2.0. Overall, there was good agreement between the two assays. The Bioneer assay showed significant linear correlation with CAP/CTM v2.0 (R2=0.963, plaboratories.

  2. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

    Science.gov (United States)

    Hubalkova, Zora; Rencova, Eva

    2011-10-01

    A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

  3. Polarization-multiplexing ghost imaging

    Science.gov (United States)

    Dongfeng, Shi; Jiamin, Zhang; Jian, Huang; Yingjian, Wang; Kee, Yuan; Kaifa, Cao; Chenbo, Xie; Dong, Liu; Wenyue, Zhu

    2018-03-01

    A novel technique for polarization-multiplexing ghost imaging is proposed to simultaneously obtain multiple polarimetric information by a single detector. Here, polarization-division multiplexing speckles are employed for object illumination. The light reflected from the objects is detected by a single-pixel detector. An iterative reconstruction method is used to restore the fused image containing the different polarimetric information by using the weighted sum of the multiplexed speckles based on the correlation coefficients obtained from the detected intensities. Next, clear images of the different polarimetric information are recovered by demultiplexing the fused image. The results clearly demonstrate that the proposed method is effective.

  4. Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of -Thalassemia

    Directory of Open Access Journals (Sweden)

    Raquel M. Fernández

    2013-01-01

    Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.

  5. Robust and efficient direct multiplex amplification method for large-scale DNA detection of blood samples on FTA cards

    International Nuclear Information System (INIS)

    Jiang Bowei; Xiang Fawei; Zhao Xingchun; Wang Lihua; Fan Chunhai

    2013-01-01

    Deoxyribonucleic acid (DNA) damage arising from radiations widely occurred along with the development of nuclear weapons and clinically wide application of computed tomography (CT) scan and nuclear medicine. All ionizing radiations (X-rays, γ-rays, alpha particles, etc.) and ultraviolet (UV) radiation lead to the DNA damage. Polymerase chain reaction (PCR) is one of the most wildly used techniques for detecting DNA damage as the amplification stops at the site of the damage. Improvements to enhance the efficiency of PCR are always required and remain a great challenge. Here we establish a multiplex PCR assay system (MPAS) that is served as a robust and efficient method for direct detection of target DNA sequences in genomic DNA. The establishment of the system is performed by adding a combination of PCR enhancers to standard PCR buffer, The performance of MPAS was demonstrated by carrying out the direct PCR amplification on l.2 mm human blood punch using commercially available primer sets which include multiple primer pairs. The optimized PCR system resulted in high quality genotyping results without any inhibitory effect indicated and led to a full-profile success rate of 98.13%. Our studies demonstrate that the MPAS provides an efficient and robust method for obtaining sensitive, reliable and reproducible PCR results from human blood samples. (authors)

  6. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  8. miRge - A Multiplexed Method of Processing Small RNA-Seq Data to Determine MicroRNA Entropy.

    Directory of Open Access Journals (Sweden)

    Alexander S Baras

    Full Text Available Small RNA RNA-seq for microRNAs (miRNAs is a rapidly developing field where opportunities still exist to create better bioinformatics tools to process these large datasets and generate new, useful analyses. We built miRge to be a fast, smart small RNA-seq solution to process samples in a highly multiplexed fashion. miRge employs a Bayesian alignment approach, whereby reads are sequentially aligned against customized mature miRNA, hairpin miRNA, noncoding RNA and mRNA sequence libraries. miRNAs are summarized at the level of raw reads in addition to reads per million (RPM. Reads for all other RNA species (tRNA, rRNA, snoRNA, mRNA are provided, which is useful for identifying potential contaminants and optimizing small RNA purification strategies. miRge was designed to optimally identify miRNA isomiRs and employs an entropy based statistical measurement to identify differential production of isomiRs. This allowed us to identify decreasing entropy in isomiRs as stem cells mature into retinal pigment epithelial cells. Conversely, we show that pancreatic tumor miRNAs have similar entropy to matched normal pancreatic tissues. In a head-to-head comparison with other miRNA analysis tools (miRExpress 2.0, sRNAbench, omiRAs, miRDeep2, Chimira, UEA small RNA Workbench, miRge was faster (4 to 32-fold and was among the top-two methods in maximally aligning miRNAs reads per sample. Moreover, miRge has no inherent limits to its multiplexing. miRge was capable of simultaneously analyzing 100 small RNA-Seq samples in 52 minutes, providing an integrated analysis of miRNA expression across all samples. As miRge was designed for analysis of single as well as multiple samples, miRge is an ideal tool for high and low-throughput users. miRge is freely available at http://atlas.pathology.jhu.edu/baras/miRge.html.

  9. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders

    2005-01-01

    species-specific detection of Campylobacter spp. in naturally infected pig faecal samples after an enrichment step, whereas the hybridization approach enhanced the specific isolation of C. jejuni (present in minority to C. coli) from pigs. Conclusions: The rt-PCR was specific for Campylobacter jejuni, C...... by phenotypic methods and the developed rt-PCR provides an easy and fast method for such differentiation. Detection of C. jejuni by colony hybridization may increase the isolation rate of this species from pig faeces....

  10. Percolation in real multiplex networks

    Science.gov (United States)

    Bianconi, Ginestra; Radicchi, Filippo

    2016-12-01

    We present an exact mathematical framework able to describe site-percolation transitions in real multiplex networks. Specifically, we consider the average percolation diagram valid over an infinite number of random configurations where nodes are present in the system with given probability. The approach relies on the locally treelike ansatz, so that it is expected to accurately reproduce the true percolation diagram of sparse multiplex networks with negligible number of short loops. The performance of our theory is tested in social, biological, and transportation multiplex graphs. When compared against previously introduced methods, we observe improvements in the prediction of the percolation diagrams in all networks analyzed. Results from our method confirm previous claims about the robustness of real multiplex networks, in the sense that the average connectedness of the system does not exhibit any significant abrupt change as its individual components are randomly destroyed.

  11. Carcinoma multiplex

    International Nuclear Information System (INIS)

    Shah, S. A.; Riaz, U.; Zahoor, I.; Jalil, A.; Zubair, M.

    2013-01-01

    Multiple primaries in a single patient are uncommon, though not very rare. The existence of such cancers in two un-related, non-paired organs is even more un-common. Here, we present a case of 55 years old male who presented to us with a mucoepidermoid carcinoma of the parotid gland and was operated. Later on, he presented with a large cystic swelling in the pelvis which turned out to be pseudomyxoma peritonei. A review of slides and immunohistochemistry indicated it to be adenocarcinoma colon. He presented again with recurrent mucoepidermoid carcinoma of the parotid which was operated successfully with the use of myocutaneous flap for wound closure. He is currently undergoing chemotherapy. In order to establish a separate mono-clonal etiology of both tumours, immunohistochemistry was performed. To the best of our knowledge, carcinoma multiplex in the colon and the parotid has never been reported before. (author)

  12. Rapid multiplex high resolution melting method to analyze inflammatory related SNPs in preterm birth

    Directory of Open Access Journals (Sweden)

    Pereyra Silvana

    2012-01-01

    Full Text Available Abstract Background Complex traits like cancer, diabetes, obesity or schizophrenia arise from an intricate interaction between genetic and environmental factors. Complex disorders often cluster in families without a clear-cut pattern of inheritance. Genomic wide association studies focus on the detection of tens or hundreds individual markers contributing to complex diseases. In order to test if a subset of single nucleotide polymorphisms (SNPs from candidate genes are associated to a condition of interest in a particular individual or group of people, new techniques are needed. High-resolution melting (HRM analysis is a new method in which polymerase chain reaction (PCR and mutations scanning are carried out simultaneously in a closed tube, making the procedure fast, inexpensive and easy. Preterm birth (PTB is considered a complex disease, where genetic and environmental factors interact to carry out the delivery of a newborn before 37 weeks of gestation. It is accepted that inflammation plays an important role in pregnancy and PTB. Methods Here, we used real time-PCR followed by HRM analysis to simultaneously identify several gene variations involved in inflammatory pathways on preterm labor. SNPs from TLR4, IL6, IL1 beta and IL12RB genes were analyzed in a case-control study. The results were confirmed either by sequencing or by PCR followed by restriction fragment length polymorphism. Results We were able to simultaneously recognize the variations of four genes with similar accuracy than other methods. In order to obtain non-overlapping melting temperatures, the key step in this strategy was primer design. Genotypic frequencies found for each SNP are in concordance with those previously described in similar populations. None of the studied SNPs were associated with PTB. Conclusions Several gene variations related to the same inflammatory pathway were screened through a new flexible, fast and non expensive method with the purpose of analyzing

  13. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    Science.gov (United States)

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M-RT-PCR

  14. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

    DEFF Research Database (Denmark)

    Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

    2013-01-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay....... The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel...... testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...

  15. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  16. Conversion of a Capture ELISA to a Luminex xMAP Assay using a Multiplex Antibody Screening Method

    Science.gov (United States)

    Baker, Harold N.; Murphy, Robin; Lopez, Erica; Garcia, Carlos

    2012-01-01

    The enzyme-linked immunosorbent assay (ELISA) has long been the primary tool for detection of analytes of interest in biological samples for both life science research and clinical diagnostics. However, ELISA has limitations. It is typically performed in a 96-well microplate, and the wells are coated with capture antibody, requiring a relatively large amount of sample to capture an antigen of interest . The large surface area of the wells and the hydrophobic binding of capture antibody can also lead to non-specific binding and increased background. Additionally, most ELISAs rely upon enzyme-mediated amplification of signal in order to achieve reasonable sensitivity. Such amplification is not always linear and can thus skew results. In the past 15 years, a new technology has emerged that offers the benefits of the ELISA, but also enables higher throughput, increased flexibility, reduced sample volume, and lower cost, with a similar workflow 1, 2. Luminex xMAP Technology is a microsphere (bead) array platform enabling both monoplex and multiplex assays that can be applied to both protein and nucleic acid applications 3-5. The beads have the capture antibody covalently immobilized on a smaller surface area, requiring less capture antibody and smaller sample volumes, compared to ELISA, and non-specific binding is significantly reduced. Smaller sample volumes are important when working with limiting samples such as cerebrospinal fluid, synovial fluid, etc. 6. Multiplexing the assay further reduces sample volume requirements, enabling multiple results from a single sample. Recent improvements by Luminex include: the new MAGPIX system, a smaller, less expensive, easier-to-use analyzer; Low-Concentration Magnetic MagPlex Microspheres which eliminate the need for expensive filter plates and come in a working concentration better suited for assay development and low-throughput applications; and the xMAP Antibody Coupling (AbC) Kit, which includes a protocol, reagents, and

  17. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  18. An accurate, specific, sensitive, high-throughput method based on a microsphere immunoassay for multiplex detection of three viruses and bacterial fruit blotch bacterium in cucurbits.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Makornwattana, Manlika; Himananto, Orawan; Seepiban, Channarong; Phuengwas, Sudtida; Warin, Nuchnard; Gajanandana, Oraprapai; Karoonuthaisiri, Nitsara

    2017-09-01

    To employ a microsphere immunoassay (MIA) to simultaneously detect multiple plant pathogens (potyviruses, Watermelon silver mottle virus, Melon yellow spot virus, and Acidovorax avenae subsp. citrulli) in actual plant samples, several factors need to be optimized and rigorously validated. Here, a simple extraction method using a single extraction buffer was successfully selected to detect the four pathogens in various cucurbit samples (cucumber, cantaloupe, melon, and watermelon). The extraction method and assay performance were validated with inoculated and field cucurbit samples. The MIA showed 98-99% relative accuracy, 97-100% relative specificity and 92-100% relative sensitivity when compared to commercial ELISA kits and reverse transcription PCR. In addition, the MIA was also able to accurately detect multiple-infected field samples. The results demonstrate that one common extraction method for all tested cucurbit samples could be applied to detect multiple pathogens; avoiding the need for multiple protocols to be employed. This multiplex method can therefore be instrumental for high-throughput screening of multiple plant pathogens with many advantages such as a shorter assay time (2.5h) with single assay format, a lower cost of detection ($5 vs $19.7 for 4 pathogens/sample) and less labor requirement. Its multiplex capacity can also be expanded to detect up to 50 different pathogens upon the availability of specific antibodies. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

    Science.gov (United States)

    Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

    2017-07-10

    Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

  20. Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

    Science.gov (United States)

    Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

    2013-08-01

    Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

  1. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  2. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FT