WorldWideScience

Sample records for monomer response element

  1. Effect of organoelemental compounds of group 3 elements on radical polymerization of vinyl monomers

    International Nuclear Information System (INIS)

    Grishin, D.F.; Mojkin, A.A.

    1996-01-01

    When alkyl, alkyl alkoxy, and alkyl halide derivatives of boron and aluminium are introduced into the system in amounts that are comparable to the concentration of initiator, they coordinate to the growing macroradicals, thus changing their reactivity, and exert regulating effect on the rate of polymerization of vinyl monomers and the molecular mass of the resulting polymers. The said organoelemental compounds accelerate the polymerization of butyl acrylate, methyl methacrylate, acrylonitrile, vinyl acetate, and vinylidene chloride, reduce the molecular mass of acrylic polymers, and virtually do not affect the polymerization of styrene. The specific features of vinyl polymerization are associated with participation of organoelemental additives at the stages of chain growth and chain termination and can be explained within the framework of the mechanism of radical-coordination polymerization. 32 refs., 3 tabs

  2. Simulation study ε-Caprolactam monomer and metallic elements migration from irradiated polymeric packaging into food stimulants

    International Nuclear Information System (INIS)

    Rosa, Faena Machado Leite

    2008-01-01

    For decades migration study of chemical compounds from packaging into food, such as metals, residual monomers and additives, is a very important issue, concerning public health and minimize chemical contamination. In this work, it was done irradiations of packagings taken in contact with food simulant, and it was studied this migration through a mathematical model of the diffusion process, compiled in a computational simulation method in order to study the microscopic behavior of migration of metallic elements cadmium, chromium, antimony and cobalt, present in metallic plastics from dairy product packagings, and also the migration of - caprolactam monomer, present in nylon polymeric plastics used for package meat stuffs, to the food simulant acetic acid 3%. The results from simulations of the migration of -caprolactam monomer were compared with experimental results obtained from high resolution gas chromatography (HRGC) measurements, and the simulation of metallic elements migration were compared with the neutron activation analysis measurements (NAA). These experimental results were performed and kindly informed by another research groups, partners in this project. The food packaging system was discretized in one-dimension space and in time and the partial differential equation that defines the diffusive process, the second 'Fick's law', together with an equation of Arrhenius type dealing with the thermal influence, were solved using finite differences. The final step of the resolution was a tridiagonal linear system, solved using the Thomas algorithm. It was studied, and in some cases even foreseen, experimental quantities, like the diffusion coefficient, activation energy and concentration profile of migrant compounds, allowing the understanding of the diffusion process and the quantitative estimate of the migration of such compounds under ionizing radiation influence. Variation on the initial concentration levels (C 0 ) of the monomer inside the packaging

  3. Response of ethylene propylene diene monomer rubber (EPDM) to simulant Hanford tank waste

    Energy Technology Data Exchange (ETDEWEB)

    NIGREY,PAUL J.

    2000-02-01

    This report presents the findings of the Chemical Compatibility Program developed to evaluate plastic packaging components that may be incorporated in packaging mixed-waste forms for transportation. Consistent with the methodology outlined in this report, the author performed the second phase of this experimental program to determine the effects of simulant Hanford tank mixed wastes on packaging seal materials. That effort involved the comprehensive testing of five plastic liner materials in an aqueous mixed-waste simulant. The testing protocol involved exposing the materials to {approximately}143, 286, 571, and 3,670 krad of gamma radiation and was followed by 7-, 14-, 28-, 180-day exposures to the waste simulant at 18, 50, and 60 C. Ethylene propylene diene monomer (EPDM) rubber samples subjected to the same protocol were then evaluated by measuring seven material properties: specific gravity, dimensional changes, mass changes, hardness, compression set, vapor transport rates, and tensile properties. The author has determined that EPDM rubber has excellent resistance to radiation, this simulant, and a combination of these factors. These results suggest that EPDM is an excellent seal material to withstand aqueous mixed wastes having similar composition to the one used in this study.

  4. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  5. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  6. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  7. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  8. The effect of distribution of monomer moiety on the pH response and mechanical properties of poly(acrylonitrile-co-acrylic acid) copolymers

    International Nuclear Information System (INIS)

    Sahoo, Anasuya; Jassal, Manjeet; Agrawal, Ashwini K

    2010-01-01

    The pH response and mechanical properties of copolymer-based hydrogels such as poly(acrylonitrile-co-acrylic acid) are usually attributed to their chemical composition. In this study, it has been shown that the architecture of the polymer chains, i.e. the distribution of comonomers in the macromolecules, also plays a major role in controlling these properties. A series of four poly(acrylonitrile-co-acrylic acids) with fixed composition (i.e. ∼30 mol% acrylic acid moieties) were synthesized, where the block lengths of both AN (acrylonitrile) and AAc (acrylic acid) moieties in the copolymers were varied by controlling the feeding pattern of the monomers during free radical copolymerization. These copolymers were then converted into fine fibers of the same dimensions. The monomer distribution in the four copolymers was estimated using quantitative carbon 13 C nuclear magnetic resonance (NMR) and related to the mechanical and pH response properties of the resultant fibers. The pH response of the fibers with similar composition increased dramatically as the block length of the AAc moiety was increased, while the mechanical properties increased as a direct function of the block length of the AN moieties. The fiber's response at pH 10 in terms of the change in length increased by ∼four times while its response rate increased by ∼50 times with the increase in block length of the AAc moiety. On the other hand, the tensile properties and retractive stress increased by ∼four times with the increase in the block length of the AN moiety

  9. The effect of distribution of monomer moiety on the pH response and mechanical properties of poly(acrylonitrile-co-acrylic acid) copolymers

    Science.gov (United States)

    Sahoo, Anasuya; Jassal, Manjeet; Agrawal, Ashwini K.

    2010-02-01

    The pH response and mechanical properties of copolymer-based hydrogels such as poly(acrylonitrile-co-acrylic acid) are usually attributed to their chemical composition. In this study, it has been shown that the architecture of the polymer chains, i.e. the distribution of comonomers in the macromolecules, also plays a major role in controlling these properties. A series of four poly(acrylonitrile-co-acrylic acids) with fixed composition (i.e. ~30 mol% acrylic acid moieties) were synthesized, where the block lengths of both AN (acrylonitrile) and AAc (acrylic acid) moieties in the copolymers were varied by controlling the feeding pattern of the monomers during free radical copolymerization. These copolymers were then converted into fine fibers of the same dimensions. The monomer distribution in the four copolymers was estimated using quantitative carbon 13C nuclear magnetic resonance (NMR) and related to the mechanical and pH response properties of the resultant fibers. The pH response of the fibers with similar composition increased dramatically as the block length of the AAc moiety was increased, while the mechanical properties increased as a direct function of the block length of the AN moieties. The fiber's response at pH 10 in terms of the change in length increased by ~four times while its response rate increased by ~50 times with the increase in block length of the AAc moiety. On the other hand, the tensile properties and retractive stress increased by ~four times with the increase in the block length of the AN moiety.

  10. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  11. Novel biocompatible hydrogel nanoparticles: generation and size-tuning of nanoparticles by the formation of micelle templates obtained from thermo-responsive monomers mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Khandadash, Raz; Machtey, Victoria [Bar Ilan University, Department of Chemistry (Israel); Shainer, Inbal [Tel-Aviv University, Department of Neurobiology, The George S. Wise Faculty of Life Sciences (Israel); Gottlieb, Hugo E. [Bar Ilan University, Department of Chemistry (Israel); Gothilf, Yoav [Tel-Aviv University, Department of Neurobiology, The George S. Wise Faculty of Life Sciences, and Sagol School of Neuroscience (Israel); Ebenstein, Yuval [Tel Aviv University, Raymond and Beverly Sackler Faculty of Exact Sciences, School of Chemistry (Israel); Weiss, Aryeh [Bar Ilan University, School of Engineering (Israel); Byk, Gerardo, E-mail: gerardo.byk@biu.ac.il [Bar Ilan University, Department of Chemistry (Israel)

    2014-12-15

    Biocompatible hydrogel nanoparticles are prepared by polymerization and cross-linking of N-isopropyl acrylamide in a micelle template formed by block copolymers macro-monomers at high temperature. Different monomer ratios form, at high temperature, well-defined micelles of different sizes which are further polymerized leading to nanoparticles with varied sizes from 20 to 390 nm. Physico-chemical characterization of the nanoparticles demonstrates their composition and homogeneity. The NPs were tested in vitro and in vivo biocompatibility assays, and their lack of toxicity was proven. The NPs can be labeled with fluorescent probes, and their intracellular fate can be visualized and quantified using confocal microscopy. Their uptake by live stem cells and distribution in whole developing animals is reported. On the basis of our results, a mechanism of nanoparticle formation is suggested. The lack of toxicity makes these nanoparticles especially attractive for biological applications such as screening and bio-sensing.

  12. Monomers and Monomer Mixtures Used in Impregnation of Fibrous Materials

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1968-10-15

    Some important properties of monomers and polymers in relation to their use for reinforcement of fibrous materials are listed. Some monomers and their properties important in impregnation of fibrous materials are also listed. In general it is not advantageous to use a pure monomer for impregnation but rather a mixture of monomers or a mixture of a monomer and a low molecular weight polymer such as unsaturated polyester. Some of these mixtures which have been well studied in connection with WPC are listed together with some of their properties when used in WPC. Other monomer mixtures may well come in question and other monomers can probably be used. For instance, it is reported from Japan that the cheap monomer ethyleneoxide, which cannot be polymerized by gamma radiation as such, can be polymerized (in bulk) as a mixture with methylmethacrylate. Good results with WPC have generally been obtained without swelling agents but more is grafted if some swelling agent is used, and it is possible that a swelling agent might be useful in the case of fibre-boards. Solvents, plasticizers, crosslinkable natural resins, aromatic chlorinated hydrocarbons, and retardants can be added, and with their use the properties of WPC can be widely modified. For example, a chlorinated wax can act as retardant, can reduce the total dose of radiation and can increase the flame resistance simultaneously.

  13. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  14. Ionic Liquid Epoxy Resin Monomers

    Science.gov (United States)

    Paley, Mark S. (Inventor)

    2013-01-01

    Ionic liquid epoxide monomers capable of reacting with cross-linking agents to form polymers with high tensile and adhesive strengths. Ionic liquid epoxide monomers comprising at least one bis(glycidyl) N-substituted nitrogen heterocyclic cation are made from nitrogen heterocycles corresponding to the bis(glycidyl) N-substituted nitrogen heterocyclic cations by a method involving a non-nucleophilic anion, an alkali metal cation, epichlorohydrin, and a strong base.

  15. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  16. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  17. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  18. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  19. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  20. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  1. Complex-radical copolymerization of vinyl monomers on organoelemental initiators

    International Nuclear Information System (INIS)

    Grishin, D.F.

    1993-01-01

    Data on regularities of the initiation and growth of the (co)polymerization of polar vinyl series monomers on organo-elemental initiator, organo-boron in particular, are generalized. The effect of organo-metallic compounds and some phenol type inhibitors on the rate of acrylate (co)polymerization is analyzed from view of the change of electroacceptor properties (electrophilicity) of macroradicals

  2. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  4. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  5. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  6. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  7. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  8. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  9. Surface active monomers synthesis, properties, and application

    CERN Document Server

    Borzenkov, Mykola

    2014-01-01

    This brief includes information on the background?of and development of synthesis of various types of surface active monomers. The authors explain the importance of utilization of surface active monomers for creation of surface active polymers? and the various biomedical applications of such compounds . This brief introduces techniques for the synthesis of novel types of surface active monomers, their colloidal and polymerizable properties and application for needs of medicine and biology.

  10. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  11. Monomers capable of forming four hydrogen bridges and supramolecular polymers formed by copolymerization of these monomers with regular monomers

    NARCIS (Netherlands)

    2004-01-01

    The invention relates to the synthesis of polymers containing self-complementary quadruple hydrogen groups by copolymerizing monomers containing a quadruple hydrogen bonding group with one or more monomers of choice. The resulting polymers show unique new characteristics due to the presence of

  12. Step growth of two flexible ABf monomers

    DEFF Research Database (Denmark)

    Cameron, Colin; Fawcett, Allan H.; Hetherington, Cecil R.

    2000-01-01

    A three-dimensional lattice model was used to simulate the competition between the growth of hyperbranched structures and cycle formation that occurs when flexible ABf monomers undergo step growth. The monomers in the model are mapped onto several lattice sites. The effect of functionality...

  13. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  14. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  15. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  16. Synthesis and characterization of novel organotin carboxylate maleimide monomers and copolymers

    Directory of Open Access Journals (Sweden)

    2009-06-01

    Full Text Available Two novel tributyltin carboxylate maleimide monomers, tributyltin(maleimidoacetate and tributyltin(4-maleimidobenzoate, were synthesized by condensation reaction of maleimidoacetic acid or 4-maleimidobenzoic acid with bis(tributyltin oxide. Copolymerization of these monomers with styrene was carried in dioxane at 70°C using asobisisobutyronitrile as free radical initiator. The structures of monomers and copolymers were confirmed by FT-IR (Fourier Transform Infrared, 1H and 13C NMR (nuclear magnetic resonance spectroscopy and elemental analysis. The copolymers were characterized by solubility and thermal analysis.

  17. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  18. Valve seat pores sealed with thermosetting monomer

    Science.gov (United States)

    Olmore, A. B.

    1966-01-01

    Hard anodic coating provides a smooth wear resistant value seating surface on a cast aluminum alloy valve body. Vacuum impregnation with a thermosetting monomer, diallyl phthalate, seals the pores on the coating to prevent galvanic corrosion.

  19. Photopolymerizable silicone monomers, oligomers, and resins

    International Nuclear Information System (INIS)

    Jacobine, A.F.; Nakos, S.T.

    1992-01-01

    The purpose of this chapter is to acquaint the general photopolymer researcher with the historical development of the chemistry and technology of photopolymerizable silicone monomers, fluids, and resins. The current status of research in these areas is assessed. The focus of this chapter is not only on the polymer chemistry and application of this technology, but also on important aspects of the synthetic chemistry involved in the preparation of UV-curable silicone monomers, oligomers, and resins. 236 refs., 6 tabs

  20. Effects of monomer shape on the formation of aggregates from a power law monomer distribution

    International Nuclear Information System (INIS)

    Perry, J; Kimery, J; Matthews, L S; Hyde, T W

    2013-01-01

    The coagulation of dust aggregates is an important process in many physical systems such as the Earth's upper atmosphere, comet tails and protoplanetary discs. Numerical models which study the aggregation in these systems typically involve spherical monomers. There is evidence, however, via the polarization of sunlight in the interstellar medium, as well as optical and LIDAR observations of high-altitude particles in Earth's atmosphere (70–100 km), which indicate that dust monomers may not necessarily be spherical. This study investigates the influence of different ellipsoidal monomer shapes on the morphology of aggregates given various distributions of monomer sizes. Populations of aggregates are grown from a single monomer using a combination of ballistic particle–cluster aggregation and ballistic cluster–cluster aggregation regimes incorporating the rotation of monomers and aggregates. The resulting structures of the aggregates are then compared via the compactness factor, geometric cross-section and friction time. (paper)

  1. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  2. Synthesis of the diazonium (perfluoroalkyl) benzenesulfonimide monomer from Nafion monomer for proton exchange membrane fuel cells

    Science.gov (United States)

    Mei, Hua; D'Andrea, Dan; Nguyen, Tuyet-Trinh; Nworie, Chima

    2014-02-01

    One diazonium (perfluoroalkyl) benzenesulfonimide monomer, perfluoro-3, 6-dioxa-4-methyl-7-octene benzenesulfonyl imide, has been synthesized from Nafion monomer for the first time. With trifluorovinyl ether and diazonium precursors, the partially-fluorinated diazonium PFSI monomer can be polymerized and will provide chemically bonding with carbon electrode in proton exchange membrane fuel cells. A systematic study of the synthesis and characterization of this diazonium PFSI monomer has been conducted by varying reaction conditions. The optimized synthesis method has been established in the lab.

  3. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  4. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Preparation of supramolecular polymers by copolymerization of monomers containing quadruple hydrogen bonding units with regular monomers

    NARCIS (Netherlands)

    2004-01-01

    The invention relates to the synthesis of polymers containing self-complementary quadruple hydrogen groups by copolymerizing monomers containing a quadruple hydrogen bonding group with one or more monomers of choice. The resulting polymers show unique new characteristics due to the presence of

  6. Preparation of supramolecular polymers by copolymerization of monomers containing quadruple hydrogen bonding units with regular monomers

    NARCIS (Netherlands)

    2004-01-01

    The invention relates to the synthesis of polymers contg. self-complementary quadruple H groups by copolymg. monomers contg. a quadruple H bonding group with ³1 monomers of choice. The resulting polymers show unique new characteristics due to the presence of addnl. phys. interactions between the

  7. Thermodynamics of monomer partitioning in polymer latices: effect of molar volume of the monomers

    NARCIS (Netherlands)

    Schoonbrood, H.A.S.; German, A.L.

    1994-01-01

    A model of the thermodn. of partitioning of moderately water-sol. monomers in polymer latex systems is developed to show deviations that occur when the molar vols. of the monomers are not similar. The model, as well as expts. with Me acrylate and cyclohexyl methacrylate in polystyrene latex systems,

  8. Scattering Studies of Hydrophobic Monomers in Liposomal Bilayers: An Expanding Shell Model of Monomer Distribution

    International Nuclear Information System (INIS)

    Richter, Andrew; Dergunov, Sergey; Ganus, Bill; Thomas, Zachary; Pingali, Sai Venkatesh; Urban, Volker S.; Liu, Yun; Porcar, Lionel; Pinkhassik, Eugene

    2011-01-01

    Hydrophobic monomers partially phase separate from saturated lipids when loaded into lipid bilayers in amounts exceeding a 1:1 monomer/lipid molar ratio. This conclusion is based on the agreement between two independent methods of examining the structure of monomer-loaded bilayers. Complete phase separation of monomers from lipids would result in an increase in bilayer thickness and a slight increase in the diameter of liposomes. A homogeneous distribution of monomers within the bilayer would not change the bilayer thickness and would lead to an increase in the liposome diameter. The increase in bilayer thickness, measured by the combination of small-angle neutron scattering (SANS) and small-angle X-ray scattering (SAXS), was approximately half of what was predicted for complete phase separation. The increase in liposome diameter, measured by dynamic light scattering (DLS), was intermediate between values predicted for a homogeneous distribution and complete phase separation. Combined SANS, SAXS, and DLS data suggest that at a 1.2 monomer/lipid ratio approximately half of the monomers are located in an interstitial layer sandwiched between lipid sheets. These results expand our understanding of using self-assembled bilayers as scaffolds for the directed covalent assembly of organic nanomaterials. In particular, the partial phase separation of monomers from lipids corroborates the successful creation of nanothin polymer materials with uniform imprinted nanopores. Pore-forming templates do not need to span the lipid bilayer to create a pore in the bilayer-templated films.

  9. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  10. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  11. Radiation cured and monomer modified silicon elastomers

    International Nuclear Information System (INIS)

    Eldred, R.J.

    1979-01-01

    A method is described for the production of a tear resistant silicone elastomer, which has improved elongation properties. This elastomer is the radiation induced reaction product of a noncured methyl vinyl silicone resin (VMQ) and uniformly dispersed therein a blend of a polyfunctional acrylic crosslinking monomer and a filler

  12. New monomers for high performance polymers

    Science.gov (United States)

    Gratz, Roy F.

    1993-01-01

    This laboratory has been concerned with the development of new polymeric materials with high thermo-oxidative stability for use in the aerospace and electronics industries. Currently, there is special emphasis on developing matrix resins and composites for the high speed civil transport (HSCT) program. This application requires polymers that have service lifetimes of 60,000 hr at 350 F (177 C) and that are readily processible into void-free composites, preferably by melt-flow or powder techniques that avoid the use of high boiling solvents. Recent work has focused on copolymers which have thermally stable imide groups separated by flexible arylene ether linkages, some with trifluoromethyl groups attached to the aromatic rings. The presence of trifluoromethyl groups in monomers and polymers often improves their solubility and processibility. The goal of this research was to synthesize several new monomers containing pendant trifluoromethyl groups and to incorporate these monomers into new imide/arylene ether copolymers. Initially, work was begun on the synthesis of three target compounds. The first two, 3,5-dihydroxybenzo trifluoride and 3-amino 5-hydroxybenzo trifluoride, are intermediates in the synthesis of more complex monomers. The third, 3,5-bis (3-amino-phenoxy) benzotrifluoride, is an interesting diamine that could be incorporated into a polyimide directly.

  13. Softening and elution of monomers in ethanol

    DEFF Research Database (Denmark)

    Benetti, Ana Raquel; Asmussen, Erik; Munksgaard, E Christian

    2009-01-01

    The purpose of this study was to investigate the effect of light-curing protocol on softening and elution of monomers in ethanol as measured on a model polymer. It was a further aim to correlate the measured values with previously reported data on degree of conversion and glass transition...

  14. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  15. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  16. The mutual diffusion coefficient for (meth)acrylate monomers as determined with a nuclear microprobe

    International Nuclear Information System (INIS)

    Leewis, Christian M.; Mutsaers, Peter H.A.; Jong, Arthur M. de; Ijzendoorn, Leo J. van; Voigt, Martien J.A. de; Ren, Min Q.; Watt, Frank; Broer, Dirk J.

    2004-01-01

    The value of the mutual diffusion coefficient D V of two acrylic monomers is determined with nuclear microprobe measurements on a set of polymer films. These films have been prepared by allowing the monomers to diffuse into each other for a certain time and subsequently applying fast ultraviolet photo-polymerization, which freezes the concentration profile. The monomer diffusion profiles are studied with a scanning 2.1 MeV proton microprobe. Each monomer contains a marker element, e.g., Cl and Si, which are easily detected with proton induced x-ray emission. From the diffusion profiles, it is possible to determine the mutual diffusion coefficient. The mutual diffusion coefficient is dependent of concentration, which is concluded from the asymmetry in the Cl- and Si-profiles. A linear dependence of the mutual diffusion coefficient on the composition is used as a first order approximation. The best fits are obtained for a value of b=(0.38±0.15), which is the ratio of the diffusion coefficient of 1,3-bis(3-methacryloxypropyl)-1, 1,3,3-tetramethyldisiloxane in pure 2-chloroethyl acrylate and the diffusion coefficient of 2-chloroethyl acrylate in pure 1,3-bis(3-methacryloxypropyl)-1,1,3,3-tetramethyldisiloxane. Under the assumption of a linear dependence of the mutual diffusion coefficient D V on monomer composition, it follows that D V =(2.9±0.6)·10 -10 m 2 /s at a 1:1 monomer ratio. With Flory-Huggins expressions for the monomer chemical potentials, one can derive approximate values for the individual monomer diffusion coefficients

  17. Synergetic interaction between neighbouring platinum monomers in CO2 hydrogenation

    Science.gov (United States)

    Li, Hongliang; Wang, Liangbing; Dai, Yizhou; Pu, Zhengtian; Lao, Zhuohan; Chen, Yawei; Wang, Menglin; Zheng, Xusheng; Zhu, Junfa; Zhang, Wenhua; Si, Rui; Ma, Chao; Zeng, Jie

    2018-05-01

    Exploring the interaction between two neighbouring monomers has great potential to significantly raise the performance and deepen the mechanistic understanding of heterogeneous catalysis. Herein, we demonstrate that the synergetic interaction between neighbouring Pt monomers on MoS2 greatly enhanced the CO2 hydrogenation catalytic activity and reduced the activation energy relative to isolated monomers. Neighbouring Pt monomers were achieved by increasing the Pt mass loading up to 7.5% while maintaining the atomic dispersion of Pt. Mechanistic studies reveal that neighbouring Pt monomers not only worked in synergy to vary the reaction barrier, but also underwent distinct reaction paths compared with isolated monomers. Isolated Pt monomers favour the conversion of CO2 into methanol without the formation of formic acid, whereas CO2 is hydrogenated stepwise into formic acid and methanol for neighbouring Pt monomers. The discovery of the synergetic interaction between neighbouring monomers may create a new path for manipulating catalytic properties.

  18. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  19. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  20. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  1. Photokopolimerisasi monomer akrilat degan kulit kras sapi

    Directory of Open Access Journals (Sweden)

    Dwi Wahini Nurhajati

    1997-06-01

    Full Text Available The research on photocopolymerization of acrylate monomer with cow crust hide had object to observe the resulted copolymer onto cow crust hide. Crust hides, saturated with aqueous emulsions containing 25 wt % of n-butyl acrylate (n-BA or tripropylene glycol diacrylate (TPGDA were irradiated by cobalt – 60 gamma rays with doses ranges from 5 to 25 kGy. The irradiated hides were washed with water, dried in air and extracted in soxhlet apparatus for 48 hours to remove homopolymer. The highest yield of photocopolymerization of n – butyl acrylate monomer with crust hides was found 17,7878% at dose 25 kGy, and for photocopolymerization of tripropylene glycol diacrylate with crust hides was found 39,4245% at dose 20 kGy.

  2. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  3. Radiation crosslinking of PVC with polyfunctional monomers

    International Nuclear Information System (INIS)

    Dobo, J.; Takacs, E.; Csato, P.

    1984-01-01

    The radiation crosslinking of PVC in the presence of ethylene glycol dimethacrylate (EGDM) and of trimethylol propane trimethacrylate (TMPTM) was investigated. The effect of PVC powders of different types on the polymerization rate of these monomers was studied by a Calvet-type microcalorimeter. In the milled PVC sheets containing 50 part EGDM a high concentration of trapped free radicals was found by ESR after 16 months storage. (author)

  4. Kinetics of the monomer-dimer reaction of yeast hexokinase PI.

    Science.gov (United States)

    Hoggett, J G; Kellett, G L

    1992-10-15

    Kinetic studies of the glucose-dependent monomer-dimer reaction of yeast hexokinase PI at pH 8.0 in the presence of 0.1 M-KCl have been carried out using the fluorescence temperature-jump technique. A slow-relaxation effect was observed which was attributed from its dependence on enzyme concentration to the monomer-dimer reaction; the reciprocal relaxation times tau-1 varied from 3 s-1 at low concentrations of glucose to 42 s-1 at saturating concentrations. Rate constants for association (kass.) and dissociation (kdiss.) were determined as a function of glucose concentration using values of the equilibrium association constant of the monomer-dimer reaction derived from sedimentation ultracentrifugation studies under similar conditions, and also from the dependence of tau-2 on enzyme concentration. kass. was almost independent of glucose concentration and its value (2 x 10(5) M-1.s-1) was close to that expected for a diffusion-controlled process. The influence of glucose on the monomer-dimer reaction is entirely due to effects on kdiss., which increases from 0.21 s-1 in the absence of glucose to 25 s-1 at saturating concentrations. The monomer and dimer forms of hexokinase have different affinities and Km values for glucose, and the results reported here imply that there may be a significant lag in the response of the monomer-dimer reaction to changes in glucose concentrations in vivo with consequent hysteretic effects on the hexokinase activity.

  5. Elution of Monomers from Provisional Composite Materials

    Directory of Open Access Journals (Sweden)

    Simon Daniel Schulz

    2015-01-01

    Full Text Available The aim of this study was to evaluate the elution of substances from different materials used for the manufacturing of temporary indirect restorations, after storage in saliva and ethanol 75%. 10 samples of three chemically cured materials (Protemp 3 Garant, Systemp.c&b, and Trim and one light-cured material (Clip F were stored in saliva and ethanol 75% for 24 h, 7, and days 28 days. From the storage media at each time period, samples were prepared and analysed by LC-MS/MS, in order to access the elution of monomers. The results differed among the materials (P ≤ 0.05. No monomers were detected in the samples of Protemp 3 Garant and Clip F. Substances were detected only in ethanol samples of Systemp.c&b and Trim. The amount of BisGMA, TEGDMA, and UDMA 2 released from Systemp.c&b was higher compared to Trim. Storage time affected the release of substances (P ≤ 0.05. The highest release was observed within the first 24 h. It can be concluded that provisional resin composite materials do not show high release of monomers and this release is material dependent. However, the detection of additional peaks during the analysis, suggesting the formation of by-products of the eluted substances, may not be in favour of these materials with respect to their toxicity.

  6. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  7. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  8. 21 CFR 888.4220 - Cement monomer vapor evacuator.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cement monomer vapor evacuator. 888.4220 Section... (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Surgical Devices § 888.4220 Cement monomer vapor evacuator. (a) Identification. A cement monomer vapor evacuator is a device intended for use during surgery to contain or remove...

  9. Thermodynamics of swelling of latex particles with two monomers

    NARCIS (Netherlands)

    Maxwell, I.A.; Kurja, J.; van Doremaele, G.H.J.; German, A.L.

    1992-01-01

    The partitioning of 2 monomers between the latex particle, monomer droplet, and aq. phases of an emulsion polymer latex are measured at satn. swelling of the latex particle phase (corresponding to intervals I and II of an emulsion polymn.). The monomer (Me acrylate, Bu acrylate, styrene) and polymer

  10. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  11. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  12. Using monomer vibrational wavefunctions to compute numerically exact (12D) rovibrational levels of water dimer

    Science.gov (United States)

    Wang, Xiao-Gang; Carrington, Tucker

    2018-02-01

    We compute numerically exact rovibrational levels of water dimer, with 12 vibrational coordinates, on the accurate CCpol-8sf ab initio flexible monomer potential energy surface [C. Leforestier et al., J. Chem. Phys. 137, 014305 (2012)]. It does not have a sum-of-products or multimode form and therefore quadrature in some form must be used. To do the calculation, it is necessary to use an efficient basis set and to develop computational tools, for evaluating the matrix-vector products required to calculate the spectrum, that obviate the need to store the potential on a 12D quadrature grid. The basis functions we use are products of monomer vibrational wavefunctions and standard rigid-monomer basis functions (which involve products of three Wigner functions). Potential matrix-vector products are evaluated using the F matrix idea previously used to compute rovibrational levels of 5-atom and 6-atom molecules. When the coupling between inter- and intra-monomer coordinates is weak, this crude adiabatic type basis is efficient (only a few monomer vibrational wavefunctions are necessary), although the calculation of matrix elements is straightforward. It is much easier to use than an adiabatic basis. The product structure of the basis is compatible with the product structure of the kinetic energy operator and this facilitates computation of matrix-vector products. Compared with the results obtained using a [6 + 6]D adiabatic approach, we find good agreement for the inter-molecular levels and larger differences for the intra-molecular water bend levels.

  13. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  14. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  15. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  16. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  17. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  18. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  19. Kinetics of monomer biodegradation in soil.

    Science.gov (United States)

    Siotto, Michela; Sezenna, Elena; Saponaro, Sabrina; Innocenti, Francesco Degli; Tosin, Maurizio; Bonomo, Luca; Mezzanotte, Valeria

    2012-01-01

    In modern intensive agriculture, plastics are used in several applications (i.e. mulch films, drip irrigation tubes, string, clips, pots, etc.). Interest towards applying biodegradable plastics to replace the conventional plastics is promising. Ten monomers, which can be applied in the synthesis of potentially biodegradable polyesters, were tested according to ASTM 5988-96 (standard respirometric test to evaluate aerobic biodegradation in soil by measuring the carbon dioxide evolution): adipic acid, azelaic acid, 1,4-butanediol, 1,2-ethanediol, 1,6-hexanediol, lactic acid, glucose, sebacic acid, succinic acid and terephthalic acid. Eight replicates were carried out for each monomer for 27-45 days. The numerical code AQUASIM was applied to process the CO₂ experimental data in order to estimate values for the parameters describing the different mechanisms occurring to the monomers in soil: i) the first order solubilization kinetic constant, K(sol) (d⁻¹); ii) the first order biodegradation kinetic constant, K(b) (d⁻¹); iii) the lag time in biodegradation, t(lag) (d); and iv) the carbon fraction biodegraded but not transformed into CO₂, Y (-). The following range of values were obtained: [0.006 d⁻¹, 6.9 d⁻¹] for K(sol), [0.1 d⁻¹, 1.2 d⁻¹] for K(b), and [0.32-0.58] for Y; t(lag) was observed for azelaic acid, 1,2-ethanediol, and terephthalic acid, with estimated values between 3.0 e 4.9 d. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Controlled grafting of vinylic monomers on polyolefins: a robust mathematical modeling approach.

    Science.gov (United States)

    Saeb, Mohammad Reza; Rezaee, Babak; Shadman, Alireza; Formela, Krzysztof; Ahmadi, Zahed; Hemmati, Farkhondeh; Kermaniyan, Tayebeh Sadat; Mohammadi, Yousef

    2017-01-01

    Experimental and mathematical modeling analyses were used for controlling melt free-radical grafting of vinylic monomers on polyolefins and, thereby, reducing the disturbance of undesired cross-linking of polyolefins. Response surface, desirability function, and artificial intelligence methodologies were blended to modeling/optimization of grafting reaction in terms of vinylic monomer content, peroxide initiator concentration, and melt-processing time. An in-house code was developed based on artificial neural network that learns and mimics processing torque and grafting of glycidyl methacrylate (GMA) typical vinylic monomer on high-density polyethylene (HDPE). Application of response surface and desirability function enabled concurrent optimization of processing torque and GMA grafting on HDPE, through which we quantified for the first time competition between parallel reactions taking place during melt processing: (i) desirable grafting of GMA on HDPE; (ii) undesirable cross-linking of HDPE. The proposed robust mathematical modeling approach can precisely learn the behavior of grafting reaction of vinylic monomers on polyolefins and be placed into practice in finding exact operating condition needed for efficient grafting of reactive monomers on polyolefins.

  1. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  2. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  3. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  4. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  5. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  6. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  8. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  9. Copolymerization of Carbon–carbon Double-bond Monomer (Styrene with Cyclic Monomer (Tetrahydrofuran

    Directory of Open Access Journals (Sweden)

    Sari Fouad

    2012-12-01

    Full Text Available We reported in this work that the cationic copolymerization in one step takes place between carbon–carbon double-bond monomer styrene with cyclic monomer tetrahydrofuran. The comonomers studied belong to different families: vinylic and cyclic ether. The reaction is initiated with maghnite-H+ an acid exchanged montmorillonite as acid solid ecocatalyst. Maghnite-H+ is already used as catalyst for polymerization of many vinylic and heterocyclic monomers. The oxonium ion of tetrahydrofuran and carbonium ion of styrene propagated the reaction of copolymerization. The acetic anhydride is essential for the maintenance of the ring opening of tetrahydrofuran and the entry in copolymerization. The temperature was kept constant at 40°C in oil bath heating for 6 hours. A typical reaction product was analyzed by 1H-NMR, 13C-NMR and IR and the formation of the copolymer was confirmed. The reaction was proved by matched with analysis. The maghnite-H+ allowed us to obtain extremely pure copolymer in good yield by following a simples operational conditions. Copyright © 2012 by BCREC UNDIP. All rights reservedReceived: 29th October 2012; Revised: 29th November 2012; Accepted: 29th November 2012[How to Cite: S. Fouad, M.I. Ferrahi, M. Belbachir. (2012. Copolymerization of Carbon–carbon Double-bond Monomer (Styrene with Cyclic Monomer (Tetrahydrofuran. Bulletin of Chemical Reaction Engineering & Catalysis, 7(2: 165-171. (doi:10.9767/bcrec.7.2.4074.165-171][How to Link / DOI: http://dx.doi.org/10.9767/bcrec.7.2.4074.165-171 ] | View in 

  10. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  11. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  12. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  13. Pseudomonas syringae evades host immunity by degrading flagellin monomers with alkaline protease AprA

    NARCIS (Netherlands)

    Pel, Michiel J C; van Dijken, Anja J H; Bardoel, Bart W; Seidl, Michael F; van der Ent, Sjoerd; van Strijp, Jos A G; Pieterse, Corné M J

    Bacterial flagellin molecules are strong inducers of innate immune responses in both mammals and plants. The opportunistic pathogen Pseudomonas aeruginosa secretes an alkaline protease called AprA that degrades flagellin monomers. Here, we show that AprA is widespread among a wide variety of

  14. Pseudomonas syringae evades host Immunity by degrading flagellin monomers with alkaline protease AprA

    NARCIS (Netherlands)

    Pel, M.J.C.; Van Dijken, A.J.H.; Bardoel, B.W.; Seidl, M.F; Van der Ent, S.; Van Strijp, J.A.G.

    2014-01-01

    Bacterial flagellin molecules are strong inducers of innate immune responses in both mammals and plants. The opportunistic pathogen Pseudomonas aeruginosa secretes an alkaline protease called AprA that degrades flagellin monomers. Here, we show that AprA is widespread among a wide variety of

  15. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  16. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  17. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  18. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  19. Interference of functional monomers with polymerization efficiency of adhesives.

    Science.gov (United States)

    Hanabusa, Masao; Yoshihara, Kumiko; Yoshida, Yasuhiro; Okihara, Takumi; Yamamoto, Takatsugu; Momoi, Yasuko; Van Meerbeek, Bart

    2016-04-01

    The degree of conversion (DC) of camphorquinone/amine-based adhesives is affected by acidic functional monomers as a result of inactivation of the amine co-initiator through an acid-base reaction. During bonding, functional monomers of self-etch adhesives chemically interact with hydroxyapatite (HAp). Here, we tested in how far the latter interaction of functional monomers with HAp counteracts the expected reduction in DC of camphorquinone/amine-based adhesives. The DC of three experimental adhesive formulations, containing either of the two functional monomers [10-methacryloyloxydecyl dihydrogen phosphate (10-MDP) or 4-methacryloxyethyl trimellitic acid anhydride (4-META)] or no functional monomer (no-FM; control), was measured with and without HAp powder added to the adhesive formulations. Both the variables 'functional monomer' and 'HAp' were found to be significant, with the functional monomer reducing the DC and HAp counteracting this effect. It is concluded that the functional monomers 10-MDP and 4-META interfere with the polymerization efficiency of adhesives. This interference is less prominent in the presence of HAp, which would clinically correspond to when these two functional monomers of the adhesive simultaneously interact with HAp in tooth tissue. © 2016 Eur J Oral Sci.

  20. The effect of monomer molecular weight on grafting reaction

    International Nuclear Information System (INIS)

    Wu Minghong; Ding Zhongli; Ma Zueteh

    1995-01-01

    In this paper, some condensed ethylene glycol acrylate monomers with different molecular weight being grafted to the PE film by means of pre-irradiation is reported. The effect of molecular weight of monomer on grafting reaction and the hydrophilicity of grafting sample have been discussed. The experimental results show: molar degrees of grafting decreased non-linearly with the increasement of molecular weight of monomer, the grafting reaction of polymer is greater effected by the swelling degree of PE film, the greater the swelling degree of grafting material, the higher the grating degree grafting is, the initial rate of grafting reaction decreased with the increasement of molecular weight of monomer. (author)

  1. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  2. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  3. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  4. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  5. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  6. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  7. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  8. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  9. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  10. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  11. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  12. Partial swelling of latex particles by two monomers

    NARCIS (Netherlands)

    Noel, E.F.J.; Maxwell, I.A.; German, A.L.

    1993-01-01

    The swelling of polymeric latex particles with solvent and monomer is of great importance for the emulsion polymn. process in regard to compn. drift and rate of polymn. For the monomer combination, Me acrylate-vinyl acetate, both satn. and partial swelling were detd. exptl. Theories for satn.

  13. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  14. Oligonucleotides with 1,4-dioxane-based nucleotide monomers

    DEFF Research Database (Denmark)

    Madsen, Andreas S; Wengel, Jesper

    2012-01-01

    An epimeric mixture of H-phosphonates 5R and 5S has been synthesized in three steps from known secouridine 1. Separation of the epimers has been accomplished by RP-HPLC, allowing full characterization and incorporation of monomers X and Y into 9-mer oligonucleotides using H-phosphonates building...... blocks 5R and 5S, respectively. A single incorporation of either monomer X or monomer Y in the central position of a DNA 9-mer results in decreased thermal affinity toward both DNA and RNA complements (ΔT(m) = -3.5 °C/-3.5 °C for monomer X and ΔT(m) = -11.0 °C/-6.5 °C for monomer Y). CD measurements do...

  15. Graft copolymers of polypropylene films. 1. radiation induced grafting of mixed monomers. Vol. 3

    International Nuclear Information System (INIS)

    El-Salmawi, K.M.; El-Naggar, A.M.; Said, H.M.; Zahran, A.H.

    1996-01-01

    Radiation graft copolymerization of co monomer mixtures of acrylic acid (AAC), and styrene (S) onto polypropylene (PP) film by mutual method has been investigated. The effects of different factors that may affect the grafting yield such as inhibitor concentration (Mohr's salt), solvent composition (MeOH and H 2 O), radiation dose and dose rate were considered. It was found that the role of Mohr's salt is very effective when the ratio of AAC in the co monomer mixtures was at lower values. However, the addition of 1.25 Wt% of Mohr's salt reduced the homo polymer formation and enhances the grafting process. Graft copolymerization in presence of solvent mixture composed of methanol and water was found to afford higher grafting than in pure methanol regardless of the composition of the co monomer mixture used. However, the highest degree of grafting was obtained at a solvent composition of 20% H 2 O:80%MeOH and a co monomer mixture of 20%AAC:80%sty. An attempt was made to determine each PAAC and PS fractions in the total graft yield obtained. Two methods of analysis based on using the reactivity ratios reported in literature, elemental analysis and IR spectroscopy. The determination of poly (acrylic acid) and polystyrene fractions by elemental analysis is believed more accurate than these by reactivity ratio. The precise results obtained by elemental analysis with respect to the chemical structure of known polymer prepared under identical conditions. The results obtained by IR measurements go well with that obtained with the reactivity ratio methods. 5 figs., 3 tabs

  16. Graft copolymers of polypropylene films. 1. radiation induced grafting of mixed monomers. Vol. 3

    Energy Technology Data Exchange (ETDEWEB)

    El-Salmawi, K M; El-Naggar, A M; Said, H M; Zahran, A H [Radiation Chemistry Department, National Center for Radiation Research and Technology, Atomic Energy Authority, Cairo, (Egypt)

    1996-03-01

    Radiation graft copolymerization of co monomer mixtures of acrylic acid (AAC), and styrene (S) onto polypropylene (PP) film by mutual method has been investigated. The effects of different factors that may affect the grafting yield such as inhibitor concentration (Mohr`s salt), solvent composition (MeOH and H{sub 2} O), radiation dose and dose rate were considered. It was found that the role of Mohr`s salt is very effective when the ratio of AAC in the co monomer mixtures was at lower values. However, the addition of 1.25 Wt% of Mohr`s salt reduced the homo polymer formation and enhances the grafting process. Graft copolymerization in presence of solvent mixture composed of methanol and water was found to afford higher grafting than in pure methanol regardless of the composition of the co monomer mixture used. However, the highest degree of grafting was obtained at a solvent composition of 20% H{sub 2} O:80%MeOH and a co monomer mixture of 20%AAC:80%sty. An attempt was made to determine each PAAC and PS fractions in the total graft yield obtained. Two methods of analysis based on using the reactivity ratios reported in literature, elemental analysis and IR spectroscopy. The determination of poly (acrylic acid) and polystyrene fractions by elemental analysis is believed more accurate than these by reactivity ratio. The precise results obtained by elemental analysis with respect to the chemical structure of known polymer prepared under identical conditions. The results obtained by IR measurements go well with that obtained with the reactivity ratio methods. 5 figs., 3 tabs.

  17. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  18. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  19. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  20. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  1. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  2. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  3. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  5. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  6. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  7. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  8. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  9. Inverse opal pH sensors with various protic monomers copolymerized with polyhydroxyethylmethacrylate hydrogel

    International Nuclear Information System (INIS)

    Shin, Jinsub; Han, Sung Gu; Lee, Wonmok

    2012-01-01

    Highlights: ► We polymerized four different inverse opal pH sensors by using vinyl monomers containing acidic or basic substituents. ► Stepwise swelling response from polyprotic acid sensor was investigated. ► Opposite color changing responses were obtained for acidic and basic sensors. ► Composite pH sensor with wide pH sensing range was fabricated by mixing different monomers. ► Both acid and base sensors show the response time as fast as ∼10 s. - Abstract: pH sensitive inverse opal sensors were synthesized using various vinyl monomers containing acidic or basic substituents. Acrylic acid (AA), vinylphosphonic acid (VPA), vinylimidazole (VI), and dimethylaminoethylmethacrylic acid (DMAEMA) were respectively copolymerized with hydroxyethylmethacrylate (HEMA), the building block monomer of the hydrogel via UV-initiated photopolymerization. Opal templating and subsequent template removal enabled the fabrication of four inverse opal (IO) hydrogel colorimetric sensors, which responded to pH in different fashions. pH-dependent swelling of the IO hydrogel induced the red-shift of the diffracted color. The sensors containing AA or VPA, the proton donating monomers showed the color shifts from green to red with pH increase due to the increased concentration of carboxylate anions bound to the hydrogel. Diprotic VPA sensor exhibited two-step increases of diffracted wavelengths at its pK a1 and pK a2 respectively. The sensors containing proton acceptors, VI and DMAEMA showed the pH-dependent color changes in an opposite way to the AA sensor and the VPA sensor since their ionizations take place by lowering pH due to the protonation at the amino groups. The shapes of pH response curves of VI and DMAEMA sensors were similar but pK b s were different from each other. Optical diffraction responses of four sensors were compared with the calculated concentration ratios of the ionized species to the total monomer with pH variation, and a deswelling effect in the

  10. Highly Efficient Synthesis of Allopurinol Locked Nucleic Acid Monomer by C6 Deamination of 8-Aza-7-bromo-7-deazaadenine Locked Nucleic Acid Monomer

    DEFF Research Database (Denmark)

    Kosbar, Tamer Reda El-Saeed; Sofan, M.; Abou-Zeid, L.

    2013-01-01

    An allopurinol locked nucleic acid (LNA) monomer was prepared by a novel strategy through C6 deamination of the corresponding 8-aza-7-bromo-7-deazaadenine LNA monomer with aqueous sodium hydroxide. An 8-aza-7-deazaadenine LNA monomer was also synthesized by a modification of the new synthetic...... the required LNA monomers....

  11. Redesign of the monomer-monomer interface of Cre recombinase yields an obligate heterotetrameric complex.

    Science.gov (United States)

    Zhang, Chi; Myers, Connie A; Qi, Zongtai; Mitra, Robi D; Corbo, Joseph C; Havranek, James J

    2015-10-15

    Cre recombinase catalyzes the cleavage and religation of DNA at loxP sites. The enzyme is a homotetramer in its functional state, and the symmetry of the protein complex enforces a pseudo-palindromic symmetry upon the loxP sequence. The Cre-lox system is a powerful tool for many researchers. However, broader application of the system is limited by the fixed sequence preferences of Cre, which are determined by both the direct DNA contacts and the homotetrameric arrangement of the Cre monomers. As a first step toward achieving recombination at arbitrary asymmetric target sites, we have broken the symmetry of the Cre tetramer assembly. Using a combination of computational and rational protein design, we have engineered an alternative interface between Cre monomers that is functional yet incompatible with the wild-type interface. Wild-type and engineered interface halves can be mixed to create two distinct Cre mutants, neither of which are functional in isolation, but which can form an active heterotetramer when combined. When these distinct mutants possess different DNA specificities, control over complex assembly directly discourages recombination at unwanted half-site combinations, enhancing the specificity of asymmetric site recombination. The engineered Cre mutants exhibit this assembly pattern in a variety of contexts, including mammalian cells. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  13. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  14. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  15. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  16. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  17. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  18. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  19. Synthesis of New Vinyl Monomers for Chemical Agent Sensing Applications

    National Research Council Canada - National Science Library

    Hogen-Esch, Thieo

    2001-01-01

    The synthesis of styrene momomer p-vinylbenzoylacetophenone (monomer i) has been carried by the acetylation of 2- chloroethylbenzene and base elimination of the resulting 4-acetyl-2-chloroethylbenzene to give 4-acetylstyrene...

  20. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  1. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  2. Monomer-dependent secondary nucleation in amyloid formation.

    Science.gov (United States)

    Linse, Sara

    2017-08-01

    Secondary nucleation of monomers on the surface of an already existing aggregate that is formed from the same kind of monomers may lead to autocatalytic amplification of a self-assembly process. Such monomer-dependent secondary nucleation occurs during the crystallization of small molecules or proteins and self-assembled materials, as well as in protein self-assembly into fibrous structures. Indications of secondary nucleation may come from analyses of kinetic experiments starting from pure monomers or monomers supplemented with a low concentration of pre-formed aggregates (seeds). More firm evidence requires additional experiments, for example those employing isotope labels to distinguish new aggregates arising from the monomer from those resulting from fragmentation of the seed. In cases of amyloid formation, secondary nucleation leads to the formation of toxic oligomers, and inhibitors of secondary nucleation may serve as starting points for therapeutic developments. Secondary nucleation displays a high degree of structural specificity and may be enhanced by mutations or screening of electrostatic repulsion.

  3. Polymerization of impregnated monomer in wood by microwave irradiation

    International Nuclear Information System (INIS)

    Kawase, Kaoru; Hayakawa, Kiyoshi

    1976-01-01

    The manufacturing of a wood-plastic combination (WPC) by irradiation of microwave (2,450 and 915 +- 50 MHz) or gamma-ray was carried out. After the impregnation of dry woods (Hinoki: Chamaecyparis obtusa Endl., Buna: Acer mono Maxim., and Kaede: Fagus crenata Blume) with the mixture of the vinyl monomers and chemical reagents, the monomer in wood was polymerized by irradiation. In case of polymerization with microwave (2,450 MHz) the effect of oxygen was not recognized, but in the case of gamma-ray the rate of polymerization remarkably decreased in the presence of oxygen. The polymerization of various monomers was carried out also in the air, and the conversions of styrene, methyl-, ethyl-, n-propyl-, and n-butyl-methacrylate were 51.8 -- 89.1%, but that of vinyl acetate was lower (4.3 -- 8.2%). The conversion of monomers with irradiation of 915 MHz microwave was very low (2.6 -- 33.5%). The conversion of monomers increased when toluylene diisocyanate was added in the monomers. The percentage of extraction with hot benzene of WPC (chip) decreased by the addition of toluylene diisocyanate. It was concluded from C.H.N. analyses that the reaction took place among the wood, toluylene diisocyanate and methyl methacrylate. (auth.)

  4. Ligustrazine monomer against cerebral ischemia-reperfusion injury

    Directory of Open Access Journals (Sweden)

    Hai-jun Gao

    2015-01-01

    Full Text Available Ligustrazine (2,3,5,6-tetramethylpyrazine is a major active ingredient of the Szechwan lovage rhizome and is extensively used in treatment of ischemic cerebrovascular disease. The mechanism of action of ligustrazine use against ischemic cerebrovascular diseases remains unclear at present. This study summarizes its protective effect, the optimum time window of administration, and the most effective mode of administration for clinical treatment of cerebral ischemia/reperfusion injury. We examine the effects of ligustrazine on suppressing excitatory amino acid release, promoting migration, differentiation and proliferation of endogenous neural stem cells. We also looked at its effects on angiogenesis and how it inhibits thrombosis, the inflammatory response, and apoptosis after cerebral ischemia. We consider that ligustrazine gives noticeable protection from cerebral ischemia/reperfusion injury. The time window of ligustrazine administration is limited. The protective effect and time window of a series of derivative monomers of ligustrazine such as 2-[(1,1-dimethylethyloxidoimino]methyl]-3,5,6-trimethylpyrazine, CXC137 and CXC195 after cerebral ischemia were better than ligustrazine.

  5. Adjuvant activity of peptidoglycan monomer and its metabolic products.

    Science.gov (United States)

    Halassy, Beata; Krstanović, Marina; Frkanec, Ruza; Tomasić, Jelka

    2003-02-14

    Peptidoglycan monomer (PGM) is a natural compound of bacterial origin. It is a non-toxic, non-pyrogenic, water-soluble immunostimulator potentiating humoral immune response to ovalbumin (OVA) in mice. It is fast degraded and its metabolic products-the pentapeptide (PP) and the disaccharide (DS)-are excreted from the mammalian organism upon parenteral administration. The present study investigates: (a). whether PGM could influence the long-living memory generation; (b). whether metabolic products retain adjuvant properties of the parent compound and contribute to its adjuvanticity. We report now that mice immunised twice with OVA+PGM had significantly higher anti-OVA IgG levels upon challenge with antigen alone 6 months later in comparison to control group immunised with OVA only. PP and DS were prepared enzymatically in vitro as apyrogenic and chemically pure compounds. When mice were immunised with OVA plus PP and DS, respectively, the level of anti-OVA IgGs in sera was not higher than in mice immunised with OVA alone, while PGM raised the level of specific antibodies. Results implicate that the adjuvant active molecule, capable of enhancing long-living memory generation, is PGM itself, and none of its metabolic products.

  6. Perturbation of the Monomer-Monomer Interfaces of the Benzoylformate Decarboxylase Tetramer

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, Forest H.; Rogers, Megan P.; Paul, Lake N.; McLeish, Michael J. [IUPUI; (Purdue)

    2014-08-14

    The X-ray structure of benzoylformate decarboxylase (BFDC) from Pseudomonas putida ATCC 12633 shows it to be a tetramer. This was believed to be typical of all thiamin diphosphate-dependent decarboxylases until recently when the structure of KdcA, a branched-chain 2-keto acid decarboxylase from Lactococcus lactis, showed it to be a homodimer. This lent credence to earlier unfolding experiments on pyruvate decarboxylase from Saccharomyces cerevisiae that indicated that it might be active as a dimer. To investigate this possibility in BFDC, we sought to shift the equilibrium toward dimer formation. Point mutations were made in the noncatalytic monomer–monomer interfaces, but these had a minimal effect on both tetramer formation and catalytic activity. Subsequently, the R141E/Y288A/A306F variant was shown by analytical ultracentrifugation to be partially dimeric. It was also found to be catalytically inactive. Further experiments revealed that just two mutations, R141E and A306F, were sufficient to markedly alter the dimer–tetramer equilibrium and to provide an ~450-fold decrease in kcat. Equilibrium denaturation studies suggested that the residual activity was possibly due to the presence of residual tetramer. The structures of the R141E and A306F variants, determined to <1.5 Å resolution, hinted that disruption of the monomer interfaces will be accompanied by movement of a loop containing Leu109 and Leu110. As these residues contribute to the hydrophobicity of the active site and the correct positioning of the substrate, it seems that tetramer formation may well be critical to the catalytic activity of BFDC.

  7. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  8. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  9. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  10. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  12. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  13. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  14. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  15. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  16. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  17. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  18. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  19. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  20. In-vitro transdentinal diffusion of monomers from adhesives.

    Science.gov (United States)

    Putzeys, Eveline; Duca, Radu Corneliu; Coppens, Lieve; Vanoirbeek, Jeroen; Godderis, Lode; Van Meerbeek, Bart; Van Landuyt, Kirsten L

    2018-06-01

    Biocompatibility of adhesives is important since adhesives may be applied on dentin near the pulp. Accurate knowledge of the quantity of monomers reaching the pulp is important to determine potential side effects. The aim of this study was to assess the transdentinal diffusion of residual monomers from dental adhesive systems using an in-vitro pulp chamber model. Dentin disks with a thickness of 300 µm were produced from human third molars. These disks were fixed between two open-ended glass tubes, representing an in-vitro pulp chamber. The etch-and-rinse adhesive OptiBond FL and the self-etch adhesive Clearfil SE Bond were applied to the dentin side of the disks, while on in the pulpal side, the glass tube was filled with 600 µL water. The transdentinal diffusion of different monomers was quantified using ultra-performance liquid chromatography-tandem mass spectrometry. The monomers HEMA, CQ, BisGMA, GPDM, 10-MDP and UDMA eluted from the dental materials and were able to diffuse through the dentin disks to a certain extent. Compounds with a lower molecular weight (uncured group: HEMA 7850 nmol and CQ 78.2 nmol) were more likely to elute and diffuse compared to monomers with a higher molecular weight (uncured group: BisGMA 0.42 nmol). When the adhesives were left uncured, diffusion was up to 10 times higher compared to the cured conditions. This in-vitro research resulted in the quantification of various monomers able to diffuse through dentin and therefore contributes to a more detailed understanding about the potential exposure of the dental pulp to monomers from dental adhesives. Biocompatibility of adhesives is important since adhesives may be applied on dentin near the pulp, where tubular density and diameter are greatest. Copyright © 2018. Published by Elsevier Ltd.

  1. Dip-pen nanopatterning of photosensitive conducting polymer using a monomer ink

    Science.gov (United States)

    Su, Ming; Aslam, Mohammed; Fu, Lei; Wu, Nianqiang; Dravid, Vinayak P.

    2004-05-01

    Controlled patterning of conducting polymers at a micro- or nanoscale is the first step towards the fabrication of miniaturized functional devices. Here, we introduce an approach for the nanopatterning of conducting polymers using an improved monomer "ink" in dip-pen nanolithography (DPN). The nominal monomer "ink" is converted, in situ, to its conducting solid-state polymeric form after patterned. Proof-of-concept experiments have been performed with acid-promoted polymerization of pyrrole in a less reactive environment (tetrahydrofuran). The ratios of reactants are optimized to give an appropriate rate to match the operation of DPN. A similar synthesis process for the same polymer in its bulk form shows a high conductance and crystalline structure. The miniaturized conducting polymer sensors with light detection ability are fabricated by DPN using the improved ink formula, and exhibit excellent response, recovery, and sensitivity parameters.

  2. Dip-pen nanopatterning of photosensitive conducting polymer using a monomer ink

    International Nuclear Information System (INIS)

    Su Ming; Aslam, Mohammed; Fu Lei; Wu Nianqiang; Dravid, Vinayak P.

    2004-01-01

    Controlled patterning of conducting polymers at a micro- or nanoscale is the first step towards the fabrication of miniaturized functional devices. Here, we introduce an approach for the nanopatterning of conducting polymers using an improved monomer 'ink' in dip-pen nanolithography (DPN). The nominal monomer 'ink' is converted, in situ, to its conducting solid-state polymeric form after patterned. Proof-of-concept experiments have been performed with acid-promoted polymerization of pyrrole in a less reactive environment (tetrahydrofuran). The ratios of reactants are optimized to give an appropriate rate to match the operation of DPN. A similar synthesis process for the same polymer in its bulk form shows a high conductance and crystalline structure. The miniaturized conducting polymer sensors with light detection ability are fabricated by DPN using the improved ink formula, and exhibit excellent response, recovery, and sensitivity parameters

  3. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  4. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  5. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  6. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  7. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  8. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  9. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  10. In situ polymerization of vinyl monomers in polyester yarns

    International Nuclear Information System (INIS)

    Avny, Y.; Rebenfeld, L.; Weigmann, H.D.

    1978-01-01

    The effects of a pretreatment of polyester (PET) yarns with a strongly interacting solvent such as dimethylformamide (DMF) on vinyl monomer incorporation were investigated. When the DMF pretreatment is carried out at high temperatures (above 120 0 C), the swollen PET structure is stabilized by solvent-induced secondary crystallization. This substrate is highly suitable for the incorporation of vinyl monomers. In situ polymerization of vinyl monomers in DMF-treated PET was investigated using chemical and γ-irradiation polymerization techniques, both in the presence and in the absence of excess monomer outside the PET fibers. When polymerization was carried out in a system in which a constant supply of free radicals was available from the outside of the PET fibers, lower initiator concentrations and smaller γ-irradiation doses were necessary. These results are attributed to a low efficiency of the initiator inside the PET fiber due to mobility restrictions. Water uptake and moisture regain of PET yarns containing poly(hydroxyethyl methacrylate) and poly(acrylic acid) were also investigated. When most of the vinyl polymer was inside the PET fiber, water absorption was limited. The changes in mechanical properties of the PET yarns resulting from the DMF pretreatment were partially reversed by in situ polymerization of vinyl monomers

  11. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  12. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  13. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  14. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  15. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  16. The radiation grafting of vinyl monomers to cotton fabrics

    International Nuclear Information System (INIS)

    Shiraishi, N.; Williams, J.L.; Stannett, V.

    1982-01-01

    Cobalt 60 γ and electron beam radiation were used to graft diethylphosphatoethyl methacrylate, pure and in 90:10 methanol solution, to cotton cloth. This monomer, with an 11.64% phosphorus content, was especially developed by the Scott Paper Co. to develop fire retardancy. A simple pad and squeeze application followed by direct irradiation under a nitrogen atmosphere was used. Although excess monomer could be removed by washing with water, no solvent for the polymer was found so only the total 'add-ons' could be measured. With 60 Co irradiation, total polymerization was obtained with more than 1 Mrad but with electron beam irradiation only about 50% conversion was obtained even with 10 Mrad. No acceleration in the rates could be achieved with the viscous pure monomer as opposed to in solution. Yields adequate to impart reasonable fire retardancy could, however, be obtained with about 3 Mrad with electrons. No noticeable degradation of the polymer occurred at the doses used. (author)

  17. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  18. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  19. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  20. In situ polymerization of monomers for polyphenylquinoxaline/graphite

    Science.gov (United States)

    Serafini, T. T.; Delvigs, P.; Vannucci, R. D.

    1973-01-01

    Methods currently used to prepare fiber reinforced, high temperature resistant polyphenylquinoxaline (PPQ) composites employ extremely viscous, low solids content solutions of high molecular weight PPQ polymers. An improved approach, described in this report, consists of impregnating the fiber with a solution of the appropriate monomers instead of a solution of previously synthesized high molecular weight polymer. Polymerization of the monomers occurs in situ on the fiber during the solvent removal and curing stages. The in situ polymerization approach greatly simplifies the fabrication of PPQ graphite fiber composites. The use of low viscosity monomeric type solutions facilitates fiber wetting, permits a high solids content, and eliminates the need for prior polymer synthesis.

  1. Evaluation of level of impregnation monomers in hydrotalcite

    International Nuclear Information System (INIS)

    Carmo, Danieli M. do; Machado, Jacson S.C.; Oliveira, Marcelo F.L.; Oliveira, Marcia G.; Soares, Bluma G.

    2011-01-01

    To evaluate the impregnation degree of 1,6-hexamethylene diisocyanate and 1,4-butanediol monomers in hydrotalcite clays it was prepared dispersions with mixing ratio 1:100 (clay/monomer), using the Ultraturrax and Ultrasound. Subsequently the samples were characterized by Fourier Transform Infrared Spectroscopy and X-ray Diffraction. Swelling tests and Tyndall effect were used to illustrate the different dispersions. The results indicated a strong interaction between the hydrotalcite with 1,6-hexamethylene diisocyanate, favoring the formation of intercalated structures. (author)

  2. Studies on curing effect of phosphite monomer by EB radiation in the air

    International Nuclear Information System (INIS)

    Xiao, B.; Zhou, Y.; Li, S.; Luo, M.; Wang, X.; Zhao, P.

    2000-01-01

    A new type phosphite active monomer was synthesized. The resisting oxygen inhibition effect of this monomer and the effects of irradiation dose and concentration of phosphite active monomer on curing were studied. At the same time, curing results were analysed, through gel content and IR spectrum. The excellent resisting oxygen inhibition result of this phosphite active monomer was shown by experiments. EB radiation curing in the air was successfully carried out by the phosphite active monomer. (author)

  3. Selective extraction of bisphenol A from water by one-monomer molecularly imprinted magnetic nanoparticles.

    Science.gov (United States)

    Lin, Zhenkun; Zhang, Yanfang; Su, Yu; Qi, Jinxia; Jia, Yinhang; Huang, Changjiang; Dong, Qiaoxiang

    2018-01-15

    One-monomer molecularly imprinted magnetic nanoparticles were prepared as adsorbents for selective extraction of bisphenol A from water in this study. A single bi-functional monomer was adopted for preparation of the molecularly imprinted polymer, avoiding the tedious trial-and-error optimizations as traditional strategy. Moreover, bisphenol F was used as the dummy template for bisphenol A to avoid the interference from residual template molecules. These nanoparticles showed not only large adsorption capacity and good selectivity to the bisphenol A but also outstanding magnetic response performance. Furthermore, they were successfully used as magnetic solid-phase extraction adsorbents of bisphenol A from various water samples, including tap water, river water, and seawater. The developed method was found to be much more efficient, convenient, and economical for selective extraction of bisphenol A compared with the traditional solid-phase extraction. Separation of these nanoparticles can be easily achieved with an external magnetic field, and the optimized adsorption time was only 15 min. The recoveries of bisphenol A in different water samples ranged from 85.38 to 93.75%, with relative standard deviation lower than 7.47%. These results showed that one-monomer molecularly imprinted magnetic nanoparticles had the potential to be popular adsorbents for selective extraction of pollutants from water. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Two Functionally Distinct Sources of Actin Monomers Supply the Leading Edge of Lamellipodia

    Science.gov (United States)

    Vitriol, Eric A.; McMillen, Laura M.; Kapustina, Maryna; Gomez, Shawn M.; Vavylonis, Dimitrios; Zheng, James Q.

    2015-01-01

    Summary Lamellipodia, the sheet-like protrusions of motile cells, consist of networks of actin filaments (F-actin) regulated by the ordered assembly from and disassembly into actin monomers (G-actin). Traditionally, G-actin is thought to exist as a homogeneous pool. Here, we show that there are two functionally and molecularly distinct sources of G-actin that supply lamellipodial actin networks. G-actin originating from the cytosolic pool requires the monomer binding protein thymosin β4 (Tβ4) for optimal leading edge localization, is targeted to formins, and is responsible for creating an elevated G/F-actin ratio that promotes membrane protrusion. The second source of G-actin comes from recycled lamellipodia F-actin. Recycling occurs independently of Tβ4 and appears to regulate lamellipodia homeostasis. Tβ4-bound G-actin specifically localizes to the leading edge because it doesn’t interact with Arp2/3-mediated polymerization sites found throughout the lamellipodia. These findings demonstrate that actin networks can be constructed from multiple sources of monomers with discrete spatiotemporal functions. PMID:25865895

  5. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  6. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  7. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  8. Influence of vinyl chloride monomer and vinyl chloride monomer derivatives on hepatic DNA synthesis

    International Nuclear Information System (INIS)

    Brenner, E.A.

    1982-01-01

    Vinyl chloride monomer (VCM) is used extensively in the chemical industry, mainly in the production of polyvinyl chloride. It has recently been found to cause hepatic angiosarcoma. As VCM has also been shown to be mutagenic after metabolic activation the effect of VCM on DNA synthesis was investigated. [ 3 H]Thymidine incorporation into DNA was used to measure the rate of DNA synthesis in regenerating rat liver. A possible direct toxic effect of VCM or its metabolites on liver cell metabolism was examined by two unrelated techniques, viz. the measurement of adenine nucleotide concentrations in regenerating livers and the influence on transmembrane potentials in hepatocytes. The distribution of radioactivity in subcellular fractions following [ 14 C]VCM administration suggested microsomal conversion of VCM to an active form which was selectively retained in the nuclear fraction. Measurement of the activities of thymidine kinase and DNA polymerase in regenerating liver indicated that the induction of these enzymes which normally occurs after partial hepatectomy was not prevented by VCM treatment. Three techniques were used to test the hypothesis that the retardation in DNA synthesis was due to DNA damage: the prophage lambda induction test for DNA damage, autoradiographic detection of unscheduled thymidine incorporation into DNA, and detection of DNA strand breaks in alkaline sucrose gradients. All three provided evidence of DNA damage and led to the development of a novel technique to confirm these findings. This involved centrifugation in neutral sucrose gradients on intact double-stranded DNA contained in hepatocyte nucleoids and showed conclusively that VCM administration causes DNA strand breaks. Subsequent repair of DNA was also assessed by this technique. The site of the VCM/metabolite: DNA reaction was characterized by DNA thermal denaturation and renaturation studies

  9. Dimer monomer transition and dimer re-formation play important role for ATM cellular function during DNA repair

    International Nuclear Information System (INIS)

    Du, Fengxia; Zhang, Minjie; Li, Xiaohua; Yang, Caiyun; Meng, Hao; Wang, Dong; Chang, Shuang; Xu, Ye; Price, Brendan; Sun, Yingli

    2014-01-01

    Highlights: • ATM phosphorylates the opposite strand of the dimer in response to DNA damage. • The PETPVFRLT box of ATM plays a key role in its dimer dissociation in DNA repair. • The dephosphorylation of ATM is critical for dimer re-formation after DNA repair. - Abstract: The ATM protein kinase, is a serine/threonine protein kinase that is recruited and activated by DNA double-strand breaks, mediates responses to ionizing radiation in mammalian cells. Here we show that ATM is held inactive in unirradiated cells as a dimer and phosphorylates the opposite strand of the dimer in response to DNA damage. Cellular irradiation induces rapid intermolecular autophosphorylation of serine 1981 that causes dimer dissociation and initiates cellular ATM kinase activity. ATM cannot phosphorylate the substrates when it could not undergo dimer monomer transition. After DNA repair, the active monomer will undergo dephosphorylation to form dimer again and dephosphorylation is critical for dimer re-formation. Our work reveals novel function of ATM dimer monomer transition and explains why ATM dimer monomer transition plays such important role for ATM cellular activity during DNA repair

  10. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  11. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  12. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  13. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  14. Base-catalyzed depolymerization of lignin : separation of monomers

    Energy Technology Data Exchange (ETDEWEB)

    Vigneault, A. [Sherbrooke Univ., PQ (Canada). Dept. of Chemical Engineering; Johnson, D.K. [National Renewable Energy Laboratory, Golden, CO (United States); Chornet, E. [Sherbrooke Univ., PQ (Canada). Dept. of Chemical Engineering; National Renewable Energy Laboratory, Golden, CO (United States)

    2007-12-15

    Biofuels produced from residual lignocellulosic biomass range from ethanol to biodiesel. The use of lignin for the production of alternate biofuels and green chemicals has been studied with particular emphasis on the structure of lignin and its oxyaromatic nature. In an effort to fractionate lignocellulosic biomass and valorize specific constitutive fractions, the authors developed a strategy for the separation of 12 added value monomers produced during the hydrolytic base catalyzed depolymerization (BCD) of a Steam Exploded Aspen Lignin. The separation strategy was similar to vanillin purification to obtain pure monomers, but combining more steps after the lignin depolymerization such as acidification, batch liquid-liquid-extraction (LLE), followed by vacuum distillation, liquid chromatography (LC) and crystallization. The purpose was to develop basic data for an industrial size process flow diagram, and to evaluate both the monomer losses during the separation and the energy requirements. Experimentally testing of LLE, vacuum distillation and flash LC in the laboratory showed that batch vacuum distillation produced up to 4 fractions. Process simulation revealed that a series of 4 vacuum distillation columns could produce 5 distinct monomer streams, of which 3 require further chromatography and crystallization operations for purification. 22 refs., 4 tabs., 8 figs.

  15. Two Populations Mean-Field Monomer-Dimer Model

    Science.gov (United States)

    Alberici, Diego; Mingione, Emanuele

    2018-04-01

    A two populations mean-field monomer-dimer model including both hard-core and attractive interactions between dimers is considered. The pressure density in the thermodynamic limit is proved to satisfy a variational principle. A detailed analysis is made in the limit of one population is much smaller than the other and a ferromagnetic mean-field phase transition is found.

  16. The LOMOsup(R) process: a solution for residual monomers

    International Nuclear Information System (INIS)

    Derbyshire, R.L.

    1979-01-01

    Regulatory activity over the last several years has addressed the potential problems associated with the migration of residual monomers from a number of commodity food packages. Regardless of the outcome of current debates, it will always be desirable to reduce monomer levels to as low a level as economically practicable so that they do not become indirect additives. The LOMO process is a body of technology inclusive of an ionizing radiation treatment which can result in sharp reduction of residual monomer levels in commodity plastic resins. The process may be applicable to factory intermediates, raw resins, or finished articles. Depending upon the individual system and its monomers, LOMO treatment can result in reductions to levels which press today's analytical test capability. Industrial radiation processing is normally accomplished with electron beam accelerators. Electron beam processing continues to gain in understanding and acceptance as one of the very few basic methods by which energy can be imparted to an industrial process system. Typically, whole factories are constructed around one accelerator. (author)

  17. Low temperature irradiation of vitrifiable mixtures of unsaturated monomers

    International Nuclear Information System (INIS)

    Kaetsu, I.; Ito, A.; Hayashi, K.

    1975-01-01

    A specific mixture containing at least one polymerizable unsaturated monomer which is not vitrifiable by itself can advantageously be polymerized by irradiating the mixture at a temperature not higher than 100 0 C above glass transition temperature of the mixture with an ionizing radiation and/or a light. 12 claims, 6 drawings, figures

  18. 21 CFR 864.7300 - Fibrin monomer paracoagulation test.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Fibrin monomer paracoagulation test. 864.7300 Section 864.7300 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7300 Fibrin...

  19. Facile synthesis of allyl resinate monomer in an aqueous solution ...

    Indian Academy of Sciences (India)

    The synthesized monomer product appeared as a viscous liquid, with a viscosity of 460 mPa·s at 25◦C and a density of ... ated under high reaction temperature, which reduces the ... The use of DMF as an organic solvent also comes with.

  20. Step growth of an AB2 monomer, with cycle formation

    DEFF Research Database (Denmark)

    Cameron, Colin; Fawcett, Allan H.; Hetherington, Cecil R.

    1998-01-01

    A computer-based lattice model of the step growth reaction of an AB2 monomer, the next elaborate system after an AB monomer, has been devised that allows the simultaneous and explicit occurrence of inter- and intramolecular reactions of A and B groups of the flexible and moving molecules according...... with fractal characteristics. Growth stops when each molecule contains a cycle. For the model explored, in which six lattice sites are used for each monomer, the limiting value of the number average degree of polymerization, 〈x〉n,∞, is 14.6(±0.3) (after infinite time). The occurrence within the system of rings...... of m residues (m=1,2,3,...) is found to depend upon m and the extent of reaction of the A groups, pa, according to Rm=C0pm am-2.71, the constant C0 reflecting the structure of the lattice and the monomer, and being shown to determine the final degree of polymerization. The exponent of the integers m...

  1. Monomer-Polymer Chemistry and the Impregnation Process

    Energy Technology Data Exchange (ETDEWEB)

    Stannett, V. [North Carolina State University, Raleigh, NC (United States)

    1968-10-15

    A brief outline of early polymerization techniques is followed by a description of polymerization process chemistry, impregnation and polymerization methods and criteria for the choice of monomer. General considerations, including the effects of polymerization inhibitors, swelling agents, radiation dose rate and sample thickness, are enumerated. (author)

  2. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  3. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  4. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  5. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  6. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  7. Binding interactions between suberin monomer components and pesticides

    Energy Technology Data Exchange (ETDEWEB)

    Olivella, M.À., E-mail: angels.olivella@udg.edu [Department of Chemical Engineering, Escola Politècnica Superior, Universitat de Girona, Maria Aurèlia Capmany, 61, 17071 Girona (Spain); Bazzicalupi, C.; Bianchi, A. [Department of Chemistry “Ugo Schiff”, University of Florence, Via della Lastruccia, 3, 50019 Sesto Fiorentino (Italy); Río, J.C. del [Instituto de Recursos Naturales y Agrobiología de Sevilla, Consejo Superior de Investigaciones Científicas, P.O. Box 1052, 41080 Seville (Spain); Fiol, N.; Villaescusa, I. [Department of Chemical Engineering, Escola Politècnica Superior, Universitat de Girona, Maria Aurèlia Capmany, 61, 17071 Girona (Spain)

    2015-09-15

    Understanding the role of biomacromolecules and their interactions with pollutants is a key for elucidating the sorption mechanisms and making an accurate assessment of the environmental fate of pollutants. The knowledge of the sorption properties of the different constituents of these biomacromolecules may furnish a significant contribution to this purpose. Suberin is a very abundant biopolymer in higher plants. In this study, suberin monomers isolated from cork were analyzed by thermally-assisted methylation with tetramethylammonium hydroxide (TMAH) in a pyrolysis unit coupled to gas chromatography–mass spectrometry (GC/MS). The isolated monomer mixture was used to study the sorption of three pesticides (isoproturon, methomyl and oxamyl). The modes of pesticide–sorbent interactions were analyzed by means of two modeling calculations, the first one representing only the mixture of suberin monomers used in the sorption study, and the second one including glycerol to the mixture of suberin monomers, as a building block of the suberin molecule. The results indicated that the highest sorption capacity exhibited by the sorbent was for isoproturon (33%) being methomyl and oxamyl sorbed by the main suberin components to a lesser extent (3% and < 1%, respectively). In addition to van der Waals interactions with the apolar region of sorbent and isoproturon, modeling calculations evidenced the formation of a hydrogen bond between the isoproturon NH group and a carboxylic oxygen atom of a suberin monomer. In the case of methomyl and oxamyl only weak van der Waals interactions stabilize the pesticide–sorbent adducts. The presence of glycerol in the model provoked significant changes in the interactions with isoproturon and methomyl. - Highlights: • Suberin has low affinity to retain pesticides of aliphatic character. • Suberin has a moderate affinity to adsorb isoproturon. • Modeling calculations show that apolar portion of suberin interacts with isoproturon.

  8. Binding interactions between suberin monomer components and pesticides

    International Nuclear Information System (INIS)

    Olivella, M.À.; Bazzicalupi, C.; Bianchi, A.; Río, J.C. del; Fiol, N.; Villaescusa, I.

    2015-01-01

    Understanding the role of biomacromolecules and their interactions with pollutants is a key for elucidating the sorption mechanisms and making an accurate assessment of the environmental fate of pollutants. The knowledge of the sorption properties of the different constituents of these biomacromolecules may furnish a significant contribution to this purpose. Suberin is a very abundant biopolymer in higher plants. In this study, suberin monomers isolated from cork were analyzed by thermally-assisted methylation with tetramethylammonium hydroxide (TMAH) in a pyrolysis unit coupled to gas chromatography–mass spectrometry (GC/MS). The isolated monomer mixture was used to study the sorption of three pesticides (isoproturon, methomyl and oxamyl). The modes of pesticide–sorbent interactions were analyzed by means of two modeling calculations, the first one representing only the mixture of suberin monomers used in the sorption study, and the second one including glycerol to the mixture of suberin monomers, as a building block of the suberin molecule. The results indicated that the highest sorption capacity exhibited by the sorbent was for isoproturon (33%) being methomyl and oxamyl sorbed by the main suberin components to a lesser extent (3% and < 1%, respectively). In addition to van der Waals interactions with the apolar region of sorbent and isoproturon, modeling calculations evidenced the formation of a hydrogen bond between the isoproturon NH group and a carboxylic oxygen atom of a suberin monomer. In the case of methomyl and oxamyl only weak van der Waals interactions stabilize the pesticide–sorbent adducts. The presence of glycerol in the model provoked significant changes in the interactions with isoproturon and methomyl. - Highlights: • Suberin has low affinity to retain pesticides of aliphatic character. • Suberin has a moderate affinity to adsorb isoproturon. • Modeling calculations show that apolar portion of suberin interacts with isoproturon.

  9. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  10. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  12. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  13. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  14. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  15. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  16. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  17. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  18. Pseudomonas syringae evades host Immunity by degrading flagellin monomers with alkaline protease AprA

    OpenAIRE

    Pel, M.J.C.; Van Dijken, A.J.H.; Bardoel, B.W.; Seidl, M.F; Van der Ent, S.; Van Strijp, J.A.G.

    2014-01-01

    Bacterial flagellin molecules are strong inducers of innate immune responses in both mammals and plants. The opportunistic pathogen Pseudomonas aeruginosa secretes an alkaline protease called AprA that degrades flagellin monomers. Here, we show that AprA is widespread among a wide variety of bacterial species. In addition, we investigated the role of AprA in virulence of the bacterial plant athogen P. syringae pv. tomato DC3000. The AprA-deficient DC3000 ΔaprA knockout mutant was significantl...

  19. Design, synthesis and characterization of a highly luminescent Eu-complex monomer featuring thenoyltrifluoroacetone and 5-acryloxyethoxymethyl-8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Xu Cunjin [State Key Laboratory of Chemical Engineering, Department of Chemical and Biochemical Engineering, Zhejiang University, Hangzhou 310027 (China); College of Material, Chemistry and Chemical Engineering, Hangzhou Normal University, Hangzhou 310036 (China); Li Bogeng, E-mail: bgli@zju.edu.cn [State Key Laboratory of Chemical Engineering, Department of Chemical and Biochemical Engineering, Zhejiang University, Hangzhou 310027 (China); Wan Jintao; Bu Zhiyang [State Key Laboratory of Chemical Engineering, Department of Chemical and Biochemical Engineering, Zhejiang University, Hangzhou 310027 (China)

    2011-08-15

    A multi-functional ligand, 5-acryloxyethoxymethyl-8-hydroxyquinoline (Hamq), was synthesized, which contained a polymerizable C=C double bond for the copolymerization with other vinyl monomers and acted as photon antenna able to transfer energy to Eu{sup 3+} ions effectively. The triplet state energy of Hamq was determined to be 22,370 cm{sup -1} via the phosphorescence spectra of Hamq and its gadolinium complex. The title complex monomer Eu(tta){sub 2}(amq) was prepared by coordination reaction of Hamq with europium isopropoxide and 2-thenoyltrifluoroacetone (Htta) in dry organic solvents under argon atmosphere and characterized by elemental analysis and IR spectrum. The photophysical properties of the complex were studied in detail with UV-vis, luminescence spectra, luminescence lifetime and quantum yield. The complex exhibited nearly monochromatic red emission at 612 nm, a remarkable luminescence quantum yield at room temperature (30.6%) upon ligand excitation and a long {sup 5}D{sub 0} lifetime (389 {mu}s), which indicated that the ligand Hamq could sensitize the luminescence of Eu(III) ion efficiently in Eu(tta){sub 2}(amq), resulting in a strong luminescence of its copolymer poly[MMA-co-Eu(TTA){sub 2}(amq)] under UV excitation. The excellent luminescence properties of the complex made it not only a promising light-conversion molecular device but also an excellent luminescent monomer. - Highlights: >iWe designed and synthesized a highly luminescent Eu-complex monomer. > Quantum yield and lifetime of the complex are 30.6% and 389 {mu}s, respectively. > Excellent luminescence of the complex made it an excellent luminescent monomer.

  20. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  1. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  2. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  4. Macroradical initiated polymerisation of acrylic and methacrylic monomers.

    Science.gov (United States)

    Mijangos, Irene; Guerreiro, António; Piletska, Elena; Whitcombe, Michael J; Karim, Kal; Chianella, Iva; Piletsky, Sergey

    2009-10-01

    An approach has been developed for the grafting of monomers onto poly(trimethylolpropane trimethacrylate) (polyTRIM) particles using 2,2-diethyl dithiocarbamic acid benzyl ester (DDCABE) as an initiator. A set of polymers was prepared with this technique over different lengths of time and the kinetics of the reaction studied experimentally. It was found that the grafting of initiator to the polymeric support followed a second order reaction, while the subsequent addition of monomers from solution into the polyTRIM macroradicals followed a first order reaction. The living nature of the iniferter modified macroradicals permits easy consecutive grafting of multiple polymeric layers, allowing straightforward functionalisation of particles. However, the effectiveness of the grafted initiator decreased with each cycle of polymerisation. This technique can be used for a wide range of applications in analytical and biochemistry.

  5. Calculation of vibrational spectra for dioxouranium monochloride monomer and dimers

    Science.gov (United States)

    Umreiko, D. S.; Shundalau, M. B.; Zazhogin, A. P.; Komyak, A. I.

    2010-09-01

    Structural models were built and spectral characteristics were calculated based on ab initio calculations for the monomer and dimers of dioxouranium monochoride UO2Cl. The calculations were carried out in the effective core potential LANL2DZ approximation for the uranium atom and all-electron basis sets using DFT methods for oxygen and chlorine atoms (B3LYP/cc-pVDZ). The monomer UO2Cl was found to possess an equilibrium planar (close to T-shaped) configuration with C2v symmetry. The obtained spectral characteristics were analyzed and compared with experimental data. The adequacy of the proposed models and the qualitative agreement between calculation and experiment were demonstrated.

  6. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  8. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  9. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  10. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  11. In situ polymerization of monomers for polyphenylquinoxaline-graphite fiber composites

    Science.gov (United States)

    Serafini, T. T.; Delvigs, P.; Vannucci, R. D.

    1974-01-01

    In situ polymerization of monomers was used to prepare graphite-fiber-reinforced polyphenylquinoxaline composites. Six different monomer combinations were investigated. Composite mechanical property retention characteristics were determined at 316 C (600 F) over an extended time period.

  12. Functionalized Nanoporous Polymer Membranes with Well-Defined Pore Architectures via Lyotropic Liquid-Crystalline Monomers

    National Research Council Canada - National Science Library

    Gin, Douglas

    1997-01-01

    .... Two lyotropic liquid-crystalline monomer platforms have been synthesized. The interchannel separations in the polymerizable materials can be varied in the 30-40 A range by the choice of counterion on the ionic headgroup of the monomers...

  13. Ortho-substituted triptycene-based diamines, monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Ghanem, Bader Saleh

    2017-04-13

    Described herein are ortho-dimethyl-substituted and tetramethyi-substituted triptycene-containing diamine monomers and microporous triptycene-based poiyimides and poiyamides, and methods of making the monomers and polymers.

  14. Ortho-substituted triptycene-based diamines, monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Ghanem, Bader Saleh; Pinnau, Ingo

    2017-01-01

    Described herein are ortho-dimethyl-substituted and tetramethyi-substituted triptycene-containing diamine monomers and microporous triptycene-based poiyimides and poiyamides, and methods of making the monomers and polymers.

  15. Reticuloendothelial hyperphagocytosis occurs in streptozotocin-diabetic rats. Studies with colloidal carbon, albumin microaggregates, and soluble fibrin monomers

    International Nuclear Information System (INIS)

    Cornell, R.P.

    1982-01-01

    In contrast to previous studies of diabetic humans and animals, which reported unchanged or depressed function, reticuloendothelial system (RES) hyperphagocytosis of colloidal carbon, 125 I-albumin microaggregates, and 125 I-fibrin monomers were observed in rats as early as 14 days after the induction of diabetes with streptozotocin (STZ). The fact that enhanced phagocytosis by RE macrophages was prevented by chronic insulin replacement therapy indicates that the diabetic internal environment of hyperglycemia and hypoinsulinemia was perhaps responsible for the observed changes. Experiments involving organ localization of intravenously administered particles, perfusion of isolated livers, and microscopic examination of the liver all suggested that increased Kupffer cell activity was the primary event in RES hyperphagocytosis by STZ-diabetic rats. Both hypertrophy and hyperplasia of Kupffer cells were apparent in livers of STZ-diabetic animals as evidenced by photomicrographs and hepatic cell quantification. Plasma fibronectin, which binds fibrin monomers to RE macrophages before phagocytosis, was significantly decreased in the circulation of STZ-diabetic rats, but the level of cell-associated fibronectin was not measured. Renal localization of urea-soluble 125 I-fibrin monomers exceeded splenic and pulmonary uptake in normal control rats and was enhanced in animals with STZ-diabetes. Changes in fibronectin levels, fibrin monomer localization, and Kupffer cell size and numbers in experimental diabetes in rats may have implications for the pathogenesis of vascular disease involving phagocytic mesangial and foam cells in diabetic humans

  16. Reticuloendothelial hyperphagocytosis occurs in streptozotocin-diabetic rats. Studies with colloidal carbon, albumin microaggregates, and soluble fibrin monomers.

    Science.gov (United States)

    Cornell, R P

    1982-02-01

    In contrast to previous studies of diabetic humans and animals, which reported unchanged or depressed function, reticuloendothelial system (RES) hyperphagocytosis of colloidal carbon, 125I-albumin microaggregates, and 125I-fibrin monomers were observed in rats as early as 14 days after the induction of diabetes with streptozotocin (STZ). The fact that enhanced phagocytosis by RE macrophages was prevented by chronic insulin replacement therapy indicates that the diabetic internal environment of hyperglycemia and hypoinsulinemia was perhaps responsible for the observed changes. Experiments involving organ localization of intravenously administered particles, perfusion of isolated livers, and microscopic examination of the liver all suggested that increased Kupffer cell activity was the primary event in RES hyperphagocytosis by STZ-diabetic rats. Both hypertrophy and hyperplasia of Kupffer cells were apparent in livers of STZ-diabetic animals as evidenced by photomicrographs and hepatic cell quantification. Plasma fibronectin, which binds fibrin monomers to RE macrophages before phagocytosis, was significantly decreased in the circulation of STZ-diabetic rats, but the level of cell-associated fibronectin was not measured. Renal localization of urea-soluble 125I-fibrin monomers exceeded splenic and pulmonary uptake in normal control rats and was enhanced in animals with STZ-diabetes. Changes in fibronectin levels, fibrin monomer localization, and Kupffer cell size and numbers in experimental diabetes in rats may have implications for the pathogenesis of vascular disease involving phagocytic mesangial and foam cells in diabetic humans.

  17. Structural similarity between β(3)-peptides synthesized from β(3)-homo-amino acids and aspartic acid monomers.

    Science.gov (United States)

    Ahmed, Sahar; Sprules, Tara; Kaur, Kamaljit

    2014-07-01

    Formation of stable secondary structures by oligomers that mimic natural peptides is a key asset for enhanced biological response. Here we show that oligomeric β(3)-hexapeptides synthesized from L-aspartic acid monomers (β(3)-peptides 1, 5a, and 6) or homologated β(3)-amino acids (β(3)-peptide 2), fold into similar stable 14-helical secondary structures in solution, except that the former form right-handed 14-helix and the later form left-handed 14-helix. β(3)-Peptides from L-Asp monomers contain an additional amide bond in the side chains that provides opportunities for more hydrogen bonding. However, based on the NMR solution structures, we found that β(3)-peptide from L-Asp monomers (1) and from homologated amino acids (2) form similar structures with no additional side-chain interactions. These results suggest that the β(3)-peptides derived from L-Asp are promising peptide-mimetics that can be readily synthesized using L-Asp monomers as well as the right-handed 14-helical conformation of these β(3)-peptides (such as 1 and 6) may prove beneficial in the design of mimics for right-handed α-helix of α-peptides. © 2014 Wiley Periodicals, Inc.

  18. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  19. Structure of human insulin monomer in water/acetonitrile solution

    Energy Technology Data Exchange (ETDEWEB)

    Bocian, Wojciech; Sitkowski, Jerzy; Bednarek, Elzbieta [National Medicines Institute (Poland); Tarnowska, Anna; Kawecki, Robert [Institute of Organic Chemistry Polish Academy of Sciences (Poland); Kozerski, Lech [National Medicines Institute (Poland)], E-mail: lkoz@icho.edu.pl

    2008-01-15

    Here we present evidence that in water/acetonitrile solvent detailed structural and dynamic information can be obtained for important proteins that are naturally present as oligomers under native conditions. An NMR-derived human insulin monomer structure in H{sub 2}O/CD{sub 3}CN, 65/35 vol%, pH 3.6 is presented and compared with the available X-ray structure of a monomer that forms part of a hexamer (Acta Crystallogr. 2003 Sec. D59, 474) and with NMR structures in water and organic cosolvent. Detailed analysis using PFGSE NMR, temperature-dependent NMR, dilution experiments and CSI proves that the structure is monomeric in the concentration and temperature ranges 0.1-3 mM and 10-30 deg. C, respectively. The presence of long-range interstrand NOEs, as found in the crystal structure of the monomer, provides the evidence for conservation of the tertiary structure. Starting from structures calculated by the program CYANA, two different molecular dynamics simulated annealing refinement protocols were applied, either using the program AMBER in vacuum (AMBER{sub V}C), or including a generalized Born solvent model (AMBER{sub G}B)

  20. Structure of human insulin monomer in water/acetonitrile solution

    International Nuclear Information System (INIS)

    Bocian, Wojciech; Sitkowski, Jerzy; Bednarek, Elzbieta; Tarnowska, Anna; Kawecki, Robert; Kozerski, Lech

    2008-01-01

    Here we present evidence that in water/acetonitrile solvent detailed structural and dynamic information can be obtained for important proteins that are naturally present as oligomers under native conditions. An NMR-derived human insulin monomer structure in H 2 O/CD 3 CN, 65/35 vol%, pH 3.6 is presented and compared with the available X-ray structure of a monomer that forms part of a hexamer (Acta Crystallogr. 2003 Sec. D59, 474) and with NMR structures in water and organic cosolvent. Detailed analysis using PFGSE NMR, temperature-dependent NMR, dilution experiments and CSI proves that the structure is monomeric in the concentration and temperature ranges 0.1-3 mM and 10-30 deg. C, respectively. The presence of long-range interstrand NOEs, as found in the crystal structure of the monomer, provides the evidence for conservation of the tertiary structure. Starting from structures calculated by the program CYANA, two different molecular dynamics simulated annealing refinement protocols were applied, either using the program AMBER in vacuum (AMBER V C), or including a generalized Born solvent model (AMBER G B)

  1. Characterisation of polyhydroxyalkanoate copolymers with controllable four-monomer composition.

    Science.gov (United States)

    Dai, Yu; Lambert, Lynette; Yuan, Zhiguo; Keller, Jurg

    2008-03-20

    Polyhydroxyalkanoate (PHA) copolymers comprising the four monomers 3-hydroxybutyrate (3HB), 3-hydroxyvalerate (3HV), 3-hydroxy-2-methylvalerate (3HMV) and 3-hydroxy-2-methylbutyrate (3HMB) were generated using the recently discovered Defluviicoccus vanus-related glycogen accumulating organisms (DvGAOs) under anaerobic conditions without applying any nutrient limitations. The composition could be manipulated in a defined range by modifying the ratio of propionate and acetate provided in the feed stream. The PHAs produced were characterised as random copolymers (from propionate alone) or a mixture of random copolymers (from mixture of propionate and acetate) through microstructure analysis using 13C NMR spectroscopy. The sequence distribution of all eight comonomer pairs in the carbonyl region of 3HB and 3HV was identified and assigned with confidence utilising two-dimensional heteronuclear multiple bond coherence (HMBC) spectroscopy. Weight average molecular weights were in the range 390-560 kg/mol. Differential scanning calorimetry (DSC) traces showed that the melting temperature (Tm) varied between 70 and 161 degrees C and glass transition temperature (Tg) ranged from -8 to 0 degrees C. The incorporation of considerable amounts of 3HMV and 3HMB monomer units introduced additional "defects" into the PHBV copolymer structure and hence greatly lowered the crystallinity. The data indicate the potential of these four-monomer PHAs to be employed for practical applications, considering their favourable properties and the cost-effective production process using a mixed culture and simple carbon sources.

  2. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  3. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  4. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  5. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  6. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  7. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  8. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  9. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  10. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  11. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  12. Thermodynamics of swelling of latex particles with two monomers: a sensitivity analysis

    NARCIS (Netherlands)

    Maxwell, I.A.; Noel, E.F.J.; Schoonbrood, H.A.S.; German, A.L.

    1993-01-01

    A sensitivity anal. is performed to det. at what conditions the simplified model for swelling of latex particles by two monomers or two solvents is valid. This model proposes that, inter alia, the fractions of two monomers in the latex particles and in the monomer droplets are equal. The model is a

  13. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  14. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  15. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  16. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  17. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  18. Fabrication of Surface Protein-Imprinted Nanoparticles Using a Metal Chelating Monomer via Aqueous Precipitation Polymerization.

    Science.gov (United States)

    Li, Wei; Sun, Yan; Yang, Chongchong; Yan, Xianming; Guo, Hao; Fu, Guoqi

    2015-12-16

    Molecular imprinting is a promising way for constructing artificial protein recognition materials, but it has been challenged by difficulties such as restricted biomacromolecule transfer in the cross-linked polymer networks, and reduced template-monomer interactions that are due to the required aqueous media. Herein, we propose a strategy for imprinting of histidine (His)-exposed proteins by combining previous approaches such as surface imprinting over nanostructures, utilization of metal coordination interactions, and adoption of aqueous precipitation polymerization capable of forming reversible physical crosslinks. With lysozyme as a model template bearing His residues, imprinted polymer nanoshells were grafted over vinyl-modified nanoparticles by aqueous precipitation copolymerization of a Cu(2+) chelating monomer with a temperature-responsive monomer carried out at 37 °C, above the volume phase-transition temperature (VPTT) of the final copolymer. The imprinted nanoshells showed significant temperature sensitivity and the template removal could be facilitated by swelling of the imprinted layers at 4 °C, below the VPTT. The resultant core-shell imprinted nanoparticles exhibited strikingly high rebinding selectivity against a variety of nontemplate proteins. An imprinting factor up to 22.7 was achieved, which is among the best values reported for protein imprinting, and a rather high specific binding capacity of 67.3 mg/g was obtained. Moreover, this approach was successfully extended to preliminary imprinting of hemoglobin, another protein with accessible His. Therefore, it may be a versatile method for fabrication of high-performance surface-imprinted nanoparticles toward His-exposed proteins.

  19. Prediction of monomer isomery in Florine: a workflow dedicated to nonribosomal peptide discovery.

    Directory of Open Access Journals (Sweden)

    Thibault Caradec

    Full Text Available Nonribosomal peptides represent a large variety of natural active compounds produced by microorganisms. Due to their specific biosynthesis pathway through large assembly lines called NonRibosomal Peptide Synthetases (NRPSs, they often display complex structures with cycles and branches. Moreover they often contain non proteogenic or modified monomers, such as the D-monomers produced by epimerization. We investigate here some sequence specificities of the condensation (C and epimerization (E domains of NRPS that can be used to predict the possible isomeric state (D or L of each monomer in a putative peptide. We show that C- and E- domains can be divided into 2 sub-regions called Up-Seq and Down-Seq. The Up-Seq region corresponds to an InterPro domain (IPR001242 and is shared by C- and E-domains. The Down-Seq region is specific to the enzymatic activity of the domain. Amino-acid signatures (represented as sequence logos previously described for complete C-and E-domains have been restricted to the Down-Seq region and amplified thanks to additional sequences. Moreover a new Down-Seq signature has been found for Ct-domains found in fungi and responsible for terminal cyclization of the peptides. The identification of these signatures has been included in a workflow named Florine, aimed to predict nonribosomal peptides from NRPS sequence analyses. In some cases, the prediction of isomery is guided by genus-specific rules. Florine was used on a Pseudomonas genome to allow the determination of the type of pyoverdin produced, the update of syringafactin structure and the identification of novel putative products.

  20. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  1. The Relationship between the Monomer Chain Length and the Electro-Optical Properties of Polymer Dispersed Liquid Crystals

    Directory of Open Access Journals (Sweden)

    Liu J.

    2016-03-01

    Full Text Available Five polymers dispersed liquid crystalline (LC films were fabricated using photo-polymerizable monomers with different lengths of carbon chains. These LC films have shown different electro-optical (EO properties. Through their SEM pictures, the relationship between the linear electro-optical effect and the mesh size of the polymer network was explored. With the increase of number of photo-polymerizable monomers, the mesh size of the polymer network would become larger. So the liquid crystal molecules would be easily oriented in the electric field and therefore, the threshold voltage and saturation voltage would decrease. The open state response times were also reduced and the off state response times would be extended. The DFT simulations have shown principal role of the ground state dipole moments in the observed electro-optical efficiency.

  2. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  3. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  4. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  5. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  6. Radiation induced ionic polymerisation and grafting of vinyl monomers

    International Nuclear Information System (INIS)

    Stannett, V.T.

    1981-01-01

    Some special aspects of the radiation induced ionic polymerisation and grafting of vinyl monomers will be described. In particular the effects of solvents on the cationic polymerisation of the vinyl ethers will be discussed in detail. The unequivocal free ion nature of the polymerisation makes such information of considerable general interest. Estimates of the propagation rate constants with free cation polymerisation in solvents of different dielectric constants and solvation powers will be presented. Finally, some observations on the radiation induced graft polymerisation of ethyl vinyl ether to poly(vinyl chloride) and to polypropylene will be presented. (author)

  7. Radiation vulcanization of ethylene-propylene rubber with polyfunctional monomers

    Energy Technology Data Exchange (ETDEWEB)

    Jinhua, Wang; Yoshii, Fumio; Makuuchi, Keizo

    2001-01-01

    This paper reports on the sensitizing efficiency of several polyfunctional monomers to radiation vulcanization of ethylene-propylene rubber. And the results show that triethyleneglycol dimethacrylate (TEGDMA) gave the best results. TEGDMA not only lowers the vulcanization dose (D{sub v}), but also increases the tensile strength greatly. The content of TEGDMA does not affect the D{sub v} of TEGDMA-EPM, but affects the tensile strength at the D{sub v}. At best content (0.04 mol/100 g EPM), the tensile strength is increased from 6.0 to 12 MPa, and the elongation is 790% at the D{sub v}. (author)

  8. Breathing zone concentrations of methylmethacrylate monomer during joint replacement operations

    DEFF Research Database (Denmark)

    Darre, E; Jørgensen, L G; Vedel, P

    1992-01-01

    By use of a methylmethacrylate (MMA) Dräger tube and bellow bump, the breathing zone concentrations of MMA monomer were measured for the operating surgeon during cementation of the components of hip and knee joint prostheses. The highest recordings (50-100 p.p.m.) were encountered during cementat...... cementation of the acetabular cups with conventional polymethylmethacrylate cement. Such exposure could be eliminated by the use of personal protection equipment, local punctual field suction or change to a MMA/n-decylmethacrylate/isobornylmethacrylate bone cement....

  9. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  10. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  11. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  12. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  13. A novel antibacterial orthodontic cement containing a quaternary ammonium monomer dimethylaminododecyl methacrylate

    Science.gov (United States)

    Melo, Mary A.S.; Wu, Junling; Weir, Michael D.; Xu, Hockin H. K.

    2015-01-01

    Demineralized lesions in tooth enamel around orthodontic brackets are caused by acids from cariogenic biofilm. This study aimed to develop a novel antibacterial orthodontic cement by incorporating a quaternary ammonium monomer dimethylaminododecyl methacrylate (DMADDM) into a commercial orthodontic cement, and to investigate the effects on microcosm biofilm response and enamel bond strength. DMADDM, a recently-synthetized antibacterial monomer, was incorporated into orthodontic cement at 0%, 1.5%, 3% and 5% mass fractions. Bond strength of brackets to enamel was measured. A microcosm biofilm model was used to measure metabolic activity, lactic acid production, and colony-forming units (CFU) on orthodontic cements. Shear bond strength was not reduced at 3% DAMDDM (p > 0.1), but was slightly reduced at 5% DMADDM, compared to 0% DMADDM. Biofilm viability was substantially inhibited when in contact with orthodontic cement containing 3% DMADDM. Biofilm metabolic activity, lactic acid production, and CFU were much lower on orthodontic cement containing DMADDM than control cement (p orthodontic cement containing 3% DMADDM inhibited oral biofilms without compromising the enamel bond strength, and is promising to reduce or eliminate demineralization in enamel around orthodontic brackets. PMID:25035230

  14. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  15. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  16. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  17. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  18. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  19. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  20. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  1. Shelf Life of PMR Polyimide Monomer Solutions and Prepregs Extended

    Science.gov (United States)

    Alston, William B.; Scheiman, Daniel A.

    2000-01-01

    PMR (Polymerization of Monomeric Reactants) technology was developed in the mid-1970's at the NASA Glenn Research Center at Lewis Field for fabricating high-temperature stable polyimide composites. This technology allowed a solution of polyimide monomers or prepreg (a fiber, such as glass or graphite, impregnated with PMR polyimide monomers) to be thermally cured without the release of volatiles that cause the formation of voids unlike the non-PMR technology used for polyimide condensation type resins. The initial PMR resin introduced as PMR 15 is still commercially available and is used worldwide by aerospace industries as the state-of-the-art resin for high-temperature polyimide composite applications. PMR 15 offers easy composite processing, excellent composite mechanical property retention, a long lifetime at use temperatures of 500 to 550 F, and relatively low cost. Later, second-generation PMR resin versions, such as PMR II 50 and VCAP 75, offer improvements in the upper-use temperature (to 700 F) and in the useful life at temperature without major compromises in processing and property retention but with significant increases in resin cost. Newer versions of nontoxic (non-methylene dianiline) PMR resins, such as BAX PMR 15, offer similar advantages as originally found for PMR 15 but also with significant increases in resin cost. Thus, the current scope of the entire PMR technology available meets a wide range of aeronautical requirements for polymer composite applications.

  2. Monomer-dimer problem on random planar honeycomb lattice

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Haizhen [School of Mathematical Sciences, Xiamen University, Xiamen 361005, Fujian (China); Department of Mathematics, Qinghai Normal University, Xining 810008, Qinghai (China); Zhang, Fuji; Qian, Jianguo, E-mail: jqqian@xmu.edu.cn [School of Mathematical Sciences, Xiamen University, Xiamen 361005, Fujian (China)

    2014-02-15

    We consider the monomer-dimer (MD) problem on a random planar honeycomb lattice model, namely, the random multiple chain. This is a lattice system with non-periodic boundary condition, whose generating process is inspired by the growth of single walled zigzag carbon nanotubes. By applying algebraic and combinatorial techniques we establish a calculating expression of the MD partition function for bipartite graphs, which corresponds to the permanent of a matrix. Further, by using the transfer matrix argument we show that the computing problem of the permanent of high order matrix can be converted into some lower order matrices for this family of lattices, based on which we derive an explicit recurrence formula for evaluating the MD partition function of multiple chains and random multiple chains. Finally, we analyze the expectation of the number of monomer-dimer arrangements on a random multiple chain and the asymptotic behavior of the annealed MD entropy when the multiple chain becomes infinite in width and length, respectively.

  3. Elution of monomer from different bulk fill dental composite resins.

    Science.gov (United States)

    Cebe, Mehmet Ata; Cebe, Fatma; Cengiz, Mehmet Fatih; Cetin, Ali Rıza; Arpag, Osman Fatih; Ozturk, Bora

    2015-07-01

    The purpose of this study was to evaluate the elution of Bis-GMA, TEGDMA, HEMA, and Bis-EMA monomers from six bulk fill composite resins over four different time periods, using HPLC. Six different composite resin materials were used in the present study: Tetric Evo Ceram Bulk Fill (Ivoclar Vivadent, Amherst, NY), X-tra Fill (VOCO, Cuxhaven, Germany), Sonic Fill (Kerr, Orange, CA, USA), Filtek Bulk Fill (3M ESPE Dental Product, St. Paul, MN), SDR (Dentsply, Konstanz, Germany), EQUIA (GC America INC, Alsip, IL). The samples (4mm thickness, 5mm diameter) were prepared and polymerized for 20s with a light emitted diode unit. After fabrication, each sample was immediately immersed in 75wt% ethanol/water solution used as extraction fluid and stored in the amber colored bottles at room temperature. Ethanol/water samples were taken (0.5mL) at predefined time intervals:10m (T1), 1h (T2), 24h (T3) and 30 days (T4). These samples were analyzed by HPLC. The obtained data were analyzed with one-way ANOVA and Tukey HSD at significance level of pcomposites (pcomposite resins in all time periods and the amount of eluted monomers was increased with time. Copyright © 2015 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  4. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  5. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  6. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  7. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  8. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  9. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  10. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  11. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  12. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  13. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  14. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  15. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  16. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  17. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  18. High performance dental resin composites with hydrolytically stable monomers.

    Science.gov (United States)

    Wang, Xiaohong; Huyang, George; Palagummi, Sri Vikram; Liu, Xiaohui; Skrtic, Drago; Beauchamp, Carlos; Bowen, Rafael; Sun, Jirun

    2018-02-01

    The objectives of this project were to: 1) develop strong and durable dental resin composites by employing new monomers that are hydrolytically stable, and 2) demonstrate that resin composites based on these monomers perform superiorly to the traditional bisphenol A glycidyl dimethacrylate/triethylene glycol dimethacrylate (Bis-GMA/TEGDMA) composites under testing conditions relevant to clinical applications. New resins comprising hydrolytically stable, ether-based monomer, i.e., triethylene glycol divinylbenzyl ether (TEG-DVBE), and urethane dimethacrylate (UDMA) were produced via composition-controlled photo-polymerization. Their composites contained 67.5wt% of micro and 7.5wt% of nano-sized filler. The performances of both copolymers and composites were evaluated by a battery of clinically-relevant assessments: degree of vinyl conversion (DC: FTIR and NIR spectroscopy); refractive index (n: optical microscopy); elastic modulus (E), flexural strength (F) and fracture toughness (K IC ) (universal mechanical testing); Knoop hardness (HK; indentation); water sorption (W sp ) and solubility (W su ) (gravimetry); polymerization shrinkage (S v ; mercury dilatometry) and polymerization stress (tensometer). The experimental UDMA/TEG-DVBE composites were compared with the Bis-GMA/TEGDMA composites containing the identical filler contents, and with the commercial micro hybrid flowable composite. UDMA/TEG-DBVE composites exhibited n, E, W sp , W su and S v equivalent to the controls. They outperformed the controls with respect to F (up to 26.8% increase), K IC (up to 27.7% increase), modulus recovery upon water sorption (full recovery vs. 91.9% recovery), and stress formation (up to 52.7% reduction). In addition, new composites showed up to 27.7% increase in attainable DC compared to the traditional composites. Bis-GMA/TEGDMA controls exceeded the experimental composites with respect to only one property, the composite hardness. Significantly, up to 18.1% lower HK values in

  19. Polymerization of Polar Monomers from a Theoretical Perspective

    KAUST Repository

    Alghamdi, Miasser

    2016-10-11

    Density functional theory calculations have been used to investigate catalytic mechanism of polymer formation containing polar groups, from the synthesis of the monomer to the synthesis of the macromolecule. In the spirit of a sustainable and green chemistry, we initially focused attention on the coupling of CO2 as economically convenient and recyclable C1 source with C2H4 to form acrylate and/or butirro-lactone, two important polar monomers. In this process formation of a mettallolactone via oxidative coupling of CO2 and C2H4 is an important intermediate. Given this background, we explored in detail (chapter-3) several Ni based catalysts for CO2 coupling with C2H4 to form acrylate. In this thesis we report on the competitive reaction mechanisms (inner vs outer sphere) for the oxidative coupling of CO2 and ethylene for a set of 11 Ni-based complexes containing bisphosphine ligands. In another effort, considering incorporation of a C=C bond into a metal-oxygen-Functional-Group moiety is a challenging step in several polymerization reactions, we explored the details of this reaction (chapter4) using two different catalysts that are capable to perform this reaction in the synthesis of heterocycles. Specifically, the [Rh]-catalyzed intramolecular alkoxyacylation ([Rh] = [RhI(dppp)+] (dppp, 1,3-Bis-diphenylphosphino-propane), and the [Pd]/BPh3 intramolecular alkoxyfunctionalizations. Rest of the thesis we worked on understanding the details of the polymerization of polar monomers using organocatalysts based on N-heterocyclic carbenes (NHC) or N-heterocyclic olefins (NHO). In particular (chapter-5) we studied the polymerization of N-methyl N-carboxy- anhydrides, towards cyclic poly(N-substituted glycine)s, promoted by NHC catalysts. In good agreement with the experimental findings, we demonstrated that NHC promoted ring opening polymerization of N-Me N-Carboxyanhydrides may proceed via two different catalytic pathways. In a similar effort we studied polymerization of

  20. Final report of the safety assessment of methacrylate ester monomers used in nail enhancement products.

    Science.gov (United States)

    2005-01-01

    Triethylene Glycol Dimethacrylate are not sensitizers. Ethylene Glycol Dimethacrylate was not a sensitizer in one guinea pig study, but was a strong sensitizer in another. There is cross-reactivity between various methacrylate esters in some sensitization tests. Inhaled Butyl Methacrylate, HEMA, Hydroxypropyl Methacrylate, and Trimethylolpropane Trimethacrylate can be developmental toxicants at high exposure levels (1000 mg/kg/day). None of the methacrylate ester monomers that were tested were shown to have any endocrine disrupting activity. These methacrylate esters are mostly non-mutagenic in bacterial test systems, but weak mutagenic responses were seen in mammalian cell test systems. Chronic dermal exposure of mice to PEG-4 Dimethacrylate (25 mg, 2 x weekly for 80 weeks) or Trimethylolpropane Trimethacrylate (25 mg, 2 x weekly for 80 weeks) did not result in increased incidence of skin or visceral tumors. The carcinogenicity of Triethylene Glycol Dimethacrylate (5, 25, or 50%) was assessed in a mouse skin painting study (50 microl for 5 days/week for 78 weeks), but was not carcinogenic at any dose level tested. The Expert Panel was concerned about the strong sensitization and crossor co-reactivity potential of the methacrylate esters reviewed in this report. However, data demonstrated the rates of polymerization of these Methacrylates were similar to that of Ethyl Methacrylate and there would be little monomer available exposure to the skin. In consideration of the animal toxicity data, the CIR Expert Panel decided that these methacrylate esters should be restricted to the nail and must not be in contact with the skin. Accordingly, these methacrylate esters are safe as used in nail enhancement products when skin contact is avoided.

  1. Graft copolimerization of hydrophilic monomers onto irradiated polypropylene fibers

    International Nuclear Information System (INIS)

    Sundardi, F.

    1978-01-01

    A method of graft copolymerization of hydrophilic monomers, such as 1-vinyl-2-pyrrolidone, acrylonitrile, acrylic acid, and acrylamide, onto irradiated polypropylene fibers has been studied. γ ray as well as electron beam were employed for the irradiation processes. Graft-copolymerization kinetics and the properties of grafted fibers have been investigated. Moisture regain, dyes absorption, and melting point of the grafted fibers were found to increase with the increasing of the degree of grafting. Polypropylene for 1-vinyl-2-pyrrolidone grafted fibers showed excellent dye absorption for almost all kinds of dyes such as direct, basic, acid, reactive, disper, and naphthol dyes. However, for polypropylene acrylic acid grafted fibers, the colorfastness to washing was found to be unsatisfactory. The colorfastness to washing for polypropylene 1-vinyl-2-pyrrolidone grafted fibers was found to be fairly good for certain types of dyes such as vat and naphthol dyes. (author)

  2. Biobased Epoxy Nanocomposites Derived from Lignin-Based Monomers.

    Science.gov (United States)

    Zhao, Shou; Abu-Omar, Mahdi M

    2015-07-13

    Biobased epoxy nanocomposites were synthesized based on 2-methoxy-4-propylphenol (dihydroeugenol, DHE), a molecule that has been obtained from the lignin component of biomass. To increase the content of hydroxyl groups, DHE was o-demethylated using aqueous HBr to yield propylcatechol (DHEO), which was subsequently glycidylated to epoxy monomer. Optimal conditions in terms of yield and epoxy equivalent weight were found to be 60 °C with equal NaOH/phenolic hydroxyl molar ratio. The structural evolution from DHE to cured epoxy was followed by (1)H NMR and Fourier transform infrared spectroscopy. The nano-montmorillonite modified DHEO epoxy exhibited improved storage modulus and thermal stability as determined from dynamic mechanical analysis and thermogravimetric analysis. This study widens the synthesis routes of biobased epoxy thermosets from lignin-based molecules.

  3. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  4. On-line measurement of residual monomer during polymerisation of acrylamide using ultrasonics

    International Nuclear Information System (INIS)

    Ponraju, D.; Sebastian, Letha; Viswanathan, S.; Natarajan, A.; Palanichamy, P.; Jayakumar, T.; Baldev Raj

    1996-01-01

    An ultrasonic technique for the estimation of residual acrylamide monomer during the polymerization of aqueous acrylamide solution has been investigated. Polyacrylamide gel medium serves as a sensitive medium for detection and dosimetry of fast and thermal neutrons. This technique is based on the fact that the velocity of ultrasonic wave increases with the increase in elasticity due to polymerization. The percentage of residual acrylamide monomer is estimated using ultraviolet spectrophotometric analysis. The ultrasonic velocity is correlated with the residual monomer concentration

  5. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  6. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  8. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  9. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  10. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  11. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  12. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  13. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  14. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  16. Influence of template/functional monomer/cross‐linking monomer ratio on particle size and binding properties of molecularly imprinted nanoparticles

    DEFF Research Database (Denmark)

    Yoshimatsu, Keiichi; Yamazaki, Tomohiko; Chronakis, Ioannis S.

    2012-01-01

    A series of molecularly imprinted polymer nanoparticles have been synthesized employing various template/functional monomer/crosslinking monomer ratio and characterized in detail to elucidate the correlation between the synthetic conditions used and the properties (e.g., particle size and templat...... tuning of particle size and binding properties are required to fit practical applications. © 2011 Wiley Periodicals, Inc. J Appl Polym Sci, 2012...

  17. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  18. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  19. An engineered transforming growth factor β (TGF-β) monomer that functions as a dominant negative to block TGF-β signaling

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sun Kyung; Barron, Lindsey; Hinck, Cynthia S.; Petrunak, Elyse M.; Cano, Kristin E.; Thangirala, Avinash; Iskra, Brian; Brothers, Molly; Vonberg, Machell; Leal, Belinda; Richter, Blair; Kodali, Ravindra; Taylor, Alexander B.; Du, Shoucheng; Barnes, Christopher O.; Sulea, Traian; Calero, Guillermo; Hart, P. John; Hart, Matthew J.; Demeler, Borries; Hinck, Andrew P. (Texas-HSC); (NRCC); (Pitt)

    2017-02-22

    The transforming growth factor β isoforms, TGF-β1, -β2, and -β3, are small secreted homodimeric signaling proteins with essential roles in regulating the adaptive immune system and maintaining the extracellular matrix. However, dysregulation of the TGF-β pathway is responsible for promoting the progression of several human diseases, including cancer and fibrosis. Despite the known importance of TGF-βs in promoting disease progression, no inhibitors have been approved for use in humans. Herein, we describe an engineered TGF-β monomer, lacking the heel helix, a structural motif essential for binding the TGF-β type I receptor (TβRI) but dispensable for binding the other receptor required for TGF-β signaling, the TGF-β type II receptor (TβRII), as an alternative therapeutic modality for blocking TGF-β signaling in humans. As shown through binding studies and crystallography, the engineered monomer retained the same overall structure of native TGF-β monomers and bound TβRII in an identical manner. Cell-based luciferase assays showed that the engineered monomer functioned as a dominant negative to inhibit TGF-β signaling with a Ki of 20–70 nM. Investigation of the mechanism showed that the high affinity of the engineered monomer for TβRII, coupled with its reduced ability to non-covalently dimerize and its inability to bind and recruit TβRI, enabled it to bind endogenous TβRII but prevented it from binding and recruiting TβRI to form a signaling complex. Such engineered monomers provide a new avenue to probe and manipulate TGF-β signaling and may inform similar modifications of other TGF-β family members.

  20. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  1. Pseudomonas syringae evades host immunity by degrading flagellin monomers with alkaline protease AprA.

    Science.gov (United States)

    Pel, Michiel J C; van Dijken, Anja J H; Bardoel, Bart W; Seidl, Michael F; van der Ent, Sjoerd; van Strijp, Jos A G; Pieterse, Corné M J

    2014-07-01

    Bacterial flagellin molecules are strong inducers of innate immune responses in both mammals and plants. The opportunistic pathogen Pseudomonas aeruginosa secretes an alkaline protease called AprA that degrades flagellin monomers. Here, we show that AprA is widespread among a wide variety of bacterial species. In addition, we investigated the role of AprA in virulence of the bacterial plant pathogen P. syringae pv. tomato DC3000. The AprA-deficient DC3000 ΔaprA knockout mutant was significantly less virulent on both tomato and Arabidopsis thaliana. Moreover, infiltration of A. thaliana Col-0 leaves with DC3000 ΔaprA evoked a significantly higher level of expression of the defense-related genes FRK1 and PR-1 than did wild-type DC3000. In the flagellin receptor mutant fls2, pathogen virulence and defense-related gene activation did not differ between DC3000 and DC3000 ΔaprA. Together, these results suggest that AprA of DC3000 is important for evasion of recognition by the FLS2 receptor, allowing wild-type DC3000 to be more virulent on its host plant than AprA-deficient DC3000 ΔaprA. To provide further evidence for the role of DC3000 AprA in host immune evasion, we overexpressed the AprA inhibitory peptide AprI of DC3000 in A. thaliana to counteract the immune evasive capacity of DC3000 AprA. Ectopic expression of aprI in A. thaliana resulted in an enhanced level of resistance against wild-type DC3000, while the already elevated level of resistance against DC3000 ΔaprA remained unchanged. Together, these results indicate that evasion of host immunity by the alkaline protease AprA is important for full virulence of strain DC3000 and likely acts by preventing flagellin monomers from being recognized by its cognate immune receptor.

  2. 46 CFR 151.50-34 - Vinyl chloride (vinyl chloride monomer).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Vinyl chloride (vinyl chloride monomer). 151.50-34... chloride (vinyl chloride monomer). (a) Copper, aluminum, magnesium, mercury, silver, and their alloys shall... equipment that may come in contact with vinyl chloride liquid or vapor. (b) Valves, flanges, and pipe...

  3. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  4. Modulation of i-motif thermodynamic stability by the introduction of UNA (unlocked nucleic acid) monomers

    DEFF Research Database (Denmark)

    Pasternak, Anna; Wengel, Jesper

    2011-01-01

    The influence of acyclic RNA derivatives, UNA (unlocked nucleic acid) monomers, on i-DNA thermodynamic stability has been investigated. The 22 nt human telomeric fragment was chosen as the model sequence for stability studies. UNA monomers modulate i-motif stability in a position-depending manner...

  5. Triptycene-based ladder monomers and polymers, methods of making each, and methods of use

    KAUST Repository

    Pinnau, Ingo; Ghanem, Bader; Swaidan, Raja

    2015-01-01

    Embodiments of the present disclosure provide for a triptycene-based A-B monomer, a method of making a triptycene-based A-B monomer, a triptycene-based ladder polymer, a method of making a triptycene-based ladder polymers, a method of using

  6. Sulfonated copolyimide membranes derived from a novel diamine monomer with pendant benzimidazole groups for fuel cells

    DEFF Research Database (Denmark)

    Li, Wei; Guo, Xiaoxia; Aili, David

    2015-01-01

    . A series of sulfonated copolyimides (SPI) are prepared via random copolymerizatio of 1,4,5,8-naphthalenetetracarboxylic dianhydride (NTDA) with a new diamine monomer with pendant benzimidazole groups, 2,2'-bis(4-(1H-benzo[d]imidazol-2-yl)phenoxy)benzidine (BIPOB), and a sulfonated diamine monomer 4,4'-bis...

  7. Use of Monomer Fraction Data in the Parametrization of Association Theories

    DEFF Research Database (Denmark)

    Kontogeorgis, Georgios; Tsivintzelis, Ioannis; von Solms, Nicolas

    2010-01-01

    the monomer fraction of hydrogen bonding compounds and their mixtures. Monomer fraction data are obtained from spectroscopic measurements and they are available for a few compounds such as pure water and alcohols as well as for some alcohol–alkane and similar mixtures. These data are useful...... “improved” model parameters can be obtained if monomer fraction data are included in the parameter estimation together with vapor pressures and liquid densities. The expression “improved” implies parameters which can represent several pure compound properties as well as monomer fraction data for pure......, liquid densities and monomer fractions of water and alcohols. The 4C scheme is the best choice for water, while for methanol there is small difference between the 2B and 3B association schemes....

  8. Polyfunctional monomers as additives for enhancing the radiation copolymerization of styrene with polyethylene, polypropylene, and PVC

    International Nuclear Information System (INIS)

    Ang, C.H.; Garnett, J.L.; Levot, R.; Long, M.A.

    1982-01-01

    Additives which can increase the yield in the radiation grafting of monomers to polymers are useful. The use of polyfunctional monomers as additives (approx. = 1% v/v) are shown to enhance significantly the copolymerization yields of styrene in methanol to films of polyethylene and polypropylene under certain radiation conditions. The results obtained when the polyolefins are replaced by PVC as backbone polymer in these accelerated grafting reactions are reported. Divinylbenzene (DVB) and trimethylolpropane triacrylate (TMPTA) were used as representative polyfunctional monomers for the enhancement effect. When polypropylene was used as backbone polymer, the inclusion of DVB significantly enhanced the radiation grafting of styrene in methanol at all monomer concentrations studied above 35%. At certain monomer concentrations (50% , 60%), the yield of graft copolymer was almost doubled by the addition of DVB. 3 tables. (DP)

  9. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  10. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  11. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  12. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  13. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  15. Controllable synthesis, crystal structure and magnetic properties of Monomer-Dimer Cocrystallized MnIII Salen-type composite material

    Science.gov (United States)

    Wu, Qiong; Wu, Wei; Wu, Yongmei; Li, Weili; Qiao, Yongfeng; Wang, Ying; Wang, Baoling

    2018-04-01

    By the reaction of manganese-Schiff-base complexes with penta-anionic Anderson heteropolyanion, a new supramolecular architecture [Mn2(Salen)2(H2O)2][Mn(Salen)(H2O)2]2Na[IMo6O24]·8H2O (1) (salen = N,N‧-ethylene-bis (salicylideneiminate) has been isolated. Compound 1 was characterized by the single-crystal X-ray diffraction, elemental, IR and thermal gravimetric analyses. Structural analysis reveals that the unit cell simultaneously contains MnIII-Salen dimer and monomer cation fragments, for which the Anderson-type polyanions serve as counter anions. In the packing arrangement, all the MnIII dimers are well separated by polyoxometalate units and form tertiary structure together with MnIII monomers. Interestingly, different from the previous work, in the exact same reaction conditions, we are able to template MnIII-Salen complexes into different configurations by varying the charge state of polyanions. Besides, the magnetic properties of 1 were also examined by using both dc and ac magnetic field of the superconducting quantum interference devices. Most importantly, our fitting of the experimental data to a Heisenberg-type spin model shows that there exists a ferromagnetic exchange interaction ∼5 K between the spins (S = 2) on MnIII in the dimer, while antiferromagnetic ones exist among monomers and dimer (∼2 K). This meta-magnetic state could induce a slight spin frustration at low temperature, which would in turn affect the magnetic behavior. In addition, our ac field measurement of the susceptibilities suggests a typical signature for a single-molecule magnet.

  16. Effect of residual monomer from polyacrylamide on head lettuce grown in peat substrate.

    Science.gov (United States)

    Mroczek, Ewelina; Kleiber, Tomasz; Konieczny, Piotr; Waśkiewicz, Agnieszka

    2015-01-01

    The paper investigates the migration of the acrylamide monomer (AMD) to lettuce chosen as a test plant growing in an organic medium (peat substrate). Polyacrylamide (PAM)-based flocculant added to the growing medium contained no more than 1000 mg kg(-1) of AMD. Plants were grown with varied doses of PAM preparation (0.5-3.0 mg dm(-3) of peat substrate) to compare the results with the control sample. The determination of AMD content, chlorophyll content, weight of the lettuce head, and also analysis of macro- and micro-elements in lyophilised test material was made under the same analytical conditions. The results showed that lettuce plants absorb AMD to the leaves from the peat substrate. The AMD uptake has a negative impact on the growth of lettuce. It reduces the average fresh weight of heads and destabilises the mineral composition of the plant. Therefore, concern related to the transfer risk of the residual AMD from sludge used for organic fertilisation of edible plants still remains a crucial question from a food and consumer safety point of view. To ensure consumer safety, the fate of the AMD following the application of PAM to cropland should be carefully monitored in the whole food chain.

  17. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  18. Investigation on physical behavior of styrene wood-polymer in different concentrations of monomer

    Directory of Open Access Journals (Sweden)

    maryam ghorbani

    2016-09-01

    Full Text Available This research was conducted to study the effect of different concentrations of styrene lumen monomer on the physical properties of beech wood. Physical test samples were prepared according to ASTM-D1037 standard and treated with vacuum-pressure method at five concentration levels; 0, 40, 60, 80 and 100 percent of soluble monomer. For polymerization, treated samples were heated in oven for two 24-hour period at 90 and 103ºC respectively. Monomer and polymer absorption, density variation, water absorption, swelling and anti-swelling efficiency (ASE were determined. According to the results, Monomer and polymer absorption were increment by monomer concentration increase, and they were reported 38.2% and 26% in highest level. With polymer absorption enhancement, density of wood increased from 0/63g/cm³ in control to 0/91g/cm³ in the highest monomer concentration level that reduces pores in wood-polymer structure. Absorbed polymer enhancement decreased hydrophilicity and dimensional changes of treated samples, so that water absorption and swelling volume of the samples saturated with 100% concentration of monomer were decreased 64% and 45.3% after the longest immersion time. Highest Anti-swelling efficiency of Styrene-saturated samples was determined 56.15% in the maximum concentration level of treatment.

  19. Solubility of mixed monomers of tetrafluoroethylene and propylene in water and latex

    International Nuclear Information System (INIS)

    Watanabe, Hiromasa; Okamoto, Jiro

    1978-03-01

    For kinetical analysis of the emulsion copolymerization of tetrafluoroethylene with propylene and selection of the optimum reaction conditions, the monomer concentrations and composition of the polymer particle were measured and the relations with reaction conditions were determined. Solubilities of tetrafluoroethylene and propylene in water increase with pressure. solubility of propylene is larger than that of tetrafluoroethylene. Solubility of the mixed monomers in water and latex increases with pressure and propylene concentration and decreases with temperature. Propylene concentration in the dissolved monomers is dependent on its concentration in the gas phase and independent of pressure and temperature. The monomer concentrations and the composition were estimated from measurements. Under propylene concentration in the gas phase of 0 to 40 wt % at 30 Kg/cm 2 G and 40 0 C, the monomer concentration and propylene fraction of the polymer particle are 17 -- 27% and 0 -- 62% respectively. The amount of propylene in the particle increases with its fraction in the gas phase, but the amount of tetrafluoroethylene is independent of its fraction in the gas phase. Monomer composition of the polymer particle is dependent on monomer composition of the gas phase and independent of temperature and pressure. The concentration in the polymer particle is 17% at propylene concentration 10 mole % in the gas phase. (auth.)

  20. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  1. Vogel-Fulcher dependence of relaxation rates in a nematic monomer and elastomer

    Science.gov (United States)

    Shenoy, D.; Filippov, S.; Aliev, F.; Keller, P.; Thomsen, D.; Ratna, B.

    2000-12-01

    Dielectric relaxation spectroscopy is used to study the relaxation processes in a nematic monomer and the corresponding cross-linked polymer nematic liquid crystal (elastomer). In the frequency window 10 mHz to 2 GHz the monomer liquid crystal shows a single relaxation whereas the polymer exhibits three relaxation processes, two of which are quantitatively analyzed. The temperature dependence of relaxation times in both the monomer and polymer follows a Vogel-Fulcher behavior. The relaxation processes are identified with specific molecular motions and activation energies are calculated in a linear approximation for comparison with literature data.

  2. Radiation curing of mixtures of diallylphthalate prepolymer and vinyl monomer, 9

    International Nuclear Information System (INIS)

    Gotoda, Masao; Kitada, Yoshinori.

    1975-01-01

    Radiation curing, mainly by electron beams was studied with mixtures of low molecular weight diallylphthalate prepolymer (DAPsub(p).L) and vinyl monomers with special reference to their workability. Among the vinyl monomers, acrylonitrile gave a solution of low viscosity and methyl acrylate gave a solution of low dose curing. Radiation curing of DAPsub(p).L/vinyl monomer mixtures impregnated in wood was also tried. To obtain uniform wood-polymer composites, γ-irradiation after impregnation at 10 kg/cm 2 was found to be required for thick plate (110 mm), while electron beam irradiation after impregnation at normal pressure was sufficient for thin plate. (author)

  3. Effect of monomer composition on the properties of high temperature polymer concretes

    Energy Technology Data Exchange (ETDEWEB)

    Zeldin, A.; Kukacka, L.E.; Carciello, N.

    1980-01-01

    The effects of organic monomer composition on the thermomechanical properties of polymer concrete (PC) containing sand-cement mixtures as an agregate filler were investigated. The effects of various monomer mixtures on compressive strength and hydrolytic stability are discussed. Composites were fabricated in the same way as ordinary concrete, with monomer solutions of various compositions and concentrations used to bind the sand-cement mixture. The compressive strengths of th composites before and after exposure to air and to brine solutions at 240/sup 0/C are discussed.

  4. Self-assembly of actin monomers into long filaments: Brownian Dynamics simulations

    DEFF Research Database (Denmark)

    Shillcock, Julian C.

    2009-01-01

    Brownian dynamics simulations are used to study the dynamical process of self-assembly of actin monomers into long filaments containing up to 1000 actin protomers. In order to overcome the large separation of time scales between the diffusive motion of the freemonomers and the relatively slow....../detachment events. When a single filament is allowed to grow in a bath of constant concentration of free ADP-actin monomers, its growth rate increases linearly with the free monomer concentration in quantitative agreement with in vitro experiments. Theresults also show that the waiting time is governed by...

  5. Dynamic conformations of nucleophosmin (NPM1 at a key monomer-monomer interface affect oligomer stability and interactions with granzyme B.

    Directory of Open Access Journals (Sweden)

    Wei D Duan-Porter

    Full Text Available Nucleophosmin (NPM1 is an abundant, nucleolar tumor antigen with important roles in cell proliferation and putative contributions to oncogenesis. Wild-type NPM1 forms pentameric oligomers through interactions at the amino-terminal core domain. A truncated form of NPM1 found in some hepatocellular carcinoma tissue formed an unusually stable oligomer and showed increased susceptibility to cleavage by granzyme B. Initiation of translation at the seventh methionine generated a protein (M7-NPM that shared all these properties. We used deuterium exchange mass spectrometry (DXMS to perform a detailed structural analysis of wild-type NPM1 and M7-NPM, and found dynamic conformational shifts or local "unfolding" at a specific monomer-monomer interface which included the β-hairpin "latch." We tested the importance of interactions at the β-hairpin "latch" by replacing a conserved tyrosine in the middle of the β-hairpin loop with glutamic acid, generating Y67E-NPM. Y67E-NPM did not form stable oligomers and further, prevented wild-type NPM1 oligomerization in a dominant-negative fashion, supporting the critical role of the β-hairpin "latch" in monomer-monomer interactions. Also, we show preferential cleavage by granzyme B at one of two available aspartates (either D161 or D122 in M7-NPM and Y67E-NPM, whereas wild-type NPM1 was cleaved at both sites. Thus, we observed a correlation between the propensity to form oligomers and granzyme B cleavage site selection in nucleophosmin proteins, suggesting that a small change at an important monomer-monomer interface can affect conformational shifts and impact protein-protein interactions.

  6. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  7. Guidelines To Select the N-Heterocyclic Carbene for the Organopolymerization of Monomers with a Polar Group

    KAUST Repository

    Falivene, Laura; Cavallo, Luigi

    2017-01-01

    be tuned by the hindrance of the NHC and the nature of the monomer. In addition to rationalize existing systems, the 45 NHC/monomer combinations we examined can be used as a guideline to predict the behavior of a new NHC/monomer combination.

  8. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  9. Dually Fluorescent Sensing of pH and Dissolved Oxygen Using a Membrane Made from Polymerizable Sensing Monomers.

    Science.gov (United States)

    Tian, Yanqing; Shumway, Bradley R; Youngbull, A Cody; Li, Yongzhong; Jen, Alex K-Y; Johnson, Roger H; Meldrum, Deirdre R

    2010-06-03

    Using a thermal polymerization approach and polymerizable pH and oxygen sensing monomers with green and red emission spectra, respectively, new pH, oxygen, and their dual sensing membranes were prepared using poly(2-hydroxyethyl methacrylate)-co-poly(acrylamide) as a matrix. The sensors were grafted on acrylate-modified quartz glass and characterized under different pH values, oxygen concentrations, ion strengths, temperatures and cell culture media. The pH and oxygen sensors were excited using the same excitation wavelength and exhibited well-separated emission spectra. The pH-sensing films showed good response over the pH range 5.5 to 8.5, corresponding to pK(a) values in the biologically-relevant range between 6.9 and 7.1. The oxygen-sensing films exhibited linear Stern-Volmer quenching responses to dissolved oxygen. As the sensing membranes were prepared using thermally initiated polymerization of sensing moiety-containing monomers, no leaching of the sensors from the membranes to buffers or medium was observed. This advantageous characteristic accounts in part for the sensors' biocompatibility without apparent toxicity to HeLa cells after 40 hours incubation. The dual-sensing membrane was used to measure pH and dissolved oxygen simultaneously. The measured results correlated with the set-point values.

  10. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  11. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  12. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  13. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  14. Study on grafting of different types of acrylic monomers onto natural rubber by γ-rays

    International Nuclear Information System (INIS)

    Dafader, N.C.; Haque, M.E.; Akhtar, F.; Ahmad, M.U.

    2006-01-01

    A comparative study of various acrylic monomers for grafting onto natural rubber was done. The stability of natural rubber latex (NRL) against coagulum with monomer, mechanical properties of grafted rubbers and percent of grafting were investigated. The NRL with monomers, methylacrylate (MA), ethylacrylate (EA) and n-butylacrylate (n-BA), is unstable but it is stable with methyl methacrylate (MMA), n-butyl methacrylate (BMA) and cyclohexyl methacrylate (CHMA). The mechanical properties and degree of grafting attained a maximum at a total radiation dose of 4 kGy. The values of tensile properties of MMA and CHMA grafted rubbers are almost similar, and higher than those of BMA grafted rubbers. On the other hand, the degree of grafting for CHMA is higher than those of MMA and BMA grafted rubbers. The infrared (IR) spectra of monomer grafted natural rubber were also studied

  15. Determination of unreacted monomers in restorative dental resins based on dimethacrylate by NMR hydrogen

    International Nuclear Information System (INIS)

    Correa, Ivo Carlos; Miranda Junior, Walter G.; Tavares, Maria Ines B.

    2001-01-01

    The presence of unreacted monomers after photo-activation of dental composites causes mechanical and biological properties to decrease and could be detected by NMR analysis. The aim of this study was to evaluate the percentage of leachable monomers of light-cured composites under the effect of variations of exposure time of photo activation by nuclear magnetic resonance of hydrogen in solution (NMR 1 H). The composite resins tested Z250 and Fill Magic obtained similar values of unreacted monomers (%) at photo curing time suggested by the manufacturer and values were also lower than Durafill and A110 concentrations. From the NMR results, one day extractable time was efficient to quantify the amount of residual monomers in the dental composites tested, unless for Durafill composite. (author)

  16. Chimeric polymers formed from a monomer capable of free radical, oxidative and electrochemical polymerisation.

    Science.gov (United States)

    Lakshmi, Dhana; Whitcombe, Michael J; Davis, Frank; Chianella, Iva; Piletska, Elena V; Guerreiro, Antonio; Subrahmanyam, Sreenath; Brito, Paula S; Fowler, Steven A; Piletsky, Sergey A

    2009-05-21

    A new monomer, which incorporates both aniline and methacrylamide functional groups, was shown to possess orthogonal polymerisation behaviour to produce conjugated polyaniline suitable for a wide range of applications.

  17. Radical copolymerization in homogenous medium and emulsion system monomers acrylonitrile/styrene

    Directory of Open Access Journals (Sweden)

    Boussehel H.

    2013-09-01

    Full Text Available This study examines the radical copolymerization in homogeneous and emulsion of the monomer system acrylonitrile/styrene. These copolymers are of great interest to the plastics industry, because they combine the good mechanical properties and implementation provided by the styrene units in the very high solvent resistance and extreme gas impermeability provided by the acrylonitrile units. The properties of a copolymer are directly related to its composition and distribution of monomer units in its macromolecular chains. Based on the reports of the couple reactivity's of monomers (AN/S found in the literature, the objective of the work is to provide theoretical simulation (by analytical and numerical integration of the equation of copolymerization: The kinetics of the reaction copolymerization of AN/S in a homogeneous medium and emulsion (drift composition, azeotropic and the microstructure (distribution of monomer sequences and the glass transition property of the macromolecular chains instant formed throughout the copolymerization reaction.

  18. A comment on water’s structure using monomer fraction data and theories

    DEFF Research Database (Denmark)

    Liang, Xiaodong; Maribo-Mogensen, Bjørn; Tsivintzelis, Ioannis

    2016-01-01

    Monomer fraction data for water (and other compounds) can provide useful information about their structure and can be used in “advanced” equations of state, which account explicitly for association phenomena. Recent findings about the performance of association theories in representing the monomer...... fraction of water are reviewed. Three such theories are considered and all of them perform qualitatively similar. They can all represent phase equilibria for water solutions qualitatively well but with parameters which are not in good agreement with Luck’s famous monomer fraction data. While this could set...... the theoretical basis of these theories in doubt, we also show in this work that the findings with these association models are in agreement with a recently presented theory which links monomer fraction to dielectric constants. This new theory, like the three thermodynamic models, predicts more hydrogen bonding...

  19. Vinyl Monomers Double as UV Stabilizers: 179th ACS Meeting Houston.

    Science.gov (United States)

    Chemical and Engineering News, 1980

    1980-01-01

    Synthesis and polymerization of vinyl monomers that double as stabilizers against degradation of plastics by ultraviolet light has been accomplished. Potential applications include protection of photovoltaic cells in solar power plants. (Author/RE)

  20. Theoretical prediction and experimental determination of the effect of mold characteristics on temperature and monomer conversion fraction profiles during polymerization of a PMMA-based bone cement.

    Science.gov (United States)

    Vallo, Claudia I

    2002-01-01

    The present work is concerned with applications of a kinetic model for free-radical polymerization of a polymethylmethacrylate-based bone cement. Autocatalytic behavior at the first part of the reaction as well as a diffusion control phenomenon near vitrification are described by the model. Comparison of theoretical computations with experimental measurements for the temperature evolution during batch casting demonstrated the capacity of the proposed model to represent the kinetic behavior of the polymerization reaction. Temperature evolution and monomer conversion were simulated for the cure of the cement in molds made of different materials. The maximum monomer conversion fraction was markedly influenced by the physical properties of the mold material. The unreacted monomer acts as a plasticizer that influences the mechanical behavior of the cement. Hence, the same cement formulation cured in molds of different materials may result in different mechanical response because of the differences in the amounts of residual monomer. Standardization of the mold type to prepare specimens for the mechanical characterization of bone cements is recommended. Theoretical prediction of temperature evolution during hip replacement indicated that for cement thickness lower than 6 mm the peak temperature at the bone-cement interface was below the limit stated for thermal injury (50 degrees C for more than 1 min). The use of thin cement layers is recommended to diminish the risk of thermal injury; however, it is accompanied by an increase in the amount of unreacted monomer present in the cured material. Copyright 2002 Wiley Periodicals, Inc. J Biomed Mater Res (Appl Biomater) 63: 627-642, 2002

  1. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  2. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  3. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  4. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  5. Triptycene-based ladder monomers and polymers, methods of making each, and methods of use

    KAUST Repository

    Pinnau, Ingo

    2015-02-05

    Embodiments of the present disclosure provide for a triptycene-based A-B monomer, a method of making a triptycene-based A-B monomer, a triptycene-based ladder polymer, a method of making a triptycene-based ladder polymers, a method of using triptycene-based ladder polymers, a structure incorporating triptycene-based ladder polymers, a method of gas separation, and the like.

  6. Radiation Induced Crosslinking of Polyethylene in the Presence of Bifunctional Vinyl Monomers

    DEFF Research Database (Denmark)

    Joshi, M. S.; Singer, Klaus Albert Julius; Silverman, J.

    1977-01-01

    Several reports have been published showing that the radiation induced grafting of bifunctional vinyl monomers to low density polyethylene results in a product with an unusually high density of crosslinks. The same grafting reactions are shown to reduce the incipient gel dose by more than a factor...... of fifty. This paper is concerned with the apparent crosslinking produced by the radiation grafting of two monomers to polyethylene: acrylic acid and acrylonitrile....

  7. Effect of food simulating liquids on release of monomers from two dental resin composites

    Directory of Open Access Journals (Sweden)

    Ghavam M

    2010-06-01

    Full Text Available "nBackground and Aims: The elution of residual monomers from cured dental composites to oral cavity has a harmful effect on human health and can affect their clinical durability. The purpose of this study was to evaluate the amount of eluted monomers (Bis-GMA, TEGDMA, UDMA from two types of composites (Gradia and P60 after exposure to food simulating liquids such as ethanol (25, 50, 75 % and heptane 50 % for 24 hours and 7 days. "nMaterials and Methods: Forty specimens of each composite were prepared. Equal numbers of each composite were immersed in tubes containing 2cc volumes of 25, 50, 75 % ethanole and 50 % heptane. The amount of eluted monomers in standard condition such as Bis-GMA, TEGDMA and UDMA was measured by GC/MS (Gas Chromatography/Mass Spectroscopy and results were statistically analysed by three way and one way ANOVA. P<0.05 was considered as the level of significancy. "nResults: The results showed that Gradia released more TEGDMA than P60. In assessing the effect of environment, the result showed that ethanol caused releasing monomers more than heptane and the concentration rate of 75 % ethanole resulted in most releasing of monomers. In assessing the effect of time, the observation showed that more monomers were released 7 days compared to 24 hours. Bis-GMA and UDMA were not detected in any solutions in these conditions. "nConclusion: Ethanole caused more release of monomers than heptane and 75 % ethanole released the most amount of monomers. Gradia released more amount of TEGDMA than P60.

  8. Inhibition of odontogenic differentiation of human dental pulp cells by dental resin monomers

    OpenAIRE

    Kwon, Ji Hyun; Park, Hee Chul; Zhu, Tingting; Yang, Hyeong-Cheol

    2015-01-01

    Background Dental resin monomers that are leached from the resin matrix due to incomplete polymerization can affect the viability and various functions of oral tissues and cells. In this study, the effects of triethylene glycol dimethacrylate (TEGDMA) and 2-hydroxyethyl methacrylate (HEMA) on odontogenic differentiation of human dental pulp cells (HDPCs) were examined. To mimic clinical situations, dental pulp cells were treated with resin monomers for 24?h prior to the analysis of alkaline p...

  9. Residual monomer content determination in some acrylic denture base materials and possibilities of its reduction

    Directory of Open Access Journals (Sweden)

    Kostić Milena

    2009-01-01

    Full Text Available Background/Aim. Polymethyl methacrylate is used for producing a denture basis. It is a material made by the polymerization process of methyl methacrylate. Despite of the polymerization type, there is a certain amount of free methyl methacrylate (residual monomer incorporated in the denture, which can cause irritation of the oral mucosa. The aim of this study was to determine the amount of residual monomer in four different denture base acrylic resins by liquid chromatography and the possibility of its reduction. Methods. After the polymerization, a postpolymerization treatment was performed in three different ways: in boiling water for thirty minutes, with 500 W microwaves for three minutes and in steam bath at 22º C for one to thirty days. Results. The obtained results showed that the amount of residual monomer is significantly higher in cold polymerizing acrylates (9.1-11%. The amount of residual monomer after hot polymerization was in the tolerance range (0.59- 0.86%. Conclusion. The obtained results denote a low content of residual monomer in the samples which have undergone postpolymerization treatment. A lower percent of residual monomer is established in samples undergone a hot polymerization.

  10. Folding Landscape of Mutant Huntingtin Exon1: Diffusible Multimers, Oligomers and Fibrils, and No Detectable Monomer.

    Directory of Open Access Journals (Sweden)

    Bankanidhi Sahoo

    Full Text Available Expansion of the polyglutamine (polyQ track of the Huntingtin (HTT protein above 36 is associated with a sharply enhanced risk of Huntington's disease (HD. Although there is general agreement that HTT toxicity resides primarily in N-terminal fragments such as the HTT exon1 protein, there is no consensus on the nature of the physical states of HTT exon1 that are induced by polyQ expansion, nor on which of these states might be responsible for toxicity. One hypothesis is that polyQ expansion induces an alternative, toxic conformation in the HTT exon1 monomer. Alternative hypotheses posit that the toxic species is one of several possible aggregated states. Defining the nature of the toxic species is particularly challenging because of facile interconversion between physical states as well as challenges to identifying these states, especially in vivo. Here we describe the use of fluorescence correlation spectroscopy (FCS to characterize the detailed time and repeat length dependent self-association of HTT exon1-like fragments both with chemically synthesized peptides in vitro and with cell-produced proteins in extracts and in living cells. We find that, in vitro, mutant HTT exon1 peptides engage in polyQ repeat length dependent dimer and tetramer formation, followed by time dependent formation of diffusible spherical and fibrillar oligomers and finally by larger, sedimentable amyloid fibrils. For expanded polyQ HTT exon1 expressed in PC12 cells, monomers are absent, with tetramers being the smallest molecular form detected, followed in the incubation time course by small, diffusible aggregates at 6-9 hours and larger, sedimentable aggregates that begin to build up at 12 hrs. In these cell cultures, significant nuclear DNA damage appears by 6 hours, followed at later times by caspase 3 induction, mitochondrial dysfunction, and cell death. Our data thus defines limits on the sizes and concentrations of different physical states of HTT exon1 along the

  11. Water-resistive humidity sensor prepared by printing process using polyelectrolyte ink derived from new monomer.

    Science.gov (United States)

    Kim, Min-Ji; Gong, Myoung-Seon

    2012-03-21

    A simple strategy was developed based on a new monomer containing both photocurable function and ammonium salt, N-(2-cinnamoyloxy)ethyl-N-(2-(methacryloyloxy)ethyl)-N,N-dimethyl ammonium bromide (CMDAB) to obtain photocurable polyelectrolyte ink and stable humidity-sensitive membranes by printing process. Humidity-sensitive membranes are photocrosslinked polyelectrolytes obtained from copolymers of [2-(methacryloyloxy)ethyl] dimethyl propyl ammonium bromide (MEPAB), CMDAB and MMA. A flexible gold electrode/polyimide was pretreated with 2-(mercaptoethyl) cinnamamide (MEC) containing a thiol-coupling agent for the purpose of anchoring the humidity-sensitive polyelectrolyte to the gold electrode. The sensors using screen printing methods reduced the deflection of sensor characteristics showing humidity precision ±1%RH. The photocured copolymer MEPAB/CMDAB/MMA = 63/7/30 show good sensitivity (0.0586 logΩ/%RH) changing resistance approximately four orders of magnitude with relative humidity varying from 20% to 95% and fast response and recovery time. The resultant sensors showed acceptable linearity (Y = -0.04X + 7.0, R(2) = -0.9900) and small hysteresis. The reliability including water resistance and a long-term stability were estimated for the application of the flexible humidity sensor prepared by screen printing process.

  12. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  13. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  14. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  15. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  16. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  17. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  18. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  19. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  20. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  1. Synthesis and evaluation of novel siloxane-methacrylate monomers used as dentin adhesives.

    Science.gov (United States)

    Ge, Xueping; Ye, Qiang; Song, Linyong; Misra, Anil; Spencer, Paulette

    2014-09-01

    The objectives of this study were to synthesize two new siloxane-methacrylate (SM) monomers for application in dentin adhesives and to investigate the influence of different functionality of the siloxane-containing monomers on the adhesive photopolymerization, water sorption, and mechanical properties. Two siloxane-methacrylate monomers (SM1 and SM2) with four and eight methacrylate groups were synthesized. Dentin adhesives containing BisGMA, HEMA and the siloxane-methacrylate monomers were photo-polymerized. The experimental adhesives were compared with the control adhesive (HEMA/BisGMA, 45/55, w/w) and characterized with regard to degree of conversion (DC), water miscibility of the liquid resin, water sorption and dynamic mechanical analysis (DMA). The experimental adhesives exhibited improved water miscibility as compared to the control. When cured in the presence of 12 wt% water to simulate the wet environment of the mouth, the SM-containing adhesives showed DC comparable to the control. The experimental adhesives showed higher rubbery modulus than the control under dry conditions. Under wet conditions, the mechanical properties of the formulations containing SM monomer with increased functionality were comparable with the control, even with more water sorption. The concentration and functionality of the newly synthesized siloxane-methacrylate monomers affected the water miscibility, water sorption and mechanical properties of the adhesives. The experimental adhesives show improved water compatibility compared with the control. The mechanical properties were enhanced with an increase of the functionality of the siloxane-containing monomers. The results provide critical structure/property relationships and important information for future development of durable, versatile siloxane-containing dentin adhesives. Published by Elsevier Ltd.

  2. Thermodynamically stable amyloid-β monomers have much lower membrane affinity than the small oligomers

    Directory of Open Access Journals (Sweden)

    Bidyut eSarkar

    2013-04-01

    Full Text Available Amyloid beta (Aβ is an extracellular 39-43 residue long peptide present in the mammalian cerebrospinal fluid, whose aggregation is associated with Alzheimer’s disease. Small oligomers of Aβ are currently thought to be the key to toxicity. However, it is not clear why the monomers of Aβ are non-toxic, and at what stage of aggregation toxicity emerges. Interactions of Aβ with cell membranes is thought to be the initiator of toxicity, but membrane-binding studies with different preparations of monomers and oligomers have not settled this issue. We have earlier found that thermodynamically stable Aβ monomers emerge spontaneously from oligomeric mixtures upon long term incubation in physiological solutions (Nag et al, JBC, 2011. Here we show that the membrane-affinity of these stable Aβ monomers is much lower than that of a mixture of small oligomers (containing dimers to decamers, providing a clue to the emergence of toxicity. Fluorescently labeled Aβ40 monomers show negligible binding to cell membranes of a neuronal cell line (RN46A at physiological concentrations (250 nM, while oligomers at the same concentrations show strong binding within 30 minutes of incubation. The increased affinity most likely does not require any specific neuronal receptor, since this difference in membrane-affinity was also observed in a somatic cell-line (HEK 293T. Similar results are also obtained for Aβ42 monomers and oligomers. Minimal amount of cell death is observed at these concentrations even after 36 hours of incubation. It is likely that membrane binding precedes subsequent slower toxic events induced by Aβ. Our results a provide an explanation for the non-toxic nature of Aβ monomers, b suggest that Aβ toxicity emerges at the initial oligomeric phase, and c provide a quick assay for monitoring the benign-to-toxic transformation of Aβ.

  3. Anisotropy of the monomer random walk in a polymer melt: local-order and connectivity effects

    International Nuclear Information System (INIS)

    Bernini, S; Leporini, D

    2016-01-01

    The random walk of a bonded monomer in a polymer melt is anisotropic due to local order and bond connectivity. We investigate both effects by molecular-dynamics simulations on melts of fully-flexible linear chains ranging from dimers (M  =  2) up to entangled polymers (M  =  200). The corresponding atomic liquid is also considered a reference system. To disentangle the influence of the local geometry and the bond arrangements, and to reveal their interplay, we define suitable measures of the anisotropy emphasising either the former or the latter aspect. Connectivity anisotropy, as measured by the correlation between the initial bond orientation and the direction of the subsequent monomer displacement, shows a slight enhancement due to the local order at times shorter than the structural relaxation time. At intermediate times—when the monomer displacement is comparable to the bond length—a pronounced peak and then decays slowly as t −1/2 , becoming negligible when the displacement is as large as about five bond lengths, i.e. about four monomer diameters or three Kuhn lengths. Local-geometry anisotropy, as measured by the correlation between the initial orientation of a characteristic axis of the Voronoi cell and the subsequent monomer dynamics, is affected at shorter times than the structural relaxation time by the cage shape with antagonistic disturbance by the connectivity. Differently, at longer times, the connectivity favours the persistence of the local-geometry anisotropy, which vanishes when the monomer displacement exceeds the bond length. Our results strongly suggest that the sole consideration of the local order is not enough to understand the microscopic origin of the rattling amplitude of the trapped monomer in the cage of the neighbours. (paper)

  4. Net expansion of dried demineralized dentin matrix produced by monomer/alcohol saturation and solvent evaporation.

    Science.gov (United States)

    Agee, Kelli A; Becker, Thomas D; Joyce, Anthony P; Rueggeberg, Frederick A; Borke, James L; Waller, Jennifer L; Tay, Franklin R; Pashley, David H

    2006-11-01

    The purpose of this work was to determine if nonaqueous methacrylate monomer/alcohol mixtures could expand dried collapsed demineralized dentin matrix. Thin disks (ca. 200 microm) of human dentin were demineralized and placed in wells beneath contact probes of linear variable differential transformers. The probes were placed on water-saturated expanded matrices to record the shrinkage associated with drying. Monomer mixtures containing hydroxyethyl methacrylate, 2,2-bis[4-(2-hydroxy-3 methacryloyloxy)propoxyphenyl] propane, or triethyleneglycol dimethacrylate were mixed with methanol or ethanol at alcohol/monomer mass fraction % of 90/10, 70/30, 50/50, or 30/70. They were randomly applied to the dried matrices to determine the rate and magnitude of expansion; then shrinkage was recorded during evaporation of the alcohols. The results indicated that matrix expansion was positively correlated with the Hoy's solubility parameters for hydrogen bonding forces (delta(h)) of the monomer/solvent mixtures (p methanol-containing than with ethanol-containing monomer mixtures. For the test solutions, triethyleneglycol dimethacrylate-containing mixtures produced the slowest rate of matrix expansion and hydroxyethyl methacrylate-containing mixtures the most rapid expansion. When the solvents were evaporated, the matrix shrank in proportion to the solvent content and the delta(h) of the monomer-solvent mixtures. The results indicate that expansion of dried, collapsed dentin matrices requires that the delta(h) of the mixtures be larger than 17 (J/cm(3))(1/2). The greater the delta(h) of the monomer solutions, the greater the rate and extent of expansion.

  5. Synthesis of phosphate monomers and bonding to dentin: esterification methods and use of phosphorus pentoxide.

    Science.gov (United States)

    Ogliari, Fabrício Aulo; da Silva, Eduardo de Oliveira; Lima, Giana da Silveira; Madruga, Francine Cardozo; Henn, Sandrina; Bueno, Márcia; Ceschi, Marco Antônio; Petzhold, Cesar Liberato; Piva, Evandro

    2008-03-01

    The aim of this study was to synthesize an acidic monomer using an alternative synthetic pathway and to evaluate the influence of the acidic monomer concentration on the microtensile bond strength to dentin. The intermediary 5-hydroxypentyl methacrylate (HPMA) was synthesized through methacrylic acid esterification with 1,5-pentanediol, catalyzed by p-toluenesulfonic acid. To displace the reaction balance, the water generated by esterification was removed by three different methods: anhydrous sodium sulfate; molecular sieves or azeotropic distillation. In the next step, a phosphorus pentoxide (4.82 mmol) slurry was formed in cold acetone and 29 mmol of HPMA was slowly added by funnel addition. After the reaction ended, solvent was evaporated and the product was characterized by 1HNMR and FTIR. The phosphate monomer was introduced in a self-etch primer at concentrations of 0, 15, 30, 50, 70 and 100 wt%. Clearfil SE Bond was used as commercial reference. Microtensile bond strength to dentin was evaluated 24h after the bonding procedures, followed by fracture analysis (n=20). Data was submitted to ANOVA and Tukey's post hoc test. The highest yield was obtained (62%) when azeotropic distillation was used, while the reaction with molecular sieves was not feasible. The phosphoric moiety attachment to the monomer was successfully performed with a quantitative yield that reached around 100%. The acidic monomer concentration significantly affected the bond strength and the highest mean (55.1+/-12.8 MPa) was obtained when 50% of acidic monomer was used. The synthesis pathways described in the present study appear to be a viable alternative for developing phosphate monomers.

  6. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  7. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  8. Elucidation of the Corrosion Inhibition of Mild Steel in 1.0 M HCl by Catechin Monomers from Commercial Green Tea Extracts

    Science.gov (United States)

    Nofrizal, S.; Rahim, Afidah A.; Saad, Bahruddin; Bothi Raja, P.; Shah, Affaizza M.; Yahya, S.

    2012-04-01

    The inhibitive action of commercial green tea extracts on mild steel (MS) in a 1.0 M hydrochloric acid solution was investigated by weight loss, potentiodynamic polarization, and electrochemical impedance spectroscopy (EIS). A high-performance liquid chromatographic (HPLC) analysis showed conclusively that of the eight catechin monomers and caffeine found in the original extracts, only four components were responsible for the inhibition of MS. The decreasing adsorption capacity of monomers on MS is related to the stereochemistry of molecules and the number of phenolic groups, and it is as follows: epigallocatechin gallate > epicatechin gallate > epigallocatechin > epicatechin. Adsorption of green tea extract constituent was found to follow Langmuir adsorption isotherm and the calculated Gibb's free energy values indicated the physisorption of inhibitor over MS surface. Physisorption was supported well by the potential zero charge (PZC) and molecular surface energy-level calculations.

  9. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  10. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  11. Photopolymerizable phosphate acrylates as comonomers in dental adhesives with or without triclosan monomer units

    International Nuclear Information System (INIS)

    Melinte, Violeta; Buruiana, Tinca; Aldea, Horia; Matiut, Simona; Silion, Mihaela; Buruiana, Emil C.

    2014-01-01

    Phosphate diacrylates (CO-DAP, TMP-DAP) based on castor oil or trimethylolpropane were synthesized and evaluated in dental adhesive formulations in comparison with 3-acryloyloxy-2-hydroxypropyl methacrylate phosphate (AMP-P). In an attempt to promote antibacterial activity, another photopolymerizable monomer (TCS-UMA) containing 5-chloro-2-(2,4-dichlorophenoxy)phenol moiety (triclosan) was prepared and incorporated in adhesive resins. Each of these monomers had a molecular structure confirmed by spectral methods. The photopolymerization rates for monomers (0.063–0.088 s −1 ) were lower than those determined in the monomer combinations (0.116–0.158 s −1 ) incorporating phosphate diacrylate (11 wt.%), BisGMA (33 wt.%), TEGDMA (10 wt.%), UDMA (10 wt.%) and HEMA (15 wt.%), the degree of conversion varying between 63.4 and 74.5%. The formed copolymers showed high values for water sorption (18.65–57.02 μg/mm 3 ) and water solubility (3.51–13.38 μg/mm 3 ), and the contact angle was dependent on the presence of CO-DAP (θ F1 : 66.67°), TMP-DAP (θ F2 : 55.05°) or AMP-P (θ F3 : 52.90°) in the photocrosslinked specimens compared to the sample without phosphate monomer (θ F4 : 82.14°). The scanning electron microscopy image of the dentin–resin composite interface after applying our F1 formulation (pH: 4.1) and its light-curing for 20 s supports the evidence of the formation of the hybrid layer with the tooth structure created by self-etching approach, with no gaps or cracks in the adhesive. A comparative analysis of the adhesion achieved with commercial adhesive systems (Single Bond Universal, C-Bond) rather indicates similarities than differences between them. The addition of triclosan methacrylate (1 wt.%) into the formulation inhibited the bacterial growth of the Streptococcus mutans and Escherichia coli in the direct contact area due to the covalently linked antibacterial monomer. - Highlights: • Synthesis of photopolymerizable phosphate acrylate

  12. Photopolymerizable phosphate acrylates as comonomers in dental adhesives with or without triclosan monomer units

    Energy Technology Data Exchange (ETDEWEB)

    Melinte, Violeta [Petru Poni Institute of Macromolecular Chemistry, 41 A Gr. Ghica Voda Alley, 700487 Iasi (Romania); Buruiana, Tinca, E-mail: tbur@icmpp.ro [Petru Poni Institute of Macromolecular Chemistry, 41 A Gr. Ghica Voda Alley, 700487 Iasi (Romania); Aldea, Horia [Gr. T. Popa University of Medicine and Pharmacy, Faculty of Dentistry, Iasi (Romania); Matiut, Simona [Praxis Medical Investigations, 33 Independence, 700102 Iasi (Romania); Silion, Mihaela; Buruiana, Emil C. [Petru Poni Institute of Macromolecular Chemistry, 41 A Gr. Ghica Voda Alley, 700487 Iasi (Romania)

    2014-01-01

    Phosphate diacrylates (CO-DAP, TMP-DAP) based on castor oil or trimethylolpropane were synthesized and evaluated in dental adhesive formulations in comparison with 3-acryloyloxy-2-hydroxypropyl methacrylate phosphate (AMP-P). In an attempt to promote antibacterial activity, another photopolymerizable monomer (TCS-UMA) containing 5-chloro-2-(2,4-dichlorophenoxy)phenol moiety (triclosan) was prepared and incorporated in adhesive resins. Each of these monomers had a molecular structure confirmed by spectral methods. The photopolymerization rates for monomers (0.063–0.088 s{sup −1}) were lower than those determined in the monomer combinations (0.116–0.158 s{sup −1}) incorporating phosphate diacrylate (11 wt.%), BisGMA (33 wt.%), TEGDMA (10 wt.%), UDMA (10 wt.%) and HEMA (15 wt.%), the degree of conversion varying between 63.4 and 74.5%. The formed copolymers showed high values for water sorption (18.65–57.02 μg/mm{sup 3}) and water solubility (3.51–13.38 μg/mm{sup 3}), and the contact angle was dependent on the presence of CO-DAP (θ{sub F1}: 66.67°), TMP-DAP (θ{sub F2}: 55.05°) or AMP-P (θ{sub F3}: 52.90°) in the photocrosslinked specimens compared to the sample without phosphate monomer (θ{sub F4}: 82.14°). The scanning electron microscopy image of the dentin–resin composite interface after applying our F1 formulation (pH: 4.1) and its light-curing for 20 s supports the evidence of the formation of the hybrid layer with the tooth structure created by self-etching approach, with no gaps or cracks in the adhesive. A comparative analysis of the adhesion achieved with commercial adhesive systems (Single Bond Universal, C-Bond) rather indicates similarities than differences between them. The addition of triclosan methacrylate (1 wt.%) into the formulation inhibited the bacterial growth of the Streptococcus mutans and Escherichia coli in the direct contact area due to the covalently linked antibacterial monomer. - Highlights: • Synthesis of

  13. Molecular recognition at methyl methacrylate/n-butyl acrylate (MMA/nBA) monomer unit boundaries of phospholipids at p-MMA/nBA copolymer surfaces.

    Science.gov (United States)

    Yu, Min; Urban, Marek W; Sheng, Yinghong; Leszczynski, Jerzy

    2008-09-16

    Lipid structural features and their interactions with proteins provide a useful vehicle for further advances in membrane proteins research. To mimic one of potential lipid-protein interactions we synthesized poly(methyl methacrylate/ n-butyl acrylate) (p-MMA/nBA) colloidal particles that were stabilized by phospholipid (PLs). Upon the particle coalescence, PL stratification resulted in the formation of surface localized ionic clusters (SLICs). These entities are capable of recognizing MMA/nBA monomer interfaces along the p-MMA/nBA copolymer backbone and form crystalline SLICs at the monomer interface. By utilizing attenuated total reflectance Fourier transform infrared (ATR FT-IR) spectroscopy and selected area electron diffraction (SAD) combined with ab initio calculations, studies were conducted that identified the origin of SLICs as well as their structural features formed on the surface of p-MMA/nBA copolymer films stabilized by 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC) PL. Specific entities responsible for SLIC formation are selective noncovalent bonds of anionic phosphate and cationic quaternary ammonium segments of DLPC that interact with two neighboring carbonyl groups of nBA and MMA monomers of the p-MMA/nBA polymer backbone. To the best of our knowledge this is the first example of molecular recognition facilitated by coalescence of copolymer colloidal particles and the ability of PLs to form SLICs at the boundaries of the neighboring MMA and nBA monomer units of the p-MMA/nBA chain. The dominating noncovalent bonds responsible for the molecular recognition is a combination of H-bonding and electrostatic interactions.

  14. Radiation-induced graft polymerization of amphiphilic monomers with different polymerization characteristics onto hydrophobic polysilane

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Hidenori; Iwasaki, Isao; Kunai, Yuichiro [Research Reactor Institute, Kyoto University, Asashironishi 2-1010, Kumatori-cho, Sennan-gun, Osaka 590-0494 (Japan); Sato, Nobuhiro, E-mail: sato-n@rri.kyoto-u.ac.j [Research Reactor Institute, Kyoto University, Asashironishi 2-1010, Kumatori-cho, Sennan-gun, Osaka 590-0494 (Japan); Matsuyama, Tomochika [Research Reactor Institute, Kyoto University, Asashironishi 2-1010, Kumatori-cho, Sennan-gun, Osaka 590-0494 (Japan)

    2011-08-15

    The structures of poly(methyl-n-propylsilane) (PMPrS) amphiphilically modified through {gamma}-ray-induced graft polymerization were investigated with {sup 1}H NMR measurement. By the use of methyl methacrylate (MMA) or diethyl fumarate (DEF) as monomers for the graft polymerization, grafting yield rose with increasing total absorption dose and monomer concentrations, but decreased with increasing dose rate. This result means that grafting yield of modified PMPrS can be controlled by changing irradiation conditions. However, the number of PMMA or PDEF graft chains per PMPrS chain was estimated to be less than 1.0 by analysis of {sup 1}H NMR spectra, and this value was lower than that we had expected. To improve graft density, maleic anhydride (MAH), which is known as a non-homopolymerizable monomer in radical polymerization, was used as a monomer for grafting. As a result, high density grafting (one MAH unit for 4.2 silicon atoms) was attained. It demonstrates that the structure of {gamma}-ray-modified polysilane strongly depends on the polymerization characteristics of grafted monomers.

  15. Effect of solubility parameter of monomers on electron beam induced graft-polymerization onto polyethylene films

    International Nuclear Information System (INIS)

    Mori, Koji; Koshiishi, Kenji; Masuhara, Ken-ichi

    1991-01-01

    Electron beam induced graft-polymerization by the mutual irradiation technique of monomers with different solubility parameters δ onto low density polyethylene films (LDPE) and high density polyethylene films (HDPE) were investigated at high dose rates (25 Mrad per second). Graft-polymerization mechanisms were discussed on the basis of grafting rates, surface tensions, atomic ratios of surface by XPS, and SEM images of the grafted films. Grafting rates decreased with increasing δ of monomers, and grafting rates onto LDPE were larger than those onto HDPE. Graft chain contents on surface, which were evaluated in terms of surface tensions and atomic ratios of the surface, increased with increasing δ of monomers, and graft chain contents on surface of HDPE were higher than those of LDPE. It is assumed that mutual solubility of PE and monomers, i.e., infiltration of monomers into PE during graft-polymerization influence grafting rates and graft sites in films. In case of high mutual solubility, grafting rates were large and graft sites spread from the surface into bulk. On the other hand, in case of low mutual solubility, grafting rates were small and graft sites localized on the surface of films. (author)

  16. Do CAD/CAM dentures really release less monomer than conventional dentures?

    Science.gov (United States)

    Steinmassl, Patricia-Anca; Wiedemair, Verena; Huck, Christian; Klaunzer, Florian; Steinmassl, Otto; Grunert, Ingrid; Dumfahrt, Herbert

    2017-06-01

    Computer-aided design (CAD)/computer-aided manufacturing (CAM) dentures are assumed to have more favourable material properties than conventionally fabricated dentures, among them a lower methacrylate monomer release. The aim of this study was to test this hypothesis. CAD/CAM dentures were generated from ten different master casts by using four different CAD/CAM systems. Conventional, heat-polymerised dentures served as control group. Denture weight and volume were measured; the density was calculated, and the denture surface area was assessed digitally. The monomer release after 7 days of water storage was measured by high-performance liquid chromatography. Whole You Nexteeth and Wieland Digital Dentures had significantly lower mean volume and weight than conventional dentures. Baltic Denture System and Whole You Nexteeth had a significantly increased density. Baltic Denture System had a significantly smaller surface area. None of the CAD/CAM dentures released significantly less monomer than the control group. All tested dentures released very low amounts of methacrylate monomer, but not significantly less than conventional dentures. A statistically significant difference might nevertheless exist in comparison to other, less recommendable denture base materials, such as the frequently used autopolymerising resins. CAD/CAM denture fabrication has numerous advantages. It enables the fabrication of dentures with lower resin volume and lower denture weight. Both could increase the patient comfort. Dentures with higher density might exhibit more favourable mechanical properties. The hypothesis that CAD/CAM dentures release less monomer than conventional dentures could, however, not be verified.

  17. The binding of glucose to yeast hexokinase monomers is independent of ionic strength.

    Science.gov (United States)

    Mayes, E L; Hoggett, J G; Kellett, G L

    1982-05-01

    Hoggett & Kellett [Eur. J. Biochem. 66, 65-77 (1976)] have reported that the binding of glucose to the monomer of hexokinase PII isoenzyme is independent of ionic strength, in contrast to the subsequent claim of Feldman & Kramp [Biochemistry 17, 1541-1547 (1978)] that the binding is strongly dependent on ionic strength. Since measurements with native hexokinase P forms are complicated by the fact that the enzyme exists in a monomer-dimer association-dissociation equilibrium, we have now studied the binding of glucose to the proteolytically-modified S forms which are monomeric. At pH 8.5, the affinity of glucose for both SI and SII monomers is independent of salt concentration over the range of KCl concentrations 0-1.0 mol . dm-3 and is in good agreement with that of the corresponding P forms in both low and high salt. These observations confirm that the binding of glucose to hexokinase P monomers is independent of ionic strength and that the affinity of glucose for the hexokinase PII monomer is about an order of magnitude greater than that for the dimer.

  18. Growth of monodisperse mesoscopic metal-oxide colloids under constant monomer supply

    Science.gov (United States)

    Nozawa, Koh; Delville, Marie-Hélène; Ushiki, Hideharu; Panizza, Pascal; Delville, Jean-Pierre

    2005-07-01

    In closed systems, control over the size of monodisperse metal-oxide colloids is generally limited to submicrometric dimensions. To overcome this difficulty, we explore the formation and growth of silica particles under constant monomer supply. The monomer source is externally driven by the progressive addition into the system of one of the precursors. Monodisperse spherical particles are produced up to a mesoscopic size. We analyze their growth versus the monomer addition rate at different temperatures. Our results show that in the presence of a continuous monomer addition, growth is limited by diffusion over the investigated temporal window. Using the temperature variation of the growth rate, we prove that rescaling leads to a data reduction onto a single master curve. Contrary to the growth process, the final particle’s size reached after the end of the reagent supply strongly depends on the addition rate. The variation of the final particle size versus addition rate can be deduced from an analogy with crystal formation in jet precipitation. Within this framework, and using the temperature dependences of both the particle growth law and the final size, we determine the value of the molecular heat of dissolution associated to the silica solubility. These observations support the fact that classical theories of phase-ordering dynamics can be extended to the synthesis of inorganic particles. The emergence of a master behavior in the presence of continuous monomer addition also suggests the extension of these theories to open systems.

  19. TEGDMA and UDMA monomers released from composite dental material polymerized with diode and halogen lamps.

    Science.gov (United States)

    Wacławczyk, Agnieszka; Postek-Stefańska, Lidia; Pietraszewska, Daria; Birkner, Ewa; Zalejska-Fiolka, Jolanta; Wysoczańska-Jankowicz, Iwona

    2018-03-20

    More than 35 substances released from composite fillings have been identified. Among these, basic monomers and the so-called co-monomers are most often reported. The substances released from polymer-based materials demonstrate allergenic, cytotoxic, genotoxic, mutagenic, embryotoxic, teratogenic, and estrogenic properties. The aim of this study was to measure the amounts of triethylene glycol dimethacrylate (TEGDMA) and urethane dimethacrylate (UDMA) monomers released from composite dental fillings to citrate-phosphate buffer with the pH of 4, 6, 8 after 24 h and 6 months from the polymerization. Ten samples for each polymerization method had been made from the composite material (Filtek Supreme XT, 3M ESPE, St. Paul, USA), which underwent polymerization using the following lamps: halogen lamp (Translux CL, Heraeus Kulzer, Hanau, Germany) (sample H) and diode lamp (Elipar Freelight 2, 3M ESPE), with soft start function (group DS) and without that function (group DWS). It has been demonstrated that the type of light-curing units has a significant impact on the amount of TEGDMA and UDMA released. The amount of UDMA and TEGDMA monomers released from composite fillings differed significantly depending on the source of polymerization applied, as well as the pH of the solution and sample storage time. Elution of the monomers from composite material polymerized using halogen lamp was significantly greater as compared to curing with diode lamps.

  20. Design and Applications of Biodegradable Polyester Tissue Scaffolds Based on Endogenous Monomers Found in Human Metabolism

    Directory of Open Access Journals (Sweden)

    Devin G. Barrett

    2009-10-01

    Full Text Available Synthetic polyesters have deeply impacted various biomedical and engineering fields, such as tissue scaffolding and therapeutic delivery. Currently, many applications involving polyesters are being explored with polymers derived from monomers that are endogenous to the human metabolism. Examples of these monomers include glycerol, xylitol, sorbitol, and lactic, sebacic, citric, succinic, α-ketoglutaric, and fumaric acids. In terms of mechanical versatility, crystallinity, hydrophobicity, and biocompatibility, polyesters synthesized partially or completely from these monomers can display a wide range of properties. The flexibility in these macromolecular properties allows for materials to be tailored according to the needs of a particular application. Along with the presence of natural monomers that allows for a high probability of biocompatibility, there is also an added benefit that this class of polyesters is more environmentally friendly than many other materials used in biomedical engineering. While the selection of monomers may be limited by nature, these polymers have produced or have the potential to produce an enormous number of successes in vitro and in vivo.

  1. The influence of monomer concentration on the optical properties of electrochemically synthesized polypyrrole thin films

    International Nuclear Information System (INIS)

    Thombare, J. V.; Fulari, V. J.; Rath, M. C.; Han, S. H.

    2013-01-01

    Polypyrrole (PPy) thin films were deposited on stainless steel and ITO coated glass substrate at a constant deposition potential of 0.8 V versus saturated calomel electrode (SCE) by using the electrochemical polymerization method. The PPy thin films were deposited at room temperature at various monomer concentrations ranging from 0.1 M to 0.3 M pyrrole. The structural and optical properties of the polypyrrole thin films were investigated using an X-ray diffractometer (XRD), FTIR spectroscopy, scanning electron microscopy (SEM), and ultraviolet—visible (UV—vis) spectroscopy. The XRD results show that polypyrrole thin films have a semi crystalline structure. Higher monomer concentration results in a slight increase of crystallinity. The polypyrrole thin films deposited at higher monomer concentration exhibit high visible absorbance. The refractive indexes of the polypyrrole thin films are found to be in the range of 1 to 1.3 and vary with monomer concentration as well as wavelength. The extinction coefficient decreases slightly with monomer concentration. The electrochemically synthesized polypyrrole thin film shows optical band gap energy of 2.14 eV. (semiconductor materials)

  2. Radiation-initiated emulsion copolymerization of styrene and carboxylic acid monomers

    International Nuclear Information System (INIS)

    Egusa, S.; Makuuchi, K.

    1982-01-01

    The emulsion copolymerization of styrene and carboxylic acid monomers such as acrylic, methacrylic, and itaconic acids (AAc, MAAc, IAc) was studied by using 60 Co γ-rays as initiator and sodium dodecylsulfate as emulsifier. The polymerization behavior of these acid monomers was followed by simultaneous conductometric and potentiometric titrations for a latex sample taken in polymerization. The polymerization rate of these acid monomers increases in the following order of hydrophobicity: IAc < AAc < MAAc; this suggests that their polymerization sites are mainly the surface and/or subsurface regions of latex particles. The copolymerization rate of styrene and acid monomer increases with an increase in the acid monomer content for AAc and MAAc, whereas for IAc the rate decreases. The particle sizes determined by the stopped-flow method reveal that this variation of copolymerization rate cannot be explained by the number of growing particles and should be attributed to another factor; for instance, the transfer rate of styrene molecules from oil droplets to growing particles

  3. Inhibition of odontogenic differentiation of human dental pulp cells by dental resin monomers.

    Science.gov (United States)

    Kwon, Ji Hyun; Park, Hee Chul; Zhu, Tingting; Yang, Hyeong-Cheol

    2015-01-01

    Dental resin monomers that are leached from the resin matrix due to incomplete polymerization can affect the viability and various functions of oral tissues and cells. In this study, the effects of triethylene glycol dimethacrylate (TEGDMA) and 2-hydroxyethyl methacrylate (HEMA) on odontogenic differentiation of human dental pulp cells (HDPCs) were examined. To mimic clinical situations, dental pulp cells were treated with resin monomers for 24 h prior to the analysis of alkaline phosphatase (ALP) activity and mRNA expression of genes related to pulp cell differentiation. To elucidate the underlying signaling pathways, regulation of mitogen-activated protein (MAP) kinases by resin monomers was also investigated. The ALP activity of HDPCs was reduced by TEGDMA and HEMA at noncytotoxic concentrations. The mRNA expression of dentin sialophosphoprotein (DSPP), osteocalcin (OCN), and osteopontin (OPN) was also downregulated by resin monomers. However, DSPP expression was not affected by hydrogen peroxide (H2O2). Among the MAP kinases examined, ERK activation (ERK phosphorylation) was not affected by either resin monomers or H2O2, whereas JNK was phosphorylated by TEGDMA and HEMA. Phospho-p38 was upregulated by HEMA, while TEGDMA and H2O2 suppressed p38 phosphorylation. Exposure to TEGDMA and HEMA for a limited period suppresses differentiation of HDPCs via different signaling pathways.

  4. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  5. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  6. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  7. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  8. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  9. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Directory of Open Access Journals (Sweden)

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  10. Testing of residual monomer content reduction possibility on acrilic resins quality

    Directory of Open Access Journals (Sweden)

    Kostić Milena

    2011-01-01

    Full Text Available Poly (methyl methacrylate (PMMA is material widely used in dentistry. Despite the various methods used to initiate the polymerization of acrylic resins, the conversion of monomer to polymer is not complete thus leaving some unreacted methyl methacrylate (MMA, known as residual monomer (RM, in denture structure. RM in dental acrylic resins has deleterious effects on their mechanical properties and their biocompatibility. The objective of the work was to test the residual monomer reduction possibility by applying the appropriate postpolymerization treatment as well as to determine the effects of this reduction on pressure yields stress and surface structure characteristics of the acrylic resins. Postpolymerization treatments and water storage induced reduction of RM amount in cold-polymerized acrylic resins improved their mechanical properties and the homogenized surface structure. After the polymerization of heat-polymerized acrylic resins the post-polymerization treatments for improving the quality of this material type are not necessary.

  11. Polymeric reaction of polymer-monomer system for pressure sensitive adhesives by low energy electron beam

    International Nuclear Information System (INIS)

    Takiguchi, R.; Uryu, T.

    1985-01-01

    Application of low-energy electron beam to non-solvent type pressure sensitive adhesives is investigated. The adhesive properties such as peel strength and holding time (dead-load strength) were closely related to the reaction of acrylate polymer-monomer systems. The reaction behavior is elucidated by combining the measurement of gel fraction, infrared spectrum of gel, and the molecular weight distribution detected by gel permeation chromatography. It was important for the production of pressure sensitive adhesives by electron beam that the adhesive with high peel strength and long holding time is composed of a proper combination of three factors, that is, about 35% gel fraction, 25% monomer units in gel, and 15% graft efficiency by irradiating the polymer-monomer system containing low molecular weight poly (butyl acrylate). (author)

  12. Dynamic mechanical properties of photopolymerizable poly(vinyl alcohol)-acrylate monomer blends

    International Nuclear Information System (INIS)

    Koshiba, M.; Yamaoka, T.; Tsunoda, T.

    1983-01-01

    Dynamic mechanical properties of photopolymerizable poly(vinyl alcohol) (PVA)-monoacrylate blends were investigated by measuring dynamic shear modulus G' and loss tangent, tan delta. The dynamic mechanical properties of the blends before being exposed to UV irradiation were governed by the weight percent of the monomers which act as plasticizers. On the other hand, the UV-irradiated blends seemed to be typical two-phase materials since they revealed two tan delta maxima whose positions were independent of the monomer content. Those two maxima were assigned to PVA and photopolymerized acrylates with reference to the dynamic mechanical data of PVA and a PVA-polyacrylamide polyblend. Those dynamic mechanical data suggested that insolubilization of the blend type photopolymers should be caused by a decrease in solubility due to graft polymerization of acrylate monomers onto PVA. 9 figures, 3 tables

  13. A study on radiation-induced graft copolymerization of monomer onto natural silk fabric

    International Nuclear Information System (INIS)

    Xiang Zhengyu; Wan Dairong; He Qian

    1995-02-01

    In order to improve the properties of natural silk fabric, the mechanism and method of the radiation induced graft copolymerization of monomers onto natural silk fabric were studied. Three monomers, acrylamide, methylacrylamide and hydroxymethyl acrylamide, were selected for grafting test according to requirements of graft processing. The processing conditions of monomer infusion were studied. The properties of grafted samples were measured. The results are as follows: the rate of weight increasing is 10%∼29%; the rate of thickness increasing is 5%∼20%; the abrupt elasticity rose by 30%; the retarded elasticity rose by 12%; wet elasticity rose by 40%; and the brightness of colour and lustre were improved. It is concluded that while the radiation grafted silk kept its natural characteristics, other properties were improved. It became even chubby and thicker. (4 refs., 3 figs., 3 tabs.)

  14. Improved thrombin binding aptamer by incorporation of a single unlocked nucleic acid monomer

    DEFF Research Database (Denmark)

    Pasternak, Anna; Hernandez, Frank J; Rasmussen, Lars Melholt

    2011-01-01

    A 15-mer DNA aptamer (named TBA) adopts a G-quadruplex structure that strongly inhibits fibrin-clot formation by binding to thrombin. We have performed thermodynamic analysis, binding affinity and biological activity studies of TBA variants modified by unlocked nucleic acid (UNA) monomers. UNA...... that a UNA monomer is allowed in many positions of the aptamer without significantly changing the thrombin-binding properties. The biological effect of a selection of the modified aptamers was tested by a thrombin time assay and showed that most of the UNA-modified TBAs possess anticoagulant properties......, and that the construct with a UNA-U monomer in position 7 is a highly potent inhibitor of fibrin-clot formation....

  15. Considerably Unfolded Transthyretin Monomers Preceed and Exchange with Dynamically Structured Amyloid Protofibrils

    DEFF Research Database (Denmark)

    Groenning, Minna; Campos, Raul I; Hirschberg, Daniel

    2015-01-01

    describe an unexpectedly dynamic TTR protofibril structure which exchanges protomers with highly unfolded monomers in solution. The protofibrils only grow to an approximate final size of 2,900 kDa and a length of 70 nm and a comparative HXMS analysis of native and aggregated samples revealed a much higher...... average solvent exposure of TTR upon fibrillation. With SAXS, we reveal the continuous presence of a considerably unfolded TTR monomer throughout the fibrillation process, and show that a considerable fraction of the fibrillating protein remains in solution even at a late maturation state. Together......, these data reveal that the fibrillar state interchanges with the solution state. Accordingly, we suggest that TTR fibrillation proceeds via addition of considerably unfolded monomers, and the continuous presence of amyloidogenic structures near the protofibril surface offers a plausible explanation...

  16. Precision design of ethylene- and polar-monomer-based copolymers by organometallic-mediated radical polymerization

    Science.gov (United States)

    Kermagoret, Anthony; Debuigne, Antoine; Jérôme, Christine; Detrembleur, Christophe

    2014-03-01

    The copolymerization of ethylene with polar monomers is a major challenge when it comes to the manufacture of materials with potential for a wide range of commercial applications. In the chemical industry, free-radical polymerization is used to make a large proportion of such copolymers, but the forcing conditions result in a lack of fine control over the architecture of the products. Herein we introduce a synthetic tool, effective under mild experimental conditions, for the precision design of unprecedented ethylene- and polar-monomer-based copolymers. We demonstrate how an organocobalt species can control the growth of the copolymer chains, their composition and the monomer distribution throughout the chain. By fine tuning the ethylene pressure during polymerization and by exploiting a unique reactive mode of the end of the organometallic chain, novel block-like copolymer structures can be prepared. This highly versatile synthetic platform provides access to a diverse range of polymer materials.

  17. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  18. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  19. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  20. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    OpenAIRE

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  1. Micelle-assisted signaling of peracetic acid by the oxidation of pyreneboronic acid via monomer-excimer switching.

    Science.gov (United States)

    Choi, Jiyoung; Lee, Hyo Jin; Cho, Min Jeoung; Chang, Suk-Kyu

    2015-08-15

    A simple fluorescent probe for the industrial oxidant peracetic acid (PAA) was investigated. PAA-assisted oxidative conversion of pyrene-1-boronic acid into 1-hydroxypyrene was used as the signaling tool. Pyreneboronic acid was found to display selective signaling behavior, being more responsive to PAA than to other commonly used practical oxidants such as H2O2 and HOCl. The changes in pyrene monomer fluorescence to excimer were used in the quantitative analysis of PAA. When using the surfactant hexadecyltrimethylammonium bromide as a micellar additive, the signaling of PAA was markedly enhanced. Selective fluorescence signaling of PAA by pyrene-1-boronic acid with a detection limit of 1.5×10(-6)M in aqueous environment was successfully achieved. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Sustainable Poly(Ionic Liquids) for CO2 Capture Based on Deep Eutectic Monomers

    KAUST Repository

    Isik, Mehmet; Zulfiqar, Sonia; Edhaim, Fatimah; Ruiperez, Fernando; Rothenberger, Alexander; Mecerreyes, David

    2016-01-01

    The design of high performance solid sorbent materials for CO2 capture is a technology which has been employed to mitigate global warming. However, the covalent incorporation of functionalities into polymeric supports usually involves multistep energy-intensive chemical processes. This fact makes the net CO2 balance of the materials negative even though they possess good properties as CO2 sorbents. Here we show a new family of polymers which are based on amines, amidoximes, and natural carboxylic acids and can be obtained using sustainable low energy processes. Thus, deep eutectic monomers based on natural carboxylic acids, amidoximes, and amines have been prepared by just mixing with cholinium type methacrylic ammonium monomer. The formation of deep eutectic monomers was confirmed by differential scanning calorimetry measurements. In all cases, the monomers displayed glass transition temperatures well below room temperature. Computational studies revealed that the formation of eutectic complexes lengthens the distance between the cation and the anion causing charge delocalization. The liquid nature of the resulting deep eutectic monomers (DEMs) made it possible to conduct a fast photopolymerization process to obtain the corresponding poly(ionic liquids). Materials were characterized by means of nuclear magnetic resonance, differential scanning calorimetry, thermogravimetric analysis, and X-ray diffraction to evaluate the properties of the polymers. The polymers were then used as solid sorbents for CO2 capture. It has been shown that the polymers prepared with citric acid displayed better performance both experimentally and computationally. The current endeavor showed that sustainable poly(ionic liquids) based on deep eutectic monomers can be easily prepared to produce low-energy-cost alternatives to the materials currently being researched for CO2 capture. © 2016 American Chemical Society.

  3. High-speed atomic force microscopy reveals structural dynamics of α -synuclein monomers and dimers

    Science.gov (United States)

    Zhang, Yuliang; Hashemi, Mohtadin; Lv, Zhengjian; Williams, Benfeard; Popov, Konstantin I.; Dokholyan, Nikolay V.; Lyubchenko, Yuri L.

    2018-03-01

    α-Synuclein (α-syn) is the major component of the intraneuronal inclusions called Lewy bodies, which are the pathological hallmark of Parkinson's disease. α-Syn is capable of self-assembly into many different species, such as soluble oligomers and fibrils. Even though attempts to resolve the structures of the protein have been made, detailed understanding about the structures and their relationship with the different aggregation steps is lacking, which is of interest to provide insights into the pathogenic mechanism of Parkinson's disease. Here we report the structural flexibility of α-syn monomers and dimers in an aqueous solution environment as probed by single-molecule time-lapse high-speed AFM. In addition, we present the molecular basis for the structural transitions using discrete molecular dynamics (DMD) simulations. α-Syn monomers assume a globular conformation, which is capable of forming tail-like protrusions over dozens of seconds. Importantly, a globular monomer can adopt fully extended conformations. Dimers, on the other hand, are less dynamic and show a dumbbell conformation that experiences morphological changes over time. DMD simulations revealed that the α-syn monomer consists of several tightly packed small helices. The tail-like protrusions are also helical with a small β-sheet, acting as a "hinge". Monomers within dimers have a large interfacial interaction area and are stabilized by interactions in the non-amyloid central (NAC) regions. Furthermore, the dimer NAC-region of each α-syn monomer forms a β-rich segment. Moreover, NAC-regions are located in the hydrophobic core of the dimer.

  4. Sustainable Poly(Ionic Liquids) for CO2 Capture Based on Deep Eutectic Monomers

    KAUST Repository

    Isik, Mehmet

    2016-10-05

    The design of high performance solid sorbent materials for CO2 capture is a technology which has been employed to mitigate global warming. However, the covalent incorporation of functionalities into polymeric supports usually involves multistep energy-intensive chemical processes. This fact makes the net CO2 balance of the materials negative even though they possess good properties as CO2 sorbents. Here we show a new family of polymers which are based on amines, amidoximes, and natural carboxylic acids and can be obtained using sustainable low energy processes. Thus, deep eutectic monomers based on natural carboxylic acids, amidoximes, and amines have been prepared by just mixing with cholinium type methacrylic ammonium monomer. The formation of deep eutectic monomers was confirmed by differential scanning calorimetry measurements. In all cases, the monomers displayed glass transition temperatures well below room temperature. Computational studies revealed that the formation of eutectic complexes lengthens the distance between the cation and the anion causing charge delocalization. The liquid nature of the resulting deep eutectic monomers (DEMs) made it possible to conduct a fast photopolymerization process to obtain the corresponding poly(ionic liquids). Materials were characterized by means of nuclear magnetic resonance, differential scanning calorimetry, thermogravimetric analysis, and X-ray diffraction to evaluate the properties of the polymers. The polymers were then used as solid sorbents for CO2 capture. It has been shown that the polymers prepared with citric acid displayed better performance both experimentally and computationally. The current endeavor showed that sustainable poly(ionic liquids) based on deep eutectic monomers can be easily prepared to produce low-energy-cost alternatives to the materials currently being researched for CO2 capture. © 2016 American Chemical Society.

  5. Distinct Internalization Pathways of Human Amylin Monomers and Its Cytotoxic Oligomers in Pancreatic Cells

    Science.gov (United States)

    Trikha, Saurabh; Jeremic, Aleksandar M.

    2013-01-01

    Toxic human amylin oligomers and aggregates are implicated in the pathogenesis of type 2 diabetes mellitus (TTDM). Although recent studies have shown that pancreatic cells can recycle amylin monomers and toxic oligomers, the exact uptake mechanism and trafficking routes of these molecular forms and their significance for amylin toxicity are yet to be determined. Using pancreatic rat insulinoma (RIN-m5F) beta (β)-cells and human islets as model systems we show that monomers and oligomers cross the plasma membrane (PM) through both endocytotic and non-endocytotic (translocation) mechanisms, the predominance of which is dependent on amylin concentrations and incubation times. At low (≤100 nM) concentrations, internalization of amylin monomers in pancreatic cells is completely blocked by the selective amylin-receptor (AM-R) antagonist, AC-187, indicating an AM-R dependent mechanism. In contrast at cytotoxic (µM) concentrations monomers initially (1 hour) enter pancreatic cells by two distinct mechanisms: translocation and macropinocytosis. However, during the late stage (24 hours) monomers internalize by a clathrin-dependent but AM-R and macropinocytotic independent pathway. Like monomers a small fraction of the oligomers initially enter cells by a non-endocytotic mechanism. In contrast a majority of the oligomers at both early (1 hour) and late times (24 hours) traffic with a fluid-phase marker, dextran, to the same endocytotic compartments, the uptake of which is blocked by potent macropinocytotic inhibitors. This led to a significant increase in extra-cellular PM accumulation, in turn potentiating amylin toxicity in pancreatic cells. Our studies suggest that macropinocytosis is a major but not the only clearance mechanism for both amylin’s molecular forms, thereby serving a cyto-protective role in these cells. PMID:24019897

  6. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Directory of Open Access Journals (Sweden)

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  7. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    International Nuclear Information System (INIS)

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  8. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Directory of Open Access Journals (Sweden)

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  9. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Science.gov (United States)

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  10. Graft copolymerization of water soluble mixed monomers onto polyethylene by the pre-irradiation method

    International Nuclear Information System (INIS)

    Long Fu; Tang Liming; Zhao Jin; Gao Zhenyong

    1993-01-01

    Grafting of water soluble mixed monomers of acrylic acid (AA)/acrylamide (Am) and acrylic acid/methacrylic acid (MA) onto polyethylene film by the pre-irradiation grafting method was investigated. The results showed that the grafting proceeded successfully with the adding of ferric salt in the solution. In the case of AA/Am system, a synergistic effect was noticed. In the case of AA/MA system, the graft percent increased with the increase in the concentration of MA in the feed ratio. Furthermore, the effects of monomer concentration, radiation dose and temperature on the grafting were also studied

  11. Synthesis and ATRP of novel fluorinated aromatic monomer with pendant sulfonate group

    DEFF Research Database (Denmark)

    Dimitrov, Ivaylo; Jankova Atanasova, Katja; Hvilsted, Søren

    2013-01-01

    Novel, fluorinated monomer with pendant sulfonate group was synthesized utilizing a two-step derivatization of 2,3,4,5,6-pentafluorostyrene (FS). The first step was a nucleophilic substitution of the fluorine atom in para position by hydroxyl group followed by sulfopropylation. The monomer...... was polymerized under aqueous ATRP conditions to yield phenyl-fluorinated aromatic homopolymer bearing pendant sulfonates on each repeating unit. Furthermore, this polymer was used as macroinitiator for the ATRP of poly(ethylene glycol) methacrylate. The polymers were characterized by 1H NMR, SEC and FTIR...

  12. Cyclic 3-alkyl pyridinium alkaloid monomers from a New Zealand Haliclona sp. marine sponge.

    Science.gov (United States)

    Damodaran, Vidhiya; Ryan, Jason L; Keyzers, Robert A

    2013-10-25

    Bioassay and NMR approaches have been used to guide the isolation of one known and two new cyclic 3-alkyl pyridinium alkaloid (3-APA) monomers from the New Zealand marine sponge Haliclona sp. The new compounds, dehydrohaliclocyclins C (3) and F (4), are the first reported examples of cyclic 3-APA monomers with unsaturation in the alkyl chain. The known compound haliclocyclin C (2) was also isolated from a mixture with 4. The structures of compounds 2-4 were elucidated using NMR spectroscopy, mass spectrometry, and chemical degradation.

  13. Preparation of poly (vinyl alcohol) membranes grafted with n-vinyl pyridine/ acrylic acid binary monomers

    International Nuclear Information System (INIS)

    Ajji, A.; Ali, A.

    2014-03-01

    Poly(vinyl alcohol) films were grafted with two monomers using gamma radiation, acrylic acid and N-vinyl pyridine. The influence of different parameters on the grafting yield was investigated as: the comonomer concentration and composition, and irradiation dose. The suitable conditions of the process had been determined to prepare PVA membranes have both properties of the two monomers, acrylic acid and vinyl pyridine as comonomer concentration and composition, and irradiation dose. Some properties of the membranes had been investigated as maximum swelling and grafting. Also the ability of the grafted films to adsorb some heavy metals and dyes was elaborated and discussed.(author)

  14. High monomer content batch microemulsion polymerization of butyl acrylate initiated with gamma ray

    Energy Technology Data Exchange (ETDEWEB)

    Chen Jun [Department of Polymer Science and Engineering, University of Science and Technology of China, Hefei, Anhui 230026 (China)]. E-mail: chjun04@mail.ustc.edu.cn; Zhang Zhicheng [Department of Polymer Science and Engineering, University of Science and Technology of China, Hefei, Anhui 230026 (China)]. E-mail: zczhang@ustc.edu.cn

    2007-05-15

    Radiation polymerization of butyl acrylate was performed in a microemulsion stabilized with a mixture of sodium of 12-acryloxy-9-octadecenoic acid and sodium dodecyl sulfate in a weight ratio of 2 at room temperature. BA content in microemulsion can be successfully improved up to 40 wt% with low surfactant concentration (lower than 10 wt%). The resulted stable, translucent microlatex contain particles with average diameter from 28.1 to 38.1 nm with different monomer content. Particle size depends on the dose rate and surfactant concentration. Effects of monomer content and dose rate on the maximum polymerization rate are discussed.

  15. PMR Polyimide prepreg with improved tack characteristics. [Polymerization of Monomer Reactants applications to fiber reinforced plastics

    Science.gov (United States)

    Serafini, T. T.; Delvigs, P.

    1978-01-01

    Current PMR Polyimide prepreg technology utilizes methanol or ethanol solvents for preparation of the PMR prepreg solutions. The volatility of these solvents limits the tack and drape retention characteristics of unprotected prepreg exposed to ambient conditions. Studies conducted to achieve PMR 15 Polyimide prepreg with improved tack and drape characteristics are described. Improved tack and drape retention were obtained by incorporation of an additional monomer. The effects of various levels of the added monomer on the thermo-oxidative stability and mechanical properties of graphite fiber reinforced PMR 15 composites exposed and tested at 316 C (600 F) are discussed.

  16. In situ polymerization of monomers for polyphenylquinoxaline/graphite fiber composites

    Science.gov (United States)

    Serafini, T. T.; Delvigs, P.; Vannucci, R. D.

    1974-01-01

    Methods currently used to prepare fiber reinforced, high temperature resistant polyphenylquinoxaline (PPQ) composites employ extremely viscous, low solids content solutions of high molecular weight PPQ polymers. An improved approach, described in this report, consists of impregnating the fiber with a solution of the appropriate monomers instead of a solution of previously synthesized high molecular weight polymer. Polymerization of the monomers occurs in situ on the fiber during the solvent removal and curing stages. The in situ polymerization approach greatly simplifies the fabrication of PPQ graphite fiber composites. The use of low viscosity monomeric type solutions facilitates fiber wetting, permits a high solids content, and eliminates the need for prior polymer synthesis.

  17. New aromatic activated dihalides and bisphenol monomers for the preparation of novel poly(arylene ethers)

    Science.gov (United States)

    Wolfe, James F.

    1993-01-01

    The goal of this research program was to synthesize a series of unique monomers of type I to be utilized at NASA-Langley in the preparation of new poly(arylene ether ketones), poly(arylene ether ketosulfones), and poly(arylene ether ketophosphine oxides). These A-A and A-B monomer systems, which possess activated aryl halide and/or phenolic end groups, are accessible via condensation reactions of appropriately substituted aryl acetonitrile carbanions with activated aryl dihalides followed by oxidative decyanation.

  18. Photoligation of self-assembled DNA constructs containing anthracene-functionalized 2'-amino-LNA monomers

    DEFF Research Database (Denmark)

    Pasternak, Karol; Pasternak, Anna; Gupta, Pankaj

    2011-01-01

    Efficient synthesis of a novel anthracene-functionalized 2'-amino-LNA phosphoramidite derivative is described together with its incorporation into oligodeoxynucleotides. Two DNA strands with the novel 2'-N-anthracenylmethyl-2'-amino-LNA monomers can be effectively cross-linked by photoligation...... at 366nm in various types of DNA constructs. Successful application of three differently functionalized 2'-amino-LNA monomers in self-assembled higher ordered structures for simultaneous cross-linking and monitoring of assembly formation is furthermore demonstrated....

  19. Effect of mineral acid on polymer produced during radiation-induced grafting of styrene monomer

    International Nuclear Information System (INIS)

    Garnett, J.L.; Jankiewicz, S.V.; Sangster, D.F.

    1982-01-01

    The inclusion of mineral acid in a solution of styrene in methanol subjected to 60 Co γ irradiation markedly enhances the yield of monomer grafted to cellulose and other radiation grafting systems. Results were reported from a preliminary investigation into the mechanism of this acid effect through a study of the action of acid during the solution polymerization process. It was found that the presence of acid in a monomer solution such as styrene in 1, 4-dioxan led to an enhancement in the homopolymer yield of styrene; and it was showed that the acid also effected the number-average molecular weight of this homopolymer. 1 figure, 4 tables

  20. Penelitian penggunaan monomer n-butil akrilat untuk peningkatan mutu kulit secara iradiasi

    OpenAIRE

    Dwi Wahini Nurhajati; Suliestiyah Wiryodiningrat; Kadarijah Kadarijah; Penny Setyowati

    1996-01-01

    Research on the utilization of n-butyl acrylate monomer for quality improvement leather by irradiation cobalt-60 gamma-rays is carried out as follows: Javanese crust hide was impregnated with water emulsions of n-butyl acrylate monomer for 2 hours, packed in to poly ethylene bags, sealed, then irradiated by cobalt-60 gamma rays (doses : 5 to 25 kGy). The irradiated leather was washed by water, dried and then physical tested. The results of physical test of leather modified with n-butyl acryl...

  1. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  2. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Science.gov (United States)

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  3. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  4. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Science.gov (United States)

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  5. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  6. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  7. Galvanic element. Galvanisches Element

    Energy Technology Data Exchange (ETDEWEB)

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  8. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  9. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  10. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  11. Structural and dynamic characterization of the C313Y mutation in Myostatin dimeric protein, responsible for the double muscle phenotype in Piedmontese cattle

    Directory of Open Access Journals (Sweden)

    Silvia eBongiorno

    2016-02-01

    Full Text Available The knowledge of the molecular effects of the C313Y mutation, responsible for the double muscle phenotype in Piedmontese cattle, can help understanding the actual mechanism of phenotype determination and paves the route for a better modulation of the positive effects of this economic important phenotype in the beef industry, while minimizing the negative side effects, now inevitably intersected.The structure and dynamic behaviour of the active dimeric form of Myostatin in cattle was analyzed by means of three state-of-the-art Molecular Dynamics simulations, 200-ns long, of wild-type and C313Y mutants. Our results highlight a role for the conserved Arg333 in establishing a network of short and long range interactions between the two monomers in the wild-type protein that is destroyed upon the C313Y mutation even in a single monomer. Furthermore, the native protein shows an asymmetry in residue fluctuation that is absent in the double monomer mutant. Time window analysis on further 200-ns of simulation demonstrates that this is a characteristic behaviour of the protein, likely depended from the long range communications between monomers. The same behaviour, in fact, has already been observed in other mutated dimers. Finally, the mutation does not produce alterations in the secondary structure elements that compose the characteristic TGF-β cystine-knot motif.

  12. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Energy Technology Data Exchange (ETDEWEB)

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  13. Do the monomers release from the composite resins after artificial aging?

    Science.gov (United States)

    Tokay, Ugur; Koyuturk, Alp Erdin; Aksoy, Abdurrahman; Ozmen, Bilal

    2015-04-01

    The aim of this study is to measure the effect of thermal cycling on the amount of monomer released from three different composite materials by HPLC analysis method. Three different composite materials, inlay composite, posterior composite and micro-hybrid composite were used. Sixty cylinder specimens each with a dimension of approximately 1 cm width and 3 mm depth, were prepared before experiments were carried out. Inlay composite material was polymerized according to manufacturers' instructions. Thermal cycling device was used to simulate thermal differences which occur in the mouth media. Monomers were analyzed using HPLC technic after thermal cycling process. The amount of ethoxylated Bis-GMA and urethane dimethacrylate (UDMA) in inlay composite material, the amount of ethoxylated Bis-GMA in posterior composite material, the amount of ethoxylated Bis-GMA and triethyleneglycol dimethacrylate (TEGDMA) in micro-hybrid composite material were investigated. Monomer release of thermal cycles levels showed a linear increase in UDMA and TEGDMA (P < 0.05). In terms of thermal cycles levels, Bis-EMA released from posterior composite showed a cubic change (P < 0.001). It was observed that use of additional polymerization processes might have positive effect on the decrease of residual monomer. In the light of the results, we suggest that indirect composite resins have more outstanding features than direct composite resins in terms of biocompatibility. © 2015 Wiley Periodicals, Inc.

  14. Reduction of residual monomer in latex products by enhanced polymerization and extraction in supercritical carbon dioxide

    NARCIS (Netherlands)

    Kemmere, M.F.; Schilt, van M.A.; Cleven, M.H.W.; Herk, van A.M.; Keurentjes, J.T.F.

    2002-01-01

    The redn. of Me methacrylate (MMA) in a PMMA latex was chosen as a representative model system. Pulsed electron beam expts. were performed to study the effect of supercrit. carbon dioxide (scCO2) on the monomer concn. inside the polymer particles during the polymn. reaction. The partitioning

  15. Polyimide, dianhydride monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Pinnau, Ingo; Ghanem, Bader Saleh; Abdulhamid, Mahmoud Atef

    2017-01-01

    Embodiments of the present disclosure include, a dianhydride monomer, a polyimide, a method of making a dianhydride, a method of making a polyimide, and the like. Embodiments of the present disclosure can be used in membrane-based gas separation applications.

  16. Titanium, zirconium- and hafnium containing initiators in the polymerization of acrylic monomers to ''living'' polymers

    International Nuclear Information System (INIS)

    Farnham, W.B.; Hertler, W.R.

    1988-01-01

    This patent describes a process for preparing ''living'' polymer. The process comprises contacting one or more acrylic monomers under polymerizing conditions with a polymerization-initiating amount of a tetra-coordinate organotitanium, organozirconium or organo-hafnium polymerization initiator, and ''living'' polymers produced thereby

  17. Microwave-assisted cationic ring-opening polymerization of a soy-based 2-oxazoline monomer

    NARCIS (Netherlands)

    Hoogenboom, R.; Wiesbrock, F.D.; Schubert, U.S.

    2005-01-01

    The microwave-assisted cationic ring-opening polymn. of a soy based 2-oxazoline monomer (SoyOx) is described. The microwave irradn. provides more efficient heating when compared to conventional heating and, in addn., the SoyOx was prepd. starting from a sustainable resource (soy beans). The

  18. The Off-rate of Monomers Dissociating from Amyloid-β Protofibrils*

    Science.gov (United States)

    Grüning, Clara S. R.; Klinker, Stefan; Wolff, Martin; Schneider, Mario; Toksöz, Küpra; Klein, Antonia N.; Nagel-Steger, Luitgard; Willbold, Dieter; Hoyer, Wolfgang

    2013-01-01

    The interconversion of monomers, oligomers, and amyloid fibrils of the amyloid-β peptide (Aβ) has been implicated in the pathogenesis of Alzheimer disease. The determination of the kinetics of the individual association and dissociation reactions is hampered by the fact that forward and reverse reactions to/from different aggregation states occur simultaneously. Here, we report the kinetics of dissociation of Aβ monomers from protofibrils, prefibrillar high molecular weight oligomers previously shown to possess pronounced neurotoxicity. An engineered binding protein sequestering specifically monomeric Aβ was employed to follow protofibril dissociation by tryptophan fluorescence, precluding confounding effects of reverse or competing reactions. Aβ protofibril dissociation into monomers follows exponential decay kinetics with a time constant of ∼2 h at 25 °C and an activation energy of 80 kJ/mol, values typical for high affinity biomolecular interactions. This study demonstrates the high kinetic stability of Aβ protofibrils toward dissociation into monomers and supports the delineation of the Aβ folding and assembly energy landscape. PMID:24247242

  19. Polyimide, dianhydride monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Pinnau, Ingo

    2017-11-16

    Embodiments of the present disclosure include, a dianhydride monomer, a polyimide, a method of making a dianhydride, a method of making a polyimide, and the like. Embodiments of the present disclosure can be used in membrane-based gas separation applications.

  20. Visualization of monomer and polymer inside porous stones by using X-ray tomography

    International Nuclear Information System (INIS)

    Brunetti, Antonio; Princi, Elisabetta; Vicini, Silvia; Pincin, Silvia; Bidali, Simone; Mariani, Alberto

    2004-01-01

    Estimate of sorption of liquid materials inside porous stones is an important parameter in industrial material testing and cultural heritage conservation. In the latter case, a suitable polymer can be used for both consolidation and conservation, it being applied either in the final form or as its parent monomer, which is subsequently allowed to polymerize in situ by the classical method or by frontal polymerization. However, the sorption of such materials through the stone is often difficult because of their viscosity and/or stone porosity. For this reason, the amount of monomer (or polymer) is a parameter of great interest in order to determine the extent of protection reachable by the treatment. In this paper a new methodology based on X-ray tomography is presented. The methodology makes use of a contrast agent added to the monomer that does not interact with its propagation inside the stone and allows to increase the absorption coefficient and so to observe the monomer inside the sample, which is finally frontally polymerized

  1. Syntheses of monomers in the reaction of hexamethylolmelamine with 2-hydroxyethyl acrylate and their photocuring

    International Nuclear Information System (INIS)

    Huhui Houlianbo Hufei

    1999-01-01

    A process has been developed for the syntheses of monomers from 2-hydroxyethyl acrylate and hexamethylolmelamine. Their structure were identified by IR and sub 1H-NMR. The photocuring characteristics of these compound and properties of the UV-cured films have been studied

  2. Regulation of the PI3K pathway through a p85a monomer-homodimer equilibrium

    KAUST Repository

    Aljedani, Safia Salim Eid

    2017-01-08

    The phosphatidylinositol-3-kinase a (PI3Ka) is heterodimeric enzyme that is composed of p85a regulatory subunit and a p110a catalytic subunit. PI3Ka plays a key role in cell survival, growth and differentation. Owing to its role as a key regulator, the PI3Ka pathway is the most frequently mutated pathway in human cancers, and is targeted by many viruses to insure their survival and successful reproduction. Previous studies have shown that the equilibrium of p85 monomers and dimers regulates the PI3K pathway, suggesting that interrupting this equilibrium could lead to disease development. Moreover, studies suggest that the p85a monomers and dimers have opposing effects on PI3Ka signaling as only the p85a dimers bind to the PTEN phosphatase, whereas p85a monomers bind to the catalytic p110 subunit. However, the mechanism for dimerisation is controversial, and it is unknown why PTEN or p110a bind only dimer or monomer. Therefore, we combine molecular biology, biophsical, computational and structural methods to investigate the suprosingly complex p85 dimerisation mechanism and its control by ligands. Results may inspire novel theraputic approaches.

  3. High-resolution structure of a retroviral protease folded as a monomer

    Czech Academy of Sciences Publication Activity Database

    Gilski, M.; Kazmierczyk, M.; Krzywda, S.; Zábranská, Helena; Cooper, S.; Popovic, Z.; Khatíb, F.; Dímaio, F.; Thompson, J.; Baker, D.; Pichová, Iva; Jaskolski, M.

    D67, č. 11 (2011), s. 907-914 ISSN 0907-4449 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : M-PMV protease * crystal structure * monomer * dimerization inhibitors Subject RIV: CE - Biochemistry Impact factor: 12.619, year: 2011

  4. Environmental effects on the lignin model monomer, vanillyl alcohol, studied by raman spectroscopy

    DEFF Research Database (Denmark)

    Larsen, Kiki Lyster; Barsberg, Søren Talbro

    2011-01-01

    model monomer, vanillyl alcohol (G type), dissolved in different solvents were compared to investigate such effects on the Raman band shapes and positions. Density functional theory combined with the polarizable continuum model were applied to assign the observed bands and tested for prediction accuracy...

  5. Enzymatic polymerization of bio-based monomers for applications in hydrogels and coatings

    DEFF Research Database (Denmark)

    Hoffmann, Christian; Nguyen, Hiep Dinh; Storgaard, Thomas

    of the enzymatic catalysts that can provide control over polymer structure in functional polymers. Lipase catalyzed polymerizations (specifically CALB) has been applied to prepare functional polyesters and to evaluate the possibilities of using less stable bio-based monomers such as itaconic acid or its...

  6. Effect of reactive monomer on PS-b-P2VP film with UV irradiation

    Science.gov (United States)

    Kim, H. J.; Shin, D. M.

    2012-03-01

    Poly(styrene-b-2-vinyl pyridine) (PS-b-P2VP) lamellar film which is hydrophobic block hydrophilic polyelectrolyte block polymer of 52 kg/mol -b- 57 kg/mol and PS-b-P2VP film with reactive monomer (RM257) were prepared for photonic gel films. The lamellar stacks, which is alternating layer of hydrophilic and hydrophobic part of PS-b-P2VP. We reported about the influence of reactive monomer on those photonic gel films. Added reactive monomer photonic gel film had higher absorbance than pure photonic gel films. And band gaps of the lamellar films shifted by the time of UV light irradiation. That Photonic gel films were measured with the UV spectrophotometer. As a result the photonic gel film with reactive monomer had more clear color. The lamellar films were swollen by DI water, Ethyl alcohol (aq) and calcium carbonate solution. Since the domain spacing of dried photonic gel films were not showing any color in visible wavelength. The band gap of the lamellar films were drastically shifted to longer wavelength swollen by calcium carbonate solution (absorbance peak 565nm-->617nm). And the lamellar films were shifted to shorter wave length swollen by ethanol (absorbance peak 565nm-->497nm). So each Photonic gel film showed different color.

  7. Monitoring of originated polymer in pure monomer with gradient polymer elution chromatography (GPEC)

    NARCIS (Netherlands)

    Staal, W.J.; Cools, P.J.C.H.; Herk, van A.M.; German, A.L.

    1994-01-01

    The anal. of the amt. of polymer in pure monomer with cloudpoint measurements gives only a qual. answer. Now by use of a liq. chromatograph and gradient elution a fully automated detn. the amt. of polymer can be measured and an impression of the molar mass can be achieved

  8. Residual monomer reduction in polymer latex products by extraction with supercritical carbon dioxide

    NARCIS (Netherlands)

    Aerts, M.; Meuldijk, J.; Kemmere, M.F.; Keurentjes, J.T.F.

    2011-01-01

    Extraction of residual monomer from a latex product with supercritical carbon dioxide ((sc)CO2) in a column was studied. Operating conditions were chosen at 35¿°C and 100 bar. For reducing the residual styrene level in a polystyrene latex from 104 ppm to 100¿ppm and from 104 ppm to 10¿ppm, a

  9. Stark effect measurements on monomers and trimers of reconstituted light-harvesting complex II of plants

    NARCIS (Netherlands)

    Palacios, M.A.; Caffarri, S.; Bassi, R.; Grondelle, van R.; Amerongen, van H.

    2004-01-01

    The electric-field induced absorption changes (Stark effect) of reconstituted light-harvesting complex II (LHCII) in different oligomerisation states - monomers and trimers - with different xanthophyll content have been probed at 77 K. The Stark spectra of the reconstituted control samples,

  10. Fatty Acid-Based Monomers as Styrene Replacements for Liquid Molding Resins

    Science.gov (United States)

    2005-05-01

    fatty acid length and unsaturation level on resin and polymer properties. Fig. 2. The addition of fatty acids ( oleic acid ) to glycidyl methacylate to...the synthetic route used to form the methacrylated fatty acids (MFA). The carboxylic acid of fatty acids undergoes a simple addition reaction with... form methacrylated fatty acid monomer

  11. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    International Nuclear Information System (INIS)

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  12. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Science.gov (United States)

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The difference of acrylic resin residual monomer levels with various polymerization method

    Directory of Open Access Journals (Sweden)

    Sherman Salim

    2011-12-01

    Full Text Available Background: After polymerization process, heat cured acrylic resin denture base actually still contains residual monomers that can become potential irritants later in oral cavity. Polymerization process is essential to obtain acrylic resin which can meet the requirements of the biocompatible and good physical properties. To meet the requirements, there are several methods of polymerization process used. Purpose: The purpose of this study was to determine the differences of the residual monomer levels of acrylic resin processed by various polymerization methods. Methods: Acrylic resin powder and liquid were mixed based on the rules of factory, and sample was made with size of 30 mm × 50 mm × 3 mm and then polymerized by using microwave at 70° C for 24 hours based on the methods of Japan Industrial Standard (JIS. Each group of samples was cut with weight of ± 0.2 g, dissolved in 5 ml of methyl ethyl ketone in test tubes, and then stored at ± 5° C for four days. Residual monomer level was conducted by using gas chromatograph mass spectrometer. Data obtained were then analyzed by using One-Way ANOVA test with p < 0.05. Results: After the level of polymerizing residual monomer with JIS method was compared to that at 70° C for 24 hours using microwave, it is known that there were significant differences (p < 0.05. Conclusion: The highest level of residual monomer of acrylic resin was that polymerized at 70° C for 24 hours.Latar belakang: Basis gigi tiruan yang berbahan dasar resin akrilik jenis heat cured setelah proses polimerisasi selesai masih mengandung monomer sisa yang berpotensi sebagai bahan iritan dalam rongga mulut. Proses polimerisasi sangat penting untuk mendapatkan resin akrilik yang memenuhi persyaratan biokompatibilitas dan fisik yang baik. Untuk persyaratan tersebut digunakan berbagai macam proses polimerisasi. Tujuan: Penelitian ini bertujuan untuk menentukan kadar monomer sisa resin akrilik yang diproses dengan metode

  14. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Directory of Open Access Journals (Sweden)

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  15. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Concomitant sensitization to glutaraldehyde and methacrylic monomers among dentists and their patients

    Directory of Open Access Journals (Sweden)

    Maya Grigorievna Lyapina

    2016-06-01

    Full Text Available Background: A multitude of methacrylic monomers is used in dentistry. Glutaraldehyde (G is used in dental practice and consumer products as a broad-spectrum antimicrobial agent. The purpose of our study is to evaluate the frequency and the risk of concomitant sensitization to some methacrylic monomers (methyl methacrylate (MMA, triethyleneglycol dimethacrylate (TEGDMA, ethyleneglycol dimethacrylate (EGDMA, 2,2-bis-[4-(2-hydroxy-3-methacrylo-xypropoxyphenyl]-propane (Bis-GMA, 2-hydroxy-ethyl methacrylate (2-HEMA and tetrahydrofurfuryl methacrylate (THFMA and glutaraldehyde in students of dentistry, students from the dental technician school, dental professionals and dental patients. Material and Methods: A total of 262 participants were included in the study: students of dentistry, students from the dental technician school, dental professionals, and dental patients as a control group. All were patch-tested with methacrylic monomers and glutaraldehyde. The results were subject to the statistical analysis (p < 0.05. Results: Among the group of dental students, the highest frequency of concomitant sensitization was to TEGDMA and G (15.5%. In the group of patients the highest frequency of concomitant sensitization was to EGDMA and G (16.4%. The frequency of concomitant sensitization among dental professionals was much lower, with the highest rate to TEGDMA and G (7.7%, too. We consider the students from the dental technician school, where the exposure to glutaraldehyde is less likely, to be the group at a lesser risk of concomitant sensitization. Conclusions: Dental students and dental patients could be outlined as groups at the risk of concomitant sensitization to glutaraldehyde and methacrylic monomers. For dental professionals, we assumed an increased risk for concomitant sensitization to TEGDMA and aldehydes that are commonly used in dentistry. We consider the students from the dental technician school to be the group at a lesser risk of

  17. Coupling of g proteins to reconstituted monomers and tetramers of the M2 muscarinic receptor.

    Science.gov (United States)

    Redka, Dar'ya S; Morizumi, Takefumi; Elmslie, Gwendolynne; Paranthaman, Pranavan; Shivnaraine, Rabindra V; Ellis, John; Ernst, Oliver P; Wells, James W

    2014-08-29

    G protein-coupled receptors can be reconstituted as monomers in nanodiscs and as tetramers in liposomes. When reconstituted with G proteins, both forms enable an allosteric interaction between agonists and guanylyl nucleotides. Both forms, therefore, are candidates for the complex that controls signaling at the level of the receptor. To identify the biologically relevant form, reconstituted monomers and tetramers of the purified M2 muscarinic receptor were compared with muscarinic receptors in sarcolemmal membranes for the effect of guanosine 5'-[β,γ-imido]triphosphate (GMP-PNP) on the inhibition of N-[(3)H]methylscopolamine by the agonist oxotremorine-M. With monomers, a stepwise increase in the concentration of GMP-PNP effected a lateral, rightward shift in the semilogarithmic binding profile (i.e. a progressive decrease in the apparent affinity of oxotremorine-M). With tetramers and receptors in sarcolemmal membranes, GMP-PNP effected a vertical, upward shift (i.e. an apparent redistribution of sites from a state of high affinity to one of low affinity with no change in affinity per se). The data were analyzed in terms of a mechanistic scheme based on a ligand-regulated equilibrium between uncoupled and G protein-coupled receptors (the "ternary complex model"). The model predicts a rightward shift in the presence of GMP-PNP and could not account for the effects at tetramers in vesicles or receptors in sarcolemmal membranes. Monomers present a special case of the model in which agonists and guanylyl nucleotides interact within a complex that is both constitutive and stable. The results favor oligomers of the M2 receptor over monomers as the biologically relevant state for coupling to G proteins. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  19. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  20. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  1. Guidelines To Select the N-Heterocyclic Carbene for the Organopolymerization of Monomers with a Polar Group

    KAUST Repository

    Falivene, Laura

    2017-02-13

    We report on the DFT stability of zwitterion and spirocycle adducts of five polar monomers with nine N-heterocyclic carbenes (NHC), covering the most typical classes of monomers and NHCs used in organopolymerization. Results indicate that the relative stability of the two adducts is dominated by the singlet-triplet energy gap of the free NHC, with low energy gaps favoring the spirocycle adduct, while high energy gaps favor the zwitterionic adduct. This basic structure/property relationship can be tuned by the hindrance of the NHC and the nature of the monomer. In addition to rationalize existing systems, the 45 NHC/monomer combinations we examined can be used as a guideline to predict the behavior of a new NHC/monomer combination.

  2. Reactivity of vinyl ethers and vinyl ribosides in UV-initiated free radical copolymerization with acceptor monomers.

    Science.gov (United States)

    Pichavant, Loic; Guillermain, Céline; Coqueret, Xavier

    2010-09-13

    The reactivity of various vinyl ethers and vinyloxy derivatives of ribose in the presence of diethyl fumarate or diethyl maleate was investigated for evaluating the potential of donor-acceptor-type copolymerization applied to unsaturated monomers derived from renewable feedstock. The photochemically induced polymerization of model monomer blends in the bulk state was monitored by infrared spectroscopy. The method allowed us to examine the influence of monomer pair structure on the kinetic profiles. The simultaneous consumption of both monomers was observed, supporting an alternating copolymerization mechanism. A lower reactivity of the blends containing maleates compared with fumarates was confirmed. The obtained kinetic data revealed a general correlation between the initial polymerization rate and the Hansen parameter δ(H) associated with the H-bonding aptitude of the donor monomer.

  3. Luminal and parenteral TFF2 and TFF3 dimer and monomer in two models of experimental colitis in the rat

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kissow, Hannelouise; Hare, Kristine

    2005-01-01

    % dextran sodium sulphate in the drinking water or by one intraperitoneal injection of mitomycin C, 3.75 mg/kg. TFF peptides were administered as subcutaneous injections or directly into the lumen via a catheter placed in the proximal colon. Treatments were saline, TFF2, TFF3 monomer or TFF3 dimer 5 mg......2 had positive effect only in DSS-induced colitis. The TFF3 monomer was without any effects in both models. Treatment effect was most pronounced in the middle part of the colon, closest to the tip of the catheter. Injected TFF peptides, especially the TFF3 monomer, aggravated the colitis score...... in both colitis models. CONCLUSIONS: Intracolonic administration of TFF3 dimer and TFF2 improves experimentally induced colitis in rats. The TFF3 monomer has no effect. Parenteral administration of TFF peptides aggravates the colitis especially the TFF3 monomer....

  4. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Science.gov (United States)

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  5. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Science.gov (United States)

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  6. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    Directory of Open Access Journals (Sweden)

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  7. One-Pot Click Access to a Cyclodextrin Dimer-Based Novel Aggregation Induced Emission Sensor and Monomer-Based Chiral Stationary Phase

    Directory of Open Access Journals (Sweden)

    Xiaoli Li

    2016-11-01

    Full Text Available A ‘two birds, one stone’ strategy was developed via a one-pot click reaction to simultaneously prepare a novel cyclodextrin (CD dimer based aggregation induced emission (AIE sensor (AIE-DCD and a monomer based chiral stationary phase (CSP-MCD for chiral high performance liquid chromatography (CHPLC. AIE-DCD was found to afford satisfactory AIE response for specific detection of Zn2+ with a detection limit of 50 nM. CSP-MCD exhibits excellent enantioseparation ability toward dansyl amino acids, where the resolution of dansyl amino leucine reaches 5.43.

  8. The role of polycarbonate monomer bisphenol-A in insulin resistance.

    Science.gov (United States)

    Pjanic, Milos

    2017-01-01

    Bisphenol A (BPA) is a synthetic unit of polycarbonate polymers and epoxy resins, the types of plastics that could be found in essentially every human population and incorporated into almost every aspect of the modern human society. BPA polymers appear in a wide range of products, from liquid storages (plastic bottles, can and glass linings, water pipes and tanks) and food storages (plastics wraps and containers), to medical and dental devices. BPA polymers could be hydrolyzed spontaneously or in a photo- or temperature-catalyzed process, providing widespread environmental distribution and chronic exposure to the BPA monomer in contemporary human populations. Bisphenol A is also a xenoestrogen, an endocrine-disrupting chemical (EDC) that interferes with the endocrine system mimicking the effects of an estrogen and could potentially keep our endocrine system in a constant perturbation that parallels endocrine disruption arising during pregnancy, such as insulin resistance (IR). Gestational insulin resistance represents a natural biological phenomenon of higher insulin resistance in peripheral tissues of the pregnant females, when nutrients are increasingly being directed to the embryo instead of being stored in peripheral tissues. Gestational diabetes mellitus may appear in healthy non-diabetic females, due to gestational insulin resistance that leads to increased blood sugar levels and hyperinsulinemia (increased insulin production from the pancreatic beta cells). The hypothesis states that unnoticed and constant exposure to this environmental chemical might potentially lead to the formation of chronic low-level endocrine disruptive state that resembles gestational insulin resistance, which might contribute to the development of diabetes. The increasing body of evidence supports the major premises of this hypothesis, as exemplified by the numerous publications examining the association of BPA and insulin resistance, both epidemiological and mechanistic. However, to

  9. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  10. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Mangrove tannins and their flavanoid monomers as alternative steel corrosion inhibitors in acidic medium

    International Nuclear Information System (INIS)

    Rahim, Afidah A.; Rocca, E.; Steinmetz, J.; Kassim, M.J.; Adnan, R.; Sani Ibrahim, M.

    2007-01-01

    The inhibitive behaviour on steel of flavanoid monomers that constitute mangrove tannins namely catechin, epicatechin, epigallocatechin and epicatechingallate was investigated in an aerated HCl solution via electrochemical methods. The monomers were found to be mainly cathodic inhibitors and the inhibition efficiency was dependent on concentration. To explain the adsorptive behaviour of the molecules on the steel surface, a semiempirical approach involving quantum chemical calculations using HyperChem 6.0 was undertaken. The HOMO electronic density of the molecule was used to explain the inhibiting mechanism. The most probable adsorption centers were found in the vicinity of the phenolic groups. In a second part, the use of mangrove tannin, extracted from the mangrove barks as steel corrosion inhibitors in acidic media was investigated and its inhibitive efficiency was compared with that of commercial mimosa, quebracho and chestnut tannins. The inhibitive performance of mangrove tannins was comparable to the other tannins investigated, indicating their potential in corrosion protection

  12. Radiation initiated grafting of hydrophilic and reactive monomers on polyetherurethane for biomedical application

    International Nuclear Information System (INIS)

    Jansen, B.; Ellinghorst, G.

    1981-01-01

    Hydrogels such poly(hydroxyethylmethacrylate), poly (acrylamide) and poly(2,3-dihydroxypropylmethacrylate) are a class of well-known materials with good to excellent biomedical properties. Unfortunately the mechanical behaviour of the water-swollen gels is poor, and thus their application in pure state is limited. Much work has been done, especially by the grafting technique, on supporting the hydrogels by several techniques in order to improve their mechanical properties. In this work grafting of hydrogel forming or reactive monomers (which can be made hydrophilic by a following chemical process) onto a polyetherurethane was performed by a technique in which the trunk polymer is swollen in the graft monomer before irradiation. (author)

  13. Preparation of unsaturated acrylic prepolymer and electron beam curing of its mixture with vinyl monomers

    International Nuclear Information System (INIS)

    Pyun, H.C.; Park, W.B.; Kim, K.Y.; Sung, K.Y.

    1980-01-01

    Electron beam curable prepolymers were prepared by the addition reaction of methyl methacrylate-glycidyl methacrylate copolymer with methacrylic acid, and electron beam curing was studied for the prepolymer and their mixtures of several kind of vinyl monomers. When the reaction was carried out in the presence of triethylbenzyl ammonium chloride in N,N-dimethyl formamide solution, the rate of addition reaction obeyed first-order kinetics. In the electron beam curing, the rate of gel formation of the prepolymer was slower than that of the mixtures of prepolymer and monomers. In the curing of mixtures of prepolymer with polyethyleneglycol dimethacrylates, the rate of gel formation increased with the increase in the degree of polymerization of polyethylene oxide fraction of polyethyleneglycol dimethacrylate, and decreased with the increase the polyethyleneglycol dimethacrylate content. The properties of cured coatings were also examined. (author)

  14. Mangrove tannins and their flavanoid monomers as alternative steel corrosion inhibitors in acidic medium

    Energy Technology Data Exchange (ETDEWEB)

    Rahim, Afidah A. [School of Chemical Sciences, University Sains Malaysia, 11800 Penang (Malaysia)]. E-mail: afidah@usm.my; Rocca, E. [Laboratoire de Chimie du Solide Mineral, Universite Henri Poincare, Nancy I BP 239, 54506 Vandoeuvre Les Nancy (France); Steinmetz, J. [Laboratoire de Chimie du Solide Mineral, Universite Henri Poincare, Nancy I BP 239, 54506 Vandoeuvre Les Nancy (France); Kassim, M.J. [School of Chemical Sciences, University Sains Malaysia, 11800 Penang (Malaysia); Adnan, R. [School of Chemical Sciences, University Sains Malaysia, 11800 Penang (Malaysia); Sani Ibrahim, M. [School of Chemical Sciences, University Sains Malaysia, 11800 Penang (Malaysia)

    2007-02-15

    The inhibitive behaviour on steel of flavanoid monomers that constitute mangrove tannins namely catechin, epicatechin, epigallocatechin and epicatechingallate was investigated in an aerated HCl solution via electrochemical methods. The monomers were found to be mainly cathodic inhibitors and the inhibition efficiency was dependent on concentration. To explain the adsorptive behaviour of the molecules on the steel surface, a semiempirical approach involving quantum chemical calculations using HyperChem 6.0 was undertaken. The HOMO electronic density of the molecule was used to explain the inhibiting mechanism. The most probable adsorption centers were found in the vicinity of the phenolic groups. In a second part, the use of mangrove tannin, extracted from the mangrove barks as steel corrosion inhibitors in acidic media was investigated and its inhibitive efficiency was compared with that of commercial mimosa, quebracho and chestnut tannins. The inhibitive performance of mangrove tannins was comparable to the other tannins investigated, indicating their potential in corrosion protection.

  15. Penelitian penggunaan monomer n-butil akrilat untuk peningkatan mutu kulit secara iradiasi

    Directory of Open Access Journals (Sweden)

    Dwi Wahini Nurhajati

    1996-06-01

    Full Text Available Research on the utilization of n-butyl acrylate monomer for quality improvement leather by irradiation cobalt-60 gamma-rays is carried out as follows: Javanese crust hide was impregnated with water emulsions of n-butyl acrylate monomer for 2 hours, packed in to poly ethylene bags, sealed, then irradiated by cobalt-60 gamma rays (doses : 5 to 25 kGy. The irradiated leather was washed by water, dried and then physical tested. The results of physical test of leather modified with n-butyl acrylate showed the increasing of tensile strength and elongation, decreasing of water absorption, resistance against the flexing test of 20,000 times, and PH was constant. Organoleptic test showed that the softly of the modified leather was no different with unmodified leather.

  16. GPCR homomers and heteromers: a better choice as targets for drug development than GPCR monomers?

    Science.gov (United States)

    Casadó, Vicent; Cortés, Antoni; Mallol, Josefa; Pérez-Capote, Kamil; Ferré, Sergi; Lluis, Carmen; Franco, Rafael; Canela, Enric I

    2009-11-01

    G protein-coupled receptors (GPCR) are targeted by many therapeutic drugs marketed to fight against a variety of diseases. Selection of novel lead compounds are based on pharmacological parameters obtained assuming that GPCR are monomers. However, many GPCR are expressed as dimers/oligomers. Therefore, drug development may consider GPCR as homo- and hetero-oligomers. A two-state dimer receptor model is now available to understand GPCR operation and to interpret data obtained from drugs interacting with dimers, and even from mixtures of monomers and dimers. Heteromers are distinct entities and therefore a given drug is expected to have different affinities and different efficacies depending on the heteromer. All these concepts would lead to broaden the therapeutic potential of drugs targeting GPCRs, including receptor heteromer-selective drugs with a lower incidence of side effects, or to identify novel pharmacological profiles using cell models expressing receptor heteromers.

  17. Synthesis and Characterization of Oligodeoxyribonucleotides Modified with 2'-Amino-α-l-LNA Adenine Monomers

    DEFF Research Database (Denmark)

    Andersen, Nicolai K; Anderson, Brooke A; Wengel, Jesper

    2013-01-01

    The development of conformationally restricted nucleotide building blocks continues to attract considerable interest because of their successful use within antisense, antigene, and other gene-targeting strategies. Locked nucleic acid (LNA) and its diastereomer α-l-LNA are two interesting examples...... (ONs) modified with 2'-amino-α-l-LNA adenine monomers W-Z. The synthesis of the target phosphoramidites 1-4 is initiated from pentafuranose 5, which upon Vorbrüggen glycosylation, O2'-deacylation, O2'-activation and C2'-azide introduction yields nucleoside 8. A one-pot tandem Staudinger....... ONs modified with pyrene-functionalized 2'-amino-α-l-LNA adenine monomers X-Z display greatly increased affinity toward DNA targets (ΔTm/modification up to +14 °C). Results from absorption and fluorescence spectroscopy suggest that the duplex stabilization is a result of pyrene intercalation...

  18. Effect of Monomer Dosing Rate in the Preparation of Mesoporous Polystyrene Nanoparticles by Semicontinuous Heterophase Polymerization

    Directory of Open Access Journals (Sweden)

    Dalia Y. Sosa

    2014-12-01

    Full Text Available The semicontinuous heterophase polymerization of styrene in the presence of cross-linking and porogen agents was carried out. Latexes with close to 20% solid content, which contained mesoporous nanoparticles with 28 nm in average diameters, up to 0.5 cm3/g in porosity and 6–8 nm in pore diameters were obtained. By varying the monomer dosing rate over the micellar solution, an unexpected direct dependence of instantaneous conversion on the monomer dosing rate was found. This was ascribed to the higher average number of radicals per particle attained in the polymerization at the higher dosing rate, which in turn would arise from the higher gel percentage in the polymer. It is believed that the cross-linked chains prevent encounters between radicals, delaying the bimolecular termination reactions and allowing the existence of more than one radical inside the particles, which in turn increases the propagation rate.

  19. Immobilization of enzymes by radiation-induced polymerization of glass-forming monomers

    International Nuclear Information System (INIS)

    Yoshida, M.; Kumakura, M.; Kaetsu, I.

    1979-01-01

    The effect of cooling rate of a monomeric system on the porosity and activity of an immobilized enzyme prepared by radiation-induced polymerization of 2-hydroxyethyl methacrylate at low temperatures has been studied. Slow cooling gave the same effect on porosity of the polymer as decreasing the monomer concentration. A glass-forming solvent such as diethylene glycol was added to water to study the effect of the supercooling tendency of the solvent. Addition of diethylene glycol decreased porosity and also enzymic activity. Water was replaced by the miscible solvent p-dioxane and the immiscible solvent n-decane in order to clarify the effect of solvent. p-Dioxane had a similar effect to water on the relation between the monomer concentration, porosity and activity. On the other hand, polymer prepared from the system containing n-decane showed different immobilization properties owing to the presence of independent pores in the matrix. (author)

  20. Modeling the structure and vibrational spectra for oxouranium dichloride monomer and dimer

    Science.gov (United States)

    Umreiko, D. S.; Shundalau, M. B.; Trubina, O. V.

    2010-11-01

    Structural models are designed and spectral characteristics are computed for the monomer and dimer of the oxouranium dichloride (UOCl2) molecule based on ab initio calculations. The calculations were carried out in the LANL2DZ effective core potential approximation for the uranium atom and all-electron basis sets using DFT methods for oxygen and chlorine atoms (B3LYP/cc-pVDZ). A close-to-planar Y-shaped equilibrium configuration with Cs symmetry is obtained for the UOCl2 monomer. The formation of the dimer is accompanied by both significant changes in the structure of the monomeric fragments and the actual loss of their identities. The obtained spectral characteristics are analyzed and compared with experimental data. The adequacy of the proposed models and qualitative agreement between calculation and experiment are demonstrated.