Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

Directory of Open Access Journals (Sweden)

Jaewoo eBai

2016-04-01

Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

Lineage specific recombination rates and microevolution in Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Nightingale Kendra K

2008-10-01

Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

A resolvase-like protein is requered for the site-specific integration of the temperate lactococcal bacteriophage TP901-1

DEFF Research Database (Denmark)

Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.

1996-01-01

upstream of attP. The N-terminal 150 to 1180 amino acids of Orf1 showed 38 to 44% similarity to the resolvase group of site-specific integrases, while no similarity to know proteins was found in the C-terminal end. Bacteriophage 'TP901-1 therefore contains a unique integration system that does not resemble...... the Int class of site-specific integrases usually found in temperate bacteriophages. The constructed integration vector, pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20% of the transformation efficiency....

Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

Directory of Open Access Journals (Sweden)

Cronin Michael

2008-06-01

Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

Listeria monocytogenes as a vector for anti-cancer therapies.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on the evaluation of the safety and efficacy of ListexTM P100 for the removal of Listeria monocytogenes surface contamination of raw fish

DEFF Research Database (Denmark)

Hald, Tine

Studies evaluating the safety and efficacy of Listex™ P100 to reduce Listeria monocytogenes contamination on raw fish were assessed. The material should not present human toxicological problems because the bacteriophage P100, used as active principle, is not regarded as harmful to consumers nor...

Polymer-based delivery systems for support and delivery of bacteriophages

Science.gov (United States)

Brown, Alyssa Marie

One of the most urgent problems in the fields of medicine and agriculture is the decreasing effectiveness of antibiotics. Once a miracle drug, antibiotics have recently become associated with the creation of antibiotic-resistant bacteria. The main limitations of these treatments include lack of both adaptability and specificity. To overcome these shortcomings of current antibiotic treatments, there has been a renewed interest in bacteriophage research. Bacteriophages are naturally-occurring viruses that lyse bacteria. They are highly specific, with each bacteriophage type lysing a narrow range of bacteria strains. Bacteriophages are also ubiquitous biological entities, populating environments where bacterial growth is supported. Just as humans are exposed to bacteria in their daily lives, we are exposed to bacteriophages as well. To use bacteriophages in practical applications, they must be delivered to the site of an infection in a controlled-release system. Two systems were studied to observe their support of bacteriophage lytic activity, as well as investigate the possibility of controlling bacteriophage release rates. First, hydrogels were studied, using crosslinking and blending techniques to achieve a range of release profiles. Second, polyanhydride microparticles were studied, evaluating release rates as a function of monomer chemistries.

Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

NARCIS (Netherlands)

Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

2014-01-01

To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

Science.gov (United States)

Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

2009-03-01

The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

Propagating the missing bacteriophages: a large bacteriophage in a new class

Directory of Open Access Journals (Sweden)

Hardies Stephen C

2007-02-01

Full Text Available Abstract The number of successful propagations/isolations of soil-borne bacteriophages is small in comparison to the number of bacteriophages observed by microscopy (great plaque count anomaly. As one resolution of the great plaque count anomaly, we use propagation in ultra-dilute agarose gels to isolate a Bacillus thuringiensis bacteriophage with a large head (95 nm in diameter, tail (486 × 26 nm, corkscrew-like tail fibers (187 × 10 nm and genome (221 Kb that cannot be detected by the usual procedures of microbiology. This new bacteriophage, called 0305φ8-36 (first number is month/year of isolation; remaining two numbers identify the host and bacteriophage, has a high dependence of plaque size on the concentration of a supporting agarose gel. Bacteriophage 0305φ8-36 does not propagate in the traditional gels used for bacteriophage plaque formation and also does not produce visible lysis of liquid cultures. Bacteriophage 0305φ8-36 aggregates and, during de novo isolation from the environment, is likely to be invisible to procedures of physical detection that use either filtration or centrifugal pelleting to remove bacteria. Bacteriophage 0305φ8-36 is in a new genomic class, based on genes for both structural components and DNA packaging ATPase. Thus, knowledge of environmental virus diversity is expanded with prospect of greater future expansion.

Cationic antimicrobial peptides inactivate Shiga toxin-encoding bacteriophages

Science.gov (United States)

Del Cogliano, Manuel E.; Hollmann, Axel; Martinez, Melina; Semorile, Liliana; Ghiringhelli, Pablo D.; Maffía, Paulo C.; Bentancor, Leticia V.

2017-12-01

Shiga toxin (Stx) is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC) infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs) are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: 1) direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, 2) cationic properties are necessary but not sufficient for bacteriophage inactivation, and 3) inactivation by cationic peptides could be sequence (or structure) specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

Cationic Antimicrobial Peptides Inactivate Shiga Toxin-Encoding Bacteriophages

Directory of Open Access Journals (Sweden)

Manuel E. Del Cogliano

2017-12-01

Full Text Available Shiga toxin (Stx is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non-alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: (1 direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, (2 cationic properties are necessary but not sufficient for bacteriophage inactivation, and (3 inactivation by cationic peptides could be sequence (or structure specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

Isolation and characterization of specific bacteriophage Va1 to Vibrio alginolyticus

Directory of Open Access Journals (Sweden)

Carla Fernández Espinel

2017-04-01

Full Text Available Vibrio alginolyticus is associated with diseases in aquaculture. The misuse of antibiotics has led to the search for alternatives in the treatment of bacterial diseases, among them the application of bacteriophages that infect and destroy bacteria selectively. In this way, a highly lytic V. alginolyticus bacteriophage, termed Va1, was isolated, with the aim to evaluate its physical chemical parameters. For this purpose, different temperature, pH, chloroform exposure and host range conditions were evaluated. The temperature stability of phage Va1 showed higher titers at 20 and 30 °C decreasing from 40 °C. With respect to pH, the highest titers for the bacteriophage were between 5 and 8, and chloroform exposure reduced viability of the Va1 phage by 25%. The one-step curve determined that the latency period and the burst size were 20 minutes and 192 PFU / infective center respectively. Under the transmission electron microscope, the Va1 phage showed an icosahedral head and a non-contractile tail, belonging to the Podoviridae family. In conclusion, Va1 phage presents potential characteristics for use in phage therapy.

Isolating E.Coli Bacteriophage from Raw Sewage and Determining its Selectivity to the Host Cell

Directory of Open Access Journals (Sweden)

SM Imeni

2016-05-01

Full Text Available Introduction: Bacteriophages are viruses that infect and destroy prokaryote cells, specifically the bacteria. They act too selective, so as each bacteriophage affects only on specific type of bacteria. Due to their specific features, bacteriophages can be used as an appropriate substitute for antibiotics in infectious diseases treatment. Therefore, this study aimed to isolate E. coli-specific bacteriophage from raw sewage. Methods: Eight samples of raw sewage, each containing approximately 50 ml of raw sewage with 10 minute gap, were prepared from Zargandeh wastewater treatment plant, Tehran, Iran. The sewages were mixed with Brain-heart infusion medium (BHI as a liquid culture medium in order to let the microorganisms grow. Incubation, purification and determination of bacteria were followed repeatedly to isolate the bacteriophage. Then it was tested on E.coli (ATCC 25922, Enterococcus faecalis (ATCC 19433, Staphylococcus aureus (ATCC 2392, and Yersinia enterocolitica (ATCC 9610 in order to determine the bacteriophage selectivity. Results: The E.coli bacteriophages were successfully isolated from all the eight samples, that were completely able to lyse and destroy E.coli bacterial cells, though no effect was observed on other types of bacteria. Conclusion: The study findings revealed that bacteriophages act selectively. Considering the raise of antibiotic resistance in the world, bacteriophages can serve as a good substitute for antibiotics in treating infectious diseases.

Bacteriophages and Biofilms

Directory of Open Access Journals (Sweden)

David R. Harper

2014-06-01

Full Text Available Biofilms are an extremely common adaptation, allowing bacteria to colonize hostile environments. They present unique problems for antibiotics and biocides, both due to the nature of the extracellular matrix and to the presence within the biofilm of metabolically inactive persister cells. Such chemicals can be highly effective against planktonic bacterial cells, while being essentially ineffective against biofilms. By contrast, bacteriophages seem to have a greater ability to target this common form of bacterial growth. The high numbers of bacteria present within biofilms actually facilitate the action of bacteriophages by allowing rapid and efficient infection of the host and consequent amplification of the bacteriophage. Bacteriophages also have a number of properties that make biofilms susceptible to their action. They are known to produce (or to be able to induce enzymes that degrade the extracellular matrix. They are also able to infect persister cells, remaining dormant within them, but re-activating when they become metabolically active. Some cultured biofilms also seem better able to support the replication of bacteriophages than comparable planktonic systems. It is perhaps unsurprising that bacteriophages, as the natural predators of bacteria, have the ability to target this common form of bacterial life.

Chlamydial plasmids and bacteriophages.

Science.gov (United States)

Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

2015-01-01

Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

Bacteriophage-based Probiotic Preparation for Managing Shigella Infections

Science.gov (United States)

2015-04-16

The preparation (designated “ShigActive”) is a bacteriophage cocktail that specifically targets Shigella spp. (significant diarrhea-causing pathogens...phages lytic for Shigella , and we have developed a murine model in which the in vivo efficacy of our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND...10-Apr-2013 Approved for Public Release; Distribution Unlimited Final Report: Bacteriophage-based Probiotic Preparation for Managing Shigella

Bacteriophage Infectivity Against Pseudomonas aeruginosa in Saline Conditions

KAUST Repository

Scarascia, Giantommaso

2018-05-02

Pseudomonas aeruginosa is a ubiquitous member of marine biofilm, and reduces thiosulfate to produce toxic hydrogen sulfide gas. In this study, lytic bacteriophages were isolated and applied to inhibit the growth of P. aeruginosa in planktonic mode at different temperature, pH, and salinity. Bacteriophages showed optimal infectivity at a multiplicity of infection of 10 in saline conditions, and demonstrated lytic abilities over all tested temperature (25, 30, 37, and 45°C) and pH 6–9. Planktonic P. aeruginosa exhibited significantly longer lag phase and lower specific growth rates upon exposure to bacteriophages. Bacteriophages were subsequently applied to P. aeruginosa-enriched biofilm and were determined to lower the relative abundance of Pseudomonas-related taxa from 0.17 to 5.58% in controls to 0.01–0.61% in treated microbial communities. The relative abundance of Alphaproteobacteria, Pseudoalteromonas, and Planococcaceae decreased, possibly due to the phage-induced disruption of the biofilm matrix. Lastly, when applied to mitigate biofouling of ultrafiltration membranes, bacteriophages were determined to reduce the transmembrane pressure increase by 18% when utilized alone, and by 49% when used in combination with citric acid. The combined treatment was more effective compared with the citric acid treatment alone, which reported ca. 30% transmembrane pressure reduction. Collectively, the findings demonstrated that bacteriophages can be used as a biocidal agent to mitigate undesirable P. aeruginosa-associated problems in seawater applications.

Recombinant phage probes for Listeria monocytogenes

Science.gov (United States)

Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

2007-10-01

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Toward modern inhalational bacteriophage therapy: nebulization of bacteriophages of Burkholderia cepacia complex.

Science.gov (United States)

Golshahi, Laleh; Seed, Kimberley D; Dennis, Jonathan J; Finlay, Warren H

2008-12-01

Antibiotic-resistant bacterial infections have renewed interest in finding substitute methods of treatment. The purpose of the present in vitro study was to investigate the possibility of respiratory delivery of a Burkholderia cepacia complex (BCC) bacteriophage by nebulized aerosol administration. Bacteriophages in isotonic saline were aerosolized with Pari LC star and eFlow nebulizers, at titers with mean value (standard deviation) of 2.15 x 10(8) (1.63 x 10(8)) plaque-forming unit (PFU)/mL in 2.5-mL nebulizer fills. The breathing pattern of an adult was simulated using a pulmonary waveform generator. During breath simulation, the size distributions of the nebulized aerosol were measured using phase doppler anemometry (PDA). Efficiency of nebulizer delivery was subsequently determined by collection of aerosol on low resistance filters and measurement of bacteriophage titers. These filter titers were used as input data to a mathematical lung deposition model to predict regional deposition of bacteriophages in the lung and initial bacteriophage titers in the liquid surface layer of each conducting airway generation. The results suggest that BCC bacteriophages can be nebulized successfully within a reasonable delivery time and predicted titers in the lung indicate that this method may hold potential for treatment of bacterial lung infections common among cystic fibrosis patients.

Ex vivo and in vivo evaluation of microemulsion based transdermal delivery of E. coli specific T4 bacteriophage: A rationale approach to treat bacterial infection.

Science.gov (United States)

Rastogi, Vaibhav; Yadav, Pragya; Verma, Anurag; Pandit, Jayanta K

2017-09-30

This study is focused on the development and evaluation of transdermal delivery of E. coli-specific T4 bacteriophages both ex-vivo and in-vivo using microemulsion as delivery carrier in eradicating the infection caused by E. coli. Microemulsions were prepared by mixing selected oil, surfactants and aqueous phase containing bacteriophages. The formulations were subjected to physicochemical characterization, ex-vivo and in-vivo permeation, stability studies, histological and immunofluorescence examination. The colloidal system exhibits a uniform size distribution, of finite size (150-320nm). Transmission electron microscopy revealed the encapsulation of bacteriophage in the aqueous globule. Ex-vivo permeation across skin was successfully achieved as 6×10 6 PFU/mL and 6.7×10 6 PFU/mL of T4 permeated from ME 6% and 10%, respectively. ME 6% was found to be thermodynamically stable and in-vivo permeation resulted in 5.49×10 5 PFU/mL of bacteriophages in the blood of the E. coli challenged rats, while 2.48×10 5 PFU/mL was detected in germ free rats, at the end of the study. Infected rats that were treated with bacteriophage were survived while significant mortality was observed in others. Histological and IL-6 immunofluorescence examination of the tissues revealed the efficacy/safety of the therapy. The microemulsion-based transdermal delivery of bacteriophage could be a promising approach to treat the infections caused by antibiotic-resistant bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA Packaging Specificity of Bacteriophage N15 with an Excursion into the Genetics of a Cohesive End Mismatch.

Directory of Open Access Journals (Sweden)

Michael Feiss

Full Text Available During DNA replication by the λ-like bacteriophages, immature concatemeric DNA is produced by rolling circle replication. The concatemers are processed into mature chromosomes with cohesive ends, and packaged into prohead shells, during virion assembly. Cohesive ends are generated by the viral enzyme terminase, which introduces staggered nicks at cos, an approx. 200 bp-long sequence containing subsites cosQ, cosN and cosB. Interactions of cos subsites of immature concatemeric DNA with terminase orchestrate DNA processing and packaging. To initiate DNA packaging, terminase interacts with cosB and nicks cosN. The cohesive ends of N15 DNA differ from those of λ at 2/12 positions. Genetic experiments show that phages with chromosomes containing mismatched cohesive ends are functional. In at least some infections, the cohesive end mismatch persists through cyclization and replication, so that progeny phages of both allelic types are produced in the infected cell. N15 possesses an asymmetric packaging specificity: N15 DNA is not packaged by phages λ or 21, but surprisingly, N15-specific terminase packages λ DNA. Implications for genetic interactions among λ-like bacteriophages are discussed.

Incorporation of Listeria monocytogenes strains in raw milk biofilms.

Science.gov (United States)

Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

2013-02-01

Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

Recombinant phage probes for Listeria monocytogenes

Energy Technology Data Exchange (ETDEWEB)

Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

2007-10-03

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

K. OXYTOCA BACTERIOPHAGES ISOLATION METHODS IMPROVEMENT

Directory of Open Access Journals (Sweden)

G. R. Sadrtdinova

2017-01-01

against the desired species of microorganism. The second stage consisted in a comparative analysis of the indices of cultivation of the isolated phages on standard meat-peptone agar and the proposed medium for isolation of bacteriophages. The main biological properties of the phages studied were also determined: morphology of negative colonies, lytic activity, specificity. The negative colonies formed on the compared media were classified as one type. The lytic activity of the studied phages on meat-peptone agar and Aph medium was the same. According to Grazia 2 × 107 BOE/ml for bacteriophage KO-3 UGSHA, (3–4 × 108BOE/ml for bacteriophage KO-8724 UGSHA. The isolated bacteriophages showed no lytic activity against strains of heterogeneous crops (Escherichia spp., Citrobacter spp., Serratia spp., Hafnia spp., Yersinia spp.. 

[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

Science.gov (United States)

Tian, Jing; Liu, Xiu-mei

2009-09-01

To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

Targeting Antibacterial Agents by Using Drug-Carrying Filamentous Bacteriophages

OpenAIRE

Yacoby, Iftach; Shamis, Marina; Bar, Hagit; Shabat, Doron; Benhar, Itai

2006-01-01

Bacteriophages have been used for more than a century for (unconventional) therapy of bacterial infections, for half a century as tools in genetic research, for 2 decades as tools for discovery of specific target-binding proteins, and for nearly a decade as tools for vaccination or as gene delivery vehicles. Here we present a novel application of filamentous bacteriophages (phages) as targeted drug carriers for the eradication of (pathogenic) bacteria. The phages are genetically modified to d...

Synthetic Biology to Engineer Bacteriophage Genomes.

Science.gov (United States)

Rita Costa, Ana; Milho, Catarina; Azeredo, Joana; Pires, Diana Priscila

2018-01-01

Recent advances in the synthetic biology field have enabled the development of new molecular biology techniques used to build specialized bacteriophages with new functionalities. Bacteriophages have been engineered towards a wide range of applications including pathogen control and detection, targeted drug delivery, or even assembly of new materials.In this chapter, two strategies that have been successfully used to genetically engineer bacteriophage genomes are addressed: a yeast-based platform and bacteriophage recombineering of electroporated DNA.

Fødevarebetinget listeria monocytogenes endokarditis

DEFF Research Database (Denmark)

Frydland, Martin; Bundgaard, Henning; Moser, Claus

2014-01-01

Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

Incorporation of T4 bacteriophage in electrospun fibres.

Science.gov (United States)

Korehei, R; Kadla, J

2013-05-01

Antibacterial food packaging materials, such as bacteriophage-activated electrospun fibrous mats, may address concerns triggered by waves of bacterial food contamination. To address this, we investigated several efficient methods for incorporating T4 bacteriophage into electrospun fibrous mats. The incorporation of T4 bacteriophage using simple suspension electrospinning led to more than five orders of magnitude decrease in bacteriophage activity. To better maintain bacteriophage viability, emulsion electrospinning was developed where the T4 bacteriophage was pre-encapsulated in an alginate reservoir via an emulsification process and subsequently electrospun into fibres. This resulted in an increase in bacteriophage viability, but there was still two orders of magnitude drop in activity. Using a coaxial electrospinning process, full bacteriophage activity could be maintained. In this process, a core/shell fibre structure was formed with the T4 bacteriophage being directly incorporated into the fibre core. The core/shell fibre encapsulated bacteriophage exhibited full bacteriophage viability after storing for several weeks at +4°C. Coaxial electrospinning was shown to be capable of encapsulating bacteriophages with high loading capacity, high viability and long storage time. These results are significant in the context of controlling and preventing bacterial infections in perishable foods during storage. © 2013 The Society for Applied Microbiology.

Replication of bacteriophage lambda DNA

International Nuclear Information System (INIS)

Tsurimoto, T.; Matsubara, K.

1983-01-01

In this paper results of studies on the mechanism of bacteriophage lambda replication using molecular biological and biochemical approaches are reported. The purification of the initiator proteins, O and P, and the role of the O and P proteins in the initiation of lambda DNA replication through interactions with specific DNA sequences are described. 47 references, 15 figures

Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

Directory of Open Access Journals (Sweden)

Qi Zhu

2017-03-01

Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

Bacteriophage cocktail for biocontrol of Salmonella in dried pet food.

Science.gov (United States)

Heyse, Serena; Hanna, Leigh Farris; Woolston, Joelle; Sulakvelidze, Alexander; Charbonneau, Duane

2015-01-01

Human salmonellosis has been associated with contaminated pet foods and treats. Therefore, there is interest in identifying novel approaches for reducing the risk of Salmonella contamination within pet food manufacturing environments. The use of lytic bacteriophages shows promise as a safe and effective way to mitigate Salmonella contamination in various food products. Bacteriophages are safe, natural, highly targeted antibacterial agents that specifically kill bacteria and can be targeted to kill food pathogens without affecting other microbiota. In this study, we show that a cocktail containing six bacteriophages had a broadspectrum activity in vitro against a library of 930 Salmonella enterica strains representing 44 known serovars. The cocktail was effective against 95% of the strains in this tested library. In liquid culture dose-ranging experiments, bacteriophage cocktail concentrations of ≥10(8) PFU/ml inactivated more than 90% of the Salmonella population (10(1) to 10(3) CFU/ml). Dried pet food inoculated with a mixture containing equal proportions of Salmonella serovars Enteritidis (ATCC 4931), Montevideo (ATCC 8387), Senftenberg (ATCC 8400), and Typhimurium (ATCC 13311) and then surface treated with the six-bacteriophage cocktail (≥2.5 ± 1.5 × 10(6) PFU/g) achieved a greater than 1-log (P contamination in samples taken from an undistributed lot of commercial dried dog food that tested positive for Salmonella. Our results indicate that bacteriophage biocontrol of S. enterica in dried pet food is technically feasible.

Occurrence and numbers of bacteriophages and bacterial indicators in faeces of yellow-legged seagull (Larus cachinnans).

Science.gov (United States)

Muniesa, M; Jofre, J; Lucena, F

1999-12-01

Faeces from feral populations of yellow-legged seagulls from the northern coastal area of Catalonia (North-eastern Spain) contained variable amounts of faecal coliforms, faecal streptococci, somatic coliphages, F-specific bacteriophages and Bacteroides fragilis bacteriophages. Occurrence and numbers of bacterial indicators and bacteriophages in the faeces of yellow-legged seagulls are in the ranges described in the faeces of different animals. The ratios between numbers of bacterial indicators and numbers of bacteriophages are much higher in faeces of seagulls than in treated or raw sewage contributed by out-falls of the same area.

Identification of the origin of faecal contamination in estuarine oysters using Bacteroidales and F-specific RNA bacteriophage markers.

Science.gov (United States)

Mieszkin, S; Caprais, M P; Le Mennec, C; Le Goff, M; Edge, T A; Gourmelon, M

2013-09-01

The aim of this study was to identify the origin of faecal pollution impacting the Elorn estuary (Brittany, France) by applying microbial source tracking (MST) markers in both oysters and estuarine waters. The MST markers used were as follows: (i) human-, ruminant- and pig-associated Bacteroidales markers by real-time PCR and (ii) human genogroup II and animal genogroup I of F-specific RNA bacteriophages (FRNAPH) by culture/genotyping and by direct real-time reverse-transcriptase PCR. The higher occurrence of the human genogroup II of F-specific RNA bacteriophages using a culture/genotyping method, and human-associated Bacteroidales marker by real-time PCR, allowed the identification of human faecal contamination as the predominant source of contamination in oysters (total of 18 oyster batches tested) and waters (total of 24 water samples tested). The importance of using the intravalvular liquids instead of digestive tissues, when applying host-associated Bacteroidales markers in oysters, was also revealed. This study has shown that the application of a MST toolbox of diverse bacterial and viral methods can provide multiple lines of evidence to identify the predominant source of faecal contamination in shellfish from an estuarine environment. Application of this MST toolbox is a useful approach to understand the origin of faecal contamination in shellfish harvesting areas in an estuarine setting. © 2013 The Society for Applied Microbiology.

Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

Science.gov (United States)

Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

2010-08-01

Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

Comparison of the cleavage of pyrimidine dimers by the bacteriophage T4 and Micrococcus luteus uv-specific endonucleases

International Nuclear Information System (INIS)

Gordon, L.K.; Haseltine, W.A.

1980-01-01

A comparison was made of the activity of the uv-specific endonucleases of bacteriophage T4 (T4 endonuclease V) and of Micrococcus luteus on ultraviolet light-irradiated DNA substrates of defined sequence. The two enzyms cleave DNA at the site of pyrimidine dimers with the same frequency. The products of the cleavage reaction are the same. The pyrimidine dimer DNA-glycosylase activity of both enzymes is more active on double-stranded DNA than it is on single-stranded DNA

Methods for generation of reporter phages and immobilization of active bacteriophages on a polymer surface

Science.gov (United States)

Morgan, Mark Thomas (Inventor); Kothapalli, Aparna (Inventor); Applegate, Bruce Michael (Inventor); Perry, Lynda Louise (Inventor)

2012-01-01

Novel reporter bacteriophages are provided. Provided are compositions and methods that allow bacteriophages that are used for specific detection or killing of E. coli 0157:H7 to be propagated in nonpathogenic E. coli, thereby eliminating the safety and security risks of propagation in E. coli 0157:H7. Provided are compositions and methods for attaching active bacteriophages to the surface of a polymer in order to kill target bacteria with which the phage comes into contact. Provided are modified bacteriophages immobilized to a surface, which capture E. coli 0157:H7 and cause the captured cells to emit light or fluorescence, allowing detection of the bacteria in a sample.

Silk Route to the Acceptance and Re-Implementation of Bacteriophage Therapy—Part II

Directory of Open Access Journals (Sweden)

Expert round table on acceptance and re-implementation of bacteriophage therapy

2018-04-01

Full Text Available This perspective paper follows up on earlier communications on bacteriophage therapy that we wrote as a multidisciplinary and intercontinental expert-panel when we first met at a bacteriophage conference hosted by the Eliava Institute in Tbilisi, Georgia in 2015. In the context of a society that is confronted with an ever-increasing number of antibiotic-resistant bacteria, we build on the previously made recommendations and specifically address how the Nagoya Protocol might impact the further development of bacteriophage therapy. By reviewing a number of recently conducted case studies with bacteriophages involving patients with bacterial infections that could no longer be successfully treated by regular antibiotic therapy, we again stress the urgency and significance of the development of international guidelines and frameworks that might facilitate the legal and effective application of bacteriophage therapy by physicians and the receiving patients. Additionally, we list and comment on several recently started and ongoing clinical studies, including highly desired double-blind placebo-controlled randomized clinical trials. We conclude with an outlook on how recently developed DNA editing technologies are expected to further control and enhance the efficient application of bacteriophages.

Antibacterial Efficacy of Lytic Bacteriophages against Antibiotic-Resistant Klebsiella Species

Directory of Open Access Journals (Sweden)

M. Khajeh Karamoddini

2011-01-01

Full Text Available Bacterial resistance to antibiotics is a leading and highly prevalent problem in the treatment of infectious diseases. Bacteriophages (phages appear to be effective and safe alternatives for the treatment of resistant infections because of their specificity for bacterial species and lack of infectivity in eukaryotic cells. The present study aimed to isolate bacteriophages against Klebsiella spp. and evaluate their efficacy against antibiotic-resistant species. Seventy-two antibiotic-resistant Klebsiella spp. were isolated from samples of patients who referred to the Ghaem Hospital (Mashhad, Iran. Lytic bacteriophages against Klebsiella spp. were isolated from wastewater of the septic tank of the same hospital. Bactericidal activity of phages against resistant Klebsiella spp. was tested in both liquid (tube method; after 1 and 24 h of incubation and solid (double-layer agar plate method; after 24 h of incubation phases. In each method, three different concentrations of bacteriophages (low: 107 PFU/mL were used. Bacteriophages showed promising bactericidal activity at all assessed concentrations, regardless of the test method and duration of incubation. Overall, bactericidal effects were augmented at higher concentrations. In the tube method, higher activity was observed after 24 h of incubation compared to the 1-h incubation. The bactericidal effects were also higher in the tube method compared to the double-layer agar plate method after 24 h of incubation. The findings of the present study suggest that bacteriophages possess effective bactericidal activity against resistant Klebsiella spp. These bactericidal activities are influenced by phage concentration, duration of incubation, and test method.

Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

Science.gov (United States)

Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

2012-06-01

The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

Science.gov (United States)

Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

2014-01-02

An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

Multiple roles of genome-attached bacteriophage terminal proteins

International Nuclear Information System (INIS)

Redrejo-Rodríguez, Modesto; Salas, Margarita

2014-01-01

Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer

Multiple roles of genome-attached bacteriophage terminal proteins

Energy Technology Data Exchange (ETDEWEB)

Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

2014-11-15

Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.

Occurrence of male-specific bacteriophage in feral and domestic animal wastes, human feces, and human-associated wastewaters.

Science.gov (United States)

Calci, K R; Burkhardt, W; Watkins, W D; Rippey, S R

1998-12-01

Male-specific bacteriophage (MSB) densities were determined in animal and human fecal wastes to assess their potential impact on aquatic environments. Fecal samples (1,031) from cattle, chickens, dairy cows, dogs, ducks, geese, goats, hogs, horses, seagulls, sheep, and humans as well as 64 sewerage samples were examined for MSB. All animal species were found to harbor MSB, although the great majority excreted these viruses at very low levels. The results from this study demonstrate that in areas affected by both human and animal wastes, wastewater treatment plants are the principal contributors of MSB to fresh, estuarine, and marine waters.

Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1

DEFF Research Database (Denmark)

Brøndsted, Lone; Hammer, Karin

1999-01-01

Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...

Genomics of three new bacteriophages useful in the biocontrol of Salmonella

Directory of Open Access Journals (Sweden)

Carlota eBardina

2016-04-01

Full Text Available Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87 able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs; 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic

Sequence specificity of mutagenesis in the cI gene of bacteriophage lambda

International Nuclear Information System (INIS)

Skopek, T.R.; Wood, R.D.; Hutchinson, F.

1985-01-01

Studies of DNA base sequence alterations have shown that for every agent the mutagenic process is specific with respect to the types of base changes induced and the location of the changes in the DNA. Analysis of the types of mutations produced by mutagenic agents can provide insight into the mechanism of mutation and can suggest which DNA lesions may be involved in the actual mutagenic event. We have developed a system for the analysis of chemically induced base sequence alterations in the cI repressor gene of bacteriophage lambda using DNA sequencing techniques. To illustrate the utility of this type of analysis, we present the results obtained with ultraviolet light (UV). Irradiation of target DNA with UV alone, or UV followed by photoreactivating light (which removes dimers), produces mostly transitions at pyrimidine-pyrimidine sites. Conversely, irradiation with 313 nm light plus acetophenone (which produces only thymine dimers) produces mostly transversions at low efficiency. This and other evidence suggests that the actual premutagenic UV lesion in E. coli may not be pyrimidine-pyrimidine dimers, but rather pyr(6-4)pyo photoproducts

[Bacteriophages in the battle against multidrug resistant bacteria

NARCIS (Netherlands)

Meer, J.W.M. van der; Vandenbroucke-Grauls, C.

2018-01-01

Bacteriophages are viruses that infect bacteria. They are highly specific for a bacterial species. The so-called 'lytic phages' can lyse bacteria when they infect them; these phages can be used to treat bacterial infections. Despite a century of experience with phage therapy, the evidence for

Molecular studies on bacteriophage endolysins and their potential to control gram-negative bacteria

OpenAIRE

Oliveira, Hugo Alexandre Mendes

2014-01-01

Thesis for PhD degree in Chemical and Biological Engineeering Bacteriophages are viruses that specifically infect bacterial hosts to reproduce. At the end of the infection cycle, progeny virions are confronted with a rigid cell wall that impedes their release into the environment. Consequently, bacteriophages encode hydrolytic enzymes, called endolysins, to digest the peptidoglycan and cause bacteriolysis. In contrast to their extensively studied counterparts, active against Gram-positi...

Yersinia enterocolitica-Specific Infection by Bacteriophages TG1 and ϕR1-RT Is Dependent on Temperature-Regulated Expression of the Phage Host Receptor OmpF.

Science.gov (United States)

Leon-Velarde, Carlos G; Happonen, Lotta; Pajunen, Maria; Leskinen, Katarzyna; Kropinski, Andrew M; Mattinen, Laura; Rajtor, Monika; Zur, Joanna; Smith, Darren; Chen, Shu; Nawaz, Ayesha; Johnson, Roger P; Odumeru, Joseph A; Griffiths, Mansel W; Skurnik, Mikael

2016-09-01

Bacteriophages present huge potential both as a resource for developing novel tools for bacterial diagnostics and for use in phage therapy. This potential is also valid for bacteriophages specific for Yersinia enterocolitica To increase our knowledge of Y. enterocolitica-specific phages, we characterized two novel yersiniophages. The genomes of the bacteriophages vB_YenM_TG1 (TG1) and vB_YenM_ϕR1-RT (ϕR1-RT), isolated from pig manure in Canada and from sewage in Finland, consist of linear double-stranded DNA of 162,101 and 168,809 bp, respectively. Their genomes comprise 262 putative coding sequences and 4 tRNA genes and share 91% overall nucleotide identity. Based on phylogenetic analyses of their whole-genome sequences and large terminase subunit protein sequences, a genus named Tg1virus within the family Myoviridae is proposed, with TG1 and ϕR1-RT (R1RT in the ICTV database) as member species. These bacteriophages exhibit a host range restricted to Y. enterocolitica and display lytic activity against the epidemiologically significant serotypes O:3, O:5,27, and O:9 at and below 25°C. Adsorption analyses of lipopolysaccharide (LPS) and OmpF mutants demonstrate that these phages use both the LPS inner core heptosyl residues and the outer membrane protein OmpF as phage receptors. Based on RNA sequencing and quantitative proteomics, we also demonstrate that temperature-dependent infection is due to strong repression of OmpF at 37°C. In addition, ϕR1-RT was shown to be able to enter into a pseudolysogenic state. Together, this work provides further insight into phage-host cell interactions by highlighting the importance of understanding underlying factors which may affect the abundance of phage host receptors on the cell surface. Only a small number of bacteriophages infecting Y. enterocolitica, the predominant causative agent of yersiniosis, have been previously described. Here, two newly isolated Y. enterocolitica phages were studied in detail, with the aim of

COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

Directory of Open Access Journals (Sweden)

G. Tantillo

2013-02-01

Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

DEFF Research Database (Denmark)

Harmsen, Morten; Lappann, Martin; Knøchel, S

2010-01-01

(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

Contribution of hydrological data to the understanding of the spatio-temporal dynamics of F-specific RNA bacteriophages in river water during rainfall-runoff events.

Science.gov (United States)

Fauvel, Blandine; Cauchie, Henry-Michel; Gantzer, Christophe; Ogorzaly, Leslie

2016-05-01

Heavy rainfall events were previously reported to bring large amounts of microorganisms in surface water, including viruses. However, little information is available on the origin and transport of viral particles in water during such rain events. In this study, an integrative approach combining microbiological and hydrological measurements was investigated to appreciate the dynamics and origins of F-specific RNA bacteriophage fluxes during two distinct rainfall-runoff events. A high frequency sampling (automatic sampler) was set up to monitor the F-specific RNA bacteriophages fluxes at a fine temporal scale during the whole course of the rainfall-runoff events. A total of 276 rainfall-runoff samples were collected and analysed using both infectivity and RT-qPCR assays. The results highlight an increase of 2.5 log10 and 1.8 log10 of infectious F-specific RNA bacteriophage fluxes in parallel of an increase of the water flow levels for both events. Faecal pollution was characterised as being mainly from anthropic origin with a significant flux of phage particles belonging to the genogroup II. At the temporal scale, two successive distinct waves of phage pollution were established and identified through the hydrological measurements. The first arrival of phages in the water column was likely to be linked to the resuspension of riverbed sediments that was responsible for a high input of genogroup II. Surface runoff contributed further to the second input of phages, and more particularly of genogroup I. In addition, an important contribution of infectious phage particles has been highlighted. These findings imply the existence of a close relationship between the risk for human health and the viral contamination of flood water. Copyright © 2016 Luxembourg institute of Science and Technology. Published by Elsevier Ltd.. All rights reserved.

Bacteriophages

International Nuclear Information System (INIS)

Klieve, A.V.

2005-01-01

Bacteriophages or phages are bacterial viruses and are present in the rumen in large numbers. They are obligate pathogens of bacteria and are ubiquitous to the rumen ecosystem. Bacteriophages are capable of lysing their bacterial hosts within the rumen and are therefore regarded as contributing to protein recycling within the rumen, a process identified as reducing the efficiency of feed utilization. However, their presence may not be entirely detrimental to the ecosystem, and it has been argued that phages may also be involved in the maintenance of a balanced ecosystem and may play a role in recycling limiting nutrients within the rumen. Furthermore, phage therapy is enjoying a renaissance and the use of phages to control or eliminate detrimental or unwanted microbes from the gastro-intestinal tract, such as Shiga-toxin producing E. coli (food-borne disease), Streptococcus bovis (acidosis in grain-fed cattle) and methanogens (produce the greenhouse gas methane), is the focus of current investigation. In order to be able to study the interaction between individual bacteriophages and their bacterial hosts, it is necessary to: (a) isolate the phage of interest from other viruses in the source material; (b) to derive stock cultures of known phage concentration; (c) store the isolated phages; and (d) determine basic physical characteristics, such as morphology. These procedures are achieved using classical microbiological procedures and this will be the methodology described in this chapter. It is also necessary to determine nucleic acid characteristics of the phage genome and to fingerprint the phage population in the rumen using molecular biological techniques. These will be described and discussed in Chapter 4.2

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

Analysis of the complete DNA sequence of the temperate bacteriophage TP901-1: Evolution, structure, and genome organization of lactococcal bacteriophages

DEFF Research Database (Denmark)

Brøndsted, Lone; Østergaard, Solvej; Pedersen, Margit

2001-01-01

A complete analysis of the entire genome of the temperate lactococcal bacteriophage TP901-1 has been performed and the function of 21 of 56 TP901-1-encoded ORFs has been assigned. This knowledge has been used to propose 10 functional modules each responsible for specific functions during...

First Trimester Listeria monocytogenes Septicemia

NARCIS (Netherlands)

Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

1997-01-01

Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

Bacteriophage therapy for safeguarding animal and human health: a review.

Science.gov (United States)

Tiwari, Ruchi; Dhama, Kuldeep; Kumar, Amit; Rahal, Anu; Kapoor, Sanjay

2014-02-01

Since the discovery of bacteriophages at the beginning of the 19th century their contribution to bacterial evolution and ecology and use in a variety of applications in biotechnology and medicine has been recognized and understood. Bacteriophages are natural bacterial killers, proven as best biocontrol agents due to their ability to lyse host bacterial cells specifically thereby helping in disease prevention and control. The requirement of such therapeutic approach is straight away required in view of the global emergence of Multidrug Resistant (MDR) strains of bacteria and rapidly developing resistance to antibiotics in both animals and humans along with increasing food safety concerns including of residual antibiotic toxicities. Phage typing is a popular tool to differentiate bacterial isolates and to identify and characterize outbreak-associated strains of Salmonella, Campylobacter, Escherichia and Listeria. Numerous methods viz. plaque morphology, ultracentrifugation in the density gradient of CsCl2, and random amplified polymorphic DNA (RAPD) have been found to be effective in detection of various phages. Bacteriophages have been isolated and recovered from samples of animal waste products of different livestock farms. High titer cocktails of broad spectrum lytic bacteriophages are usually used for clinical trial for assessing their therapeutic efficacy against antibiotic unresponsive infections in different animals. Bacteriophage therapy also helps to fight various bacterial infections of poultry viz. colibacillosis, salmonellosis and listeriosis. Moreover, the utility of phages concerning biosafety has raised the importance to explore and popularize the therapeutic dimension of this promising novel therapy which forms the topic of discussion of the present review.

Pulmonary bacteriophage therapy on Pseudomonas aeruginosa cystic fibrosis strains: first steps towards treatment and prevention.

Directory of Open Access Journals (Sweden)

Eric Morello

Full Text Available Multidrug-resistant bacteria are the cause of an increasing number of deadly pulmonary infections. Because there is currently a paucity of novel antibiotics, phage therapy--the use of specific viruses that infect bacteria--is now more frequently being considered as a potential treatment for bacterial infections. Using a mouse lung-infection model caused by a multidrug resistant Pseudomonas aeruginosa mucoid strain isolated from a cystic fibrosis patient, we evaluated bacteriophage treatments. New bacteriophages were isolated from environmental samples and characterized. Bacteria and bacteriophages were applied intranasally to the immunocompetent mice. Survival was monitored and bronchoalveolar fluids were analysed. Quantification of bacteria, bacteriophages, pro-inflammatory and cytotoxicity markers, as well as histology and immunohistochemistry analyses were performed. A curative treatment (one single dose administrated 2 h after the onset of the infection allowed over 95% survival. A four-day preventive treatment (one single dose resulted in a 100% survival. All of the parameters measured correlated with the efficacy of both curative and preventive bacteriophage treatments. We also showed that in vitro optimization of a bacteriophage towards a clinical strain improved both its efficacy on in vivo treatments and its host range on a panel of 20 P. aeruginosa cystic fibrosis strains. This work provides an incentive to develop clinical studies on pulmonary bacteriophage therapy to combat multidrug-resistant lung infections.

Listeria monocytogenes, a down-to-earth pathogen.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

2013-01-01

Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

Direct Quantitative Detection and Identification of Lactococcal Bacteriophages from Milk and Whey by Real-Time PCR: Application for the Detection of Lactococcal Bacteriophages in Goat's Raw Milk Whey in France

Directory of Open Access Journals (Sweden)

Mai Huong Ly-Chatain

2011-01-01

Full Text Available The presence of Lactococcus bacteriophages in milk can partly or completely inhibit milk fermentation. To prevent the problems associated with the bacteriophages, the real-time PCR was developed in this study for direct detection from whey and milk of three main groups of Lactococcus bacteriophages, c2, 936, and P335. The optimization of DNA extraction protocol from complex matrices such as whey and milk was optimized allowed the amplification of PCR without any matrix and nontarget contaminant interference. The real-time PCR program was specific and with the detection limit of 102 PFU/mL. The curve slopes were −3.49, −3.69, and −3.45 with the amplification efficiency estimated at 94%, 94%, and 98% and the correlation coefficient (2 of 0.999, 0.999, and 0.998 for c2, 936 and P335 group, respectively. This method was then used to detect the bacteriophages in whey and goat's raw milk coming from three farms located in the Rhône-Alpes region (France.

An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

Science.gov (United States)

Valderrama, Wladir B; Cutter, Catherine N

2013-01-01

Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

Guidelines for Bacteriophage Product Certification.

Science.gov (United States)

Fauconnier, Alan

2018-01-01

Following decades in the wilderness, bacteriophage therapy is now appearing as a credible antimicrobial strategy. However, this reemerging therapy does not rekindle without raising sensitive regulatory concerns. Indeed, whereas the European regulatory framework has been basically implemented to tackle ready-to-use pharmaceuticals produced on a large scale, bacteriophage therapy relies on a dynamic approach requiring a regulation on personalized medicine, nonexistent at present. Because of this, no guideline are currently available for addressing the scientific and regulatory issues specifically related to phage therapy medicinal products (PTMP).Pending to the implementation of an appropriate regulatory framework and to the development of ensuing guidelines, several avenues which might lead to PTMP regulatory compliance are explored here. Insights might come from the multi-strain dossier approach set up for particular animal vaccines, from the homologous group concept developed for the allergen products or from the licensing process for veterinary autogenous vaccines. Depending on national legislations, customized preparations prescribed as magistral formulas or to be used on a named-patient basis are possible regulatory approaches to be considered. However, these schemes are not optimal and should thus be regarded as transitional.

Encapsulation Strategies of Bacteriophage (Felix O1) for Oral Therapeutic Application.

Science.gov (United States)

Islam, Golam S; Wang, Qi; Sabour, Parviz M

2018-01-01

Due to emerging antibiotic-resistant strains among the pathogens, a variety of strategies, including therapeutic application of bacteriophages, have been suggested as a possible alternative to antibiotics in food animal production. As pathogen-specific biocontrol agents, bacteriophages are being studied intensively. Primarily their applications in the food industry and animal production have been recognized in the USA and Europe, for pathogens including Salmonella, Campylobacter, Escherichia coli, and Listeria. However, the viability of orally administered phage may rapidly reduce under the harsh acidic conditions of the stomach, presence of enzymes and bile. It is evident that bacteriophages, intended for phage therapy by oral administration, require efficient protection from the acidic environment of the stomach and should remain active in the animal's gastrointestinal tract where pathogen colonizes. Encapsulation of phages by spray drying or extrusion methods can protect phages from the simulated hostile gut conditions and help controlled release of phages to the digestive system when appropriate formulation strategy is implemented.

Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

Science.gov (United States)

del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

2007-02-01

Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

Science.gov (United States)

Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

2016-01-01

ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

Science.gov (United States)

Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

2016-11-01

A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

Directory of Open Access Journals (Sweden)

V. López

2006-12-01

Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

Directory of Open Access Journals (Sweden)

Moutong eChen

2015-09-01

Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

Bacteria vs. bacteriophages: parallel evolution of immune arsenals

Directory of Open Access Journals (Sweden)

Muhammad Abu Bakr Shabbir

2016-08-01

Full Text Available Bacteriophages are the most common entities on earth and represent a constant challenge to bacterial populations. To fend off bacteriophage infection, bacteria evolved immune systems to avert phage adsorption and block invader DNA entry. They developed restriction-modification systems and mechanisms to abort infection and interfere with virion assembly, as well as newly recognized clustered regularly interspaced short palindromic repeats (CRISPR. In response to bacterial immune systems, bacteriophages synchronously evolved resistance mechanisms, such as the anti-CRISPR systems to counterattack bacterial CRISPR-cas systems, in a continuing evolutionary arms race between virus and host. In turn, it is fundamental to the survival of the bacterial cell to evolve a system to combat bacteriophage immune strategies.

An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

Directory of Open Access Journals (Sweden)

Jodi Woan-Fei Law

2015-11-01

Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

DEFF Research Database (Denmark)

Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

2014-01-01

Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

Effect of HZE particles and space hadrons on bacteriophages

International Nuclear Information System (INIS)

Iurov, S.S.; Akoev, I.G.; Leonteva, G.A.

1983-01-01

The effects of particle radiation of the type encountered in space flight on bacteriophages are investigated. Survival and mutagenesis were followed in dry film cultures or liquid suspensions of T4Br(+) bacteriophage exposed to high-energy (HZE) particles during orbital flight, to alpha particles and accelerator-generated hardrons in the laboratory, and to high-energy cosmic rays at mountain altitudes. The HZE particles and high-energy hadrons are found to have a greater relative biological efficiency than standard gamma radiation, while exhibiting a highly inhomogeneous spatial structure in the observed biological and genetic effects. In addition, the genetic lesions observed are specific to the type of radiation exposure, consisting primarily of deletions and multiple lesions of low revertability, with mode of action depending on the linear energy transfer. 18 references

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

STORAGESEVER

2008-09-03

Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

Directory of Open Access Journals (Sweden)

Emmanuel Okpo

2015-11-01

Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

Listeria monocytogenes infection in pregnancy and neonatal sepsis

Directory of Open Access Journals (Sweden)

Francesca Pascale

2008-06-01

Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

Science.gov (United States)

Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

2017-09-01

Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

Science.gov (United States)

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

Listeria monocytogenes - Danger for health safety vegetable production.

Science.gov (United States)

Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

2018-04-22

The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-02-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-10-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Biofilm Formation of Listeria monocytogenes on Various Surfaces

Directory of Open Access Journals (Sweden)

M Mahdavi

2007-10-01

Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

Science.gov (United States)

Vojkovska, H; Kubikova, I; Kralik, P

2015-03-01

Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

Bacteriophages: the possible solution to treat infections caused by pathogenic bacteria.

Science.gov (United States)

El-Shibiny, Ayman; El-Sahhar, Salma

2017-11-01

Since their discovery in 1915, bacteriophages have been used to treat bacterial infections in animals and humans because of their unique ability to infect their specific bacterial hosts without affecting other bacterial populations. The research carried out in this field throughout the 20th century, largely in Georgia, part of USSR and Poland, led to the establishment of phage therapy protocols. However, the discovery of penicillin and sulfonamide antibiotics in the Western World during the 1930s was a setback in the advancement of phage therapy. The misuse of antibiotics has reduced their efficacy in controlling pathogens and has led to an increase in the number of antibiotic-resistant bacteria. As an alternative to antibiotics, bacteriophages have become a topic of interest with the emergence of multidrug-resistant bacteria, which are a threat to public health. Recent studies have indicated that bacteriophages can be used indirectly to detect pathogenic bacteria or directly as biocontrol agents. Moreover, they can be used to develop new molecules for clinical applications, vaccine production, drug design, and in the nanomedicine field via phage display.

A simple and novel modification of comet assay for determination of bacteriophage mediated bacterial cell lysis.

Science.gov (United States)

Khairnar, Krishna; Sanmukh, Swapnil; Chandekar, Rajshree; Paunikar, Waman

2014-07-01

The comet assay is the widely used method for in vitro toxicity testing which is also an alternative to the use of animal models for in vivo testing. Since, its inception in 1984 by Ostling and Johansson, it is being modified frequently for a wide range of application. In spite of its wide applicability, unfortunately there is no report of its application in bacteriophages research. In this study, a novel application of comet assay for the detection of bacteriophage mediated bacterial cell lysis was described. The conventional methods in bacteriophage research for studying bacterial lysis by bacteriophages are plaque assay method. It is time consuming, laborious and costly. The lytic activity of bacteriophage devours the bacterial cell which results in the release of bacterial genomic material that gets detected by ethidium bromide staining method by the comet assay protocol. The objective of this study was to compare efficacy of comet assay with different assay used to study phage mediated bacterial lysis. The assay was performed on culture isolates (N=80 studies), modified comet assay appear to have relatively higher sensitivity and specificity than other assay. The results of the study showed that the application of comet assay can be an economical, time saving and less laborious alternative to conventional plaque assay for the detection of bacteriophage mediated bacterial cell lysis. Copyright © 2014 Elsevier B.V. All rights reserved.

78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

Science.gov (United States)

2013-05-13

... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

Directory of Open Access Journals (Sweden)

Domenico Meloni

2015-03-01

Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

Science.gov (United States)

Meloni, Domenico

2015-03-12

The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

The Listeria monocytogenes Bile Stimulon under Acidic Conditions Is Characterized by Strain-Specific Patterns and the Upregulation of Motility, Cell Wall Modification Functions, and the PrfA Regulon

Science.gov (United States)

Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.

2018-01-01

Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736

Bacteriophages as indicators of faecal pollution and enteric virus removal.

Science.gov (United States)

McMinn, B R; Ashbolt, N J; Korajkic, A

2017-07-01

Bacteriophages are an attractive alternative to faecal indicator bacteria (FIB), particularly as surrogates of enteric virus fate and transport, due to their closer morphological and biological properties. Based on a review of published data, we summarize densities of coliphages (F+ and somatic), Bacteroides spp. and enterococci bacteriophages (phages) in individual human waste, raw wastewater, ambient fresh and marine waters and removal through wastewater treatment processes utilizing traditional treatments. We also provide comparisons with FIB and enteric viruses whenever possible. Lastly, we examine fate and transport characteristics in the aquatic environment and provide an overview of the environmental factors affecting their survival. In summary, concentrations of bacteriophages in various sources were consistently lower than FIB, but more reflective of infectious enteric virus levels. Overall, our investigation indicates that bacteriophages may be adequate viral surrogates, especially in built systems, such as wastewater treatment plants. Bacteriophage are alternative fecal indicators that may be better surrogates for viral pathogens than fecal indicator bacteria (FIB). This report offers a summary of the existing literature concerning the utility of bacteriophage as indicators of viral presence (fecal sources and surface waters) and persistence (in built infrastructure and aquatic environments). Our findings indicate that bacteriophage levels in all matrices examined are consistently lower than FIB, but similar to viral pathogens. Furthermore, in built infrastructure (e.g. wastewater treatment systems) bacteriophage closely mimic viral pathogen persistence suggesting they may be adequate sentinels of enteric virus removal. © 2017 The Society for Applied Microbiology.

Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

DEFF Research Database (Denmark)

Jørgensen, Lasse Vigel; Huss, Hans Henrik

1998-01-01

Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

Listeria monocytogenes endophthalmitis following keratoconjunctivitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2014-01-01

Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

Directory of Open Access Journals (Sweden)

Jin-Qiang Chen

2017-09-01

Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

Science.gov (United States)

Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

2018-05-20

Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

Isolation of lytic bacteriophage against Vibrio harveyi.

Science.gov (United States)

Crothers-Stomps, C; Høj, L; Bourne, D G; Hall, M R; Owens, L

2010-05-01

The isolation of lytic bacteriophage of Vibrio harveyi with potential for phage therapy of bacterial pathogens of phyllosoma larvae from the tropical rock lobster Panulirus ornatus. Water samples from discharge channels and grow-out ponds of a prawn farm in northeastern Australia were enriched for 24 h in a broth containing four V. harveyi strains. The bacteriophage-enriched filtrates were spotted onto bacterial lawns demonstrating that the bacteriophage host range for the samples included strains of V. harveyi, Vibrio campbellii, Vibrio rotiferianus, Vibrio parahaemolyticus and Vibrio proteolyticus. Bacteriophage were isolated from eight enriched samples through triple plaque purification. The host range of purified phage included V. harveyi, V. campbellii, V. rotiferianus and V. parahaemolyticus. Transmission electron microscope examination revealed that six purified phage belonged to the family Siphoviridae, whilst two belonged to the family Myoviridae. The Myoviridae appeared to induce bacteriocin production in a limited number of host bacterial strains, suggesting that they were lysogenic rather than lytic. A purified Siphoviridae phage could delay the entry of a broth culture of V. harveyi strain 12 into exponential growth, but could not prevent the overall growth of the bacterial strain. Bacteriophage with lytic activity against V. harveyi were isolated from prawn farm samples. Purified phage of the family Siphoviridae had a clear lytic ability and no apparent transducing properties, indicating they are appropriate for phage therapy. Phage resistance is potentially a major constraint to the use of phage therapy in aquaculture as bacteria are not completely eliminated. Phage therapy is emerging as a potential antibacterial agent that can be used to control pathogenic bacteria in aquaculture systems. The development of phage therapy for aquaculture requires initial isolation and determination of the bacteriophage host range, with subsequent creation of

Sequence and comparative analysis of Leuconostoc dairy bacteriophages

DEFF Research Database (Denmark)

Kot, Witold; Hansen, Lars Henrik; Neve, Horst

2014-01-01

Bacteriophages attacking Leuconostoc species may significantly influence the quality of the final product. There is however limited knowledge of this group of phages in the literature. We have determined the complete genome sequences of nine Leuconostoc bacteriophages virulent to either Leuconostoc...

Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

Directory of Open Access Journals (Sweden)

Michela Ibba

2013-09-01

Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

Bacteriophages of Yersinia pestis.

Science.gov (United States)

Zhao, Xiangna; Skurnik, Mikael

2016-01-01

Bacteriophage play many varied roles in microbial ecology and evolution. This chapter collates a vast body of knowledge and expertise on Yersinia pestis phages, including the history of their isolation and classical methods for their isolation and identification. The genomic diversity of Y. pestis phage and bacteriophage islands in the Y. pestis genome are also discussed because all phage research represents a branch of genetics. In addition, our knowledge of the receptors that are recognized by Y. pestis phage, advances in phage therapy for Y. pestis infections, the application of phage in the detection of Y. pestis, and clustered regularly interspaced short palindromic repeats (CRISPRs) sequences of Y. pestis from prophage DNA are all reviewed here.

Bacteriophage-based synthetic biology for the study of infectious diseases

Science.gov (United States)

Lu, Timothy K.

2014-01-01

Since their discovery, bacteriophages have contributed enormously to our understanding of molecular biology as model systems. Furthermore, bacteriophages have provided many tools that have advanced the fields of genetic engineering and synthetic biology. Here, we discuss bacteriophage-based technologies and their application to the study of infectious diseases. New strategies for engineering genomes have the potential to accelerate the design of novel phages as therapies, diagnostics, and tools. Though almost a century has elapsed since their discovery, bacteriophages continue to have a major impact on modern biological sciences, especially with the growth of multidrug-resistant bacteria and interest in the microbiome. PMID:24997401

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

Science.gov (United States)

Shoughy, Samir S; Tabbara, Khalid F

2014-01-01

Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

Evolution and the complexity of bacteriophages.

Science.gov (United States)

Serwer, Philip

2007-03-13

The genomes of both long-genome (> 200 Kb) bacteriophages and long-genome eukaryotic viruses have cellular gene homologs whose selective advantage is not explained. These homologs add genomic and possibly biochemical complexity. Understanding their significance requires a definition of complexity that is more biochemically oriented than past empirically based definitions. Initially, I propose two biochemistry-oriented definitions of complexity: either decreased randomness or increased encoded information that does not serve immediate needs. Then, I make the assumption that these two definitions are equivalent. This assumption and recent data lead to the following four-part hypothesis that explains the presence of cellular gene homologs in long bacteriophage genomes and also provides a pathway for complexity increases in prokaryotic cells: (1) Prokaryotes underwent evolutionary increases in biochemical complexity after the eukaryote/prokaryote splits. (2) Some of the complexity increases occurred via multi-step, weak selection that was both protected from strong selection and accelerated by embedding evolving cellular genes in the genomes of bacteriophages and, presumably, also archaeal viruses (first tier selection). (3) The mechanisms for retaining cellular genes in viral genomes evolved under additional, longer-term selection that was stronger (second tier selection). (4) The second tier selection was based on increased access by prokaryotic cells to improved biochemical systems. This access was achieved when DNA transfer moved to prokaryotic cells both the more evolved genes and their more competitive and complex biochemical systems. I propose testing this hypothesis by controlled evolution in microbial communities to (1) determine the effects of deleting individual cellular gene homologs on the growth and evolution of long genome bacteriophages and hosts, (2) find the environmental conditions that select for the presence of cellular gene homologs, (3) determine

Evolution and the complexity of bacteriophages

Directory of Open Access Journals (Sweden)

Serwer Philip

2007-03-01

Full Text Available Abstract Background The genomes of both long-genome (> 200 Kb bacteriophages and long-genome eukaryotic viruses have cellular gene homologs whose selective advantage is not explained. These homologs add genomic and possibly biochemical complexity. Understanding their significance requires a definition of complexity that is more biochemically oriented than past empirically based definitions. Hypothesis Initially, I propose two biochemistry-oriented definitions of complexity: either decreased randomness or increased encoded information that does not serve immediate needs. Then, I make the assumption that these two definitions are equivalent. This assumption and recent data lead to the following four-part hypothesis that explains the presence of cellular gene homologs in long bacteriophage genomes and also provides a pathway for complexity increases in prokaryotic cells: (1 Prokaryotes underwent evolutionary increases in biochemical complexity after the eukaryote/prokaryote splits. (2 Some of the complexity increases occurred via multi-step, weak selection that was both protected from strong selection and accelerated by embedding evolving cellular genes in the genomes of bacteriophages and, presumably, also archaeal viruses (first tier selection. (3 The mechanisms for retaining cellular genes in viral genomes evolved under additional, longer-term selection that was stronger (second tier selection. (4 The second tier selection was based on increased access by prokaryotic cells to improved biochemical systems. This access was achieved when DNA transfer moved to prokaryotic cells both the more evolved genes and their more competitive and complex biochemical systems. Testing the hypothesis I propose testing this hypothesis by controlled evolution in microbial communities to (1 determine the effects of deleting individual cellular gene homologs on the growth and evolution of long genome bacteriophages and hosts, (2 find the environmental conditions that

Listeria monocytogenes in five Sardinian swine slaughterhouses: prevalence, serotype, and genotype characterization.

Science.gov (United States)

Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina

2013-11-01

In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

Science.gov (United States)

Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

2017-01-01

The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

Simulated hatchery system to assess bacteriophage efficacy against Vibrio harveyi.

Science.gov (United States)

Raghu Patil, J; Desai, Srividya Narayanamurthy; Roy, Panchali; Durgaiah, Murali; Saravanan, R Sanjeev; Vipra, Aradhana

2014-12-02

Vibriosis caused by luminous Vibrio harveyi commonly contributes to poor survival in shrimp hatcheries and aquaculture ponds. Lytic bacteriophages pathogenic for V. harveyi are currently being investigated as an alternative to antibiotics to prevent vibriosis. Here, 8 bacteriophages were isolated from oysters and clams using V. harveyi strains as baiting hosts. Among these bacteriophages, 1 strain (VHP6b) identified as broadly pathogenic for 27 V. harveyi strains examined was further characterized by electron microscopy and genome sequence analysis. Phage VHP6b possessed a tail and morphology consistent with it being a member of the family Siphoviridae, and its genome and proteome were most closely related to the Vibrio phages SSP02 and MAR10. An integrase gene essential for lysogeny was not evident. The ability of bacteriophage VHP6b to protect shrimp postlarvae against vibriosis caused by V. harveyi strain VH6 was demonstrated in a model system designed to simulate typical hatchery conditions. Bacteriophage treatment improved survival of postlarvae by 40 to 60% under these conditions, so therapies based on this or other bacteriophages may be useful in shrimp hatcheries.

Interactions of the cell-wall glycopolymers of lactic acid bacteria with their bacteriophages

Directory of Open Access Journals (Sweden)

Marie-Pierre eChapot-Chartier

2014-05-01

Full Text Available Lactic acid bacteria (LAB are Gram positive bacteria widely used in the production of fermented food in particular cheese and yoghurts. Bacteriophage infections during fermentation processes have been for many years a major industrial concern and have stimulated numerous research efforts. Better understanding of the molecular mechanisms of bacteriophage interactions with their host bacteria is required for the development of efficient strategies to fight against infections. The bacterial cell wall plays key roles in these interactions. First, bacteriophages must adsorb at the bacterial surface through specific interactions with receptors that are cell wall components. At next step, phages must overcome the barrier constituted by cell wall peptidoglycan to inject DNA inside bacterial cell. Also at the end of the infection cycle, phages synthesize endolysins able to hydrolyze peptidoglycan and lyse bacterial cells to release phage progeny. In the last decade, concomitant development of genomics and structural analysis of cell wall components allowed considerable advances in the knowledge of their structure and function in several model LAB. Here, we describe the present knowledge on the structure of the cell wall glycopolymers of the best characterized LAB emphasizing their structural variations and we present the available data regarding their role in bacteria-phage specific interactions at the different steps of the infection cycle.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

DEFF Research Database (Denmark)

Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

2017-01-01

elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

Listeria monocytogenes Monographic Study

Directory of Open Access Journals (Sweden)

Emil Tirziu

2010-05-01

Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

T4 bacteriophage conjugated magnetic particles for E. coli capturing: Influence of bacteriophage loading, temperature and tryptone.

Science.gov (United States)

Liana, Ayu Ekajayanthi; Marquis, Christopher P; Gunawan, Cindy; Gooding, J Justin; Amal, Rose

2017-03-01

This work demonstrates the use of bacteriophage conjugated magnetic particles (Fe 3 O 4 ) for the rapid capturing and isolation of Escherichia coli. The investigation of T4 bacteriophage adsorption to silane functionalised Fe 3 O 4 with amine (NH 2 ), carboxylic (COOH) and methyl (CH 3 ) surface functional groups reveals the domination of net electrostatic and hydrophobic interactions in governing bacteriophage adsorption. The bare Fe 3 O 4 and Fe 3 O 4 -NH 2 with high T4 loading captured 3-fold more E. coli (∼70% capturing efficiency) compared to the low loading T4 on Fe 3 O 4 -COOH, suggesting the significance of T4 loading in E. coli capturing efficiency. Importantly, it is further revealed that E. coli capture is highly dependent on the incubation temperature and the presence of tryptone in the media. Effective E. coli capturing only occurs at 37°C in tryptone-containing media with the absence of either conditions resulted in poor bacteria capture. The incubation temperature dictates the capturing ability of Fe 3 O 4 /T4, whereby T4 and E. coli need to establish an irreversible binding that occurred at 37°C. The presence of tryptophan-rich tryptone in the suspending media was also critical, as shown by a 3-fold increase in E. coli capture efficiency of Fe 3 O 4 /T4 in tryptone-containing media compared to that in tryptone-free media. This highlights for the first time that successful bacteria capturing requires not only an optimum tailoring of the particle's surface physicochemical properties for favourable bacteriophage loading, but also an in-depth understanding of how factors, such as temperature and solution chemistry influence the subsequent bacteriophage-bacteria interactions. Copyright © 2016 Elsevier B.V. All rights reserved.

Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

Science.gov (United States)

Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

2011-01-01

Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

Science.gov (United States)

Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

2015-01-01

Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

Science.gov (United States)

Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

2017-12-01

Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparative analysis of the biological and physical properties of Enterococcus faecalis bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis bacteriophage vB_SmM_GEC-SmitisM_2.

Science.gov (United States)

Rigvava, Sophio; Tchgkonia, Irina; Jgenti, Darejan; Dvalidze, Teona; Carpino, James; Goderdzishvili, Marina

2013-01-01

Enterococcus faecalis and Streptococcus mitis are common commensal inhabitants of the human gastrointestinal and genitourinary tracts. However, both species can be opportunistic pathogens and cause disease in nosocomial settings. These infections can be difficult to treat because of the frequency of antibiotic resistance among these strains. Bacteriophages are often suggested as an alternative therapeutic agent against these infections. In this study, E. faecalis and S. mitis strains were isolated from female patients with urinary tract infections. Bacteriophages active against these strains were isolated from sewage water from the Mtkvari River. Two phages, designated vB_EfaS_GEC-EfS_3 (Syphoviridae) and vB_SmM_GEC-SmitisM_2 (Myoviridae), were specific for E. faecalis and S. mitis, respectively. Each phage's growth patterns and adsorption rates were quantified. Sensitivity to ultraviolet light and temperature was determined, as was host range and serology. The S. mitis bacteriophage was found to be more resistant to ultraviolet light and exposure to high temperatures than the E. faecalis bacteriophage, despite having a much greater rate of replication. While each phage was able to infect a broad range of strains of the same species as the host species from which they were isolated, they were unable to infect other host species tested.

Salmonella Typhimurium-specific bacteriophage ΦSH19 and the origins of species specificity in the Vi01-like phage family

Directory of Open Access Journals (Sweden)

Wilson Ray

2011-11-01

Full Text Available Abstract Background Whole genome sequencing of bacteriophages suitable for biocontrol of pathogens in food products is a pre-requisite to any phage-based intervention procedure. Trials involving the biosanitization of Salmonella Typhimurium in the pig production environment identified one such candidate, ΦSH19. Results This phage was sequenced and analysis of its 157,785 bp circular dsDNA genome revealed a number of interesting features. ΦSH19 constitutes another member of the recently-proposed Myoviridae Vi01-like family of phages, containing S. Typhi-specific Vi01 and Shigella-specific SboM-AG3. At the nucleotide level ΦSH19 is highly similar to phage Vi01 (80-98% pairwise identity over the length of the genome, with the major differences lying in the region associated with host-range determination. Analyses of the proteins encoded within this region by ΦSH19 revealed a cluster of three putative tail spikes. Of the three tail spikes, two have protein domains associated with the pectate lyase family of proteins (Tsp2 and P22 tail spike family (Tsp3 with the prospect that these enable Salmonella O antigen degradation. Tail spike proteins of Vi01 and SboM-AG3 are predicted to contain conserved right-handed parallel β-helical structures but the internal protein domains are varied allowing different host specificities. Conclusions The addition or exchange of tail spike protein modules is a major contributor to host range determination in the Vi01-like phage family.

Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

Science.gov (United States)

Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

2015-11-09

Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

Effectiveness of lytic bacteriophages in reducing E. coli O157:H7 populations introduced through cross-contamination on fresh cut lettuce

Science.gov (United States)

Previous research has shown that lytic bacteriophages (phages) can kill E. coli O157:H7 on produce surfaces. The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield) at 10^8 PFU/m...

Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

Science.gov (United States)

Day, J B; Basavanna, U

2015-01-01

To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

The isolation and characterization of Campylobacter jejuni bacteriophages from free range and indoor poultry.

Science.gov (United States)

Owens, Jane; Barton, Mary D; Heuzenroeder, Michael W

2013-02-22

Six hundred and sixty one samples - primarily fresh chicken faeces - were processed to isolate wild type Campylobacter jejuni bacteriophages, via overlay agar methods using C. jejuni NCTC 12662. The aims of this study were to isolate and purify bacteriophages and then test for their ability to lyse field strains of C. jejuni in vitro. Of all samples processed, 130 were positive for bacteriophages. A distinct difference was observed between samples from different poultry enterprises. No bacteriophages could be isolated from indoor broilers. The majority of bacteriophages were isolated from free range poultry - both broilers and egg layers. Bacteriophages were purified and then selected for characterization based on their ability to produce clear lysis on plaque assay, as opposed to turbid plaques. Two hundred and forty one C. jejuni field isolates were tested for sensitivity to the bacteriophages. Lysis was graded subjectively and any minimal lysis was excluded. Using this system, 59.0% of the C. jejuni isolates showed significant sensitivity to at least one bacteriophage. The sensitivity to individual bacteriophages ranged from 10.0% to 32.5% of the C. jejuni isolates. Five bacteriophages were examined by electron microscopy and determined to belong to the Myoviridae family. The physical size, predicted genetic composition and genome size of the bacteriophages correlated well with other reported Campylobacter bacteriophages. The reasons for the observed difference between indoor broilers and free range poultry is unknown, but are postulated to be due to differences in the Campylobacter population in birds under different rearing conditions. Copyright © 2012 Elsevier B.V. All rights reserved.

Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

Directory of Open Access Journals (Sweden)

Ok Kyung Koo

Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

Science.gov (United States)

Miettinen, Hanna; Wirtanen, Gun

2005-10-15

A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

Whole-genome sequence of the bacteriophage-sensitive strain Campylobacter jejuni NCTC12662

DEFF Research Database (Denmark)

Gencay, Yilmaz Emre; Sørensen, Martine C.H.; Brøndsted, Lone

2017-01-01

Campylobacter jejuni NCTC12662 has been the choice bacteriophage isolation strain due to its susceptibility to C. jejuni bacteriophages. This trait makes it a good candidate for studying bacteriophage-host interactions. We report here the whole-genome sequence of NCTC12662, allowing future...

Evidence of translation efficiency adaptation of the coding regions of the bacteriophage lambda.

Science.gov (United States)

Goz, Eli; Mioduser, Oriah; Diament, Alon; Tuller, Tamir

2017-08-01

Deciphering the way gene expression regulatory aspects are encoded in viral genomes is a challenging mission with ramifications related to all biomedical disciplines. Here, we aimed to understand how the evolution shapes the bacteriophage lambda genes by performing a high resolution analysis of ribosomal profiling data and gene expression related synonymous/silent information encoded in bacteriophage coding regions.We demonstrated evidence of selection for distinct compositions of synonymous codons in early and late viral genes related to the adaptation of translation efficiency to different bacteriophage developmental stages. Specifically, we showed that evolution of viral coding regions is driven, among others, by selection for codons with higher decoding rates; during the initial/progressive stages of infection the decoding rates in early/late genes were found to be superior to those in late/early genes, respectively. Moreover, we argued that selection for translation efficiency could be partially explained by adaptation to Escherichia coli tRNA pool and the fact that it can change during the bacteriophage life cycle.An analysis of additional aspects related to the expression of viral genes, such as mRNA folding and more complex/longer regulatory signals in the coding regions, is also reported. The reported conclusions are likely to be relevant also to additional viruses. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

A case of bovine raw milk contamination with Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hunt Karen

2012-07-01

Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

Science.gov (United States)

Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

2016-04-15

The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

Bacteriophages and Their Role in Food Safety

Directory of Open Access Journals (Sweden)

Sanna M. Sillankorva

2012-01-01

Full Text Available The interest for natural antimicrobial compounds has increased due to alterations in consumer positions towards the use of chemical preservatives in foodstuff and food processing surfaces. Bacteriophages fit in the class of natural antimicrobial and their effectiveness in controlling bacterial pathogens in agro-food industry has led to the development of different phage products already approved by USFDA and USDA. The majority of these products are to be used in farm animals or animal products such as carcasses, meats and also in agricultural and horticultural products. Treatment with specific phages in the food industry can prevent the decay of products and the spread of bacterial diseases and ultimately promote safe environments in animal and plant food production, processing, and handling. This is an overview of recent work carried out with phages as tools to promote food safety, starting with a general introduction describing the prevalence of foodborne pathogens and bacteriophages and a more detailed discussion on the use of phage therapy to prevent and treat experimentally induced infections of animals against the most common foodborne pathogens, the use of phages as biocontrol agents in foods, and also their use as biosanitizers of food contact surfaces.

Study of the reactivation of X-ray inactivated lambda bacteriophages by irradiated Escherichia coli bacteria

International Nuclear Information System (INIS)

Kiessling, W.

1980-01-01

Bacteriophages lambda and E.coli cells were exposed to X-rays in LB medium. Host cells exposed to a dose of 85 to 765 Gy had a reactivation factor 1.3 to 3.0 for bacteriophages inactivated by X-rays. The capacity of the bacteria for bacteriophage mutliplication remained apparently unchanged in this dose range. After UV-irradiation of the host cells, only a reactivation factor of 1.3 was found for bacteriophages exposed to X-radiation. The comparatively low Weigle reactivation of bacteriophages exposed to X-radiation - as compared with bacteriophages exposed to UV radiation was analyzed by counting free, non-adsorbed bacteriophages determined by filtration of radioactively labelled bacteriophage-host complexes, it was found to be due to a reduced adsorptivity. Reactivation experiments with bacteriophages exposed to X-rays and host bacterias with different degrees of radiosensitivity proved this assumption to be correct. (orig.) [de

CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

R. Mioni

2013-02-01

Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

Potential of a lytic bacteriophage to disrupt Acinetobacter baumannii biofilms in vitro.

Science.gov (United States)

Liu, Yannan; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Wang, Yong; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Li, Puyuan; Tong, Yigang; Bai, Changqing

2016-10-01

The ability of Acinetobacter baumannii to form biofilms and develop antibiotic resistance makes it difficult to control infections caused by this bacterium. In this study, we explored the potential of a lytic bacteriophage to disrupt A. baumannii biofilms. The potential of the lytic bacteriophage to disrupt A. baumannii biofilms was assessed by performing electron microscopy, live/dead bacterial staining, crystal violet staining and by determining adenosine triphosphate release. The bacteriophage inhibited the formation of and disrupted preformed A. baumannii biofilms. Results of disinfection assay showed that the lytic bacteriophage lysed A. baumannii cells suspended in blood or grown on metal surfaces. These results suggest the potential of the lytic bacteriophage to disrupt A. baumannii biofilms.

Bacteriophage-resistant mutants in Yersinia pestis: identification of phage receptors and attenuation for mice.

Directory of Open Access Journals (Sweden)

Andrey A Filippov

Full Text Available BACKGROUND: Bacteriophages specific for Yersinia pestis are routinely used for plague diagnostics and could be an alternative to antibiotics in case of drug-resistant plague. A major concern of bacteriophage therapy is the emergence of phage-resistant mutants. The use of phage cocktails can overcome this problem but only if the phages exploit different receptors. Some phage-resistant mutants lose virulence and therefore should not complicate bacteriophage therapy. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this work was to identify Y. pestis phage receptors using site-directed mutagenesis and trans-complementation and to determine potential attenuation of phage-resistant mutants for mice. Six receptors for eight phages were found in different parts of the lipopolysaccharide (LPS inner and outer core. The receptor for R phage was localized beyond the LPS core. Most spontaneous and defined phage-resistant mutants of Y. pestis were attenuated, showing increase in LD₅₀ and time to death. The loss of different LPS core biosynthesis enzymes resulted in the reduction of Y. pestis virulence and there was a correlation between the degree of core truncation and the impact on virulence. The yrbH and waaA mutants completely lost their virulence. CONCLUSIONS/SIGNIFICANCE: We identified Y. pestis receptors for eight bacteriophages. Nine phages together use at least seven different Y. pestis receptors that makes some of them promising for formulation of plague therapeutic cocktails. Most phage-resistant Y. pestis mutants become attenuated and thus should not pose a serious problem for bacteriophage therapy of plague. LPS is a critical virulence factor of Y. pestis.

Resistance of Listeria monocytogenes biofilms to sanitizing agents

Science.gov (United States)

Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

Reduction of Salmonella in ground chicken using a bacteriophage.

Science.gov (United States)

Grant, Ar'Quette; Parveen, Salina; Schwarz, Jurgen; Hashem, Fawzy; Vimini, Bob

2017-08-01

This study's goal was to ascertain the effectiveness of a commercially available Salmonella bacteriophage during ground chicken production focusing on: water source, different Salmonella serovars, and time. Salmonella-free boneless, skinless chicken meat was inoculated with 4.0 Log CFU/cm2 of either a cocktail of 3 Salmonella isolates derived from ground chicken (GC) or a cocktail of 3 Salmonella strains not isolated from ground chicken (non-GC). Bacteriophages were spread onto the chicken using sterile tap or filtered water for 30 min or 8 h. Salmonella was recovered using standard plating method. Greater Salmonella reduction was observed when the bacteriophage was diluted in sterile tap water than in sterile filtered water: 0.39 Log CFU/cm2 and 0.23 Log CFU/cm2 reduction after 30 min, respectively (P Salmonella's susceptibility to the bacteriophage, and treatment time. © 2017 Poultry Science Association Inc.

Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

Science.gov (United States)

Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

2015-11-30

Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

Photodynamic Inactivation of Mammalian Viruses and Bacteriophages

Directory of Open Access Journals (Sweden)

Liliana Costa

2012-06-01

Full Text Available Photodynamic inactivation (PDI has been used to inactivate microorganisms through the use of photosensitizers. The inactivation of mammalian viruses and bacteriophages by photosensitization has been applied with success since the first decades of the last century. Due to the fact that mammalian viruses are known to pose a threat to public health and that bacteriophages are frequently used as models of mammalian viruses, it is important to know and understand the mechanisms and photodynamic procedures involved in their photoinactivation. The aim of this review is to (i summarize the main approaches developed until now for the photodynamic inactivation of bacteriophages and mammalian viruses and, (ii discuss and compare the present state of the art of mammalian viruses PDI with phage photoinactivation, with special focus on the most relevant mechanisms, molecular targets and factors affecting the viral inactivation process.

Genome Sequences of 19 Novel Erwinia amylovora Bacteriophages.

Science.gov (United States)

Esplin, Ian N D; Berg, Jordan A; Sharma, Ruchira; Allen, Robert C; Arens, Daniel K; Ashcroft, Cody R; Bairett, Shannon R; Beatty, Nolan J; Bickmore, Madeline; Bloomfield, Travis J; Brady, T Scott; Bybee, Rachel N; Carter, John L; Choi, Minsey C; Duncan, Steven; Fajardo, Christopher P; Foy, Brayden B; Fuhriman, David A; Gibby, Paul D; Grossarth, Savannah E; Harbaugh, Kala; Harris, Natalie; Hilton, Jared A; Hurst, Emily; Hyde, Jonathan R; Ingersoll, Kayleigh; Jacobson, Caitlin M; James, Brady D; Jarvis, Todd M; Jaen-Anieves, Daniella; Jensen, Garrett L; Knabe, Bradley K; Kruger, Jared L; Merrill, Bryan D; Pape, Jenny A; Payne Anderson, Ashley M; Payne, David E; Peck, Malia D; Pollock, Samuel V; Putnam, Micah J; Ransom, Ethan K; Ririe, Devin B; Robinson, David M; Rogers, Spencer L; Russell, Kerri A; Schoenhals, Jonathan E; Shurtleff, Christopher A; Simister, Austin R; Smith, Hunter G; Stephenson, Michael B; Staley, Lyndsay A; Stettler, Jason M; Stratton, Mallorie L; Tateoka, Olivia B; Tatlow, P J; Taylor, Alexander S; Thompson, Suzanne E; Townsend, Michelle H; Thurgood, Trever L; Usher, Brittian K; Whitley, Kiara V; Ward, Andrew T; Ward, Megan E H; Webb, Charles J; Wienclaw, Trevor M; Williamson, Taryn L; Wells, Michael J; Wright, Cole K; Breakwell, Donald P; Hope, Sandra; Grose, Julianne H

2017-11-16

Erwinia amylovora is the causal agent of fire blight, a devastating disease affecting some plants of the Rosaceae family. We isolated bacteriophages from samples collected from infected apple and pear trees along the Wasatch Front in Utah. We announce 19 high-quality complete genome sequences of E. amylovora bacteriophages. Copyright © 2017 Esplin et al.

Specificity of interactions among the DNA-packaging machine components of T4-related bacteriophages.

Science.gov (United States)

Gao, Song; Rao, Venigalla B

2011-02-04

Tailed bacteriophages use powerful molecular motors to package the viral genome into a preformed capsid. Packaging at a rate of up to ∼2000 bp/s and generating a power density twice that of an automobile engine, the phage T4 motor is the fastest and most powerful reported to date. Central to DNA packaging are dynamic interactions among the packaging components, capsid (gp23), portal (gp20), motor (gp17, large "terminase"), and regulator (gp16, small terminase), leading to precise orchestration of the packaging process, but the mechanisms are poorly understood. Here we analyzed the interactions between small and large terminases of T4-related phages. Our results show that the gp17 packaging ATPase is maximally stimulated by homologous, but not heterologous, gp16. Multiple interaction sites are identified in both gp16 and gp17. The specificity determinants in gp16 are clustered in the diverged N- and C-terminal domains (regions I-III). Swapping of diverged region(s), such as replacing C-terminal RB49 region III with that of T4, switched ATPase stimulation specificity. Two specificity regions, amino acids 37-52 and 290-315, are identified in or near the gp17-ATPase "transmission" subdomain II. gp16 binding at these sites might cause a conformational change positioning the ATPase-coupling residues into the catalytic pocket, triggering ATP hydrolysis. These results lead to a model in which multiple weak interactions between motor and regulator allow dynamic assembly and disassembly of various packaging complexes, depending on the functional state of the packaging machine. This might be a general mechanism for regulation of the phage packaging machine and other complex molecular machines.

Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

Directory of Open Access Journals (Sweden)

Ninoska eCordero

2016-03-01

Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

Directory of Open Access Journals (Sweden)

Maysa A. I. Awadallah

2014-10-01

Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

Science.gov (United States)

Alali, Walid Q; Schaffner, Donald W

2013-07-01

The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

Biocontrol of Pectobacterium carotovorum subsp. carotovorum using bacteriophage PP1.

Science.gov (United States)

Lim, Jeong-A; Jee, Samnyu; Lee, Dong Hwan; Roh, Eunjung; Jung, Kyusuk; Oh, Changsik; Heu, Sunggi

2013-08-01

Pectobacterium carotovorum subsp. carotovorum (formerly Erwinia carotovora subsp. carotovora) is a plant pathogen that causes soft rot and stem rot diseases in several crops, including Chinese cabbage, potato, and tomato. To control this bacterium, we isolated a bacteriophage, PP1, with lytic activity against P. carotovorum subsp. carotovorum. Transmission electron microscopy revealed that the PP1 phage belongs to the Podoviridae family of the order Caudovirales, which exhibit icosahedral heads and short non-contractile tails. PP1 phage showed high specificity for P. carotovorum subsp. carotovorum, and several bacteria belonging to different species and phyla were resistant to PP1. This phage showed rapid and strong lytic activity against its host bacteria in liquid medium and was stable over a broad range of pH values. Disease caused by P. carotovorum subsp. carotovorum was significantly reduced by PP1 treatment. Overall, PP1 bacteriophage effectively controls P. carotovorum subsp. carotovorum.

Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

DEFF Research Database (Denmark)

Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

2001-01-01

and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

Directory of Open Access Journals (Sweden)

N. Soultos

2014-11-01

Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

Directory of Open Access Journals (Sweden)

T Civera

2013-02-01

Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

Science.gov (United States)

Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

2017-09-18

Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

Listeria monocytogenes growth limits and stress resistance mechanisms

NARCIS (Netherlands)

Veen, van der S.

2008-01-01

The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

Microencapsulation of Clostridium difficile specific bacteriophages using microfluidic glass capillary devices for colon delivery using pH triggered release.

Directory of Open Access Journals (Sweden)

Gurinder K Vinner

Full Text Available The prevalence of pathogenic bacteria acquiring multidrug antibiotic resistance is a global health threat to mankind. This has motivated a renewed interest in developing alternatives to conventional antibiotics including bacteriophages (viruses as therapeutic agents. The bacterium Clostridium difficile causes colon infection and is particularly difficult to treat with existing antibiotics; phage therapy may offer a viable alternative. The punitive environment within the gastrointestinal tract can inactivate orally delivered phages. C. difficile specific bacteriophage, myovirus CDKM9 was encapsulated in a pH responsive polymer (Eudragit® S100 with and without alginate using a flow focussing glass microcapillary device. Highly monodispersed core-shell microparticles containing phages trapped within the particle core were produced by in situ polymer curing using 4-aminobenzoic acid dissolved in the oil phase. The size of the generated microparticles could be precisely controlled in the range 80 μm to 160 μm through design of the microfluidic device geometry and by varying flow rates of the dispersed and continuous phase. In contrast to free 'naked' phages, those encapsulated within the microparticles could withstand a 3 h exposure to simulated gastric fluid at pH 2 and then underwent a subsequent pH triggered burst release at pH 7. The significance of our research is in demonstrating that C. difficile specific phage can be formulated and encapsulated in highly uniform pH responsive microparticles using a microfluidic system. The microparticles were shown to afford significant protection to the encapsulated phage upon prolonged exposure to an acid solution mimicking the human stomach environment. Phage encapsulation and subsequent release kinetics revealed that the microparticles prepared using Eudragit® S100 formulations possess pH responsive characteristics with phage release triggered in an intestinal pH range suitable for therapeutic

Evaluation of Anti- Bacteriophage as Feed Additives to Prevent (SE in Broiler

Directory of Open Access Journals (Sweden)

K. H. Kim

2013-03-01

Full Text Available This experiment was conducted to evaluate anti-Salmonella enteritidis (anti-SE bacteriophage as feed additives to prevent Salmonella enteritidis in broilers. The experimental diets were formulated for 2 phases feeding trial, and 3 different levels (0.05, 0.1 and 0.2% of anti-SE bacteriophage were supplemented in basal diet. The basal diet was regarded as the control treatment. A total of 320 1-d-old male broilers (Ross 308 were allotted by randomized complete block (RCB design in 8 replicates with 10 chicks per pen. All birds were raised on rice hull bedding in ambient controlled environment and free access to feed and water. There were no significant differences in body weight gain, feed intake and feed conversion ratio (FCR at terminal period among treatments (p>0.05. Relative weights of liver, spleen, abdominal fat and tissue muscle of breast obtained from each anti-SE bacteriophage treatment were similar to control, with a slightly higher value in anti-SE bacteriophage 0.2%. In addition, a numerical difference of glutamic-oxaloacetic transaminase (GOT, glutamic-pyruvic transaminase (GPT and LDL cholesterol level was observed in the 0.2% anti-SE bacteriophage application even though blood profiles were not significantly affected by supplemented levels of anti-SE bacteriophage (p>0.05. In the result of a 14 d record after Salmonella enteritidis challenge of 160 birds from 4 previous treatments, mortality was linearly decreased with increasing anti-SE bacteriophage level (p<0.05, and Salmonella enteritidis concentration in the cecum was decreased with increasing levels of anti-SE bacteriophage (p<0.05. Based on the results of this study, it is considered that supplementation of 0.2% anti-SE bacteriophage may not cause any negative effect on growth, meat production, and it reduces mortality after Salmonella enteritidis challenge. These results imply to a possible use of anti-SE bacteriophage as an alternative feed additive instead of antibiotics

Aligning the unalignable: bacteriophage whole genome alignments.

Science.gov (United States)

Bérard, Sèverine; Chateau, Annie; Pompidor, Nicolas; Guertin, Paul; Bergeron, Anne; Swenson, Krister M

2016-01-13

In recent years, many studies focused on the description and comparison of large sets of related bacteriophage genomes. Due to the peculiar mosaic structure of these genomes, few informative approaches for comparing whole genomes exist: dot plots diagrams give a mostly qualitative assessment of the similarity/dissimilarity between two or more genomes, and clustering techniques are used to classify genomes. Multiple alignments are conspicuously absent from this scene. Indeed, whole genome aligners interpret lack of similarity between sequences as an indication of rearrangements, insertions, or losses. This behavior makes them ill-prepared to align bacteriophage genomes, where even closely related strains can accomplish the same biological function with highly dissimilar sequences. In this paper, we propose a multiple alignment strategy that exploits functional collinearity shared by related strains of bacteriophages, and uses partial orders to capture mosaicism of sets of genomes. As classical alignments do, the computed alignments can be used to predict that genes have the same biological function, even in the absence of detectable similarity. The Alpha aligner implements these ideas in visual interactive displays, and is used to compute several examples of alignments of Staphylococcus aureus and Mycobacterium bacteriophages, involving up to 29 genomes. Using these datasets, we prove that Alpha alignments are at least as good as those computed by standard aligners. Comparison with the progressive Mauve aligner - which implements a partial order strategy, but whose alignments are linearized - shows a greatly improved interactive graphic display, while avoiding misalignments. Multiple alignments of whole bacteriophage genomes work, and will become an important conceptual and visual tool in comparative genomics of sets of related strains. A python implementation of Alpha, along with installation instructions for Ubuntu and OSX, is available on bitbucket (https://bitbucket.org/thekswenson/alpha).

Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

DEFF Research Database (Denmark)

Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

1996-01-01

Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

Aerosol studies with Listeria innocua and Listeria monocytogenes.

Science.gov (United States)

Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

2007-08-01

Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

Science.gov (United States)

Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

2016-02-01

Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

Science.gov (United States)

Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

2017-09-01

Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

Low prevalence of Listeria monocytogenes in cull sows and pork.

Science.gov (United States)

Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

2008-03-01

The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

Directory of Open Access Journals (Sweden)

Luisa Zanolli Moreno

2014-01-01

Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

Methods for initial characterization of Campylobacter jejuni bacteriophages

DEFF Research Database (Denmark)

Sørensen, Martine Camilla Holst; Gencay, Yilmaz Emre; Brøndsted, Lone

2017-01-01

Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity.......Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity....

Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

Science.gov (United States)

Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

2017-02-01

Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

Science.gov (United States)

Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

2016-01-01

Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

Science.gov (United States)

Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

2009-06-15

In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

Science.gov (United States)

González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

2001-11-01

The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

Science.gov (United States)

Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

2017-05-01

Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Immuno compatibility of Bacteriophages as Nano medicines

International Nuclear Information System (INIS)

Kaur, T.; Nafissi, N.; Wasfi, O.; Sheldon, K.; Wettig, Sh.; Slavcev, R.

2012-01-01

Bacteriophage-based medical research provides the opportunity to develop targeted nano medicines with heightened efficiency and safety profiles. Filamentous phages also can and have been formulated as targeted drug-delivery nano medicines, and phage may also serve as promising alternatives/complements to antibiotics. Over the past decade the use of phage for both the prophylaxis and the treatment of bacterial infection, has gained special significance in view of a dramatic rise in the prevalence of antibiotic resistance bacterial strains. Two potential medical applications of phages are the treatment of bacterial infections and their use as immunizing agents in diagnosis and monitoring patients with immunodeficiencies. Recently, phages have been employed as gene-delivery vectors (phage nano medicine), for nearly half a century as tools in genetic research, for about two decades as tools for the discovery of specific target-binding proteins and peptides, and for almost a decade as tools for vaccine development. As phage applications to human therapeutic development grow at an exponential rate, it will become essential to evaluate host immune responses to initial and repetitive challenges by therapeutic phage in order to develop phage therapies that offer suitable utility. This paper examines and discusses phage nano medicine applications and the immunomodulatory effects of bacteriophage exposure and treatment modalities.

Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

Science.gov (United States)

Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

2013-02-01

This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

In vitro evaluation of a novel bacteriophage cocktail as a preventative for bovine coliform mastitis.

Science.gov (United States)

Porter, J; Anderson, J; Carter, L; Donjacour, E; Paros, M

2016-03-01

The objective of this study was to investigate the potential use of bacteriophage in preventing Escherichia coli mastitis on dairies. A cocktail consisting of 4 distinct bacteriophages was generated by screening against 36 E. coli isolates from dairy cows in Washington State with clinical mastitis. The bacteriophage significantly inhibited growth of 58% of the Washington State isolates and 54% of E. coli mastitis isolates from New York State, suggesting that the cocktail of phages had a relatively broad spectrum of action against relevant strains from 2 distinct geographies. The ability to suppress bacterial growth of these isolates in a liquid growth medium was not affected by the ratio of bacteriophage particles to bacterial cells (multiplicity of infection, MOI). For those E. coli that were completely inhibited by the phage cocktail, an MOI as low as 10 had the same effect as 10 µg/mL of ceftiofur on the growth rate of E. coli over a 12-h period using optical density measurements. A 3.3- to 5.6-log reduction of growth was achieved when E. coli was co-incubated with our phage cocktail in raw milk over a 12-h period at physiologic temperature. A modified gentamicin protection assay using bovine mammary epithelial cells provided a model to test whether bacteriophage could prevent cell attachment and invasion by chronic coliform mastitis strains. Pretreatment of cell cultures with the phage cocktail significantly reduced adhesion and intracellular survival of E. coli compared with controls. When combined with a bismuth-based teat sealant, the phage cocktail was able to inhibit bacterial growth when challenged with 1.6 × 10(3) cfu/mL of a clinical mastitis E. coli strain. In vitro results show bactericidal activity by our phage in raw milk and mammary tissue culture systems. Before a bacteriophage-based dry-cow treatment becomes a potential option for dairies, in vivo studies must be able to demonstrate that a specific dose of bacteriophage can protect cows from

Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

Science.gov (United States)

Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

2001-10-01

Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

Prevalence of Listeria monocytogenes in poultry meat

Directory of Open Access Journals (Sweden)

Mehmet ELMALI

2015-01-01

Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

Directory of Open Access Journals (Sweden)

Wanessa Altimiras Costa

2009-12-01

Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

A quorum-sensing-induced bacteriophage defense mechanism

DEFF Research Database (Denmark)

Høyland-Kroghsbo, Nina Molin; Mærkedahl, Rasmus Baadsgaard; Svenningsen, Sine

2013-01-01

of uninfected survivor cells after a potent attack by virulent phages. Notably, this mechanism may apply to a broader range of phages, as AHLs also reduce the risk of ¿ phage infection through a different receptor. IMPORTANCE To enable the successful manipulation of bacterial populations, a comprehensive...... sensing plays an important role in determining the susceptibility of E. coli to infection by bacteriophages ¿ and ¿. On the basis of our findings in the classical Escherichia coli-¿ model system, we suggest that quorum sensing may serve as a general strategy to protect bacteria specifically under...

Listeria monocytogenes in retailed raw chicken meat in Turkey.

Science.gov (United States)

Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

2014-01-01

The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

Commensal microbes provide first line defense against Listeria monocytogenes infection

Science.gov (United States)

Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

2017-01-01

Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Daniel R. Rissi

2010-01-01

Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

Science.gov (United States)

Eskhan, Asma Omar

Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

Science.gov (United States)

Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

2017-04-01

Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

DEFF Research Database (Denmark)

Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

2013-01-01

Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

Bacteriophages in the control of pathogenic vibrios

DEFF Research Database (Denmark)

Plaza, Nicolás; Castillo Bermúdez, Daniel Elías; Perez-Reytor, Diliana

2018-01-01

constitute a continuing threat for aquaculture. Moreover, the continuous use of antibiotics has been accompanied by an emergence of antibiotic resistance in Vibrio species, implying a necessity for efficient treatments. One promising alternative that emerges is the use of lytic bacteriophages; however......, there are some drawbacks that should be overcome to make phage therapy a widely accepted method. In this work, we discuss about the major pathogenic Vibrio species and the progress, benefits and disadvantages that have been detected during the experimental use of bacteriophages to their control....

Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

African Journals Online (AJOL)

This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Ewa Sawosz

2010-08-01

Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

DEFF Research Database (Denmark)

Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

2017-01-01

dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

Bacteriophages: The viruses for all seasons of molecular biology

Directory of Open Access Journals (Sweden)

Karam Jim D

2005-03-01

Full Text Available Abstract Bacteriophage research continues to break new ground in our understanding of the basic molecular mechanisms of gene action and biological structure. The abundance of bacteriophages in nature and the diversity of their genomes are two reasons why phage research brims with excitement. The pages of Virology Journal will reflect the excitement of the "New Phage Biology."

Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

Science.gov (United States)

Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

2014-08-01

This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

Improved bacteriophage genome data is necessary for integrating viral and bacterial ecology.

Science.gov (United States)

Bibby, Kyle

2014-02-01

The recent rise in "omics"-enabled approaches has lead to improved understanding in many areas of microbial ecology. However, despite the importance that viruses play in a broad microbial ecology context, viral ecology remains largely not integrated into high-throughput microbial ecology studies. A fundamental hindrance to the integration of viral ecology into omics-enabled microbial ecology studies is the lack of suitable reference bacteriophage genomes in reference databases-currently, only 0.001% of bacteriophage diversity is represented in genome sequence databases. This commentary serves to highlight this issue and to promote bacteriophage genome sequencing as a valuable scientific undertaking to both better understand bacteriophage diversity and move towards a more holistic view of microbial ecology.

Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

Directory of Open Access Journals (Sweden)

Lior Lobel

2012-09-01

Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

Science.gov (United States)

Lee, Yuejia; Wang, Chinling

2017-03-01

Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

Directory of Open Access Journals (Sweden)

abazar pournajaf

2013-09-01

Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

Modeling the growth of Listeria monocytogenes in soft blue-white cheese

DEFF Research Database (Denmark)

Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne

2012-01-01

The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

Science.gov (United States)

Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

2018-06-20

Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

Science.gov (United States)

Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

2016-01-01

Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

OpenAIRE

Fossmo, Sabine

2013-01-01

Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

Monitoring paneer for Listeria monocytogenes - A high risk food ...

African Journals Online (AJOL)

A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

[Neonatal meningitis due to Listeria monocytogenes after 3 weeks of maternal treatment during pregnancy].

Science.gov (United States)

Fayol, L; Beizig, S; Le Monnier, A; Lacroze, V; Simeoni, U

2009-04-01

We report the case of a pregnant woman with listeriosis at 26 gestational weeks followed by premature labor at 30 gestational weeks. Bacterial meningitis was suspected in the neonate with ventriculitis on sonography, a high level of protein in the cerebrospinal fluid (CSF), and an identified specific bacterial genome of Listeria monocytogenes (PCR 16S rDNA and sequencing and specific amplification of L. monocytogenes hly gene) in CSF. Neonatal meningitis was complicated with cerebral venous sinus thrombosis and ventriculomegaly. Listeriosis during pregnancy can lead to severe complications in the neonate. Thus, listeriosis should be a diagnostic concern in febrile pregnant women at any stage of pregnancy. First-line treatment is based on high-dose amoxicillin (> or =6g/day) and must be used for at least 3 weeks for treatment of listeriosis during pregnancy. If the fetus survives, longer therapy until delivery can be discussed.

Genome sequences of Listeria monocytogenes strains with resistance to arsenic

Science.gov (United States)

Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

Effects of prebiotics on the infective potential of Listeria monocytogenes

DEFF Research Database (Denmark)

Ebersbach, Tine

% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

75 - 78 Samira - BACTERIOPHAGES FINAL

African Journals Online (AJOL)

DR. AMIN

Bayero Journal of Pure and Applied Sciences, 4(1): 75 - 78. Received: ... It involves the use of bacteriophages (small viruses that predate bacteria) to ..... Since the 1940s, research with ... phages is recognized by the appearance of plaques or.

[Determination of Azospirillum Brasilense Cells With Bacteriophages via Electrooptical Analysis of Microbial Suspensions].

Science.gov (United States)

Gulii, O I; Karavayeva, O A; Pavlii, S A; Sokolov, O I; Bunin, V D; Ignatov, O V

2015-01-01

The dependence-of changes in the electrooptical properties of Azospirillum brasilense cell suspension Sp7 during interaction with bacteriophage ΦAb-Sp7 on the number and time of interactions was studied. Incubation of cells with bacteriophage significantly changed the electrooptical signal within one minute. The selective effect of bacteriophage ΦAb on 18 strains of bacteria of the genus Azospirillum was studied: A. amazonense Ami4, A. brasilense Sp7, Cd, Sp107, Sp245, Jm6B2, Brl4, KR77, S17, S27, SR55, SR75, A. halopraeferans Au4, A. irakense KBC1, K A3, A. lipoferum Sp59b, SR65 and RG20a. We determined the limit of reliable determination of microbial cells infected with bacteriophage: - 10(4) cells/mL. The presence of foreign cell cultures of E. coli B-878 and E. coli XL-1 did not complicate the detection of A brasilense Sp7 cells with the use of bacteriophage ΦAb-Sp7. The results demonstrated that bacteriophage (ΦAb-Sp7 can be used for the detection of Azospirillum microbial cells via t electrooptical analysis of cell suspensions.

Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

Science.gov (United States)

Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

2017-07-01

Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

T4-related bacteriophage LIMEstone isolates for the control of soft rot on potato caused by 'Dickeya solani'.

Directory of Open Access Journals (Sweden)

Evelien M Adriaenssens

Full Text Available The bacterium 'Dickeya solani', an aggressive biovar 3 variant of Dickeya dianthicola, causes rotting and blackleg in potato. To control this pathogen using bacteriophage therapy, we isolated and characterized two closely related and specific bacteriophages, vB_DsoM_LIMEstone1 and vB_DsoM_LIMEstone2. The LIMEstone phages have a T4-related genome organization and share DNA similarity with Salmonella phage ViI. Microbiological and molecular characterization of the phages deemed them suitable and promising for use in phage therapy. The phages reduced disease incidence and severity on potato tubers in laboratory assays. In addition, in a field trial of potato tubers, when infected with 'Dickeya solani', the experimental phage treatment resulted in a higher yield. These results form the basis for the development of a bacteriophage-based biocontrol of potato plants and tubers as an alternative for the use of antibiotics.

Bacteriophages use hypermodified nucleosides to evade host's defence systems

DEFF Research Database (Denmark)

Kot, Witold; Olsen, Nikoline S.; Carstens, Alexander Byth

developed several strategies to evade these defence mechanisms. Ultimately, this led to the oldest and still running arms race - microorganisms vs. their molecular parasites. We here describe a remarkable new strategy used by the recently isolated Escherichia coli phage CAjan belonging to...... to investigate this mechanism in detail we have used several methods including direct plaque sequencing, restriction endonuclease analysis and CRISPR-Cas genome editing. Through generation of specific mutants, we were able to introduce a restriction sensitive phenotype in the CAjan bacteriophage providing new...

Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

Science.gov (United States)

Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

The Baseplate of Lactobacillus delbrueckii Bacteriophage Ld17 Harbors a Glycerophosphodiesterase.

Science.gov (United States)

Cornelissen, Anneleen; Sadovskaya, Irina; Vinogradov, Evgeny; Blangy, Stéphanie; Spinelli, Silvia; Casey, Eoghan; Mahony, Jennifer; Noben, Jean-Paul; Dal Bello, Fabio; Cambillau, Christian; van Sinderen, Douwe

2016-08-05

Glycerophosphodiester phosphodiesterases (GDPDs; EC 3.1.4.46) typically hydrolyze glycerophosphodiesters to sn-glycerol 3-phosphate (Gro3P) and their corresponding alcohol during patho/physiological processes in bacteria and eukaryotes. GDPD(-like) domains were identified in the structural particle of bacterial viruses (bacteriophages) specifically infecting Gram-positive bacteria. The GDPD of phage 17 (Ld17; GDPDLd17), representative of the group b Lactobacillus delbrueckii subsp. bulgaricus (Ldb)-infecting bacteriophages, was shown to hydrolyze, besides the simple glycerophosphodiester, two complex surface-associated carbohydrates of the Ldb17 cell envelope: the Gro3P decoration of the major surface polysaccharide d-galactan and the oligo(glycerol phosphate) backbone of the partially glycosylated cell wall teichoic acid, a minor Ldb17 cell envelope component. Degradation of cell wall teichoic acid occurs according to an exolytic mechanism, and Gro3P substitution is presumed to be inhibitory for GDPDLd17 activity. The presence of the GDPDLd17 homotrimer in the viral baseplate structure involved in phage-host interaction together with the dependence of native GDPD activity, adsorption, and efficiency of plating of Ca(2+) ions supports a role for GDPDLd17 activity during phage adsorption and/or phage genome injection. In contrast to GDPDLd17, we could not identify any enzymatic activity for the GDPD-like domain in the neck passage structure of phage 340, a 936-type Lactococcus lactis subsp. lactis bacteriophage. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

DEFF Research Database (Denmark)

Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

2005-01-01

Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

Genomic presence of gadD1 glutamate decarboxylase correlates with the organization of ascB-dapE internalin cluster in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan

2012-02-01

The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.

Bacteriophage ecology in environmental biotechnology processes.

Science.gov (United States)

Shapiro, Orr H; Kushmaro, Ariel

2011-06-01

Heterotrophic bacteria are an integral part of any environmental biotechnology process (EBP). Therefore, factors controlling bacterial abundance, activity, and community composition are central to the understanding of such processes. Among these factors, top-down control by bacteriophage predation has so far received very limited attention. With over 10(8) particles per ml, phage appear to be the most numerous biological entities in EBP. Phage populations in EBP appear to be highly dynamic and to correlate with the population dynamics of their hosts and genomic evidence suggests bacteria evolve to avoid phage predation. Clearly, there is much to learn regarding bacteriophage in EBP before we can truly understand the microbial ecology of these globally important systems. Copyright © 2011 Elsevier Ltd. All rights reserved.

Survival strategies of Listeria monocytogenes - roles of regulators and transporters

NARCIS (Netherlands)

Wemekamp-Kamphuis, H.H.

2003-01-01

Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

DEFF Research Database (Denmark)

Nørrung, Birgit

2000-01-01

This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

Prevalence of Listeria monocytogenes in raw milk in North Lebanon

International Nuclear Information System (INIS)

Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

2016-01-01

Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

Directory of Open Access Journals (Sweden)

Poyin Chen

2017-12-01

Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

Deciphering the landscape of host barriers to Listeria monocytogenes infection.

Science.gov (United States)

Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

2017-06-13

Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

Listeria monocytogenes: diagnostic problems

NARCIS (Netherlands)

Beumer, R.R.; Hazeleger, W.C.

2003-01-01

The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

Science.gov (United States)

Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

2016-01-01

Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

Use of results of microbiological analyses for risk-based control of Listeria monocytogenes in marinated broiler legs.

Science.gov (United States)

Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura

2008-02-10

Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk

DEPENDENCE BETWEEN ACYLATION DEGREE AND SPECIFIC LYSIS ACTITIVY OF THE PSEUDOMONAS AERUGINOSA М6 BACTERIOPHAGE

Directory of Open Access Journals (Sweden)

Martynov A. V.

2016-06-01

Full Text Available Introduction. The purpose of this work is to study the influence of various degrees of protein’s acylation on lytic activity and other biological properties of Pseudomonas M6 bacteriophage. Materials and methods. The subject of the study were samples of the Pseudomonas O 12 bacteriophage, hereinafter named the M6 phage. Pure phage lines were obtained from individual standard-morphology phage plaques (plaque-forming units, or PFUs after ten passes over the indicator strain. In subsequent experiments, M6 phage samples were selected that had a sufficient level of purity (homogeneous in the morphology of virions that inactivated the homologic antiphage serum by no less than 99.0% and the heterologic antibacterial serum by no more than 1%, and a titer no lower than 10 PFU per ml (PFU/ml. Titration of the phages was conducted using the standard bilayer agar. The crude protein content in the phage suspensions was determined using the spectroscopic method (at 280 and 260 nm. Succinylation of the phage samples was conducted according to the method developed by T.J. Molenaar. The phage’s lytic activity spectrum was determined through spot tests on 224 strains of the Pseudomonas genus and 106 strains of other genera (correspondingly, of strains Enterobacter -40, Escherichia -10, Citrobacter -8, Hafnia -7, Serratia -6, Shigella -10, Salmonella -8, Proteus -7 through the use of a phage suspension containing 10 5 - 10 6 PFU/ml. (This concentration of infectious phage corpuscles corresponds with the critical distribution of the M6 phage. The results of the research were subjected to statistical processing using single-factor dispersion analysis. Results and discussion. One hundred percent phage protein acylation leads to a loss of adsorption ability on sensitive cells and is accompanied by a significant (more than 103 times decrease in the level of specific lytic activity in the phage preparations. The succinylation type being studied does not cause

Isolation of Dickeya dadantii strains from potato disease and biocontrol by their bacteriophages

Directory of Open Access Journals (Sweden)

Abbas Soleimani-Delfan

2015-09-01

Full Text Available One of the most economically important bacterial pathogens of plants and plant products is Dickeya dadantii. This bacterium causes soft rot disease in tubers and other parts of the potato and other plants of the Solanaceae family. The application of restricted host range bacteriophages as biocontrol agents has recently gained widespread interest. This study purposed to isolate the infectious agent of the potato and evaluate its biocontrol by bacteriophages. Two phytopathogenic strains were isolated from infected potatoes, identified based on biochemical and 16S rRNA gene sequencing, and submitted to GenBank as D. dadantii strain pis3 (accession no. HQ423668 and D. dadantii strain sip4 (accession no. HQ423669. Their bacteriophages were isolated from Caspian Sea water by enriching the water filtrate with D. dadantii strains as hosts using spot or overlay methods. On the basis of morphotypes, the isolated bacteriophages were identified as members of the Myoviridae and Siphoviridae families and could inhibit the growth of antibiotic resistant D. dadantii strains in culture medium. Moreover, in Dickeya infected plants treated with bacteriophage, no disease progression was detected. No significant difference was seen between phage-treated and control plants. Thus, isolated bacteriophages can be suggested for the biocontrol of plant disease caused by Dickeya strains.

Bacteriophages of Soft Rot Enterobacteriaceae-a minireview.

Science.gov (United States)

Czajkowski, Robert

2016-01-01

Soft rot Enterobacteriaceae (Pectobacterium spp. and Dickeya spp., formerly pectinolytic Erwinia spp.) are ubiquitous necrotrophic bacterial pathogens that infect a large number of different plant species worldwide, including economically important crops. Despite the fact that these bacteria have been studied for more than 50 years, little is known of their corresponding predators: bacteriophages, both lytic and lysogenic. The aim of this minireview is to critically summarize recent ecological, biological and molecular research on bacteriophages infecting Pectobacterium spp. and Dickeya spp. with the main focus on current and future perspectives in that field. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

Science.gov (United States)

Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

2017-01-01

Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

Metagenomic Analysis of Dairy Bacteriophages

DEFF Research Database (Denmark)

Muhammed, Musemma K.; Kot, Witold; Neve, Horst

2017-01-01

Despite their huge potential for characterizing the biodiversity of phages, metagenomic studies are currently not available for dairy bacteriophages, partly due to the lack of a standard procedure for phage extraction. We optimized an extraction method that allows to remove the bulk protein from...

Incidence and control of Listeria monocytogenes in foods in Denmark

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

1999-01-01

The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

Science.gov (United States)

Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

2018-06-13

The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

Hygienic Shortcomings of Frozen Dessert Freezing Equipment and Fate of Listeria monocytogenes on Ice Cream-Soiled Stainless Steel.

Science.gov (United States)

Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A

2017-10-19

Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.

Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

Science.gov (United States)

Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

2017-11-01

The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

Science.gov (United States)

Valderrama, W B; Mills, E W; Cutter, C N

2009-11-01

Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

Review of Prosthetic Joint Infection from Listeria monocytogenes.

Science.gov (United States)

Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

2016-12-01

Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

Animal models for oral transmission of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Sarah E F D'Orazio

2014-02-01

Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

Bacteriophage-Based Bacterial Wilt Biocontrol for an Environmentally Sustainable Agriculture

Directory of Open Access Journals (Sweden)

Belén Álvarez

2017-07-01

Full Text Available Bacterial wilt diseases caused by Ralstonia solanacearum, R. pseudosolanacearum, and R. syzygii subsp. indonesiensis (former R. solanacearum species complex are among the most important plant diseases worldwide, severely affecting a high number of crops and ornamentals. Difficulties of bacterial wilt control by non-biological methods are related to effectiveness, bacterial resistance and environmental impact. Alternatively, a great many biocontrol strategies have been carried out, with the advantage of being environmentally friendly. Advances in bacterial wilt biocontrol include an increasing interest in bacteriophage-based treatments as a promising re-emerging strategy. Bacteriophages against the bacterial wilt pathogens have been described with either lytic or lysogenic effect but, they were proved to be active against strains belonging to R. pseudosolanacearum and/or R. syzygii subsp. indonesiensis, not to the present R. solanacearum species, and only two of them demonstrated successful biocontrol potential in planta. Despite the publication of three patents on the topic, until now no bacteriophage-based product is commercially available. Therefore, there is still much to be done to incorporate valid bacteriophages in an integrated management program to effectively fight bacterial wilt in the field.

Bacteriophage-Based Bacterial Wilt Biocontrol for an Environmentally Sustainable Agriculture.

Science.gov (United States)

Álvarez, Belén; Biosca, Elena G

2017-01-01

Bacterial wilt diseases caused by Ralstonia solanacearum , R. pseudosolanacearum , and R. syzygii subsp. indonesiensis (former R. solanacearum species complex) are among the most important plant diseases worldwide, severely affecting a high number of crops and ornamentals. Difficulties of bacterial wilt control by non-biological methods are related to effectiveness, bacterial resistance and environmental impact. Alternatively, a great many biocontrol strategies have been carried out, with the advantage of being environmentally friendly. Advances in bacterial wilt biocontrol include an increasing interest in bacteriophage-based treatments as a promising re-emerging strategy. Bacteriophages against the bacterial wilt pathogens have been described with either lytic or lysogenic effect but, they were proved to be active against strains belonging to R. pseudosolanacearum and/or R. syzygii subsp. indonesiensis , not to the present R. solanacearum species, and only two of them demonstrated successful biocontrol potential in planta . Despite the publication of three patents on the topic, until now no bacteriophage-based product is commercially available. Therefore, there is still much to be done to incorporate valid bacteriophages in an integrated management program to effectively fight bacterial wilt in the field.

Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

Directory of Open Access Journals (Sweden)

Roberta Ortenzi

2015-09-01

Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

Environmental Bacteriophages of the Emerging Enterobacterial Phytopathogen, Dickeya solani, Show Genomic Conservation and Capacity for Horizontal Gene Transfer between Their Bacterial Hosts

Directory of Open Access Journals (Sweden)

Andrew Day

2017-08-01

Full Text Available Dickeya solani is an economically important phytopathogen widespread in mainland Europe that can reduce potato crop yields by 25%. There are no effective environmentally-acceptable chemical systems available for diseases caused by Dickeya. Bacteriophages have been suggested for use in biocontrol of this pathogen in the field, and limited field trials have been conducted. To date only a small number of bacteriophages capable of infecting D. solani have been isolated and characterized, and so there is a need to expand the repertoire of phages that may have potential utility in phage therapy strategies. Here we describe 67 bacteriophages from environmental sources, the majority of which are members of the viral family Myoviridae. Full genomic sequencing of two isolates revealed a high degree of DNA identity with D. solani bacteriophages isolated in Europe in the past 5 years, suggesting a wide ecological distribution of this phage family. Transduction experiments showed that the majority of the new environmental bacteriophages are capable of facilitating efficient horizontal gene transfer. The possible risk of unintentional transfer of virulence or antibiotic resistance genes between hosts susceptible to transducing phages cautions against their environmental use for biocontrol, until specific phages are fully tested for transduction capabilities.

BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

Directory of Open Access Journals (Sweden)

Nilma Cintra Lea

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

DEFF Research Database (Denmark)

Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek

2010-01-01

-Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....

Prevalence of Listeria monocytogenes in poultry production in France.

Science.gov (United States)

Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

2008-10-01

This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

OpenAIRE

SABIL, SYAHRIANA

2015-01-01

2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

Science.gov (United States)

Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

2018-04-27

The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

Extraction and Study of Bacteriophages, Used against Agents of Potato Soft Rot

Directory of Open Access Journals (Sweden)

Magda D. Davitashvili

2012-12-01

Full Text Available The use of specific bacteriophages and their complex mixtures against bacterial diseases is very effective. As for causative agent of potato soft rot Erwinia carotovora, specific phages (25 phages in total were extracted from diseased potato, soil and sewage. The study of their biological properties showed the diversity of phages in terms of lytic action, virion plaque and morphology, as well as in relation to different environmental factors. Phages showed explicit antibacterial activity in vitro in liquid and solid media, as well as during model tests of potato tubers artificial inoculation.

Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

Science.gov (United States)

de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

2018-04-12

Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

Novel Cadmium Resistance Determinant in Listeria monocytogenes.

Science.gov (United States)

Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

2017-03-01

Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

Identification and Characterization of T5-Like Bacteriophages Representing Two Novel Subgroups from Food Products

Directory of Open Access Journals (Sweden)

Domonkos Sváb

2018-02-01

Full Text Available During recent years, interest in the use of bacteriophages as biocontrol agents against foodborne pathogens has increased, particularly for members of the family Enterobacteriaceae, with pathogenic Escherichia coli, Shigella, and Salmonella strains among them. Here, we report the isolation and characterisation of 12 novel T5-like bacteriophages from confiscated food samples. All bacterophages effectively lysed E. coli K-12 strains and were able to infect pathogenic E. coli strains representing enterohaemorrhagic (EHEC, enteropathogenic (EPEC, enterotoxigenic (ETEC, and enteroinvasive (EIEC pathotypes, Shigella dysenteriae, S. sonnei strains, as well as multidrug-resistant (MDR E. coli and multiple strains representing different Salmonella enterica serovars. All the bacteriophages exhibited Siphoviridae morphology. Whole genome sequencing of the novel T5-like bacteriophages showed that they represent two distinct groups, with the genome-based grouping correlating to the different host spectra. As these bacteriophages are of food origin, their stability and lack of any virulence genes, as well as their broad and mutually complementary host spectrum makes these new T5-like bacteriophages valuable candidates for use as biocontrol agents against foodborne pathogenic enterobacteria.

Evaluation of a loop-mediated isothermal amplification method for the detection of Listeria monocytogenes in dairy food

Directory of Open Access Journals (Sweden)

Erica Tirloni

2017-12-01

Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.

Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

Science.gov (United States)

Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

2007-10-01

To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

Directory of Open Access Journals (Sweden)

Ashley M. Sherrid

2013-01-01

Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

Science.gov (United States)

Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

Comparative Genomics of Bacteriophage of the Genus Seuratvirus

DEFF Research Database (Denmark)

Sazinas, Pavelas; Redgwell, Tamsin; Rihtman, Branko

2017-01-01

polB and terL showed these bacteriophages to be closely related to members of the genus Seuratvirus. We performed a core-gene analysis using the 14 new and four closely related genomes. A total of 58 core genes were identified, the majority of which has no known function. These genes were used...... to construct a core-gene phylogeny, the results of which confirmed the new isolates to be part of the genus Seuratvirus and expanded the number of species within this genus to four. All bacteriophages within the genus contained the genes queCDE encoding enzymes involved in queuosine biosynthesis. We suggest...

Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

Directory of Open Access Journals (Sweden)

Ivy Reid A

2008-11-01

Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

Analysis of Bacillus subtilis sporulation with spore-converting bacteriophage PMB12.

OpenAIRE

Kinney, D M; Bramucci, M G

1981-01-01

Previous observations concerning the ability of the spore-converting bacteriophage PMB12 to cause sporulation in certain sporulation-deficient mutants of Bacillus subtilis 168 were extended to include a spoOK mutant and a mutant temperature sensitive for sporulation due to a ribosomal mutation. Mutants of PMB12 that were unable to induce sporulation in the spoOK mutant were isolated to determine whether PMB12-encoded products had to affect the sporulation-specific functions of both the transc...

Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.

Science.gov (United States)

Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa

2012-06-01

Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Science.gov (United States)

Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

2017-01-01

Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

DEFF Research Database (Denmark)

Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter

2006-01-01

The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

Bacteriophage lambda: The path from biology to theranostic agent.

Science.gov (United States)

Catalano, Carlos E

2018-03-13

Viral particles provide an attractive platform for the engineering of semisynthetic therapeutic nanoparticles. They can be modified both genetically and chemically in a defined manner to alter their surface characteristics, for targeting specific cell types, to improve their pharmacokinetic features and to attenuate (or enhance) their antigenicity. These advantages derive from a detailed understanding of virus biology, gleaned from decades of fundamental genetic, biochemical, and structural studies that have provided mechanistic insight into virus assembly pathways. In particular, bacteriophages offer significant advantages as nanoparticle platforms and several have been adapted toward the design and engineering of "designer" nanoparticles for therapeutic and diagnostic (theranostic) applications. The present review focuses on one such virus, bacteriophage lambda; I discuss the biology of lambda, the tools developed to faithfully recapitulate the lambda assembly reactions in vitro and the observations that have led to cooptation of the lambda system for nanoparticle design. This discussion illustrates how a fundamental understanding of virus assembly has allowed the rational design and construction of semisynthetic nanoparticles as potential theranostic agents and illustrates the concept of benchtop to bedside translational research. This article is categorized under: Biology-Inspired Nanomaterials> Protein and Virus-Based Structures Biology-Inspired Nanomaterials> Nucleic Acid-Based Structures. © 2018 Wiley Periodicals, Inc.

Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Cristina Tostes Filgueiras

2006-05-01

Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.

Bacteriophage interactions with marine pathogenic Vibrios

DEFF Research Database (Denmark)

Kalatzis, Panagiotis

development and spreading of antibiotic resistant bacteria in the environment. Bacteriophage therapy, constitutes a potent alternative not only for treatment but also for prevention of vibriosis in aquaculture and the current thesis addresses the potential and challenges of using phages to control Vibrio...... pathogens. The combinatory administration of virulent bacteriophages φSt2 and φGrn1, isolated against Vibrio alginolyticus significantly reduced the Vibrio load in cultures of Artemia salina live prey, decreasing subsequently the risk of a vibriosis outbreak in the marine hatchery. During infection...... therapy applications. Lytic phage vB_VspP_pVa5 that has been isolated against the rapidly emerging pathogen V. splendidus is also a promising candidate for phage therapy application according to its gene content and in vitro performance against its host. The genetic features of vB_VspP_pVa5 provide also...

Comparison of the growth of Listeria monocytogenes in unirradiated and irradiated cook-chill roast beef and gravy at refrigeration temperatures

International Nuclear Information System (INIS)

Grant, I.R.; Nixon, C.R.; Patterson, M.F.

1993-01-01

Specific growth rates of two strains of Listeria monocytogenes in unirradiated and irradiated (2 kGy) roast beef and gravy stored at 5° and 10°C were found to be similar. However, exponential growth of L. monocytogenes after irradiation was preceded by an extended lag period of 6–9 d at 5°C and 3–4 d at 10°C, compared with lag periods of 1–2 d and <0.1 d in unirradiated beef and gravy stored similarly

Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

Science.gov (United States)

Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

2010-06-01

Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

A multiplex PCR for detection of Listeria monocytogenes and its lineages.

Science.gov (United States)

Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

2016-11-01

A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

Directory of Open Access Journals (Sweden)

Nilma Cintra Leal

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

DEFF Research Database (Denmark)

Kastbjerg, Vicky Gaedt; Gram, Lone

2012-01-01

or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients.

Science.gov (United States)

Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M

2009-10-01

The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

Science.gov (United States)

Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

2014-10-17

The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

Science.gov (United States)

Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth

2017-01-01

The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pmonocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112

Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

DEFF Research Database (Denmark)

Hingston, Patricia; Chen, Jessica; Allen, Kevin

2017-01-01

The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain....... This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more...... genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pcold. A core set of 22 genes was upregulated at all growth phases, including nine genes...

Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Nadine Gillmaier

Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

Complete genome sequence of the Pectobacterium carotovorum subsp. carotovorum virulent bacteriophage PM1.

Science.gov (United States)

Lim, Jeong-A; Shin, Hakdong; Lee, Dong Hwan; Han, Sang-Wook; Lee, Ju-Hoon; Ryu, Sangryeol; Heu, Sunggi

2014-08-01

PM1, a novel virulent bacteriophage that infects Pectobacterium carotovorum subsp. carotovorum, was isolated. Its morphological features were examined by electron microscopy, which indicated that this phage belongs to the family Myoviridae. It has a 55,098-bp genome, including a 2,665-bp terminal repeat. A total of 63 open reading frames (ORFs) were predicted, but only 20 ORFs possessed homology with functional proteins. There is one tRNA coding region, and the GC-content of the genome is 44.9 %. Most ORFs in bacteriophage PM1 showed high homology to enterobacteria phage ΦEcoM-GJ1 and Erwinia phage νB EamM-Y2. Like these bacteriophages, PM1 encodes an RNA polymerase, which is a hallmark of T7-like phages. There is no integrase or repressor, suggesting that PM1 is a virulent bacteriophage.

Molecular characterization of podoviral bacteriophages virulent for Clostridium perfringens and their comparison with members of the Picovirinae.

Directory of Open Access Journals (Sweden)

Nikolay V Volozhantsev

Full Text Available Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium responsible for human food-borne disease as well as non-food-borne human, animal and poultry diseases. Because bacteriophages or their gene products could be applied to control bacterial diseases in a species-specific manner, they are potential important alternatives to antibiotics. Consequently, poultry intestinal material, soil, sewage and poultry processing drainage water were screened for virulent bacteriophages that lysed C. perfringens. Two bacteriophages, designated ΦCPV4 and ΦZP2, were isolated in the Moscow Region of the Russian Federation while another closely related virus, named ΦCP7R, was isolated in the southeastern USA. The viruses were identified as members of the order Caudovirales in the family Podoviridae with short, non-contractile tails of the C1 morphotype. The genomes of the three bacteriophages were 17.972, 18.078 and 18.397 kbp respectively; encoding twenty-six to twenty-eight ORF's with inverted terminal repeats and an average GC content of 34.6%. Structural proteins identified by mass spectrometry in the purified ΦCP7R virion included a pre-neck/appendage with putative lyase activity, major head, tail, connector/upper collar, lower collar and a structural protein with putative lysozyme-peptidase activity. All three podoviral bacteriophage genomes encoded a predicted N-acetylmuramoyl-L-alanine amidase and a putative stage V sporulation protein. Each putative amidase contained a predicted bacterial SH3 domain at the C-terminal end of the protein, presumably involved with binding the C. perfringens cell wall. The predicted DNA polymerase type B protein sequences were closely related to other members of the Podoviridae including Bacillus phage Φ29. Whole-genome comparisons supported this relationship, but also indicated that the Russian and USA viruses may be unique members of the sub-family Picovirinae.

Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings.

Science.gov (United States)

Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano

2016-06-01

Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

Science.gov (United States)

Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

2016-11-01

Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

Directory of Open Access Journals (Sweden)

Hristo Daskalov

2014-03-01

Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.

Science.gov (United States)

Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline

2013-10-21

Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

Directory of Open Access Journals (Sweden)

Masoud Rezaei

2012-02-01

Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

Genetically engineered bacteriophage delivers a tumor necrosis factor alpha antagonist coating on neural electrodes

International Nuclear Information System (INIS)

Kim, Young Jun; Nam, Chang-Hoon; Jin, Young-Hyun; Stieglitz, Thomas; Salieb-Beugelaar, Georgette B

2014-01-01

This paper reports a novel approach for the formation of anti-inflammatory surface coating on a neural electrode. The surface coating is realized using a recombinant f88 filamentous bacteriophage, which displays a short platinum binding motif and a tumor necrosis factor alpha antagonist (TNF-α antagonist) on p3 and p8 proteins, respectively. The recombinant bacteriophages are immobilized on the platinum surface by a simple dip coating process. The selective and stable immobilization of bacteriophages on a platinum electrode is confirmed by quartz crystal microbalance with dissipation monitoring, atomic force microscope and fluorescence microscope. From the in vitro cell viability test, the inflammatory cytokine (TNF-α) induced cell death was prevented by presenting recombinant bacteriophage coating, albeit with no significant cytotoxic effect. It is also observed that the bacteriophage coating does not have critical effects on the electrochemical properties such as impedance and charge storage capacities. Thus, this approach demonstrates a promising anti-apoptotic as well as anti-inflammatory surface coating for neural implant applications. (paper)

What history tells us XLIII Bacteriophage

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences; Volume 42; Issue 3. What history tells us XLIII Bacteriophage: The contexts in which it was discovered. MICHEL MORANGE. Series Volume 42 Issue 3 September 2017 pp 359-362. Fulltext. Click here to view fulltext PDF. Permanent link:

TetR-dependent gene regulation in intracellular Listeria monocytogenes demonstrates the spatiotemporal surface distribution of ActA.

Science.gov (United States)

Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J

2017-08-01

To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.

Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

Science.gov (United States)

Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

2013-04-01

Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

Use of a bacteriophage cocktail to control Salmonella in food and the food industry.

Science.gov (United States)

Spricigo, Denis Augusto; Bardina, Carlota; Cortés, Pilar; Llagostera, Montserrat

2013-07-15

The use of lytic bacteriophages for the biocontrol of food-borne pathogens in food and in the food industry is gaining increasing acceptance. In this study, the effectiveness of a bacteriophage cocktail composed of three different lytic bacteriophages (UAB_Phi 20, UAB_Phi78, and UAB_Phi87) was determined in four different food matrices (pig skin, chicken breasts, fresh eggs, and packaged lettuce) experimentally contaminated with Salmonella enterica serovar Typhimurium and S. enterica serovar Enteritidis. A significant bacterial reduction (>4 and 2 log/cm(2) for S. Typhimurium and S. Enteritidis, respectively; p≤0.005) was obtained in pig skin sprayed with the bacteriophage cocktail and then incubated at 33 °C for 6h. Significant decreases in the concentration of S. Typhimurium and S. Enteritidis were also measured in chicken breasts dipped for 5 min in a solution containing the bacteriophage cocktail and then refrigerated at 4 °C for 7 days (2.2 and 0.9 log10 cfu/g, respectively; p≤0.0001) as well as in lettuce similarly treated for 60 min at room temperature (3.9 and 2.2 log10 cfu/g, respectively; p≤0.005). However, only a minor reduction of the bacterial concentration (0.9 log10 cfu/cm(2) of S. Enteritidis and S. Typhimurium; p≤0.005) was achieved in fresh eggs sprayed with the bacteriophage cocktail and then incubated at 25 °C for 2 h. These results show the potential effectiveness of this bacteriophage cocktail as a biocontrol agent of Salmonella in several food matrices under conditions similar to those used in their production. Copyright © 2013 Elsevier B.V. All rights reserved.

Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

Science.gov (United States)

Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

2017-06-01

Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

2010-03-31

Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

Science.gov (United States)

2010-01-01

Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two

Pasteurella haemolytica bacteriophage: identification, partial characterization, and relationship of temperate bacteriophages from isolates of Pasteurella haemolytica (biotype A, serotype 1)

International Nuclear Information System (INIS)

Richards, A.B.; Renshaw, H.W.; Sneed, L.W.

1985-01-01

Pasteurella haemolytica (biotype A, serotype 1) isolates (n = 15) from the upper respiratory tract of clinically normal cattle, as well as from lung lesions from cases of fatal bovine pasteurellosis, were examined for the presence of bacteriophage after irradiation with UV light. Treatment of all P haemolytica isolates with UV irradiation resulted in lysis of bacteria due to the induction of vegetative development of bacteriophages. The extent of growth inhibition and bacterial lysis in irradiated cultures was UV dose-dependent. Bacterial cultures exposed to UV light for 20 s reached peak culture density between 60 and 70 minutes after irradiation; thereafter, culture density declined rapidly, so that by 120 minutes, it was approximately 60% of the original value. When examined ultrastructurally, lytic cultures from each isolate revealed bacteriophages with an overall length of approximately 200 nm and that appeared to have a head with icosahedral symmetry and a contractile tail. Cell-free filtrate from each noninduced bacterial isolate was inoculated onto the other bacterial isolates in a cross-culture sensitivity assay for the presence of phages lytic for the host bacterial isolates. Zones of lysis (plaques) did not develop when bacterial lawns grown from the different isolates were inoculated with filtrates from the heterologous isolates

Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

Directory of Open Access Journals (Sweden)

Shi eWu

2016-02-01

Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

2016-01-01

Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Genome Analysis of Listeria monocytogenes Sequence Type 8 Strains Persisting in Salmon and Poultry Processing Environments and Comparison with Related Strains

Science.gov (United States)

Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even

2016-01-01

Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety

In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Maria da Graça F. Nascimento

1994-12-01

Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

Science.gov (United States)

Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

2011-06-01

This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

Science.gov (United States)

Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

2017-11-01

Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

DEFF Research Database (Denmark)

Kallipolitis, B H; Ingmer, H

2001-01-01

Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.

Science.gov (United States)

Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun

2012-03-01

Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.

Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

nahid Navijouy

2013-08-01

Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

A dynamical systems approach to actin-based motility in Listeria monocytogenes

Science.gov (United States)

Hotton, S.

2010-11-01

A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

Science.gov (United States)

VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

2016-10-01

Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

RNA Packing Specificity and Folding during Assembly of the Bacteriophage MS2

Directory of Open Access Journals (Sweden)

Ottar Rolfsson

2008-01-01

Full Text Available Using a combination of biochemistry, mass spectrometry, NMR spectroscopy and cryo-electron microscopy (cryo-EM, we have been able to show that quasi-equivalent conformer switching in the coat protein (CP of an RNA bacteriophage (MS2 is controlled by a sequence-specific RNA–protein interaction. The RNA component of this complex is an RNA stem-loop encompassing just 19 nts from the phage genomic RNA, which is 3569 nts in length. This binding results in the conversion of a CP dimer from a symmetrical conformation to an asymmetric one. Only when both symmetrical and asymmetrical dimers are present in solution is assembly of the T = 3 phage capsid efficient. This implies that the conformers, we have characterized by NMR correspond to the two distinct quasi-equivalent conformers seen in the 3D structure of the virion. An icosahedrally-averaged single particle cryo-EM reconstruction of the wild-type phage (to ∼9 Å resolution has revealed icosahedrally ordered density encompassing up to 90% of the single-stranded RNA genome. The RNA is seen with a novel arrangement of two concentric shells, with connections between them along the 5-fold symmetry axes. RNA in the outer shell interacts with each of the 90 CP dimers in the T = 3 capsid and although the density is icosahedrally averaged, there appears to be a different average contact at the different quasi-equivalent protein dimers: precisely the result that would be expected if protein conformer switching is RNA-mediated throughout the assembly pathway. This unprecedented RNA structure provides new constraints for models of viral assembly and we describe experiments aimed at probing these. Together, these results suggest that viral genomic RNA folding is an important factor in efficient assembly, and further suggest that RNAs that could sequester viral CPs but not fold appropriately could act as potent inhibitors of viral assembly.

BRED: a simple and powerful tool for constructing mutant and recombinant bacteriophage genomes.

Directory of Open Access Journals (Sweden)

Laura J Marinelli

Full Text Available Advances in DNA sequencing technology have facilitated the determination of hundreds of complete genome sequences both for bacteria and their bacteriophages. Some of these bacteria have well-developed and facile genetic systems for constructing mutants to determine gene function, and recombineering is a particularly effective tool. However, generally applicable methods for constructing defined mutants of bacteriophages are poorly developed, in part because of the inability to use selectable markers such as drug resistance genes during viral lytic growth. Here we describe a method for simple and effective directed mutagenesis of bacteriophage genomes using Bacteriophage Recombineering of Electroporated DNA (BRED, in which a highly efficient recombineering system is utilized directly on electroporated phage DNA; no selection is required and mutants can be readily detected by PCR. We describe the use of BRED to construct unmarked gene deletions, in-frame internal deletions, base substitutions, precise gene replacements, and the addition of gene tags.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage

Directory of Open Access Journals (Sweden)

Michline Brice

2013-10-01

Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE.

Science.gov (United States)

Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne

2013-08-16

Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

Engineered enzymatically active bacteriophages and methods of uses thereof

Energy Technology Data Exchange (ETDEWEB)

Collins, James J [Newton, MA; Kobayashi, Hideki [Yokohama, JP; Kearn, Mads [Ottawa, CA; Araki, Michihiro [Minatoku, JP; Friedland, Ari [Boston, MA; Lu, Timothy Kuan-Ta [Palo Alto, CA

2012-05-22

The present invention provides engineered bacteriophages that express at least one biofilm degrading enzyme on their surface and uses thereof for degrading bacterial biofilms. The invention also provides genetically engineered bacteriophages expressing the biofilm degrading enzymes and proteins necessary for the phage to replicate in different naturally occurring biofilm producing bacteria. The phages of the invention allow a method of biofilm degradation by the use of one or only a few administration of the phage because the system using these phages is self perpetuating, and capable of degrading biofilm even when the concentration of bacteria within the biofilm is low.

Bacteriophages of Leuconostoc, Oenococcus and Weissella

Directory of Open Access Journals (Sweden)

Witold P. Kot

2014-04-01

Full Text Available Leuconostoc (Ln., Weissella and Oenococcus form a group of related genera of lactic acid bacteria, which once all shared the name Leuconostoc. They are associated with plants, fermented vegetable products, raw milk, dairy products, meat and fish. Most of industrially relevant Leuconostoc strains can be classified as either Ln. mesenteroides or Ln. pseudomesenteroides. They are important flavor producers in dairy fermentations and they initiate nearly all vegetable fermentations. Therefore bacteriophages attacking Leuconostoc strains may negatively influence the production process. Bacteriophages attacking Leuconostoc strains were first reported in 1946. Since then, the majority of described Leuconostoc phages was isolated from either dairy products or fermented vegetable products. Both lytic and temperate phages of Leuconostoc were reported. Most of Leuconostoc phages examined using electron microscopy belong to the Siphoviridae family and differ in morphological details. Hybridization and comparative genomic studies of Leuconostoc phages suggest that they can be divided into several groups, however overall diversity of Leuconostoc phages is much lower as compared to e.g. lactococcal phages. Several fully sequenced genomes of Leuconostoc phages have been deposited in public databases. Lytic phages of Leuconostoc can be divided into two host species-specific groups with similarly organized genomes that shared very low nucleotide similarity. Phages of dairy Leuconostoc have rather limited host-ranges. The receptor binding proteins of two lytic Ln. pseudomesenteroides phages have been identified. Molecular tools for detection of dairy Leuconostoc phages have been developed. The rather limited data on phages of Oenococcus and Weissella show that i lysogeny seems to be abundant in Oenococcus strains, and ii several phages infecting Weissella cibaria are also able to productively infect strains of other Weissella species and even strains of the genus

Bacteriophages show promise as antimicrobial agents.

Science.gov (United States)

Alisky, J; Iczkowski, K; Rapoport, A; Troitsky, N

1998-01-01

The emergence of antibiotic-resistant bacteria has prompted interest in alternatives to conventional drugs. One possible option is to use bacteriophages (phage) as antimicrobial agents. We have conducted a literature review of all Medline citations from 1966-1996 that dealt with the therapeutic use of phage. There were 27 papers from Poland, the Soviet Union, Britain and the U.S.A. The Polish and Soviets administered phage orally, topically or systemically to treat a wide variety of antibiotic-resistant pathogens in both adults and children. Infections included suppurative wound infections, gastroenteritis, sepsis, osteomyelitis, dermatitis, empyemas and pneumonia; pathogens included Staphylococcus, Streptococcus, Klebsiella, Escherichia, Proteus, Pseudomonas, Shigella and Salmonella spp. Overall, the Polish and Soviets reported success rates of 80-95% for phage therapy, with rare, reversible gastrointestinal or allergic side effects. However, efficacy of phage was determined almost exclusively by qualitative clinical assessment of patients, and details of dosages and clinical criteria were very sketchy. There were also six British reports describing controlled trials of phage in animal models (mice, guinea pigs and livestock), measuring survival rates and other objective criteria. All of the British studies raised phage against specific pathogens then used to create experimental infections. Demonstrable efficacy against Escherichia, Acinetobacter, Pseudomonas and Staphylococcus spp. was noted in these model systems. Two U.S. papers dealt with improving the bioavailability of phage. Phage is sequestered in the spleen and removed from circulation. This can be overcome by serial passage of phage through mice to isolate mutants that resist sequestration. In conclusion, bacteriophages may show promise for treating antibiotic resistant pathogens. To facilitate further progress, directions for future research are discussed and a directory of authors from the reviewed

Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin.

Science.gov (United States)

Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale

2004-04-20

Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.

A Bacteriophage-Related Chimeric Marine Virus Infecting Abalone

Science.gov (United States)

Zhuang, Jun; Cai, Guiqin; Lin, Qiying; Wu, Zujian; Xie, Lianhui

2010-01-01

Marine viruses shape microbial communities with the most genetic diversity in the sea by multiple genetic exchanges and infect multiple marine organisms. Here we provide proof from experimental infection that abalone shriveling syndrome-associated virus (AbSV) can cause abalone shriveling syndrome. This malady produces histological necrosis and abnormally modified macromolecules (hemocyanin and ferritin). The AbSV genome is a 34.952-kilobase circular double-stranded DNA, containing putative genes with similarity to bacteriophages, eukaryotic viruses, bacteria and endosymbionts. Of the 28 predicted open reading frames (ORFs), eight ORF-encoded proteins have identifiable functional homologues. The 4 ORF products correspond to a predicted terminase large subunit and an endonuclease in bacteriophage, and both an integrase and an exonuclease from bacteria. The other four proteins are homologous to an endosymbiont-derived helicase, primase, single-stranded binding (SSB) protein, and thymidylate kinase, individually. Additionally, AbSV exhibits a common gene arrangement similar to the majority of bacteriophages. Unique to AbSV, the viral genome also contains genes associated with bacterial outer membrane proteins and may lack the structural protein-encoding ORFs. Genomic characterization of AbSV indicates that it may represent a transitional form of microbial evolution from viruses to bacteria. PMID:21079776

A bacteriophage-related chimeric marine virus infecting abalone.

Directory of Open Access Journals (Sweden)

Jun Zhuang

Full Text Available Marine viruses shape microbial communities with the most genetic diversity in the sea by multiple genetic exchanges and infect multiple marine organisms. Here we provide proof from experimental infection that abalone shriveling syndrome-associated virus (AbSV can cause abalone shriveling syndrome. This malady produces histological necrosis and abnormally modified macromolecules (hemocyanin and ferritin. The AbSV genome is a 34.952-kilobase circular double-stranded DNA, containing putative genes with similarity to bacteriophages, eukaryotic viruses, bacteria and endosymbionts. Of the 28 predicted open reading frames (ORFs, eight ORF-encoded proteins have identifiable functional homologues. The 4 ORF products correspond to a predicted terminase large subunit and an endonuclease in bacteriophage, and both an integrase and an exonuclease from bacteria. The other four proteins are homologous to an endosymbiont-derived helicase, primase, single-stranded binding (SSB protein, and thymidylate kinase, individually. Additionally, AbSV exhibits a common gene arrangement similar to the majority of bacteriophages. Unique to AbSV, the viral genome also contains genes associated with bacterial outer membrane proteins and may lack the structural protein-encoding ORFs. Genomic characterization of AbSV indicates that it may represent a transitional form of microbial evolution from viruses to bacteria.

Pecularities of mutagenesis of T4Br bacteriophage under the direct and indirect radiation effects

International Nuclear Information System (INIS)

Yurov, S.S.

1975-01-01

Different lethal and mutagenic effects were shown when bacteriophage T4Br + (470 r/min) was irradiated in broth (direct effect) and a buffer solution (direct and indirect action). The survival rate of the bacteriophage in the buffer solution was 0.1 percent for a dose rate of 60 kr; in the broth it was 10 percent. The frequency of mutation of the bacteriophage also showed the greater effect of the irradiation in the buffer solution than in the broth (25 and 5 r-mutants respectively at a dose rate of 10 kr). An analysis of the ratio of the r-groups when the bacteriophage was treated in various ways revealed differences between mutagenesis produced in the broth and the buffer, and spontaneous mutagenesis. (V.A.P.)

Removal of endotoxins from bacteriophage preparations by extraction with organic solvents.

Directory of Open Access Journals (Sweden)

Bożena Szermer-Olearnik

Full Text Available Lipopolysaccharide (LPS, endotoxin, pyrogen constitutes a very troubling contaminant of crude phage lysates produced in Gram-negative bacteria. Toxicity of LPS depends on the strong innate immunity response including the cytokines. Therefore, its removal is important for bacteriophage applications. In this paper, we present a procedure for extractive removal of endotoxin from bacteriophage preparations with water immiscible solvents (1-octanol or 1-butanol. During extraction most of the phage lytic activity is retained in the aqueous phase, while endotoxin accumulates in the organic solvent. The levels of endotoxin (expressed as endotoxin units, EU in the aqueous bacteriophage-containing fraction determined by limulus amebocyte lysate or EndoLISA assay were exceptionally low. While the initial endotoxin levels in the crude phage lysates ranged between 10(3 and 10(5 EU/ml the average level after organic extraction remaining in the aqueous fraction was 5.3 EU/ml. These values when related to phage titers decreased from 10(3-10(5 EU/10(9 PFU (plaque forming units down to an average of 2.8 EU/10(9 PFU. The purification procedure is scalable, efficient and applicable to all the bacteriophages tested: T4, HAP1 (E. coli and F8 (P. aeruginosa.

Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Joelle K Salazar

Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

Science.gov (United States)

NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

2018-03-01

Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Directory of Open Access Journals (Sweden)

Mira Rakic Martinez

Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Wang Y

2017-01-01

Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect

Genesis of a novel Shigella flexneri serotype by sequential infection of serotype-converting bacteriophages SfX and SfI

Directory of Open Access Journals (Sweden)

Sun Qiangzheng

2011-12-01

Full Text Available Abstract Background Shigella flexneri is the major pathogen causing bacillary dysentery. Fifteen serotypes have been recognized up to now. The genesis of new S. flexneri serotypes is commonly mediated by serotype-converting bacteriophages. Untypeable or novel serotypes from natural infections had been reported worldwide but have not been generated in laboratory. Results A new S. flexneri serotype-serotype 1 d was generated when a S. flexneri serotype Y strain (native LPS was sequentially infected with 2 serotype-converting bacteriophages, SfX first and then SfI. The new serotype 1 d strain agglutinated with both serotype X-specific anti-7;8 grouping serum and serotype 1a-specific anti- I typing serum, and differed from subserotypes 1a, 1b and 1c. Twenty four S. flexneri clinical isolates of serotype X were all converted to serotype 1 d by infection with phage SfI. PCR and sequencing revealed that SfI and SfX were integrated in tandem into the proA-yaiC region of the host chromosome. Conclusions These findings suggest a new S. flexneri serotype could be created in nature. Such a conversion may be constrained by susceptibility of a strain to infection by a given serotype-converting bacteriophage. This finding has significant implications in the emergence of new S. flexneri serotypes in nature.

Carbon dioxide and nisin act synergistically on Listeria monocytogenes

DEFF Research Database (Denmark)

Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

2000-01-01

This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

Science.gov (United States)

Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

2014-12-01

The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

M13 Bacteriophage Based Protein Sensors

Science.gov (United States)

Lee, Ju Hun

Despite significant progress in biotechnology and biosensing, early detection and disease diagnosis remains a critical issue for improving patient survival rates and well-being. Many of the typical detection schemes currently used possess issues such as low sensitivity and accuracy and are also time consuming to run and expensive. In addition, multiplexed detection remains difficult to achieve. Therefore, developing advanced approaches for reliable, simple, quantitative analysis of multiple markers in solution that also are highly sensitive are still in demand. In recent years, much of the research has primarily focused on improving two key components of biosensors: the bio-recognition agent (bio-receptor) and the transducer. Particular bio-receptors that have been used include antibodies, aptamers, molecular imprinted polymers, and small affinity peptides. In terms of transducing agents, nanomaterials have been considered as attractive candidates due to their inherent nanoscale size, durability and unique chemical and physical properties. The key focus of this thesis is the design of a protein detection and identification system that is based on chemically engineered M13 bacteriophage coupled with nanomaterials. The first chapter provides an introduction of biosensors and M13 bacteriophage in general, where the advantages of each are provided. In chapter 2, an efficient and enzyme-free sensor is demonstrated from modified M13 bacteriophage to generate highly sensitive colorimetric signals from gold nanocrystals. In chapter 3, DNA conjugated M13 were used to enable facile and rapid detection of antigens in solution that also provides modalities for identification. Lastly, high DNA loadings per phage was achieved via hydrozone chemistry and these were applied in conjunction with Raman active DNA-gold/silver core/shell nanoparticles toward highly sensitive SERS sensing.

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

Directory of Open Access Journals (Sweden)

Bahador

2015-08-01

Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

The structures of bacteriophages K1E and K1-5 explain processive degradation of polysaccharide capsules and evolution of new host specificities.

Science.gov (United States)

Leiman, Petr G; Battisti, Anthony J; Bowman, Valorie D; Stummeyer, Katharina; Mühlenhoff, Martina; Gerardy-Schahn, Rita; Scholl, Dean; Molineux, Ian J

2007-08-17

External polysaccharides of many pathogenic bacteria form capsules protecting the bacteria from the animal immune system and phage infection. However, some bacteriophages can digest these capsules using glycosidases displayed on the phage particle. We have utilized cryo-electron microscopy to determine the structures of phages K1E and K1-5 and thereby establish the mechanism by which these phages attain and switch their host specificity. Using a specific glycosidase, both phages penetrate the capsule and infect the neuroinvasive human pathogen Escherichia coli K1. In addition to the K1-specific glycosidase, each K1-5 particle carries a second enzyme that allows it to infect E. coli K5, whose capsule is chemically different from that of K1. The enzymes are organized into a multiprotein complex attached via an adapter protein to the virus portal vertex, through which the DNA is ejected during infection. The structure of the complex suggests a mechanism for the apparent processivity of degradation that occurs as the phage drills through the polysaccharide capsule. The enzymes recognize the adapter protein by a conserved N-terminal sequence, providing a mechanism for phages to acquire different enzymes and thus to evolve new host specificities.

Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish.

Science.gov (United States)

Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P

2016-01-01

The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Non-Identity-Mediated CRISPR-Bacteriophage Interaction Mediated via the Csy and Cas3 Proteins ▿#

Science.gov (United States)

Cady, Kyle C.; O'Toole, George A.

2011-01-01

Studies of the Escherichia, Neisseria, Thermotoga, and Mycobacteria clustered regularly interspaced short palindromic repeat (CRISPR) subtypes have resulted in a model whereby CRISPRs function as a defense system against bacteriophage infection and conjugative plasmid transfer. In contrast, we previously showed that the Yersinia-subtype CRISPR region of Pseudomonas aeruginosa strain UCBPP-PA14 plays no detectable role in viral immunity but instead is required for bacteriophage DMS3-dependent inhibition of biofilm formation by P. aeruginosa. The goal of this study is to define the components of the Yersinia-subtype CRISPR region required to mediate this bacteriophage-host interaction. We show that the Yersinia-subtype-specific CRISPR-associated (Cas) proteins Csy4 and Csy2 are essential for small CRISPR RNA (crRNA) production in vivo, while the Csy1 and Csy3 proteins are not absolutely required for production of these small RNAs. Further, we present evidence that the core Cas protein Cas3 functions downstream of small crRNA production and that this protein requires functional HD (predicted phosphohydrolase) and DEXD/H (predicted helicase) domains to suppress biofilm formation in DMS3 lysogens. We also determined that only spacer 1, which is not identical to any region of the DMS3 genome, mediates the CRISPR-dependent loss of biofilm formation. Our evidence suggests that gene 42 of phage DMS3 (DMS3-42) is targeted by CRISPR2 spacer 1 and that this targeting tolerates multiple point mutations between the spacer and DMS3-42 target sequence. This work demonstrates how the interaction between P. aeruginosa strain UCBPP-PA14 and bacteriophage DMS3 can be used to further our understanding of the diverse roles of CRISPR system function in bacteria. PMID:21398535

In vitro Effectiveness of Commercial Bacteriophage Cocktails on Diverse Extended-Spectrum Beta-Lactamase Producing Escherichia coli Strains.

Science.gov (United States)

Gundogdu, Aycan; Bolkvadze, Darajen; Kilic, Huseyin

2016-01-01

The objective of this study is to determine the in vitro susceptibility of Georgian bacteriophage cocktails on multidrug resistant (MDR) extended-spectrum beta-lactamase producing Escherichia coli (ESBL-EC) isolated from patients' blood and urine cultures. A total of 615 E. coli isolates were included in this study. Phene Plate (PhP)-typing and phylogenetic grouping were used for the typing. Antimicrobial resistance profiles and ESBL production of all isolates were confirmed according to Clinical and Laboratory Standards Institute (CLSI) criteria. The activities of four bacteriophage cocktails (Enko-phage, SES-bacteriophage, Pyo-bacteriophage, and Intesti-bacteriophage) were determined against 142 ESBL-EC using in vitro spot tests. According to this, Enko-phage were active against 87.3% of the tested strains while that ratio was 81.7% for Intesti-bacteriophage, 81.7% for Pyo-bacteriophage, and 59.2% for SES-bacteriophage cocktails. Based on the contingency tests, the phage cocktails were observed to be statistically significantly ( p < 0.001) more effective on ESBL-EC strains belonging to phylogenetic groups D and B2. The employed phage cocktails were found to be affective against all tested resistant types. These results are promising especially for the infections that are caused by MDR pathogens that are difficult to treat. As this is a preliminary step to the potential clinical trials to be designed for the country, in vitro confirmation of their success on a MDR ESBL-EC collection should be accepted as an initial action, which is encouraging to consider clinical trials of phage therapy especially in countries which are not introduce phage therapy.

Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.

Science.gov (United States)

Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko

2014-01-01

The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.

Modeling the growth of Listeria monocytogenes in mold-ripened cheeses.

Science.gov (United States)

Lobacz, Adriana; Kowalik, Jaroslaw; Tarczynska, Anna

2013-06-01

This study presents possible applications of predictive microbiology to model the safety of mold-ripened cheeses with respect to bacteria of the species Listeria monocytogenes during (1) the ripening of Camembert cheese, (2) cold storage of Camembert cheese at temperatures ranging from 3 to 15°C, and (3) cold storage of blue cheese at temperatures ranging from 3 to 15°C. The primary models used in this study, such as the Baranyi model and modified Gompertz function, were fitted to growth curves. The Baranyi model yielded the most accurate goodness of fit and the growth rates generated by this model were used for secondary modeling (Ratkowsky simple square root and polynomial models). The polynomial model more accurately predicted the influence of temperature on the growth rate, reaching the adjusted coefficients of multiple determination 0.97 and 0.92 for Camembert and blue cheese, respectively. The observed growth rates of L. monocytogenes in mold-ripened cheeses were compared with simulations run with the Pathogen Modeling Program (PMP 7.0, USDA, Wyndmoor, PA) and ComBase Predictor (Institute of Food Research, Norwich, UK). However, the latter predictions proved to be consistently overestimated and contained a significant error level. In addition, a validation process using independent data generated in dairy products from the ComBase database (www.combase.cc) was performed. In conclusion, it was found that L. monocytogenes grows much faster in Camembert than in blue cheese. Both the Baranyi and Gompertz models described this phenomenon accurately, although the Baranyi model contained a smaller error. Secondary modeling and further validation of the generated models highlighted the issue of usability and applicability of predictive models in the food processing industry by elaborating models targeted at a specific product or a group of similar products. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Phenotypic, fermentation characterization, and resistance mechanism analysis of bacteriophage-resistant mutants of Lactobacillus delbrueckii ssp. bulgaricus isolated from traditional Chinese dairy products.

Science.gov (United States)

Deng, Kaibo; Fang, Wei; Zheng, Baodong; Miao, Song; Huo, Guicheng

2018-03-01

Bacteriophage infection is a large factor in dairy industrial production failure on the basis of pure inoculation fermentation, and developing good commercial starter cultures from wild dairy products and improving the environmental vigor of starter cultures by enhancing their phage resistance are still the most effective solutions. Here we used a spontaneous isolation method to obtain bacteriophage-resistant mutants of Lactobacillus delbrueckii ssp. bulgaricus strains that are used in traditional Chinese fermented dairy products. We analyzed their phenotypes, fermentation characteristics, and resistance mechanisms. The results showed that bacteriophage-insensitive mutants (BIM) BIM8 and BIM12 had high bacteriophage resistance while exhibiting fermentation and coagulation attributes that were as satisfying as those of their respective parent strains KLDS1.1016 and KLDS1.1028. According to the attachment receptor detection, mutants BIM8 and BIM12 exhibited reduced absorption to bacteriophage phiLdb compared with their respective bacteriophage-sensitive parent strains because of changes to the polysaccharides or teichoic acids connected to their peptidoglycan layer. Additionally, genes, including HSDR, HSDM, and HSDS, encoding 3 subunits of a type I restriction-modification system were identified in their respective parent strains. We also discovered that HSDR and HSDM were highly conserved but that HSDS was variable because it is responsible for the DNA specificity of the complex. The late lysis that occurred only in strain KLDS1.1016 and not in strain KLDS1.1028 suggests that the former and its mutant BIM8 also may have an activatable restriction-modification mechanism. We conclude that the L. bulgaricus BIM8 and BIM12 mutants have great potential in the dairy industry as starter cultures, and their phage-resistance mechanism was effective mainly due to the adsorption interference and restriction-modification system. Copyright © 2018 American Dairy Science

[Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

Science.gov (United States)

Gelbícová, T; Karpísková, R

2012-04-01

Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

Two-Stage Dynamics of In Vivo Bacteriophage Genome Ejection

Science.gov (United States)

Chen, Yi-Ju; Wu, David; Gelbart, William; Knobler, Charles M.; Phillips, Rob; Kegel, Willem K.

2018-04-01

Biopolymer translocation is a key step in viral infection processes. The transfer of information-encoding genomes allows viruses to reprogram the cell fate of their hosts. Constituting 96% of all known bacterial viruses [A. Fokine and M. G. Rossmann, Molecular architecture of tailed double-stranded DNA phages, Bacteriophage 4, e28281 (2014)], the tailed bacteriophages deliver their DNA into host cells via an "ejection" process, leaving their protein shells outside of the bacteria; a similar scenario occurs for mammalian viruses like herpes, where the DNA genome is ejected into the nucleus of host cells, while the viral capsid remains bound outside to a nuclear-pore complex. In light of previous experimental measurements of in vivo bacteriophage λ ejection, we analyze here the physical processes that give rise to the observed dynamics. We propose that, after an initial phase driven by self-repulsion of DNA in the capsid, the ejection is driven by anomalous diffusion of phage DNA in the crowded bacterial cytoplasm. We expect that this two-step mechanism is general for phages that operate by pressure-driven ejection, and we discuss predictions of our theory to be tested in future experiments.

Two-Stage Dynamics of In Vivo Bacteriophage Genome Ejection

Directory of Open Access Journals (Sweden)

Yi-Ju Chen

2018-05-01

Full Text Available Biopolymer translocation is a key step in viral infection processes. The transfer of information-encoding genomes allows viruses to reprogram the cell fate of their hosts. Constituting 96% of all known bacterial viruses [A. Fokine and M. G. Rossmann, Molecular architecture of tailed double-stranded DNA phages, Bacteriophage 4, e28281 (2014], the tailed bacteriophages deliver their DNA into host cells via an “ejection” process, leaving their protein shells outside of the bacteria; a similar scenario occurs for mammalian viruses like herpes, where the DNA genome is ejected into the nucleus of host cells, while the viral capsid remains bound outside to a nuclear-pore complex. In light of previous experimental measurements of in vivo bacteriophage λ ejection, we analyze here the physical processes that give rise to the observed dynamics. We propose that, after an initial phase driven by self-repulsion of DNA in the capsid, the ejection is driven by anomalous diffusion of phage DNA in the crowded bacterial cytoplasm. We expect that this two-step mechanism is general for phages that operate by pressure-driven ejection, and we discuss predictions of our theory to be tested in future experiments.

Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

Science.gov (United States)

Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

2014-11-01

Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Wang Jun

2010-03-01

Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

2013-04-01

Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

Directory of Open Access Journals (Sweden)

S. Colombo

2012-08-01

Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

Bacteriophage-antibiotic synergism to control planktonic and biofilm ...

African Journals Online (AJOL)

Bacteriophage-antibiotic synergism to control planktonic and biofilm producing clinical isolates of Pseudomonas aeruginosa. Amina Amal Mahmoud Nouraldin, Manal Mohammad Baddour, Reem Abdel Hameed Harfoush, Sara AbdelAziz Mohamed Essa ...

Inactivation of Listeria monocytogenes in milk by pulsed electric field.

Science.gov (United States)

Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

1998-09-01

Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

Listeria monocytogenes inhibition by defatted mustard meal-based edible films.

Science.gov (United States)

Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C

2012-02-01

An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.

Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

Science.gov (United States)

Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

2013-12-01

Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible

Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

DEFF Research Database (Denmark)

Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

2000-01-01

A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

Listeria monocytogenes : nog steeds een probleem?

NARCIS (Netherlands)

Beumer, R.R.

2011-01-01

Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

Science.gov (United States)

Hwang, Cheng-An; Sheen, Shiowshuh

2011-05-01

This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

A review of the incidence and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments.

Science.gov (United States)

Lianou, Alexandra; Sofos, John N

2007-09-01

Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail

Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat

International Nuclear Information System (INIS)

Kamat, A.S.; Nair, M.P.

1995-01-01

Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)

How Listeria monocytogenes organizes its surface for virulence

Science.gov (United States)

Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

2014-01-01

Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Aracelly Castro

2013-09-01

Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter.

Science.gov (United States)

Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J

1997-03-01

The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

OpenAIRE

Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

2016-01-01

Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

in vitro effectiveness of commercial bacteriophage cocktails on diverse extended spectrum beta-lactamase (ESBL producing Escherichia coli strains

Directory of Open Access Journals (Sweden)

Aycan Gundogdu

2016-11-01

Full Text Available The objective of this study is to determine the in vitro susceptibility of Georgian bacteriophage cocktails on multi-drug resistant extended-spectrum β-lactamase producing Escherichia coli (ESBL-EC isolated from patients' blood and urine cultures. 615 E. coli isolates were included in this study. PhP-typing and phylogenetic grouping were used for the typing. Antimicrobial resistance profiles and ESBL production of all isolates were confirmed according to CLSI criteria. The activities of four bacteriophage cocktails (Enko-phage, SES-bacteriophage, Pyo-bacteriophage and Intesti-bacteriophage were determined against 142 ESBL- EC using in vitro spot tests. According to this, Enko-phage were active against 87.3% of the tested strains while that ratio was 81.7% for intesti-bacteriophage, 81.7% for Pyo-bacteriophage and 59.2% for SES-bacteriophage cocktails. Based on the contingency tests, the phage cocktails were observed to be statistically significantly (p<0.001 more effective on ESBL-EC strains belonging to phylogenetic groups D and B2. The employed phage cocktails were found to be affective against all tested resistant types. These results are promising especially for the infections that are caused by multi-drug resistant pathogens that are difficult to treat. As this is a preliminary step to the potential clinical trials to be designed for the country, in vitro confirmation of their success on a multi-drug-resistant ESBL-EC collection should be accepted as an initial action, which is encouraging to consider clinical trials of phage therapy especially in countries which are not introduce phage therapy.

Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review

Directory of Open Access Journals (Sweden)

James C. Barton

2018-01-01

Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.

Targeting Antibacterial Agents by Using Drug-Carrying Filamentous Bacteriophages

Science.gov (United States)

Yacoby, Iftach; Shamis, Marina; Bar, Hagit; Shabat, Doron; Benhar, Itai

2006-01-01

Bacteriophages have been used for more than a century for (unconventional) therapy of bacterial infections, for half a century as tools in genetic research, for 2 decades as tools for discovery of specific target-binding proteins, and for nearly a decade as tools for vaccination or as gene delivery vehicles. Here we present a novel application of filamentous bacteriophages (phages) as targeted drug carriers for the eradication of (pathogenic) bacteria. The phages are genetically modified to display a targeting moiety on their surface and are used to deliver a large payload of a cytotoxic drug to the target bacteria. The drug is linked to the phages by means of chemical conjugation through a labile linker subject to controlled release. In the conjugated state, the drug is in fact a prodrug devoid of cytotoxic activity and is activated following its dissociation from the phage at the target site in a temporally and spatially controlled manner. Our model target was Staphylococcus aureus, and the model drug was the antibiotic chloramphenicol. We demonstrated the potential of using filamentous phages as universal drug carriers for targetable cells involved in disease. Our approach replaces the selectivity of the drug itself with target selectivity borne by the targeting moiety, which may allow the reintroduction of nonspecific drugs that have thus far been excluded from antibacterial use (because of toxicity or low selectivity). Reintroduction of such drugs into the arsenal of useful tools may help to combat emerging bacterial antibiotic resistance. PMID:16723570

Thermal Inactivation of Listeria monocytogenes and Salmonella during Water and Steam Blanching of Vegetables.

Science.gov (United States)

Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M

2017-09-01

Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.

Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

Directory of Open Access Journals (Sweden)

Yolanda Albarracín C

2008-08-01

Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

Science.gov (United States)

Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

2008-03-01

To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

Silver as antibacterial towards Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Simone eBelluco

2016-03-01

Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

REALIS: Postgenomic Analysis of Listeria Monocytogenes

Directory of Open Access Journals (Sweden)

The REALIS Consortium

2006-04-01

Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

Bacteriophage use to control Salmonella biofilm on surfaces present in chicken slaughterhouses.

Science.gov (United States)

Garcia, Keila Carolina de Ornellas Dutka; Corrêa, Isadora Mainieri de Oliveira; Pereira, Larissa Quinto; Silva, Tarcísio Macedo; Mioni, Mateus de Souza Ribeiro; Izidoro, Ana Carolina de Moraes; Bastos, Igor Henrique Vellano; Gonçalves, Guilherme Augusto Marietto; Okamoto, Adriano Sakai; Andreatti Filho, Raphael Lucio

2017-09-01

Foodborne diseases represent a major risk to public health worldwide. Pathogenic bacteria can live in the form of biofilm within the food industry, providing a permanent source of contamination. The aim of this study was to evaluate the influence of the types of adhesion surfaces on Salmonella biofilm formation at eight different times, and analyze the action time of a bacteriophage pool on established biofilms. Most of the samples used were classified as weak biofilm producers, with serovars Enteritidis and Heidelberg showing the highest frequency of biofilm formation. Glass and stainless steel surfaces significantly favored biofilm formation at 60 and 36 h of incubation respectively, but the polyvinyl chloride surface did not favor biofilm production, suggesting that the type of material may interfere with production. The bacteriophage pool action period focused on 3 h, but treatment of 9 h on glass surface biofilms was superior to other treatments because it affected the largest number of samples. These results suggests that some surface types and Salmonella serotypes may promote biofilm formation and indicate bacteriophages as an alternative to control biofilms. But further studies are required to prove the effectiveness and safety of bacteriophage therapy as an alternative in the antimicrobial control in the processing plants. © 2017 Poultry Science Association Inc.

Listeriolysin O Regulates the Expression of Optineurin, an Autophagy Adaptor That Inhibits the Growth of Listeria monocytogenes.

Science.gov (United States)

Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena

2017-09-05

Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

Science.gov (United States)

Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-07-04

Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

Directory of Open Access Journals (Sweden)

Imad al Kassaa

2016-06-01

Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

Bacteriophage-antibiotic synergism to control planktonic and biofilm ...

African Journals Online (AJOL)

Amina Amal Mahmoud Nouraldin

2015-07-11

Jul 11, 2015 ... mote resistance to antimicrobial agents, and its occurrence during the infectious ... Biofilm is a structured community of bacterial cells adher- ent to an inert or ..... biofilms with bacteriophages and chlorine. Biotechnol Bioeng.

MetaPhinder-Identifying Bacteriophage Sequences in Metagenomic Data Sets

DEFF Research Database (Denmark)

Jurtz, Vanessa Isabell; Villarroel, Julia; Lund, Ole

2016-01-01

genome structure of many bacteriophages. The method is demonstrated to outperform both BLAST methods based on single hits and methods based on k-mer comparisons. MetaPhinder is available as a web service at the Center for Genomic Epidemiology https://cge.cbs.dtu.dk/services/MetaPhinder/, while the source...... and understand them. Here we present MetaPhinder, a method to identify assembled genomic fragments (i.e. contigs) of phage origin in metage-nomic data sets. The method is based on a comparison to a database of whole genome bacteriophage sequences, integrating hits to multiple genomes to accomodate for the mosaic...... code can be downloaded from https://bitbucket.org/genomicepidemiology/metaphinder or https://github.com/vanessajurtz/MetaPhinder....

Comparison of the virucidal efficacy of peracetic acid, potassium monopersulphate and sodium hypochlorite on bacteriophages P001 and MS2.

Science.gov (United States)

Morin, T; Martin, H; Soumet, C; Fresnel, R; Lamaudière, S; Le Sauvage, A L; Deleurme, K; Maris, P

2015-09-01

The phagicidal activity of peroxy products against the virulent bacteriophage P001 infecting lactic acid bacteria and bacteriophage MS2 used as a surrogate of enteric viruses (EVs) was evaluated and compared to sodium hypochlorite using the EN 13610 European suspension test and a surface test developed in our laboratories. Infectivity tests were adapted and/or developed to determine the activity of disinfectants against reference P001 phage of Lactoccocus lactis and F-specific RNA phage MS2 of Escherichia coli in conditions simulating practical use. Similar concentrations of sodium hypochlorite were phagicidal against both bacteriophages, either at 0·05-0·125% of active chlorine using the suspension test or at 0·12-0·5% using the surface test. For Potassium monopersulphate (MPS), phagicidal concentrations varied from 0·006 to 0·012% whatever the type of test and phages. However, for peracetic acid products (PAP) used in suspension, concentrations 55 times higher were necessary against MS2 (0·271%) than against P001 (0·005%). With the surface test, 0·089-0·178% concentrations of PAP were effective against MS2, but these concentrations were 16-32 times greater than needed against P001. Sodium hypochlorite and MPS had similar phagicidal activities against P001 and MS2, but PAP did not. This is the first comparative study to investigate through suspension and surface tests the difference in resistance to peroxy compounds between a reference bacteriophage (P001) used to evaluate phagicidal concentrations in European standards and a surrogate of EVs (MS2). Results underline the importance of validation tests on pertinent surrogates of viruses or bacteriophages to adjust the concentration of disinfectants for use in the food and water industries. © 2015 The Society for Applied Microbiology.

Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants

Science.gov (United States)

The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

Directory of Open Access Journals (Sweden)

Shahin Gaini

2015-01-01

Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

DEFF Research Database (Denmark)

Gaini, Shahin

2015-01-01

A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.

Science.gov (United States)

Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio

2008-12-01

The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.

Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.

Science.gov (United States)

Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D

2017-06-05

The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

Science.gov (United States)

Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

2010-08-01

Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Patricia Hingston

Full Text Available The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA profiling to characterize the bacterium's cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3× were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431 and magnitude (>1,000-fold of differentially expressed genes (>2-fold, p<0.05 in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12 biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5× observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold

Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Analía L. Laciar

2000-03-01

Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

Science.gov (United States)

Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

2018-04-01

ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

F-Specific RNA Bacteriophages, Especially Members of Subgroup II, Should Be Reconsidered as Good Indicators of Viral Pollution of Oysters.

Science.gov (United States)

Hartard, C; Leclerc, M; Rivet, R; Maul, A; Loutreul, J; Banas, S; Boudaud, N; Gantzer, C

2018-01-01

Norovirus (NoV) is the leading cause of gastroenteritis outbreaks linked to oyster consumption. In this study, we investigated the potential of F-specific RNA bacteriophages (FRNAPH) as indicators of viral contamination in oysters by focusing especially on FRNAPH subgroup II (FRNAPH-II). These viral indicators have been neglected because their behavior is sometimes different from that of NoV in shellfish, especially during the depuration processes usually performed before marketing. However, a significant bias needs to be taken into account. This bias is that, in the absence of routine culture methods, NoV is targeted by genome detection, while the presence of FRNAPH is usually investigated by isolation of infectious particles. In this study, by targeting both viruses using genome detection, a significant correlation between the presence of FRNAPH-II and that of NoV in shellfish collected from various European harvesting areas impacted by fecal pollution was observed. Moreover, during their depuration, while the long period of persistence of NoV was confirmed, a similar or even longer period of persistence of the FRNAPH-II genome, which was over 30 days, was observed. Such a striking genome persistence calls into question the relevance of molecular methods for assessing viral hazards. Targeting the same virus (i.e., FRNAPH-II) by culture and genome detection in specimens from harvesting areas as well as during depuration, we concluded that the presence of genomes in shellfish does not provide any information on the presence of the corresponding infectious particles. In view of these results, infectious FRNAPH detection should be reconsidered as a valuable indicator in oysters, and its potential for use in assessing viral hazard needs to be investigated. IMPORTANCE This work brings new data about the behavior of viruses in shellfish, as well as about the relevance of molecular methods for their detection and evaluation of the viral hazard. First, a strong

The high prevalence of Listeria monocytogenes peritonitis in cirrhotic patients of an Egyptian Medical Center.

Science.gov (United States)

El Sayed Zaki, Maysaa; El Shabrawy, Walaa Othman; El-Eshmawy, Mervat M; Aly Eletreby, Shahera

2011-09-01

Spontaneous bacterial peritonitis (SBP) is a potentially lethal complication of cirrhosis. It is probably the most characteristic infectious complication of cirrhosis. The aim of this study was to evaluate the bacterial and fungal causes of SBP in Egyptian population. Furthermore to predict the occurrence of rare pathogen like Listeria monocytogenes in those patients. The study included 100 patients with end stage liver disease associated with ascites. Patients were suspected to have SBP. The ascitic fluids were subjected to full cytological and microbiological study. The peritoneal fluid cytological study revealed that 50 samples had cell counts >250 cells/mm(3). 37 samples had growth and 13 samples had no growth (CNNA). The distribution of isolated pathogens was Gram positive cocci 48.8% followed by L. monocytogenes 24.4%, Gram negative bacilli 12.2% and Mycobacterium tuberculosis 7.3. The cells counts associated with listeria culture were 475 cells/mm(3) with sensitivity 70% and specificity 68%. The study highlights the prevalence of microorganisms in Egyptian patients with liver cirrhosis associated with ascites. It reflects the occurrence of L. monocytogenes as an important pathogen of such clinical situation. Other rare pathogens like M. tuberculosis are not uncommon in those patients. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Biology and genomics of an historic therapeutic Escherichia coli bacteriophage collection

DEFF Research Database (Denmark)

Baig, Abiyad; Colom, Joan; Barrow, Paul

2017-01-01

We have performed microbiological and genomic characterization of an historic collection of nine bacteriophages, specifically infecting a K1 E. coli O18:K1:H7 ColV+ strain. These phages were isolated from sewage and tested for their efficacy in vivo for the treatment of systemic E. coli infection...... in a mouse infection model by Smith and Huggins (1982). The aim of the study was to identify common microbiological and genomic characteristics, which co-relate to the performance of these phages in in vivo study. These features will allow an informed selection of phages for use as therapeutic agents...

Sensitivity to acetic acid, ability to colonize abiotic surfaces and virulence potential of Listeria monocytogenes EGD-e after incubation on parsley leaves.

Science.gov (United States)

Rieu, A; Guzzo, J; Piveteau, P

2010-02-01

To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.

Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

Directory of Open Access Journals (Sweden)

Valeria Braga

Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

Listeria monocytogenes: monitoramento desse perigo biológico na cadeia produtiva de frangos do sul do Rio Grande do Sul Listeria monocytogenes: assessing this microbiological hazard in a poultry productive chain in southern Rio Grande do Sul

Directory of Open Access Journals (Sweden)

Élen Silveira Nalério

2009-09-01

Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15

Isolation and Characterization of a Virulent Bacteriophage AB1 of Acinetobacter baumannii

Directory of Open Access Journals (Sweden)

Jia Shiru

2010-04-01

Full Text Available Abstract Background Acinetobacter baumannii is an emerging nosocomial pathogen worldwide with increasing prevalence of multi-drug and pan-drug resistance. A. baumannii exists widely in natural environment, especially in health care settings, and has been shown difficult to be eradicated. Bacteriophages are often considered alternative agent for controlling bacterial infection and contamination. In this study, we described the isolation and characterization of one virulent bacteriophage AB1 capable of specifically infecting A. baumannii. Results A virulent bacteriophage AB1, specific for infecting a clinical strain A. baumannii KD311, was first isolated from marine sediment sample. Restriction analysis indicated that phage AB1 was a dsDNA virus with an approximate genome size of 45.2 kb to 46.9 kb. Transmission electron microscopy showed that phage AB1 had an icosahedral head with a non-contractile tail and collar or whisker structures, and might be tentatively classified as a member of the Siphoviridae family. Proteomic pattern of phage AB1, generated by SDS-PAGE using purified phage particles, revealed five major bands and six minor bands with molecular weight ranging from 14 to 80 kilo-dalton. Also determined was the adsorption rate of phage AB1 to the host bacterium, which was significantly enhanced by addition of 10 mM CaCl2. In a single step growth test, phage AB1 was shown having a latent period of 18 minutes and a burst size of 409. Moreover, pH and thermal stability of phage AB1 were also investigated. At the optimal pH 6.0, 73.2% of phages survived after 60 min incubation at 50°C. When phage AB1 was used to infect four additional clinical isolates of A. baumannii, one clinical isolate of Stenotrophomonas maltophilia, and Pseudomonas aeruginosa lab strains PAK and PAO1, none of the tested strains was found susceptible, indicating a relatively narrow host range for phage AB1. Conclusion Phage AB1 was capable of eliciting efficient lysis

Stress Survival Islet 2, Predominantly Present in Listeria monocytogenes Strains of Sequence Type 121, Is Involved in the Alkaline and Oxidative Stress Responses.

Science.gov (United States)

Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin

2017-08-15

The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation

Detection of bacteriophage-infected cells of Lactococcus lactis using flow cytometry

DEFF Research Database (Denmark)

Michelsen, Ole; Cuesta-Dominguez, Álvaro; Albrektsen, Bjarne

2007-01-01

Bacteriophage infection in dairy fermentation constitutes a serious problem worldwide. We have studied bacteriophage infection in Lactococcus lactis by using the flow cytometer. The first effect of the infection of the bacterium is a change from cells in chains toward single cells. We interpret...... describe a new method for detection of phage infection in Lactococcus lactis dairy cultures. The method is based on flow cytometric detection of cells with low-density cell walls. The method allows fast and early detection of phage-infected bacteria, independently of which phage has infected the culture...

A novel approach in acidic disinfection through inhibition of acid resistance mechanisms; Maleic acid-mediated inhibition of glutamate decarboxylase activity enhances acid sensitivity of Listeria monocytogenes.

Science.gov (United States)

Paudyal, Ranju; Barnes, Ruth H; Karatzas, Kimon Andreas G

2018-02-01

Here it is demonstrated a novel approach in disinfection regimes where specific molecular acid resistance systems are inhibited aiming to eliminate microorganisms under acidic conditions. Despite the importance of the Glutamate Decarboxylase (GAD) system for survival of Listeria monocytogenes and other pathogens under acidic conditions, its potential inhibition by specific compounds that could lead to its elimination from foods or food preparation premises has not been studied. The effects of maleic acid on the acid resistance of L. monocytogenes were investigated and found that it has a higher antimicrobial activity under acidic conditions than other organic acids, while this could not be explained by its pKa or Ka values. The effects were found to be more pronounced on strains with higher GAD activity. Maleic acid affected the extracellular GABA levels while it did not affect the intracellular ones. Maleic acid had a major impact mainly on GadD2 activity as also shown in cell lysates. Furthermore, it was demonstrated that maleic acid is able to partly remove biofilms of L. monocytogenes. Maleic acid is able to inhibit the GAD of L. monocytogenes significantly enhancing its sensitivity to acidic conditions and together with its ability to remove biofilms, make a good candidate for disinfection regimes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

Science.gov (United States)

Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

2014-01-01

The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia.

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-12-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Variations in virulence between different electrophoretic types of Listeria monocytogenes

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk

2000-01-01

A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes.

Science.gov (United States)

Vadia, Stephen; Seveau, Stephanie

2014-03-01

Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes

Science.gov (United States)

2014-01-01

The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

Directory of Open Access Journals (Sweden)

Roja Rani Pallavali

Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

Quantitative risk assessment for Listeria monocytogenes in selected categories of deli meats: impact of lactate and diacetate on listeriosis cases and deaths.

Science.gov (United States)

Pradhan, Abani K; Ivanek, Renata; Gröhn, Yrjö T; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin

2009-05-01

Foodborne disease associated with consumption of ready-to-eat foods contaminated with Listeria monocytogenes represents a considerable pubic health concern. In a risk assessment published in 2003, the U.S. Food and Drug Administration and the U.S. Food Safety and Inspection Service estimated that about 90% of human listeriosis cases in the United States are caused by consumption of contaminated deli meats. In this risk assessment, all deli meats were grouped into one of 23 categories of ready-to-eat foods, and only the postretail growth of L. monocytogenes was considered. To provide an improved risk assessment for L. monocytogenes in deli meats, we developed a revised risk assessment that (i) models risk for three subcategories of deli meats (i.e., ham, turkey, and roast beef) and (ii) models L. monocytogenes contamination and growth from production to consumption while considering subcategory-specific growth kinetics parameters (i.e., lag phase and exponential growth rate). This model also was used to assess how reformulation of the chosen deli meat subcategories with L. monocytogenes growth inhibitors (i.e., lactate and diacetate) would impact the number of human listeriosis cases. Use of product-specific growth parameters demonstrated how certain deli meat categories differ in the relative risk of causing listeriosis; products that support more rapid growth and have reduced lag phases (e.g., turkey) represent a higher risk. Although reformulation of deli meats with growth inhibitors was estimated to reduce by about 2.5- to 7.8-fold the number of human listeriosis cases linked to a given deli meat subcategory and thus would reduce the overall risk of human listeriosis, even with reformulation deli meats would still cause a considerable number of human listeriosis cases. A combination of strategies is thus needed to provide continued reduction of these cases. Risk assessment models such as that described here will be critical for evaluation of different control

Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

Science.gov (United States)

Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

2014-01-21

Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

Directory of Open Access Journals (Sweden)

Anna Mureddu

2014-02-01

Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

Molecular and chemical engineering of bacteriophages for potential medical applications.

Science.gov (United States)

Hodyra, Katarzyna; Dąbrowska, Krystyna

2015-04-01

Recent progress in molecular engineering has contributed to the great progress of medicine. However, there are still difficult problems constituting a challenge for molecular biology and biotechnology, e.g. new generation of anticancer agents, alternative biosensors or vaccines. As a biotechnological tool, bacteriophages (phages) offer a promising alternative to traditional approaches. They can be applied as anticancer agents, novel platforms in vaccine design, or as target carriers in drug discovery. Phages also offer solutions for modern cell imaging, biosensor construction or food pathogen detection. Here we present a review of bacteriophage research as a dynamically developing field with promising prospects for further development of medicine and biotechnology.

Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

Directory of Open Access Journals (Sweden)

Elena Dalzini

2014-02-01

Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

Biocontrol of Escherichia coli O157:H7 on fresh-cut spinach and lettuce using a bacteriophage cocktail

Science.gov (United States)

The effect of an E. coli O157:H7-specific bacteriophage cocktail (EcoShield™) was evaluated against nalidixic acid resistant (NalR) E. coli O157:H7 strains in either a) laboratory medium or b) on leafy greens. Laboratory medium cultures were inoculated with 5 log CFU/ml and treated with 7 log PFU/ml...

The metabolic regulator CodY links L. monocytogenes metabolism to virulence by directly activating the virulence regulatory gene, prfA

Science.gov (United States)

Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.

2015-01-01

Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920

An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

DEFF Research Database (Denmark)

Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.

2017-01-01

Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...

Bactericidal Antibiotics Do Not Appear To Cause Oxidative Stress in Listeria monocytogenes

DEFF Research Database (Denmark)

Feld, Louise; Knudsen, Gitte Maegaard; Gram, Lone

2012-01-01

Oxidative stress can be an important contributor to the lethal effect of bactericidal antibiotics in some bacteria, such as Escherichia coli and Staphylococcus aureus. Thus, despite the different target-specific actions of bactericidal antibiotics, they have a common mechanism leading to bacterial...... to cause oxidative stress in L. monocytogenes and propose that this is caused by its noncyclic tricarboxylic acid (TCA) pathway. Hence, in this noncyclic metabolism, there is a decoupling between the antibiotic-mediated cellular requirement for NADH and the induction of TCA enzyme activity, which...

STUDIES ON THE BACTERIOPHAGE OF D'HÉRELLE

Science.gov (United States)

Hetler, D. M.; Bronfenbrenner, J.

1928-01-01

1. During the process of lysis by bacteriophage, there is an appreciable increase in the amount of free amino acid present in the culture. 2. The increase of free amino acid is due to hydrolysis of bacterial protein. PMID:19869482

Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

Directory of Open Access Journals (Sweden)

Catherine E Jobbings

Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

Control options for Listeria monocytogenes in seafoods

DEFF Research Database (Denmark)

Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

2000-01-01

At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.

Science.gov (United States)

Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji

2016-08-01

We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-01-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Chee Hao Kuan

2013-12-01

Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

Directory of Open Access Journals (Sweden)

Fernanda Barbosa dos Reis-Teixeira

Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.

Science.gov (United States)

Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

Directory of Open Access Journals (Sweden)

Jozi Fagundes de Mello

2008-03-01

Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

Science.gov (United States)

Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

2017-01-01

The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

NARCIS (Netherlands)

Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

2009-01-01

Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

Prevalence of Listeria spp. and Molecular Characterization of Listeria monocytogenes Isolates from Broilers at the Abattoir.

Science.gov (United States)

Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc

2015-07-01

Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.

Highly specific salt bridges govern bacteriophage P22 icosahedral capsid assembly: identification of the site in coat protein responsible for interaction with scaffolding protein.

Science.gov (United States)

Cortines, Juliana R; Motwani, Tina; Vyas, Aashay A; Teschke, Carolyn M

2014-05-01

Icosahedral virus assembly requires a series of concerted and highly specific protein-protein interactions to produce a proper capsid. In bacteriophage P22, only coat protein (gp5) and scaffolding protein (gp8) are needed to assemble a procapsid-like particle, both in vivo and in vitro. In scaffolding protein's coat binding domain, residue R293 is required for procapsid assembly, while residue K296 is important but not essential. Here, we investigate the interaction of scaffolding protein with acidic residues in the N-arm of coat protein, since this interaction has been shown to be electrostatic. Through site-directed mutagenesis of genes 5 and 8, we show that changing coat protein N-arm residue 14 from aspartic acid to alanine causes a lethal phenotype. Coat protein residue D14 is shown by cross-linking to interact with scaffolding protein residue R293 and, thus, is intimately involved in proper procapsid assembly. To a lesser extent, coat protein N-arm residue E18 is also implicated in the interaction with scaffolding protein and is involved in capsid size determination, since a cysteine mutation at this site generated petite capsids. The final acidic residue in the N-arm that was tested, E15, is shown to only weakly interact with scaffolding protein's coat binding domain. This work supports growing evidence that surface charge density may be the driving force of virus capsid protein interactions. Bacteriophage P22 infects Salmonella enterica serovar Typhimurium and is a model for icosahedral viral capsid assembly. In this system, coat protein interacts with an internal scaffolding protein, triggering the assembly of an intermediate called a procapsid. Previously, we determined that there is a single amino acid in scaffolding protein required for P22 procapsid assembly, although others modulate affinity. Here, we identify partners in coat protein. We show experimentally that relatively weak interactions between coat and scaffolding proteins are capable of driving

Research of pathogenic bacteria and bacteriophages in the residuals of wastewater treatment plants

International Nuclear Information System (INIS)

Mathlouthi, Soumaya

2011-01-01

The aim of this study is to find the pathogenic bacteria Listeria and Salmonella and to detect of bacterial (fecal coliforms) and viral indicators (bacteriophage) of fecal contamination in the residues of three sewage treatment plants in Greater Tunis: Charguia, Jdaida and Wardia. Three types of samples were analyzed: raw sewage, treated wastewater and sludge. The study showed the presence of pathogenic bacteria in some samples with a frequency of 7 pour cent for Listeria and 21 pour cent for Salmonella. However, none of these organisms has been detected in treated water of Jdaida and Chargia reflecting the efficiency of the purification process in these stations. Furthermore, all samples were positive for the presence of fecal coliforms and bacteriophages with important titles: up to 8.23 log10 (CFU/L) for coliforms and 8.36 log10 (pfu/L) for bacteriophages.

A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

Science.gov (United States)

Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

2016-04-01

A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

Science.gov (United States)

Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

2017-09-01

Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

Recruitment of the major vault protein by InlK: a Listeria monocytogenes strategy to avoid autophagy.

Directory of Open Access Journals (Sweden)

Laurent Dortet

2011-08-01

Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

Directory of Open Access Journals (Sweden)

Vanessa de Vasconcelos Byrne

2016-06-01

Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

Science.gov (United States)

Soares, Charles A; Knuckley, Bryan

2016-06-01

Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

[Studies on the repair of damaged DNA in bacteriophage, bacterial and mammalian systems]: Final report

International Nuclear Information System (INIS)

Friedberg, E.C.

1987-08-01

This study sought to exploit the use of uv radiation as a source of genomic damage. We explored the molecular mechanism of the repair of DNA damage at a number of different levels of biological organization, by investigating bacteriophage, bacterial, yeast and mammalian cells. Not only have observations obtained in one biological system suggested specific experimental approaches in others, but we have also learned that some biochemical pathways for DNA repair are unique to specific organisms. Our studies are summarized in terms of 4 major areas of research activity that span the past 16 years. 86 refs

Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

Science.gov (United States)

Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

2017-03-01

Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

Bacteriophage Distributions and Temporal Variability in the Ocean’s Interior

Directory of Open Access Journals (Sweden)

Elaine Luo

2017-11-01

Full Text Available Bacteriophages are numerically the most abundant DNA-containing entities in the oligotrophic ocean, yet how specific phage populations vary over time and space remains to be fully explored. Here, we conducted a metagenomic time-series survey of double-stranded DNA phages throughout the water column in the North Pacific Subtropical Gyre, encompassing 1.5 years from depths of 25 to 1,000 m. Viral gene sequences were identified in assembled metagenomic samples, yielding an estimated 172,385 different viral gene families. Viral marker gene distributions suggested that lysogeny was more prevalent at mesopelagic depths than in surface waters, consistent with prior prophage induction studies using mitomycin C. A total of 129 ALOHA viral genomes and genome fragments from 20 to 108 kbp were selected for further study, which represented the most abundant phages in the water column. Phage genotypes displayed discrete population structures. Most phages persisted throughout the time-series and displayed a strong depth structure that mirrored the stratified depth distributions of co-occurring bacterial taxa in the water column. Mesopelagic phages were distinct from surface water phages with respect to diversity, gene content, putative life histories, and temporal persistence, reflecting depth-dependent differences in host genomic architectures and phage reproductive strategies. The spatiotemporal distributions of the most abundant open-ocean bacteriophages that we report here provide new insight into viral temporal persistence, life history, and virus-host-environment interactions throughout the open-ocean water column.

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

Directory of Open Access Journals (Sweden)

Maíra Maciel Mattos de Oliveira

2010-03-01

Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.

Science.gov (United States)

de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf

2010-01-01

An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

In vitro characterization and in vivo properties of Salmonellae lytic bacteriophages isolated from free-range layers

Directory of Open Access Journals (Sweden)

L Fiorentin

2004-06-01

Full Text Available Occurrence of food poisoning related to Salmonella-contaminated eggs and chicken meat has been frequent in humans. Salmonella Enteritidis (SE and Salmonella Typhimurium (ST are included among the most important paratyphoid salmonellae associated with chicken meat and eggs. Elimination of Salmonella at the pre-harvest stage can play a significant role in preventing the introduction of this pathogen into the food chain and consequently in the reduction of food poisoning in humans. Bactericidal bacteriophages may provide a natural, nontoxic, feasible and non-expensive component of the multi-factorial approach for a pre-harvest control of Salmonella in poultry. Five bacteriophages lytic for SE PT4 and ST were obtained from 107 samples of feces of free-range layers in Brazil. All bacteriophages were characterized in vitro and in vivo, showing head and tail morphology and dsDNA as nucleic acids. Results of "in vivo" studies suggested that bacteriophages do not remain in Salmonella-free birds longer than one day, whereas they multiply in Salmonella-infected birds for longer periods. Besides, selection for phage-resistant SE PT4 did not seem to occur in the short term. Isolated bacteriophages will be investigated for their potential for pre-harvest biocontrol of SE PT4 in poultry.

Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

Science.gov (United States)

Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

2017-04-01

In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

Science.gov (United States)

Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

2017-09-01

The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

Factors associated with Listeria monocytogenes contamination of cold-smoked pork products produced in Latvia and Lithuania.

OpenAIRE

Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H

2007-01-01

A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...

Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

Science.gov (United States)

Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

2015-01-01

Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

Efficacy of household washing treatments for the control of Listeria monocytogenes on salad vegetables.

Science.gov (United States)

Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni

2012-10-15

The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.

Bacteriophages to combat foodborne infections caused by food contamination by bacteria of the Campylobacter genus

Directory of Open Access Journals (Sweden)

Magdalena Myga-Nowak

2016-09-01

Full Text Available It is estimated that each year more than 2 million people suffer from diarrheal diseases, resulting from the consumption of contaminated meat. Foodborne infections are most frequently caused by small Gram-negative rods Campylobacter. The hosts of these bacteria are mainly birds wherein they are part of the normal intestinal flora. During the commercial slaughter, there is a likelihood of contamination of carcasses by the bacteria found in the intestinal content. In Europe, up to 90% of poultry flocks can be a reservoir of the pathogen. According to the European Food Safety Authority report from 2015, the number of reported and confirmed cases of human campylobacteriosis exceeds 200 thousands per year, and such trend remains at constant level for several years. The occurrence of growing antibiotic resistance in bacteria forces the limitation of antibiotic use in the animal production. Therefore, the European Union allows only using stringent preventive and hygienic treatment on farms. Achieving Campylobacter free chickens using these methods is possible, but difficult to implement and expensive. Utilization of bacterial viruses – bacteriophages, can be a path to provide the hygienic conditions of poultry production and food processing. Formulations applied in the food protection should contain strictly lytic bacteriophages, be non-pyrogenic and retain long lasting biological activity. Currently, on the market there are available commercial bacteriophage preparations for agricultural use, but neither includes phages against Campylobacter. However, papers on the application of bacteriophages against Campylobacter in chickens and poultry products were published in the last few years. In accordance with the estimates, 2-logarithm reduction of Campylobacter in poultry carcases will contribute to the 30-fold reduction in the incidence of campylobacteriosis in humans. Research on bacteriophages against Campylobacter have cognitive and economic

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

DEFF Research Database (Denmark)

Andersen, Jens Kirk; Nørrung, Birgit

2011-01-01

After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

Bacteriophage populations

International Nuclear Information System (INIS)

Klieve, A.V.; Gilbert, R.A.

2005-01-01

Bacteriophages are ubiquitous to the rumen ecosystem; they have a role in nitrogen metabolism through bacterial lysis in the rumen, they may help to regulate bacterial population densities, be an agent for genetic exchange and be of use in biocontrol of bacterial populations through phage therapy. In Chapter 2.1, classical methodologies to enable the isolation, enumeration, storage and morphological characterization of phages were presented. In addition to these classic procedures, molecular biological techniques have resulted in a range of methodologies to investigate the type, topology and size of phage nucleic acids, to fingerprint individual phage strains and to create a profile of ruminal phage populations. Different phage families possess all the currently identified combinations of double-stranded or single-stranded RNA or DNA and may also possess unusual bases such as 5-hydroxymethylcytosine (found in T-even phage) or 5- hydroxymethyluracil and uracil in place of thymidine. In all morphological groups of phage except the filamentous phages, the nucleic acid is contained within a head or polyhedral structure, predominantly composed of protein. Filamentous phages have their nucleic acid contained inside the helical filament, occupying much of its length. Many of the procedures used with phage nucleic acids and double-stranded (ds) DNA, in particular, are not specific to ruminal phages but are the same as in other areas where nucleic acids are investigated and are covered elsewhere in the literature and this chapter. Most applications with rumen phages are similar to those reported for phages of non-ruminal bacteria and are covered in general texts such as Maniatis et al. In this chapter, we will concentrate on aspects of methodology as they relate to ruminal phages

Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage

Science.gov (United States)

Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.

2017-09-01

The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.

Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese.

Science.gov (United States)

Cui, H Y; Wu, J; Lin, L

2016-08-01

Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Contractile injection systems of bacteriophages and related systems

DEFF Research Database (Denmark)

Taylor, Nicholas M I; van Raaij, Mark J; Leiman, Petr G

2018-01-01

Contractile tail bacteriophages, or myobacteriophages, use a sophisticated biomolecular structure to inject their genome into the bacterial host cell. This structure consists of a contractile sheath enveloping a rigid tube that is sharpened by a spike-shaped protein complex at its tip. The spike ...

Bacteriophage Infectivity Against Pseudomonas aeruginosa in Saline Conditions

KAUST Repository

Scarascia, Giantommaso; Yap, Scott A.; Kaksonen, Anna H.; Hong, Pei-Ying

2018-01-01

at different temperature, pH, and salinity. Bacteriophages showed optimal infectivity at a multiplicity of infection of 10 in saline conditions, and demonstrated lytic abilities over all tested temperature (25, 30, 37, and 45°C) and pH 6–9. Planktonic P

Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

Science.gov (United States)

Weller, Daniel; Wiedmann, Martin

2015-01-01

While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

Ability of Bacillus subtilis protoplasts to repair irradiated bacteriophage deoxyribonucleic acid via acquired and natural enzymatic systems

International Nuclear Information System (INIS)

Yasbin, R.E.; Andersen, B.J.; Sutherland, B.M.

1981-01-01

A novel form of enzyme therapy was achieved by utilizing protoplasts of Bacillus subtilis. Photoreactivating enzyme of Escherichia coli was successfully inserted into the protoplasts of B. subtilis treated with polyethylene glycol. This enzyme was used to photoreactivate ultraviolet-damaged bacteriophage deoxyribonucleic acid (DNA). Furthermore, in polyethylene glycol-treated protoplasts, ultraviolet-irradiated transfecting bacteriophage DNA was shown to be a functional substrate for the host DNA excision repair system. Previous results (R.E. Yasbin, J.D. Fernwalt, and P.I. Fields, J. Bacteriol.; 137: 391-396) showed that ultraviolet-irradiated bacteriophage DNA could not be repaired via the excision repair system of competent cells. Therefore, the processing of bacteriophage DNA by protoplasts and by competent cells must be different. This sensitive protoplast assay can be used to identify and to isolate various types of DNA repair enzymes

RGD peptide-displaying M13 bacteriophage/PLGA nanofibers as cell-adhesive matrices for smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Shin, Yong Cheol; Lee, Jong Ho; Jin, Oh Seong; Lee, Eun Ji; Jin, Lin Hua; Kim, Chang Seok; Hong, Suck Won; Han, Dong Wook; Kim, Chun Tae; Oh, Jin Woo [Pusan National University, Busan (Korea, Republic of)

2015-01-15

Extracellular matrices (ECMs) are network structures that play an essential role in regulating cellular growth and differentiation. In this study, novel nanofibrous matrices were fabricated by electrospinning M13 bacteriophage and poly(lactic-co-glycolic acid) (PLGA) and were shown to be structurally and functionally similar to natural ECMs. A genetically-engineered M13 bacteriophage was constructed to display Arg-Gly-Asp (RGD) peptides on its surface. The physicochemical properties of RGD peptide-displaying M13 bacteriophage (RGD-M13 phage)/PLGA nanofibers were characterized by using scanning electron microscopy and Fourier-transform infrared spectroscopy. We used immunofluorescence staining to confirm that M13 bacteriophages were homogenously distributed in RGD-M13 phage/PLGA matrices. Furthermore, RGD-M13 phage/PLGA nanofibrous matrices, having excellent biocompatibility, can enhance the behaviors of vascular smooth muscle cells. This result suggests that RGD-M13 phage/PLGA nanofibrous matrices have potentials to serve as tissue engineering scaffolds.

Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

NARCIS (Netherlands)

Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

2013-01-01

The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

Science.gov (United States)

Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia.

Science.gov (United States)

Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S

2013-06-01

A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

Identification of novel bacteriophage peptides using a combination of gene sequence LC-MS-MS analysis and BLASTP

Science.gov (United States)

Introduction: In an effort to characterize novel bacteriophage with lytic activity against pathogenic E.coli associated with foodborne illness, gene sequencing and mass spectrometry have been used to identify expressed peptides which differentiate isolated bacteriophage from other known phage. Here,...

Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.

Science.gov (United States)

Redfern, J; Verran, J

2017-04-01

Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

Directory of Open Access Journals (Sweden)

Gopala K. Mannala

2017-12-01

Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

Science.gov (United States)

Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

2013-12-01

Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

Science.gov (United States)

Lu, Chunye; Marjanovic, Olivera; Kiang, David

2017-01-01

ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

OpenAIRE

Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

2015-01-01

Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

Determination of fecal bacteriophages fecales from pre-potable waters using a simple membrane filtration technique; Determinacion de bacteriofagos fecales en aguas pre-potables por la tecnica de filtracion por membrana

Energy Technology Data Exchange (ETDEWEB)

Luque, A.; Basanta, A. [EMASESA. Sevilla (Spain); Fuentes, M. V.; Alonso, M. C.; Borrego, J. J. [Universidad de Malaga (Spain)

2000-07-01

A modification of the simple filtration technique used for the detection and enumeration of fecal bacteriophages from pre-treated and treated drinking water is described. The filters and equipments used are similar to those employed for the classical bacterial indicator analysis, and the titer of bacteriophages may be recorded in only 6 hours. The proposed modification is based on the elimination of the bacterial decontamination of the water sample by use the selective medium mFC agar; and, in addition, an optimal visualization of the lysis plaques is obtained in this medium, which avoid the use of specific stains like triphenyl tetrazolium chloride (TTC). On the other hand, the proposed modification of the technique presents a high accuracy, since bacteriophage titers of<10 pfu/100 ml of water are detected. (Author) 46 refs.

Insights into bacteriophage application in controlling Vibrio species

Directory of Open Access Journals (Sweden)

Vengadesh Letchumanan

2016-07-01

Full Text Available Bacterial infections from various organisms including Vibrio sp. pose a serious hazard to humans in many forms from clinical infection to affecting the yield of agriculture and aquaculture via infection of livestock. Vibrio sp. is one of the main foodborne pathogens causing human infection and is also a common cause of losses in the aquaculture industry. Prophylactic and therapeutic usage of antibiotics has become the mainstay of managing this problem, however this in turn led to the emergence of multidrug resistant strains of bacteria in the environment; which has raised awareness of the critical need for alternative non antibiotic based methods of preventing and treating bacterial infections. Bacteriophages - viruses that infect and result in the death of bacteria – are currently of great interest as a highly viable alternative to antibiotics. This article provides an insight into bacteriophage application in controlling Vibrio species as well underlining the advantages and drawbacks of phage therapy.

Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

Science.gov (United States)

Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

2014-05-01

A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

Science.gov (United States)

Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

2012-01-01

The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

Science.gov (United States)

Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

2014-03-03

This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

Adhesion to the host cell surface is sufficient to mediate Listeria monocytogenes entry into epithelial cells

Science.gov (United States)

Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.

2017-01-01

The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987

A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

Science.gov (United States)

Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

2017-03-21

Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role

Lytic Infection of Lactococcus lactis by Bacteriophages Tuc2009 and c2 Triggers Alternative Transcriptional Host Responses

NARCIS (Netherlands)

Ainsworth, S.; Zomer, A.L.; Mahony, J.; Sinderen, D. van

2013-01-01

Here we present an entire temporal transcriptional profile of Lactococcus lactis subsp. cremoris UC509.9 undergoing lytic infection with two distinct bacteriophages, Tuc2009 and c2. Furthermore, corresponding high-resolution whole-phage genome tiling arrays of both bacteriophages were performed

Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

Science.gov (United States)

Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

2010-02-01

Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.

Isolation of a bacteriophage specific for a new capsular type of Klebsiella pneumoniae and characterization of its polysaccharide depolymerase.