WorldWideScience

Sample records for monocytogenes specific bacteriophages

  1. Receptor binding proteins of Listeria monocytogenes bacteriophages A118 and P35 recognize serovar-specific teichoic acids

    Energy Technology Data Exchange (ETDEWEB)

    Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)

    2015-03-15

    Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.

  2. Programming Bacteriophages by Swapping Their Specificity Determinants.

    Science.gov (United States)

    Goren, Moran G; Yosef, Ido; Qimron, Udi

    2015-12-01

    Bacteriophages, bacteria's natural enemies, may serve as potent antibacterial agents. Their specificity for certain bacterial sub-species limits their effectiveness, but allows selective targeting of bacteria. Lu and colleagues present a platform for such targeting through alteration of bacteriophages' host specificity by swapping specificity domains in their host-recognition ligand.

  3. Control of Listeria monocytogenes growth in soft cheeses by bacteriophage P100

    Directory of Open Access Journals (Sweden)

    Elaine Nóbrega Gibson Silva

    2014-01-01

    Full Text Available The purpose of this study was to determine the effect of bacteriophage P100 on strains of Listeria monocytogenes in artificially inoculated soft cheeses. A mix of L. monocytogenes 1/2a and Scott A was inoculated in Minas Frescal and Coalho cheeses (approximately 10(5 cfu/g with the bacteriophage added thereafter (8.3 x 10(7 PFU/g. Samples were analyzed immediately, and then stored at 10 ºC for seven days. At time zero, 30 min post-infection, the bacteriophage P100 reduced L. monocytogenes counts by 2.3 log units in Minas Frescal cheese and by 2.1 log units in Coalho cheese, compared to controls without bacteriophage. However, in samples stored under refrigeration for seven days, the bacteriophage P100 was only weakly antilisterial, with the lowest decimal reduction (DR for the cheeses: 1.0 log unit for Minas Frescal and 0.8 log units for Coalho cheese. The treatment produced a statistically significant decrease in the counts of viable cells (p < 0.05 and in all assays performed, we observed an increase of approximately one log cycle in the number of viable cells of L. monocytogenes in the samples under refrigeration for seven days. Moreover, a smaller effect of phages was observed. These results, along with other published data, indicate that the effectiveness of the phage treatment depends on the initial concentration of L. monocytogenes, and that a high concentration of phages per unit area is required to ensure sustained inactivation of target pathogens on food surfaces.

  4. Effectiveness of a bacteriophage in reducing Listeria monocytogenes on fresh-cut fruits and fruit juices.

    Science.gov (United States)

    Oliveira, M; Viñas, I; Colàs, P; Anguera, M; Usall, J; Abadias, M

    2014-04-01

    Listeria monocytogenes is a serious foodborne pathogen and new strategies to control it in food are needed. Among them, bacteriophages hold attributes that appear to be attractive. The objective of this study was to investigate the efficacy of the bacteriophage Listex P100 to control L. monocytogenes growth on melon, pear and apple products (juices and slices) stored at 10 °C. L. monocytogenes grew well in untreated fruit slices. In juices, the pathogen grew in untreated melon, survived in untreated pear and decreased in untreated apple. Phage treatment was more effective on melon followed by pear, but no effect on apple products was observed. Reductions of about 1.50 and 1.00 log cfu plug(-1) for melon and pear slices were found, respectively. In juices, higher reductions were obtained in melon (8.00 log cfu mL(-1)) followed by pear (2.10 log cfu mL(-1)) after 8 days of storage. L. monocytogenes in apple juice was unaffected by phage treatment in which the phage decreased to almost undetectable numbers. These results highlight that Listex P100 could avoid pathogen growth on fresh-cut and in fruit juices with high pH during storage at 10 °C. The combination with other technologies may be required to improve the phage application on high acidity fruits. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Effect of a bacteriophage cocktail in combination with modified atmosphere packaging in controlling Listeria monocytogenes on fresh-cut spinach

    Directory of Open Access Journals (Sweden)

    Boyacioglu O.

    2016-06-01

    Full Text Available A Listeria monocytogenes-specific bacteriophage cocktail was evaluated for its activity against a nalidixic acid-resistant L. monocytogenes (Lm-NalR isolate on fresh-cut spinach stored under modified atmosphere packaging at various temperatures. Pieces (~2 × 2 cm2 of fresh spinach inoculated with 4.5 log CFU/cm2 Lm-NalR were sprayed with the phage cocktail (6.5 log plaque-forming units [PFU]/cm2 or a control. The samples were stored at 4°C or 10°C for up to 14 d in sealed packages filled with either atmospheric air (AA or modified atmosphere (MA. At 4°C under AA, the phages significantly (P ≤ 0.05 lowered the Lm-NalR populations on spinach, compared to control-treated inoculated samples, by 1.12 and 1.51 log CFU/cm2 after 1 and 14 d, respectively. At 4°C under MA, Lm-NalR was significantly reduced by 1.95 log CFU/cm2 compared to control leaves after both 1 and 14 d. At 10°C under AA, the phages significantly reduced Lm-NalR by 1.50 and 2.51 log CFU/cm2 after 1 and 14 d compared to the control. Again at 10°C under MA, the phages significantly reduced Lm-NalR by 1.71 and 3.24 log CFU/cm2 compared to control after 1 and 14 d, respectively. The results support the potential of lytic bacteriophages in effectively reducing populations of L. monocytogenes on freshcut leafy produce, under both AA and MA conditions.

  6. Bacteriophage predation promotes serovar diversification in Listeria monocytogenes.

    Science.gov (United States)

    Eugster, Marcel R; Morax, Laurent S; Hüls, Vanessa J; Huwiler, Simona G; Leclercq, Alexandre; Lecuit, Marc; Loessner, Martin J

    2015-07-01

    Listeria monocytogenes is a bacterial pathogen classified into distinct serovars (SVs) based on somatic and flagellar antigens. To correlate phenotype with genetic variation, we analyzed the wall teichoic acid (WTA) glycosylation genes of SV 1/2, 3 and 7 strains, which differ in decoration of the ribitol-phosphate backbone with N-acetylglucosamine (GlcNAc) and/or rhamnose. Inactivation of lmo1080 or the dTDP-l-rhamnose biosynthesis genes rmlACBD (lmo1081-1084) resulted in loss of rhamnose, whereas disruption of lmo1079 led to GlcNAc deficiency. We found that all SV 3 and 7 strains actually originate from a SV 1/2 background, as a result of small mutations in WTA rhamnosylation and/or GlcNAcylation genes. Genetic complementation of different SV 3 and 7 isolates using intact alleles fully restored a characteristic SV 1/2 WTA carbohydrate pattern, including antisera reactions and phage adsorption. Intriguingly, phage-resistant L. monocytogenes EGDe (SV 1/2a) isolates featured the same glycosylation gene mutations and were serotyped as SV 3 or 7 respectively. Again, genetic complementation restored both carbohydrate antigens and phage susceptibility. Taken together, our data demonstrate that L. monocytogenes SV 3 and 7 originate from point mutations in glycosylation genes, and we show that phage predation represents a major driving force for serovar diversification and evolution of L. monocytogenes.

  7. Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests.

    Science.gov (United States)

    Chaitiemwong, N; Hazeleger, W C; Beumer, R R

    2014-12-01

    To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after which inactivation of the pathogen by Suma Tab D4 (sodium dichloroisocyanurate, 240 and 300 mg/liter), Suma Bac D10 (quaternary ammonium compound, 740 mg/liter), and bacteriophage suspension (Listex P100) was determined. Both chemical disinfectants performed well in suspension tests and in clean carrier tests according to the European standard with a reduction of more than 5 and 4 log units, respectively, of Listeria cells after 5 min of contact time. However, for the plates with grooves, the reduction could not meet the standard requirement, although a higher reduction of L. monocytogenes was observed in the shallow grooves compared with the deeper grooves. Furthermore, presence of food residues and biofilm reduced the effect of the disinfectants especially in the deep grooves, which was dependent on type of food substrate. Bacteriophages showed the best antimicrobial effect compared with the chemical disinfectants (sodium dichloroisocyanurate and quaternary ammonium compound) in most cases in the shallow grooves, but not in the deep grooves. The chlorine based disinfectants were usually less effective than quaternary ammonium compound. The results clearly demonstrate that surfaces with grooves influenced the antimicrobial effect of the chemical disinfectants and bacteriophages because the pathogen is protected in the deep grooves. The use of bacteriophages to inactivate pathogens on surfaces could be helpful in limited cases; however, use of large quantities in practice may be costly and phage-resistant strains may develop.

  8. An Undergraduate Laboratory Activity Demonstrating Bacteriophage Specificity

    Directory of Open Access Journals (Sweden)

    Mary E. Allen

    2013-02-01

    Full Text Available Bacteriophage are among the most diverse and numerous microbes inhabiting our planet. Yet many laboratory activities fail to engage students in meaningful exploration of their diversity, unique characteristics, and abundance. In this curriculum activity students use a standard plaque assay to enumerate bacteriophage particles from a natural sample and use the scientific method to address questions about host specificity and diversity. A raw primary sewage sample is enriched for bacteriophage using hosts in the family Enterobacteriaceae. Students hypothesize about host specificity and use quantitative data (serial dilution and plaque assay to test their hypotheses. Combined class data also help them answer questions about phage diversity. The exercise was field tested with a class of 47 students using pre- and posttests. For all learning outcomes posttest scores were higher than pretest scores at or below p = 0.01. Average individualized learning gain (G was also calculated for each learning outcome. Students’ use of scientific language in reference to bacteriophage and host interaction significantly improved (p = 0.002; G = 0.50. Improved means of expression helped students construct better hypotheses on phage host specificity (G = 0.31, p = 0.01 and to explain the plaque assay method (G = 0.33, p = 0.002. At the end of the exercise students also demonstrated improved knowledge and understanding of phage specificity as related to phage therapy in humans (p < 0.001; G = 51.

  9. Bacteriophages: back to the future

    Science.gov (United States)

    A Listeria monocytogenes-specific bacteriophage cocktail (ListShield™) was evaluated for its activity against a nalidixic acid-resistant L. monocytogenes (Lm-NalR) isolate on fresh-cut spinach stored under modified atmosphere packaging (MAP) at various temperatures. Pieces (~2x2 cm2) of fresh spinac...

  10. Understanding Bacteriophage Specificity in Natural Microbial Communities

    Directory of Open Access Journals (Sweden)

    Britt Koskella

    2013-03-01

    Full Text Available Studying the coevolutionary dynamics between bacteria and the bacteriophage viruses that infect them is critical to understanding both microbial diversity and ecosystem functioning. Phages can play a key role in shaping bacterial population dynamics and can significantly alter both intra- and inter-specific competition among bacterial hosts. Predicting how phages might influence community stability and apparent competition, however, requires an understanding of how bacteria-phage interaction networks evolve as a function of host diversity and community dynamics. Here, we first review the progress that has been made in understanding phage specificity, including the use of experimental evolution, we then introduce a new dataset on natural bacteriophages collected from the phyllosphere of horse chestnut trees, and finally we highlight that bacterial sensitivity to phage is rarely a binary trait and that this variation should be taken into account and reported. We emphasize that there is currently insufficient evidence to make broad generalizations about phage host range in natural populations, the limits of phage adaptation to novel hosts, or the implications of phage specificity in shaping microbial communities. However, the combination of experimental and genomic approaches with the study of natural communities will allow new insight to the evolution and impact of phage specificity within complex bacterial communities.

  11. Host range and in vitro lysis of Listeria monocytogenes seafood isolates by bacteriophages.

    Science.gov (United States)

    Arachchi, Geevika J Ganegama; Cruz, Cristina D; Dias-Wanigasekera, Beatrice M; McIntyre, Lynn; Billington, Craig; Hudson, Andrew; Flint, Steve H; Mutukumira, Anthony N

    2014-12-01

    Listeria-infecting bacteriophages (listeriaphages) can be used to control Listeria monocytogenes in the food industry. However, the sensitivity of many of seafood-borne Listeria strains to phages has not been reported. This research investigated the host ranges of three listeriaphages (FWLLm1, FWLLm3 and FWLLm5) by the formation of lytic zones and plaques on host lawns and in vitro lysis kinetics of listeriaphage FWLLm3. The study also predicted the phage titres required to lyse host cells. The host ranges of the phages were determined using 50 L. monocytogenes strains, of which 48 were isolated from the seafood industry and two from clinical cases. Of the 50 strains, 36 were tested at 25 and 30 ℃ and the remainder (14) at 15 and 25 ℃. Based on the formation of either discrete plaques or lytic zones (host kill zones), the host ranges of FWLLm1, FWLLm3 and FWLLm5 were about 87%, 81% and 87%, respectively, at 25 ℃. Six L. monocytogenes strains from the seafood environment were insensitive to all three phages, while the other seafood strains (42) were phage-sensitive. The adsorption rate constant (k value) of listeriaphage FWLLm3 was between 1.2 × 10(-9) and 1.6 × 10(-9 )ml/min across four host strains in tryptic soy broth at 25 ℃. The cultures (at 3-4 log colony-forming unit (CFU/ml) were completely lysed ( 8.7 log phage-forming units (PFU/ml) for 30 min. Re-growth of phage-infected cultures was not detected after 24 h. The effective empirical phage titre was similar to the calculated titre using a kinetic model. Results indicate the potential use of the three phages for controlling L. monocytogenes strains in seafood processing environments. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  12. 21 CFR 172.785 - Listeria-specific bacteriophage preparation.

    Science.gov (United States)

    2010-04-01

    ... FOOD FOR HUMAN CONSUMPTION Other Specific Usage Additives § 172.785 Listeria -specific bacteriophage... Nutrition's Library, 5100 Paint Branch Pkwy., College Park, MD 20740, or at the National Archives...

  13. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes.

    Science.gov (United States)

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon

    2015-06-15

    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. 40 CFR 180.1261 - Xanthomonas campestris pv. vesicatoria and Pseudomonas syringae pv. tomato specific Bacteriophages.

    Science.gov (United States)

    2010-07-01

    ... and Pseudomonas syringae pv. tomato specific Bacteriophages. 180.1261 Section 180.1261 Protection of.... vesicatoria and Pseudomonas syringae pv. tomato specific Bacteriophages. An exemption from the requirement of... syringae pv. tomato specific bacteriophages in or on pepper and tomato. ...

  15. Bacteriophage Administration Reduces the Concentration of Listeria monocytogenes in the Gastrointestinal Tract and Its Translocation to Spleen and Liver in Experimentally Infected Mice

    Directory of Open Access Journals (Sweden)

    Volker Mai

    2010-01-01

    Full Text Available To investigate the efficacy of phage supplementation in reducing pathogen numbers, mice were treated via oral gavage with a Listeria monocytogenes phage preparation (designated ListShield before being orally infected with L. monocytogenes. The concentrations of L. monocytogenes in the liver, spleen, and intestines were significantly lower (P<.05 in the phage-treated than in the control mice. Phage and antibiotic treatments were similarly effective in reducing the levels of L. monocytogenes in the internal organs of the infected mice. However, the significant weight loss detected in the control and antibiotic-treated groups was not observed in the infected, ListShield-treated mice. Long-term (90 days, biweekly treatment of uninfected mice with ListShield did not elicit detectable changes in the microbiota of their large intestines or deleterious changes in their health. Our data support the potential feasibility of using bacteriophages to control proliferation of L. monocytogenes in mice without affecting commensal microbiota composition.

  16. Novel Bacteroides host strains for detection of human- and animal-specific bacteriophages in water.

    Science.gov (United States)

    Wicki, Melanie; Auckenthaler, Adrian; Felleisen, Richard; Tanner, Marcel; Baumgartner, Andreas

    2011-03-01

    Bacteriophages active against specific Bacteroides host strains were shown to be suitable for detection of human faecal pollution. However, the practical application of this finding is limited because some specific host strains were restricted to certain geographic regions. In this study, novel Bacteroides host strains were isolated that discriminate human and animal faecal pollution in Switzerland. Two strains specific for bacteriophages present in human faecal contamination and three strains specific for bacteriophages indicating animal faecal contamination were evaluated. Bacteriophages infecting human strains were exclusively found in human wastewater, whereas animal strains detected bacteriophages only in animal waste. The newly isolated host strains could be used to determine the source of surface and spring water faecal contamination in field situations. Applying the newly isolated host Bacteroides thetaiotaomicron ARABA 84 for detection of bacteriophages allowed the detection of human faecal contamination in spring water.

  17. UV ability to destroy poliovirus end FRNA specific bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Baron, J.; Joret, J.C.; Lesavre, J.; Perrot, J.Y.

    1996-01-01

    In France, the use of ultraviolet radiation to disinfect secondary effluents is only in its initial stage. The aim of this study was to examine the ability of UV to destroy Poliovirus Type 1 and FRNA specific bacteriophages (laboratory MS2 phages and indigenous phages). Concentrated viral solutions were mixed with secondary effluents artificially enriched with suspended solids and then irradiated at various UV dose in a collimated beam. Bacteriological analysis of Escherichia coli and enterococci were performed at the same time. UV were very efficient to kill Poliovirus : Inactivation of 3 and 5 log units were observed respectively at UV doses of 20 and 40 mW/cm{sup 2}. The Poliovirus disinfection rate was almost the same than Escherichia coli. Enterococci were more resistant than E. coli. Inactivation of MS2 bacteriophages was significantly correlated to UV dose following the relationship MS2 Inactivation = 0.047{sup *} Dose + 0,396. At UV dose of 20 mWs/cm{sup 2}, MS2 phages were 2.3 times more resistant to UV than Poliovirus, i.e. they need UV dose 2,3 times greater to be disinfected at the same level. A review of the literature has also shown that viruses more resistant to UV treatment have never been reported. All this would tend to confirm the interest of this group of virus as indicators of the disinfection efficiency of UV, which could indicate, on site, the inactivation of pathogenic viruses. Inactivation rates obtained for FRNA phages proved the good virucidal activity of UV. The inactivation of indigenous FRNA bacteriophages was not correlated with E. coli inactivation. On the other hand, it was correlated with enterococci inactivation. (Author). 23 refs., 7 figs., 4 tabs.

  18. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  19. Isolation and characterization of bacteriophages specific to hydrogen-sulfide-producing bacteria.

    Science.gov (United States)

    Gong, Chao; Heringa, Spencer; Singh, Randhir; Kim, Jinkyung; Jiang, Xiuping

    2013-01-01

    The objectives of this study were to isolate and characterize bacteriophages specific to hydrogen-sulfide-producing bacteria (SPB) from raw animal materials, and to develop a SPB-specific bacteriophage cocktail for rendering application. Meat, chicken offal, and feather samples collected from local supermarkets and rendering processing plants were used to isolate SPB (n = 142). Bacteriophages (n = 52) specific to SPB were isolated and purified from the above samples using 18 of those isolated SPB strains as hosts. The host ranges of bacteriophages against 5 selected SPB strains (Escherichia coli, Citrobacter freundii, and Hafnia alvei) were determined. Electron microscopy observation of 9 phages selected for the phage cocktail revealed that 6 phages belonged to the family of Siphoviridae and 3 belonged to the Myoviridae family. Restriction enzyme digestion analysis with endonuclease DraI detected 6 distinguished patterns among the 9 phages. Phage treatment prevented the growth of SPB for up to 10 h with multiplicity of infection ratios of 1, 10, 100, and 1000 in tryptic soy broth at 30 °C, and extended the lag phase of SPB growth for 2 h at 22 °C with multiplicities of infection of 10, 100, and 1000. These results suggest that the selected bacteriophage cocktail has a high potential for phage application to control SPB in raw animal materials destined for the rendering process.

  20. Biotinylation of environmentally isolated Shiga toxin-producing Escherichia coli (STEC) – specific bacteriophages for biosensor and biocontrol applications

    Science.gov (United States)

    Like common bacteriophages, Shiga toxin-producing Escherichia coli (STEC) bacteriophages are viruses that recognize and bind to specific bacterial host (STEC) for propagation. They co-exist with STEC hosts, which cause epidemic food and waterborne illnesses, but may act as host populations limiting ...

  1. MOF-Bacteriophage Biosensor for Highly Sensitive and Specific Detection of Staphylococcus aureus.

    Science.gov (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev K; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash

    2017-09-21

    To produce a sensitive and specific biosensor for Staphylococcus aureus, bacteriophages have been interfaced with a water-dispersible and environmentally stable metal-organic framework (MOF), NH2-MIL-53(Fe). The conjugation of the MOF with bacteriophages has been achieved through the use of glutaraldehyde as cross-linker. Highly sensitive detection of S. aureus in both synthetic and real samples was realized by the proposed MOF-bacteriophage biosensor based on the photoluminescence quenching phenomena: limit of detection (31 CFU/mL) and range of detection (40 to 4 × 10(8) CFU/mL). This is the first report exploiting the use of an MOF-bacteriophage complex for the biosensing of S. aureus. The results of our study highlight that the proposed biosensor is more sensitive than most of the previous methods while exhibiting some advanced features like specificity, regenerability, extended range of linear detection, and stability for long-term storage (even at room temperature).

  2. Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

    Science.gov (United States)

    Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

    2016-10-01

    Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

  3. Inactivation of F-specific bacteriophages during flocculation with polyaluminum chloride - a mechanistic study.

    Science.gov (United States)

    Kreißel, Katja; Bösl, Monika; Hügler, Michael; Lipp, Pia; Franzreb, Matthias; Hambsch, Beate

    2014-03-15

    Bacteriophages are often used as surrogates for enteric viruses in spiking experiments to determine the efficiencies of virus removal of certain water treatment measures, like e.g. flocculation or filtration steps. Such spiking experiments with bacteriophages are indispensable if the natural virus concentrations in the raw water of water treatment plants are too low to allow the determination of elimination levels over several orders of magnitude. In order to obtain reliable results from such spiking tests, it is essential that bacteriophages behave comparable to viruses and remain stable during the experiments. To test this, the influence of flocculation parameters on the bacteriophages MS2, Qβ and phiX174 was examined. Notably, the F-specific phages MS2 and Qβ were found to be inactivated in flocculation processes with polyaluminum chloride (PACl). In contrast, other aluminum coagulants like AlCl3 or Al2(SO4)3 did not show a comparable effect on MS2 in this study. In experiments testing the influence of different PACl species on MS2 and Qβ inactivation during flocculation, it could be shown that cationic dissolved PACl species (Al13) interacted with the MS2 surface and hereby reduced the surviving phage fraction to c/c0 values below 1*10(-4) even at very low PACl concentrations of 7 μmol Al/L. Other inactivation mechanisms like the irreversible adsorption of phages to the floc structure or the damage of phage surfaces due to entrapment into the floc during coagulation and floc formation do not seem to contribute to the low surviving fraction found for both F-specific bacteriophages. Furthermore, no influence of phage agglomeration or pH drops during the flocculation process on phage inactivation could be observed. The somatic coliphage phiX174 in contrast did not show sensitivity to chemical stress and in accordance only slight interaction between Al13 and the phage surface was observed. Consequently, F-specific phages like MS2 should not be used as

  4. Isolation and characterization of Yersinia-specific bacteriophages from pig stools in Finland.

    Science.gov (United States)

    Salem, M; Virtanen, S; Korkeala, H; Skurnik, M

    2015-03-01

    Bacteriophages infect bacteria, and they are present everywhere in the world including the intestinal tracts of animals. Yersiniosis is a common foodborne infection caused by Yersinia enterocolitica and Yersinia pseudotuberculosis. As these bacteria are frequently isolated from pigs, we wanted to know whether Yersinia-specific bacteriophages are also present in the pig stools and, if so, whether there is a positive or negative association between the prevalence of the Yersinia phages and the pathogenic Yersinia in the stool samples. Altogether 793 pig stool samples collected between November 2010 and March 2012 from 14 Finnish pig farms were screened for the presence of bacteriophages able to infect Y. enterocolitica serotype O:3, O:5,27 or O:9 strains, or Y. pseudotuberculosis serotype O:1a, O:1b or O:3 strains. Yersinia phages were isolated from 90 samples from eight farms. Yersinia enterocolitica O:3 was infected by 59 phages, 28 phages infected serotypes O:3 and O:5,27, and eight phages infected serotypes O:3, O:5,27 and O:9, and Y. pseudotuberculosis O:1a by eight phages. Many phages originating from pigs in the same farm were identical based on their restriction enzyme digestion patterns; 20 clearly different phages were selected for further characterization. Host ranges of these phages were tested with 94 Yersinia strains. Six of the phages infected eight strains, 13 phages infected three strains, and one phage infected only one strain, indicating that the phages had a relatively narrow host range. There was a clear association between the presence of the host bacteria and specific phages in the stools. The isolated bacteriophages may have potential as biocontrol agents for yersiniosis in both humans and pigs in future, and as alternatives or in addition to antibiotics. To our knowledge, this is the first reported isolation of Yersinia-specific phages from pig stool samples. © 2014 The Society for Applied Microbiology.

  5. Characterization of Bacteriophage Specific to Bacillus pumilus from Ciapus River in Bogor, West Java, Indonesia

    Directory of Open Access Journals (Sweden)

    Anik Kusmiatun

    2015-01-01

    Full Text Available Bacillus pumilus is a spore-forming bacteria that is rod-shaped, gram positive, and aerobic. B. pumilus produced pumilacidins, known to have toxic effects on epithelial cells. Antibiotics were usually used to treat the disease caused by bacteria. Antibiotic typing test of B. pumilus indigenous from sewage water showed that this isolate was resistant to ampicillin and clindamycin. An alternative way was by application of bacteriophages as biocontrol agents to reduce B. pumilus in environment. The aim of this study were to isolate and characterize B. pumilus bacteriophage isolated from Ciapus River in Bogor, West Java. Bacteriophages infecting B. pumilus were isolated from river water using the double agar overlay method. Phages were defined by plaque morphology, structure, host range, and characteristic of molecular weight protein phage. Phage FBa1, FBa2, and FBa3 had narrow host range and they were specific for infecting B. pumilus. Electron microscope observation showed that phage FBa1 had icosahedral head without tail (166.67 nm in diameter, so it is called phage-like particles. Characterization of phage FBa1 by SDS-PAGE showed five proteins band. Molecular weight of FBa1 proteins was 70.9, 54.9, 33.8, 28.3, and 21.4 kDa.

  6. Campylobacter bacteriophages and bacteriophage therapy.

    Science.gov (United States)

    Connerton, P L; Timms, A R; Connerton, I F

    2011-08-01

    Members of the genus Campylobacter are frequently responsible for human enteric disease with occasionally very serious outcomes. Much of this disease burden is thought to arise from consumption of contaminated poultry products. More than 80% of poultry in the UK harbour Campylobacter as a part of their intestinal flora. To address this unacceptably high prevalence, various interventions have been suggested and evaluated. Among these is the novel approach of using Campylobacter-specific bacteriophages, which are natural predators of the pathogen. To optimize their use as therapeutic agents, it is important to have a comprehensive understanding of the bacteriophages that infect Campylobacter, and how they can affect their host bacteria. This review will focus on many aspects of Campylobacter-specific bacteriophages including: their first isolation in the 1960s, their use in bacteriophage typing schemes, their isolation from the different biological sources and genomic characterization. As well as their use as therapeutic agents to reduce Campylobacter in poultry their future potential, including their use in bio-sanitization of food, will be explored. The evolutionary consequences of naturally occurring bacteriophage infection that have come to light through investigations of bacteriophages in the poultry ecosystem will also be discussed.

  7. Analysis of a mutation affecting the specificity domain for prohead binding of the bacteriophage lambda terminase.

    OpenAIRE

    1992-01-01

    Genetic studies have identified a specificity domain for prohead binding in the C-terminal 32 amino acids of gpA, the large subunit of bacteriophage lambda terminase (S. Frackman, D. A. Siegele, and M. Feiss, J. Mol. Biol. 180:283-300, 1984). In the present work, an amber mutation, Aam42, in the fifth-to-last codon of the A gene was found to be lethal in nonsuppressing hosts. The mutation, expected to generate gpA lacking the last five amino acids, caused the production of a terminase that cu...

  8. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  9. Comparative genomic analysis of bacteriophages specific to the channel catfish pathogen Edwardsiella ictaluri

    Directory of Open Access Journals (Sweden)

    Mead David A

    2011-01-01

    Full Text Available Abstract Background The bacterial pathogen Edwardsiella ictaluri is a primary cause of mortality in channel catfish raised commercially in aquaculture farms. Additional treatment and diagnostic regimes are needed for this enteric pathogen, motivating the discovery and characterization of bacteriophages specific to E. ictaluri. Results The genomes of three Edwardsiella ictaluri-specific bacteriophages isolated from geographically distant aquaculture ponds, at different times, were sequenced and analyzed. The genomes for phages eiAU, eiDWF, and eiMSLS are 42.80 kbp, 42.12 kbp, and 42.69 kbp, respectively, and are greater than 95% identical to each other at the nucleotide level. Nucleotide differences were mostly observed in non-coding regions and in structural proteins, with significant variability in the sequences of putative tail fiber proteins. The genome organization of these phages exhibit a pattern shared by other Siphoviridae. Conclusions These E. ictaluri-specific phage genomes reveal considerable conservation of genomic architecture and sequence identity, even with considerable temporal and spatial divergence in their isolation. Their genomic homogeneity is similarly observed among E. ictaluri bacterial isolates. The genomic analysis of these phages supports the conclusion that these are virulent phages, lacking the capacity for lysogeny or expression of virulence genes. This study contributes to our knowledge of phage genomic diversity and facilitates studies on the diagnostic and therapeutic applications of these phages.

  10. Assessment of swine-specific bacteriophages of Bacteroides fragilis in swine farms with different antibiotic practices.

    Science.gov (United States)

    Leknoi, Yuranan; Mongkolsuk, Skorn; Sirikanchana, Kwanrawee

    2017-04-01

    We assessed the occurrence and specificity of bacteriophages of Bacteroides fragilis in swine farms for their potential application in microbial source tracking. A local B. fragilis host strain, SP25 (DSM29413), was isolated from a pooled swine feces sample taken from a non-antibiotic farm. This strain was highly specific to swine fecal materials because it did not detect bacteriophages in any samples from human sewage, sheep, goats, cattle, dogs, and cats. The reference B. fragilis strain, RYC2056, could detect phages in swine samples but also detected phages in most human sewage and polluted urban canal samples. Phages of SP25 exist in the proximity of certain swine farms, regardless of their antibiotic use (p > 0.05). B. fragilis strain SP25 exhibited relatively high resistance to most of the veterinary antimicrobial agents tested. Interestingly, most farms that were positive for SP25 phages were also positive for RYC2056 phages. In conclusion, the swine-specific SP25 strain has the potential to indicate swine fecal contamination in certain bodies of water. Bacterial isolates with larger distributions are being studied and validated. This study highlights the importance of assessing the abundance of phages in local swine populations before determining their potential applicability for source tracking in local surface waters.

  11. Identification of Conserved and Species-Specific Functions of the Listeria monocytogenes PrsA2 Secretion Chaperone

    Science.gov (United States)

    Cahoon, Laty A.

    2015-01-01

    The Gram-positive bacterium Listeria monocytogenes is a facultative intracellular pathogen that relies on the regulated secretion and activity of a variety of proteins that sustain life within diverse environments. PrsA2 has recently been identified as a secreted peptidyl-prolyl cis/trans isomerase and chaperone that is dispensable for bacterial growth in broth culture but essential for L. monocytogenes virulence. Following host infection, PrsA2 contributes to the proper folding and activity of secreted proteins that are required for bacterial replication within the host cytosol and for bacterial spread to adjacent cells. PrsA2 is one member of a family of Gram-positive secretion chaperones that appear to play important roles in bacterial physiology; however, it is not known how these proteins recognize their substrate proteins or the degree to which their function is conserved across diverse Gram-positive species. We therefore examined PrsA proteins encoded by a variety of Gram-positive bacteria for functional complementation of L. monocytogenes mutants lacking prsA2. PrsA homologues encoded by Bacillus subtilis, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus mutans, Staphylococcus aureus, and Lactococcus lactis were examined for functional complementation of a variety of L. monocytogenes PrsA2-associated phenotypes central to L. monocytogenes pathogenesis and bacterial cell physiology. Our results indicate that while selected aspects of PrsA2 function are broadly conserved among diverse Gram-positive bacteria, PrsA2 exhibits unique specificity for L. monocytogenes target proteins required for pathogenesis. The L. monocytogenes PrsA2 chaperone thus appears evolutionarily optimized for virulence factor secretion within the host cell cytosol while still maintaining aspects of activity relevant to more general features of Gram-positive protein translocation. PMID:26216425

  12. Development and validation of an antigen capture ELISA based on monoclonal antibodies specific for Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Rossella Lelli

    2011-09-01

    Full Text Available A capture enzyme-linked immunosorbent assay (ELISA for the identification of Listeria monocytogenes in food was standardised and validated. The assay was refined by analysing samples of meat, seafood, dairy products, pasta and flour. The method was found to be 100% specific for Listeria spp. tested, with a limit of sensitivity of 6.6 × 10(3 colony-forming units (cfu/ml. Comparison of L. monocytogenes capture ELISA against the official International Organization for Standardization (ISO method 11290-1:1996 for the isolation and identification of L. monocytogenes in food matrices produced a significant concordance index. The assay was validated on food matrices including meat, seafood and dairy products in line with ISO 16140:2003 concerning qualitative analytical methods. The assay was found to be accurate, specific, sensitive, selective, reproducible and fast, resulting in lower costs and faster turnaround in microbiological screening of foods.

  13. Characterization of a novel non-specific nuclease from thermophilic bacteriophage GBSV1

    Directory of Open Access Journals (Sweden)

    Zhang Xiaobo

    2008-04-01

    Full Text Available Abstract Background Thermostable enzymes from thermophiles have attracted extensive studies. In this investigation, a nuclease-encoding gene (designated as GBSV1-NSN was obtained from a thermophilic bacteriophage GBSV1 for the first time. Results After recombinant expression in Escherichia coli, the purified GBSV1-NSN exhibited non-specific nuclease activity, being able to degrade various nucleic acids, including RNA, single-stranded DNA and double-stranded DNA that was circular or linear. Based on sequence analysis, the nuclease shared no homology with any known nucleases, suggesting that it was a novel nuclease. The characterization of the recombinant GBSV1-NSN showed that its optimal temperature and pH were 60°C and 7.5, respectively. The results indicated that the enzymatic activity was inhibited by enzyme inhibitors or detergents, such as ethylene diamine tetraacetic acid, citrate, dithiothreitol, β-mercaptoethanol, guanidine hydrochloride, urea and SDS. In contrast, the nuclease activity was enhanced by TritonX-100, Tween-20 or chaps to approximately 124.5% – 141.6%. The Km of GBSV1-NSN nuclease was 231, 61 and 92 μM, while its kcat was 1278, 241 and 300 s-1 for the cleavage of dsDNA, ssDNA and RNA, respectively. Conclusion Our study, therefore, presented a novel thermostable non-specific nuclease from thermophilic bacteriophage and its overexpression and purification for scientific research and applications.

  14. Detection specificity studies of bacteriophage adhesin-coated long-period grating-based biosensor

    Science.gov (United States)

    Koba, Marcin; Śmietana, Mateusz; Brzozowska, Ewa; Górska, Sabina; Mikulic, Predrag; Cusano, Andrea; Bock, Wojtek J.

    2015-09-01

    In this work, we present a label-free detection specificity study of an optical fiber long-period grating (LPG) biosensor working near the dispersion turning point of higher order cladding modes. The LPG sensor functionalized with bacteriophage adhesin is tested with specific and non-specific bacteria dry weight. We show that such biosensor is able to selectively bind, thus recognize different bacteria. We use bacteria dry weights of E. coli B as positive test and E. coli K12 and Salmonella enterica as negative tests. The resonance wavelength shift induced by E. coli B reaches over 90 nm, while for E. coli K12 and Salmonella enterica approximately 40 and 20 nm, respectively.

  15. Isolation and characterization of a bacteriophage specific for Sphaerotilus natans which contain an unusual base in its deoxyribonucleic acid.

    Science.gov (United States)

    Winston, V; Thompson, T L

    1979-05-01

    A bacteriophage was isolated specific for Sphaerotilus natans, an organism for which bacteriophages have not been previously described. This phage (designated SN1) was found to infect both the single-cell (S-type) and filamentous (R-type) forms of the host, although the sheath appeared to provide R-type cells with a degree of physical protection from infection. SN1 had a hexagonal head and a long flexible tail resembling most closely the phages in Bradley's group B. The nucleic acid was found to be deoxyribonucleic acid and contained an unusual base which substituted for 35% of the guanine. Deoxyribonucleic acid base composition was 56% cytosine plus guanine.

  16. Genome-wide analyses reveal lineage specific contributions of positive selection and recombination to the evolution of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sun Qi

    2008-08-01

    Full Text Available Abstract Background The genus Listeria includes two closely related pathogenic and non-pathogenic species, L. monocytogenes and L. innocua. L. monocytogenes is an opportunistic human foodborne and animal pathogen that includes two common lineages. While lineage I is more commonly found among human listeriosis cases, lineage II appears to be overrepresented among isolates from foods and environmental sources. This study used the genome sequences for one L. innocua strain and four L. monocytogenes strains representing lineages I and II, to characterize the contributions of positive selection and recombination to the evolution of the L. innocua/L. monocytogenes core genome. Results Among the 2267 genes in the L. monocytogenes/L. innocua core genome, 1097 genes showed evidence for recombination and 36 genes showed evidence for positive selection. Positive selection was strongly associated with recombination. Specifically, 29 of the 36 genes under positive selection also showed evidence for recombination. Recombination was more common among isolates in lineage II than lineage I; this trend was confirmed by sequencing five genes in a larger isolate set. Positive selection was more abundant in the ancestral branch of lineage II (20 genes as compared to the ancestral branch of lineage I (9 genes. Additional genes under positive selection were identified in the branch separating the two species; for this branch, genes in the role category "Cell wall and membrane biogenesis" were significantly more likely to have evidence for positive selection. Positive selection of three genes was confirmed in a larger isolate set, which also revealed occurrence of multiple premature stop codons in one positively selected gene involved in flagellar motility (flaR. Conclusion While recombination and positive selection both contribute to evolution of L. monocytogenes, the relative contributions of these evolutionary forces seem to differ by L. monocytogenes lineages and

  17. Characterization of a virulent bacteriophage LK1 specific for Citrobacter freundii isolated from sewage water.

    Science.gov (United States)

    Chaudhry, Waqas Nasir; Haq, Irshad Ul; Andleeb, Saadia; Qadri, Ishtiaq

    2014-06-01

    Citrobacter freundii is a worldwide emerging nosocomial pathogen with escalating incidence of multidrug resistance. Citrobacter freundii exists in natural environment, especially in health care settings and is difficult to eradicate. Phage therapy is considered as an alternative way of controlling bacterial infections and contaminations. In this study, we have described isolation and characterization of a virulent bacteriophage LK1 capable of specifically infecting Citrobacter freundii. A virulent bacteriophage LK1, specific for Citrobacter freundii was isolated from sewage water sample. TEM showed that phage Lk1 has an icosahedral head 70 nm in diameter and short tail of 17 nm, and can be classified as a member of the Podoviridae family. Restriction analysis indicated that phage LK1 was a dsDNA virus with an approximate genome size of 20-23 kb. Proteomic pattern generated by SDS PAGE using purified LK1 phage particles, revealed three major and six minor protein bands with molecular weight ranging from 25 to 80 kDa. Adsorption rate of LK1 relative to the host bacterium was also determined which showed significant improvement in adsorption with the addition of CaCl2 . In a single step growth experiment, LK1 exhibited a latent period of 24 min and burst size of 801 particle/cell. Moreover, pH and thermal stability of phage LK1 demonstrated a pH range of 5.0-6.0 and phage viability decreased to 0% at 65 °C. When LK1 was used to infect six other clinically isolated pathogenic strains, it showed relatively narrow host range. LK1 was capable of eliciting efficient lysis of Citrobacter freundii, revealing its potential as a non-toxic sanitizer for controlling Citrobacter freundii infection and contamination in both hospital and other public environments.

  18. The possible use of V. parahaemolyticus - specific bacteriophages for prevention and therapy of infections caused by V. parahaemolyticus.

    Science.gov (United States)

    Tskhvediani, A; Khukhunashvili, T; Eliashvili, T; Tsertsvadze, G; Gachechiladze, N; Tediashvili, M

    2014-06-01

    Vibrio parahaemolyticus is the most common halophilic Vibrio species causing serious gastroenteritis in humans. The main source of infection is consumption of undercooked or raw seafood or exposure to contaminated water. The monitoring conducted in 2006-2008 demonstrated that warm, subtropical climate and low- to moderate salinity of water in the Black Sea coastal zone provides a favorable environment for growth and spread of V. parahaemolyticus bacteria. Antibiotics are commonly applied for control V.parahaemolyticus infections in humans. However, with the growing problem with bacterial antibiotic-resistance search for alternative biological anti-infectives, such as bacteriophages, becomes more actual. The aim of the presented work was characterization of V. parahamolyticus- specific bacteriophages in relation with their possible use for treatment and prevention of food and waterborne gastroenteritis in humans infected with V.parahaemolyticus. 69 bacteriophages specific to V.parahaemolyticus were isolated from different water sources and 5 of them were characterized according to their virion morphology, host-range, temperature and pH dependence. Stability of phages in different media and solutions, also susceptibility to action of a number of protolithic enzymes was studied as well. Obtained results showed that studied bacteriophages can be used for preparation of phage mixture as a potential therapeutic preparation against V.parahaemolyticus associated infections.

  19. Application of bacteriophages specific to hydrogen sulfide-producing bacteria in raw poultry by-products.

    Science.gov (United States)

    Gong, Chao; Liu, Xiaohua; Jiang, Xiuping

    2014-03-01

    Hydrogen sulfide-producing bacteria (SPB) can spoil raw animal materials and release harmful hydrogen sulfide (H2S) gas. The objective of this study was to apply a SPB-specific bacteriophage cocktail to control H2S production by SPB in different raw poultry by-products in the laboratory (20, 30, and 37°C) and greenhouse (average temperature 29 to 31°C, humidity 34.8 to 59.8%, and light intensity 604.8 Wm(2)) by simulating transportation and a rendering facility. The amount of H2S production was determined using either test strips impregnated with lead acetate or a H2S monitor. In the laboratory, phage treatment applied to fresh chicken meat inoculated with SPB, spoiled chicken meat, chicken guts, and chicken feathers reduced H2S production by approximately 25 to 69% at temperatures from 20 to 37°C. In the greenhouse, phage treatment achieved approximately a 30 to 85% reduction of H2S yield in chicken offal and feathers. Among all phage treatments, multiplicity of infection (MOI) of 100 exhibited the highest inhibitory activities against SPB on H2S production. Several factors such as initial SPB level, temperature, and MOI affect lytic activities of bacteriophages. Our study demonstrated that the phage cocktail is effective to reduce the production of H2S by SPB significantly in raw animal materials. This biological control method can control SPB in raw poultry by-products at ambient temperatures, leading to a safer working environment and high quality product with less nutrient degradation for the rendering industry.

  20. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Directory of Open Access Journals (Sweden)

    Mendonça Marcelo

    2012-11-01

    Full Text Available Abstract Background Immunomagnetic separation (IMS and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs against Internalin A (InlA and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P 5 CFU/mL was significantly higher (P Listeria antibody (9 %. Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g, enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food.

  1. Bacteriophage epitope libraries. The generation of specific binding proteins and peptides in vitro.

    Science.gov (United States)

    Fink, L M; Hsu, P L

    1994-01-01

    New concepts and methodologies that can be used to generate proteins, such as specific variable regions of immunoglobulins and other binding peptides in an in vitro selection system are reviewed. These technologies can also be used to alter the kinetics, affinity and avidity of various binding interactions. The nature of epitopes recognized by specific antibodies or receptors can be delineated using selected epitopes displayed on bacteriophages. The basic principles of the technology is predicted upon the belief that if one has a large enough variety of keys, one can open any given lock. The range of utility of these systems to generate new reagents will impact upon the development of new diagnostic and therapeutic reagents. This technology should allow for a much wider range of probes which may have increased binding capacity and allow the development of more sensitive assays with higher signal to noise ratios. These reagents can be produced more efficiently without the use of animals and will be used in diagnostic and experimental pathology. This brief review presents a concise description of the concepts and uses of this new technology. Selected references and reviews are given as sources for further details.

  2. Biological characterization of v. Cholerae-specific bacteriophages isolated from water sources in Georgia.

    Science.gov (United States)

    Elbakidze, T; Kokashvili, T; Janelidze, N; Porchkhidze, K; Koberidze, T; Tediashvili, M

    2015-03-01

    Vibrio cholerae, a widely spread bacterium in various marine, fresh, and brackish water environments, can cause a devastating diarrheal disease - cholera and also mild forms of gastroenteritis. Bacterial viruses are natural controllers of bacterial population density in water systems. The goal of this study was to isolate and characterize V. cholerae-specific bacteriophages occurring in the Georgian coastal zone of the Black Sea and inland water reservoirs in the eastern part of Georgia. During 2006-2009, 71 phages lytic to V. cholerae were collected from these aquatic environments. The phage isolation rate was varying from 8% to 15%, depending on the sampling season and site, and the abundance of host bacteria. The majority of phages specific to V. cholerae were collected from freshwater sources. The phage isolation showed seasonal character covering warm period -from April to September. Based on basic characteristics of primary phage isolates (lytic spectrum, virion morphology and DNA restriction profiles) 23 V. cholerae -specific phages were selected for series of consecutive screenings. Comparatively wide spectrum of lytic activity was revealed in case of 14 phages specific to V. cholerae O1, and one phage - VchBS3, active against non-O1 V. cholerae. Three phages active against V. cholerae non-O1 and six V. cholerae O1 -specific phages have been studied in detail for a number of biological features (stability in different solutions, temperature-, pH- and UV- sensitivity, influence of high ionic strength etc.), considered to be additional important characteristics for selection of phages with therapeutic potential.

  3. Isolation and Characterization of Lytic Properties of Bacteriophages Specific for M. haemolytica Strains.

    Directory of Open Access Journals (Sweden)

    Renata Urban-Chmiel

    Full Text Available The objective of this study was isolation and morphological characterization of temperate bacteriophages obtained from M. haemolytica strains and evaluation of their lytic properties in vitro against M. haemolytica isolated from the respiratory tract of calves.The material for the study consisted of the reference strain M. haemolytica serotype 1 (ATCC® BAA-410™, reference serotypes A1, A2, A5, A6, A7, A9 and A11, and wild-type isolates of M. haemolytica. Bacteriophages were induced from an overnight bacterial starter culture of all examined M. haemolytica strains treated with mitomycin C. The lytic properties and host ranges were determined by plaque assays. The morphology of the bacteriophages was examined in negative-stained smears with 5% uranyl acetate solution using a transmission electron microscope. The genetic analysis of the bacteriophages was followed by restriction analysis of bacteriophage DNA. This was followed by analysis of genetic material by polymerase chain reaction (PCR.Eight bacteriophages were obtained, like typical of the families Myoviridae, Siphoviridae and Podoviridae. Most of the bacteriophages exhibited lytic properties against the M. haemolytica strains. Restriction analysis revealed similarities to the P2-like phage obtained from the strain M. haemolytica BAA-410. The most similar profiles were observed in the case of bacteriophages φA1 and φA5. All of the bacteriophages obtained were characterized by the presence of additional fragments in the restriction profiles with respect to the P2-like reference phage. In the analysis of PCR products for the P2-like reference phage phi-MhaA1-PHL101 (DQ426904 and the phages of the M. haemolytica serotypes, a 734-bp phage PCR product was obtained. The primers were programmed in Primer-Blast software using the structure of the sequence DQ426904 of reference phage PHL101.The results obtained indicate the need for further research aimed at isolating and characterizing

  4. Isolation and Characterization of Lytic Properties of Bacteriophages Specific for M. haemolytica Strains.

    Science.gov (United States)

    Urban-Chmiel, Renata; Wernicki, Andrzej; Stęgierska, Diana; Dec, Marta; Dudzic, Anna; Puchalski, Andrzej

    2015-01-01

    The objective of this study was isolation and morphological characterization of temperate bacteriophages obtained from M. haemolytica strains and evaluation of their lytic properties in vitro against M. haemolytica isolated from the respiratory tract of calves. The material for the study consisted of the reference strain M. haemolytica serotype 1 (ATCC®) BAA-410™, reference serotypes A1, A2, A5, A6, A7, A9 and A11, and wild-type isolates of M. haemolytica. Bacteriophages were induced from an overnight bacterial starter culture of all examined M. haemolytica strains treated with mitomycin C. The lytic properties and host ranges were determined by plaque assays. The morphology of the bacteriophages was examined in negative-stained smears with 5% uranyl acetate solution using a transmission electron microscope. The genetic analysis of the bacteriophages was followed by restriction analysis of bacteriophage DNA. This was followed by analysis of genetic material by polymerase chain reaction (PCR). Eight bacteriophages were obtained, like typical of the families Myoviridae, Siphoviridae and Podoviridae. Most of the bacteriophages exhibited lytic properties against the M. haemolytica strains. Restriction analysis revealed similarities to the P2-like phage obtained from the strain M. haemolytica BAA-410. The most similar profiles were observed in the case of bacteriophages φA1 and φA5. All of the bacteriophages obtained were characterized by the presence of additional fragments in the restriction profiles with respect to the P2-like reference phage. In the analysis of PCR products for the P2-like reference phage phi-MhaA1-PHL101 (DQ426904) and the phages of the M. haemolytica serotypes, a 734-bp phage PCR product was obtained. The primers were programmed in Primer-Blast software using the structure of the sequence DQ426904 of reference phage PHL101. The results obtained indicate the need for further research aimed at isolating and characterizing bacteriophages

  5. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  6. Analysis of a mutation affecting the specificity domain for prohead binding of the bacteriophage lambda terminase.

    Science.gov (United States)

    Sippy, J; Feiss, M

    1992-02-01

    Genetic studies have identified a specificity domain for prohead binding in the C-terminal 32 amino acids of gpA, the large subunit of bacteriophage lambda terminase (S. Frackman, D. A. Siegele, and M. Feiss, J. Mol. Biol. 180:283-300, 1984). In the present work, an amber mutation, Aam42, in the fifth-to-last codon of the A gene was found to be lethal in nonsuppressing hosts. The mutation, expected to generate gpA lacking the last five amino acids, caused the production of a terminase that cut cos efficiently both in vivo and in vitro but was defective in DNA packaging. lambda Aam42 lysates contained unused proheads, consistent with a defect in prohead binding. Aam42 terminase was more strongly dependent than wild-type terminase on gpFI, the catalyst of prohead binding. Like wild-type terminase, Aam42 terminase did not cut cos in vivo when prohead assembly was blocked by a mutation in one of the genes encoding the prohead.

  7. Investigation of four {sup 99m}Tc-labeled bacteriophages for infection-specific imaging

    Energy Technology Data Exchange (ETDEWEB)

    Rusckowski, Mary [Division of Nuclear Medicine, Department of Radiology, University of Massachusetts Medical School, Worcester, MA 01655-0243 (United States)], E-mail: mary.rusckowski@umassmed.edu; Gupta, Suresh; Liu Guozheng; Dou Shuping; Hnatowich, Donald J. [Division of Nuclear Medicine, Department of Radiology, University of Massachusetts Medical School, Worcester, MA 01655-0243 (United States)

    2008-05-15

    Introduction: This study investigated radiolabeled bacteriophages for specific detection of infection through gamma imaging. Previously, a {sup 99m}Tc-labeled M13 phage demonstrated specific binding for its host Escherichia coli in vitro and in mice through imaging. Methods: This study was extended to phages P22, E79, VD-13 and phage 60. Each was radiolabeled with {sup 99m}Tc using the chelator MAG{sub 3}, and were evaluated for binding to host and non-host bacteria in vitro and in a mouse infection model. Results: In vitro, each {sup 99m}Tc-phage bound to its host at least 4-fold higher than to non-host bacteria. For example, {sup 99m}Tc-E79 showed 10- to 20-fold greater binding to host Pseudomonas aeruginosa compared to non-host Escherichia coli and Salmonella enterica, and {sup 99m}Tc-phage 60 showed 20-fold greater binding to host Klebsiella pneumoniae over non-hosts. Mice received host or non-host bacteria in one thigh, and 3 h later, the {sup 99m}Tc-phages were administered intravenously. After a further 3 h, the tissues were counted. Liver accumulation was highest for {sup 99m}Tc-E79, averaging 39% compared to an average of 13% for the other {sup 99m}Tc-phages. Animals infected with host bacteria showed infected thigh/normal thigh ratios of 14.2 for {sup 99m}Tc-E79, 2.9 for {sup 99m}Tc-P22, 3.5 for {sup 99m}Tc-VD-13 and 2.1 for {sup 99m}Tc-phage 60. Conclusions: Although specific host binding was observed in vitro for each of these four {sup 99m}Tc-phages, only {sup 99m}Tc-E79 showed specificity for its host in an in vivo model.

  8. Trace detection of specific viable bacteria using tetracysteine-tagged bacteriophages.

    Science.gov (United States)

    Wu, Lina; Luan, Tian; Yang, Xiaoting; Wang, Shuo; Zheng, Yan; Huang, Tianxun; Zhu, Shaobin; Yan, Xiaomei

    2014-01-01

    Advanced methods are urgently needed to determine the identity and viability of trace amounts of pathogenic bacteria in a short time. Existing approaches either fall short in the accurate assessment of microbial viability or lack specificity in bacterial identification. Bacteriophages (or phages for short) are viruses that exclusively infect bacterial host cells with high specificity. As phages infect and replicate only in living bacterial hosts, here we exploit the strategy of using tetracysteine (TC)-tagged phage in combination with biarsenical dye to the discriminative detection of viable target bacteria from dead target cells and other viable but nontarget bacterial cells. Using recombinant M13KE-TC phage and Escherichia coli ER2738 as a model system, distinct differentiation between individual viable target cells from dead target cells was demonstrated by flow cytometry and fluorescence microscopy. As few as 1% viable E. coli ER2738 can be accurately quantified in a mix with dead E. coli ER2738 by flow cytometry. With fluorescence microscopic measurement, specific detection of as rare as 1 cfu/mL original viable target bacteria was achieved in the presence of a large excess of dead target cells and other viable but nontarget bacterial cells in 40 mL artificially contaminated drinking water sample in less than 3 h. This TC-phage-FlAsH approach is sensitive, specific, rapid, and simple, and thus shows great potential in water safety monitoring, health surveillance, and clinical diagnosis of which trace detection and identification of viable bacterial pathogens is highly demanded.

  9. Specificity of interactions among the DNA-packaging machine components of T4-related bacteriophages.

    Science.gov (United States)

    Gao, Song; Rao, Venigalla B

    2011-02-04

    Tailed bacteriophages use powerful molecular motors to package the viral genome into a preformed capsid. Packaging at a rate of up to ∼2000 bp/s and generating a power density twice that of an automobile engine, the phage T4 motor is the fastest and most powerful reported to date. Central to DNA packaging are dynamic interactions among the packaging components, capsid (gp23), portal (gp20), motor (gp17, large "terminase"), and regulator (gp16, small terminase), leading to precise orchestration of the packaging process, but the mechanisms are poorly understood. Here we analyzed the interactions between small and large terminases of T4-related phages. Our results show that the gp17 packaging ATPase is maximally stimulated by homologous, but not heterologous, gp16. Multiple interaction sites are identified in both gp16 and gp17. The specificity determinants in gp16 are clustered in the diverged N- and C-terminal domains (regions I-III). Swapping of diverged region(s), such as replacing C-terminal RB49 region III with that of T4, switched ATPase stimulation specificity. Two specificity regions, amino acids 37-52 and 290-315, are identified in or near the gp17-ATPase "transmission" subdomain II. gp16 binding at these sites might cause a conformational change positioning the ATPase-coupling residues into the catalytic pocket, triggering ATP hydrolysis. These results lead to a model in which multiple weak interactions between motor and regulator allow dynamic assembly and disassembly of various packaging complexes, depending on the functional state of the packaging machine. This might be a general mechanism for regulation of the phage packaging machine and other complex molecular machines.

  10. Comparative analysis of two phenotypically-similar but genomically-distinct Burkholderia cenocepacia-specific bacteriophages

    Directory of Open Access Journals (Sweden)

    Lynch Karlene H

    2012-06-01

    Full Text Available Abstract Background Genomic analysis of bacteriophages infecting the Burkholderia cepacia complex (BCC is an important preliminary step in the development of a phage therapy protocol for these opportunistic pathogens. The objective of this study was to characterize KL1 (vB_BceS_KL1 and AH2 (vB_BceS_AH2, two novel Burkholderia cenocepacia-specific siphoviruses isolated from environmental samples. Results KL1 and AH2 exhibit several unique phenotypic similarities: they infect the same B. cenocepacia strains, they require prolonged incubation at 30°C for the formation of plaques at low titres, and they do not form plaques at similar titres following incubation at 37°C. However, despite these similarities, we have determined using whole-genome pyrosequencing that these phages show minimal relatedness to one another. The KL1 genome is 42,832 base pairs (bp in length and is most closely related to Pseudomonas phage 73 (PA73. In contrast, the AH2 genome is 58,065 bp in length and is most closely related to Burkholderia phage BcepNazgul. Using both BLASTP and HHpred analysis, we have identified and analyzed the putative virion morphogenesis, lysis, DNA binding, and MazG proteins of these two phages. Notably, MazG homologs identified in cyanophages have been predicted to facilitate infection of stationary phase cells and may contribute to the unique plaque phenotype of KL1 and AH2. Conclusions The nearly indistinguishable phenotypes but distinct genomes of KL1 and AH2 provide further evidence of both vast diversity and convergent evolution in the BCC-specific phage population.

  11. Specific antibody-receptor interactions trigger InlAB-independent uptake of listeria monocytogenes into tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hotz Christian

    2011-07-01

    Full Text Available Abstract Background Specific cell targeting is an important, yet unsolved problem in bacteria-based therapeutic applications, like tumor or gene therapy. Here, we describe the construction of a novel, internalin A and B (InlAB-deficient Listeria monocytogenes strain (Lm-spa+, which expresses protein A of Staphylococcus aureus (SPA and anchors SPA in the correct orientation on the bacterial cell surface. Results This listerial strain efficiently binds antibodies allowing specific interaction of the bacterium with the target recognized by the antibody. Binding of Trastuzumab (Herceptin® or Cetuximab (Erbitux® to Lm-spa+, two clinically approved monoclonal antibodies directed against HER2/neu and EGFR/HER1, respectively, triggers InlAB-independent internalization into non-phagocytic cancer cell lines overexpressing the respective receptors. Internalization, subsequent escape into the host cell cytosol and intracellular replication of these bacteria are as efficient as of the corresponding InlAB-positive, SPA-negative parental strain. This specific antibody/receptor-mediated internalization of Lm-spa+ is shown in the murine 4T1 tumor cell line, the isogenic 4T1-HER2 cell line as well as the human cancer cell lines SK-BR-3 and SK-OV-3. Importantly, this targeting approach is applicable in a xenograft mouse tumor model after crosslinking the antibody to SPA on the listerial cell surface. Conclusions Binding of receptor-specific antibodies to SPA-expressing L. monocytogenes may represent a promising approach to target L. monocytogenes to host cells expressing specific receptors triggering internalization.

  12. RNA Packing Specificity and Folding during Assembly of the Bacteriophage MS2

    Directory of Open Access Journals (Sweden)

    Ottar Rolfsson

    2008-01-01

    Full Text Available Using a combination of biochemistry, mass spectrometry, NMR spectroscopy and cryo-electron microscopy (cryo-EM, we have been able to show that quasi-equivalent conformer switching in the coat protein (CP of an RNA bacteriophage (MS2 is controlled by a sequence-specific RNA–protein interaction. The RNA component of this complex is an RNA stem-loop encompassing just 19 nts from the phage genomic RNA, which is 3569 nts in length. This binding results in the conversion of a CP dimer from a symmetrical conformation to an asymmetric one. Only when both symmetrical and asymmetrical dimers are present in solution is assembly of the T = 3 phage capsid efficient. This implies that the conformers, we have characterized by NMR correspond to the two distinct quasi-equivalent conformers seen in the 3D structure of the virion. An icosahedrally-averaged single particle cryo-EM reconstruction of the wild-type phage (to ∼9 Å resolution has revealed icosahedrally ordered density encompassing up to 90% of the single-stranded RNA genome. The RNA is seen with a novel arrangement of two concentric shells, with connections between them along the 5-fold symmetry axes. RNA in the outer shell interacts with each of the 90 CP dimers in the T = 3 capsid and although the density is icosahedrally averaged, there appears to be a different average contact at the different quasi-equivalent protein dimers: precisely the result that would be expected if protein conformer switching is RNA-mediated throughout the assembly pathway. This unprecedented RNA structure provides new constraints for models of viral assembly and we describe experiments aimed at probing these. Together, these results suggest that viral genomic RNA folding is an important factor in efficient assembly, and further suggest that RNAs that could sequester viral CPs but not fold appropriately could act as potent inhibitors of viral assembly.

  13. Bacteriophages infecting Propionibacterium acnes.

    Science.gov (United States)

    Brüggemann, Holger; Lood, Rolf

    2013-01-01

    Viruses specifically infecting bacteria, or bacteriophages, are the most common biological entity in the biosphere. As such, they greatly influence bacteria, both in terms of enhancing their virulence and in terms of killing them. Since the first identification of bacteriophages in the beginning of the 20th century, researchers have been fascinated by these microorganisms and their ability to eradicate bacteria. In this review, we will cover the history of the Propionibacterium acnes bacteriophage research and point out how bacteriophage research has been an important part of the research on P. acnes itself. We will further discuss recent findings from phage genome sequencing and the identification of phage sequence signatures in clustered regularly interspaced short palindromic repeats (CRISPRs). Finally, the potential to use P. acnes bacteriophages as a therapeutic strategy to combat P. acnes-associated diseases will be discussed.

  14. Bacteriophages Infecting Propionibacterium acnes

    Directory of Open Access Journals (Sweden)

    Holger Brüggemann

    2013-01-01

    Full Text Available Viruses specifically infecting bacteria, or bacteriophages, are the most common biological entity in the biosphere. As such, they greatly influence bacteria, both in terms of enhancing their virulence and in terms of killing them. Since the first identification of bacteriophages in the beginning of the 20th century, researchers have been fascinated by these microorganisms and their ability to eradicate bacteria. In this review, we will cover the history of the Propionibacterium acnes bacteriophage research and point out how bacteriophage research has been an important part of the research on P. acnes itself. We will further discuss recent findings from phage genome sequencing and the identification of phage sequence signatures in clustered regularly interspaced short palindromic repeats (CRISPRs. Finally, the potential to use P. acnes bacteriophages as a therapeutic strategy to combat P. acnes-associated diseases will be discussed.

  15. Isolation and partial characterization of a virulent bacteriophage IHQ1 specific for Aeromonas punctata from stream water.

    Science.gov (United States)

    Ul Haq, Irshad; Chaudhry, Waqas Nasir; Andleeb, Saadia; Qadri, Ishtiaq

    2012-05-01

    design of new detection and phage typing (diagnosis) methods. The specificity of the bacteriophage for A. punctata makes it an attractive candidate for phage therapy of A. punctata infections.

  16. A hybrid toxin from bacteriophage f1 attachment protein and colicin E3 has altered cell receptor specificity.

    OpenAIRE

    Jakes, K S; Davis, N G; Zinder, N D

    1988-01-01

    A hybrid protein was constructed in vitro which consists of the first 372 amino acids of the attachment (gene III) protein of filamentous bacteriophage f1 fused, in frame, to the carboxy-terminal catalytic domain of colicin E3. The hybrid toxin killed cells that had the F-pilus receptor for phage f1 but not F- cells. The activity of the hybrid protein was not dependent upon the presence of the colicin E3 receptor, BtuB protein. The killing activity was colicin E3 specific, since F+ cells expr...

  17. The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture

    Directory of Open Access Journals (Sweden)

    Stern NJ

    2006-06-01

    Full Text Available Abstract Background There has been a recent resurgent interest in bacteriophage biology. Research was initiated to examine Campylobacter jejuni-specific bacteriophage in the Russian Federation to develop alternative control measures for this pathogen. Results A C. jejuni flagellum-specific phage PV22 from Proteus vulgaris was identified in sewage drainage. This phage interacted with C. jejuni by attachment to flagella followed by translocation of the phage to the polar region of the bacterium up to the point of DNA injection. Electron microscopic examination revealed adsorption of PV22 on C. jejuni flagella after a five minute incubation of the phage and bacteria. A different phenomenon was observed after incubating the mix under the same conditions, but for twenty minutes or longer. Phage accumulated primarily on the surface of cells at sites where flagella originated. Interestingly, PV22 did not inject DNA into C. jejuni and PV22 did not produce lytic plaques on medium containing C. jejuni cells. The constant of velocity for PV22 adsorption on cells was 7 × 10-9 ml/min. Conclusion It was demonstrated that a bacteriophage that productively infects P. vulgaris was able to bind C. jejuni and by a spot test that the growth of C. jejuni was reduced relative to control bacteria in the region of phage application. There may be two interesting applications of this effect. First, it may be possible to test phage PV22 as an antimicrobial agent to decrease C. jejuni colonization of the chicken intestine. Second, the phage could potentially be utilized for investigating biogenesis of C. jejuni flagella.

  18. Isolation and characterization of specific bacteriophage Va1 to Vibrio alginolyticus

    Directory of Open Access Journals (Sweden)

    Carla Fernández Espinel

    2017-04-01

    Full Text Available Vibrio alginolyticus is associated with diseases in aquaculture. The misuse of antibiotics has led to the search for alternatives in the treatment of bacterial diseases, among them the application of bacteriophages that infect and destroy bacteria selectively. In this way, a highly lytic V. alginolyticus bacteriophage, termed Va1, was isolated, with the aim to evaluate its physical chemical parameters. For this purpose, different temperature, pH, chloroform exposure and host range conditions were evaluated. The temperature stability of phage Va1 showed higher titers at 20 and 30 °C decreasing from 40 °C. With respect to pH, the highest titers for the bacteriophage were between 5 and 8, and chloroform exposure reduced viability of the Va1 phage by 25%. The one-step curve determined that the latency period and the burst size were 20 minutes and 192 PFU / infective center respectively. Under the transmission electron microscope, the Va1 phage showed an icosahedral head and a non-contractile tail, belonging to the Podoviridae family. In conclusion, Va1 phage presents potential characteristics for use in phage therapy.

  19. Comparative (metagenomic analysis and ecological profiling of human gut-specific bacteriophage φB124-14.

    Directory of Open Access Journals (Sweden)

    Lesley A Ogilvie

    Full Text Available Bacteriophage associated with the human gut microbiome are likely to have an important impact on community structure and function, and provide a wealth of biotechnological opportunities. Despite this, knowledge of the ecology and composition of bacteriophage in the gut bacterial community remains poor, with few well characterized gut-associated phage genomes currently available. Here we describe the identification and in-depth (metagenomic, proteomic, and ecological analysis of a human gut-specific bacteriophage (designated φB124-14. In doing so we illuminate a fraction of the biological dark matter extant in this ecosystem and its surrounding eco-genomic landscape, identifying a novel and uncharted bacteriophage gene-space in this community. φB124-14 infects only a subset of closely related gut-associated Bacteroides fragilis strains, and the circular genome encodes functions previously found to be rare in viral genomes and human gut viral metagenome sequences, including those which potentially confer advantages upon phage and/or host bacteria. Comparative genomic analyses revealed φB124-14 is most closely related to φB40-8, the only other publically available Bacteroides sp. phage genome, whilst comparative metagenomic analysis of both phage failed to identify any homologous sequences in 136 non-human gut metagenomic datasets searched, supporting the human gut-specific nature of this phage. Moreover, a potential geographic variation in the carriage of these and related phage was revealed by analysis of their distribution and prevalence within 151 human gut microbiomes and viromes from Europe, America and Japan. Finally, ecological profiling of φB124-14 and φB40-8, using both gene-centric alignment-driven phylogenetic analyses, as well as alignment-free gene-independent approaches was undertaken. This not only verified the human gut-specific nature of both phage, but also indicated that these phage populate a distinct and unexplored

  20. Comparative (Meta)genomic Analysis and Ecological Profiling of Human Gut-Specific Bacteriophage φB124-14

    Science.gov (United States)

    Ogilvie, Lesley A.; Caplin, Jonathan; Dedi, Cinzia; Diston, David; Cheek, Elizabeth; Bowler, Lucas; Taylor, Huw; Ebdon, James; Jones, Brian V.

    2012-01-01

    Bacteriophage associated with the human gut microbiome are likely to have an important impact on community structure and function, and provide a wealth of biotechnological opportunities. Despite this, knowledge of the ecology and composition of bacteriophage in the gut bacterial community remains poor, with few well characterized gut-associated phage genomes currently available. Here we describe the identification and in-depth (meta)genomic, proteomic, and ecological analysis of a human gut-specific bacteriophage (designated φB124-14). In doing so we illuminate a fraction of the biological dark matter extant in this ecosystem and its surrounding eco-genomic landscape, identifying a novel and uncharted bacteriophage gene-space in this community. φB124-14 infects only a subset of closely related gut-associated Bacteroides fragilis strains, and the circular genome encodes functions previously found to be rare in viral genomes and human gut viral metagenome sequences, including those which potentially confer advantages upon phage and/or host bacteria. Comparative genomic analyses revealed φB124-14 is most closely related to φB40-8, the only other publically available Bacteroides sp. phage genome, whilst comparative metagenomic analysis of both phage failed to identify any homologous sequences in 136 non-human gut metagenomic datasets searched, supporting the human gut-specific nature of this phage. Moreover, a potential geographic variation in the carriage of these and related phage was revealed by analysis of their distribution and prevalence within 151 human gut microbiomes and viromes from Europe, America and Japan. Finally, ecological profiling of φB124-14 and φB40-8, using both gene-centric alignment-driven phylogenetic analyses, as well as alignment-free gene-independent approaches was undertaken. This not only verified the human gut-specific nature of both phage, but also indicated that these phage populate a distinct and unexplored ecological landscape

  1. Hyperexpansion of RNA Bacteriophage Diversity

    Science.gov (United States)

    Krishnamurthy, Siddharth R.; Janowski, Andrew B.; Zhao, Guoyan; Barouch, Dan; Wang, David

    2016-01-01

    Bacteriophage modulation of microbial populations impacts critical processes in ocean, soil, and animal ecosystems. However, the role of bacteriophages with RNA genomes (RNA bacteriophages) in these processes is poorly understood, in part because of the limited number of known RNA bacteriophage species. Here, we identify partial genome sequences of 122 RNA bacteriophage phylotypes that are highly divergent from each other and from previously described RNA bacteriophages. These novel RNA bacteriophage sequences were present in samples collected from a range of ecological niches worldwide, including invertebrates and extreme microbial sediment, demonstrating that they are more widely distributed than previously recognized. Genomic analyses of these novel bacteriophages yielded multiple novel genome organizations. Furthermore, one RNA bacteriophage was detected in the transcriptome of a pure culture of Streptomyces avermitilis, suggesting for the first time that the known tropism of RNA bacteriophages may include gram-positive bacteria. Finally, reverse transcription PCR (RT-PCR)-based screening for two specific RNA bacteriophages in stool samples from a longitudinal cohort of macaques suggested that they are generally acutely present rather than persistent. PMID:27010970

  2. Hyperexpansion of RNA Bacteriophage Diversity.

    Directory of Open Access Journals (Sweden)

    Siddharth R Krishnamurthy

    2016-03-01

    Full Text Available Bacteriophage modulation of microbial populations impacts critical processes in ocean, soil, and animal ecosystems. However, the role of bacteriophages with RNA genomes (RNA bacteriophages in these processes is poorly understood, in part because of the limited number of known RNA bacteriophage species. Here, we identify partial genome sequences of 122 RNA bacteriophage phylotypes that are highly divergent from each other and from previously described RNA bacteriophages. These novel RNA bacteriophage sequences were present in samples collected from a range of ecological niches worldwide, including invertebrates and extreme microbial sediment, demonstrating that they are more widely distributed than previously recognized. Genomic analyses of these novel bacteriophages yielded multiple novel genome organizations. Furthermore, one RNA bacteriophage was detected in the transcriptome of a pure culture of Streptomyces avermitilis, suggesting for the first time that the known tropism of RNA bacteriophages may include gram-positive bacteria. Finally, reverse transcription PCR (RT-PCR-based screening for two specific RNA bacteriophages in stool samples from a longitudinal cohort of macaques suggested that they are generally acutely present rather than persistent.

  3. Hyperexpansion of RNA Bacteriophage Diversity.

    Science.gov (United States)

    Krishnamurthy, Siddharth R; Janowski, Andrew B; Zhao, Guoyan; Barouch, Dan; Wang, David

    2016-03-01

    Bacteriophage modulation of microbial populations impacts critical processes in ocean, soil, and animal ecosystems. However, the role of bacteriophages with RNA genomes (RNA bacteriophages) in these processes is poorly understood, in part because of the limited number of known RNA bacteriophage species. Here, we identify partial genome sequences of 122 RNA bacteriophage phylotypes that are highly divergent from each other and from previously described RNA bacteriophages. These novel RNA bacteriophage sequences were present in samples collected from a range of ecological niches worldwide, including invertebrates and extreme microbial sediment, demonstrating that they are more widely distributed than previously recognized. Genomic analyses of these novel bacteriophages yielded multiple novel genome organizations. Furthermore, one RNA bacteriophage was detected in the transcriptome of a pure culture of Streptomyces avermitilis, suggesting for the first time that the known tropism of RNA bacteriophages may include gram-positive bacteria. Finally, reverse transcription PCR (RT-PCR)-based screening for two specific RNA bacteriophages in stool samples from a longitudinal cohort of macaques suggested that they are generally acutely present rather than persistent.

  4. Differentiation of polyvalent bacteriophages specific to uropathogenic Proteus mirabilis strains based on the host range pattern and RFLP.

    Science.gov (United States)

    Maszewska, Agnieszka; Wójcik, Ewelina; Ciurzyńska, Aneta; Wojtasik, Arkadiusz; Piątkowska, Iwona; Dastych, Jarosław; Różalski, Antoni

    2016-01-01

    Urinary tract infections (UTIs) caused by P. mirabilis are difficult to cure because of the increasing antimicrobial resistance of these bacteria. Phage therapy is proposed as an alternative infection treatment. The aim of this study was to isolate and differentiate uropathogenic P. mirabilis strain specific polyvalent bacteriophages producing polysaccharide depolymerases (PDs). 51 specific phages were obtained. The plaques of 29 bacteriophages were surrounded by halos, which indicated that they produced PDs. The host range analysis showed that, except phages 58B and 58C, the phage host range profiles differed from each other. Phages 35 and 45 infected all P. mirabilis strains tested. Another 10 phages lysed more than 90% of isolates. Among these phages, 65A, 70, 66 and 66A caused a complete lysis of the bacterial lawn formed by 62% to 78% of strains. Additionally, phages 39A and 70 probably produced PDs. The phages' DNA restriction fragment length polymorphism (RFLP) analysis demonstrated that genomes of 51 isolated phages represented 34 different restriction profiles. DNA of phage 58A seemed to be resistant to selected EcoRV endonuclease. The 33 RFLP-EcoRV profiles showed a Dice similarity index of 38.8%. 22 RFLP patterns were obtained from single phage isolates. The remaining 12 restriction profiles consisted of 2 to 4 viruses. The results obtained from phage characterization based on the pattern of phage host range in combination with the RFLP method enabled effective differentiation of the studied phages and selection of PD producing polyvalent phages for further study.

  5. DNA Packaging Specificity of Bacteriophage N15 with an Excursion into the Genetics of a Cohesive End Mismatch.

    Directory of Open Access Journals (Sweden)

    Michael Feiss

    Full Text Available During DNA replication by the λ-like bacteriophages, immature concatemeric DNA is produced by rolling circle replication. The concatemers are processed into mature chromosomes with cohesive ends, and packaged into prohead shells, during virion assembly. Cohesive ends are generated by the viral enzyme terminase, which introduces staggered nicks at cos, an approx. 200 bp-long sequence containing subsites cosQ, cosN and cosB. Interactions of cos subsites of immature concatemeric DNA with terminase orchestrate DNA processing and packaging. To initiate DNA packaging, terminase interacts with cosB and nicks cosN. The cohesive ends of N15 DNA differ from those of λ at 2/12 positions. Genetic experiments show that phages with chromosomes containing mismatched cohesive ends are functional. In at least some infections, the cohesive end mismatch persists through cyclization and replication, so that progeny phages of both allelic types are produced in the infected cell. N15 possesses an asymmetric packaging specificity: N15 DNA is not packaged by phages λ or 21, but surprisingly, N15-specific terminase packages λ DNA. Implications for genetic interactions among λ-like bacteriophages are discussed.

  6. DNA Packaging Specificity of Bacteriophage N15 with an Excursion into the Genetics of a Cohesive End Mismatch.

    Science.gov (United States)

    Feiss, Michael; Young Min, Jea; Sultana, Sawsan; Patel, Priyal; Sippy, Jean

    2015-01-01

    During DNA replication by the λ-like bacteriophages, immature concatemeric DNA is produced by rolling circle replication. The concatemers are processed into mature chromosomes with cohesive ends, and packaged into prohead shells, during virion assembly. Cohesive ends are generated by the viral enzyme terminase, which introduces staggered nicks at cos, an approx. 200 bp-long sequence containing subsites cosQ, cosN and cosB. Interactions of cos subsites of immature concatemeric DNA with terminase orchestrate DNA processing and packaging. To initiate DNA packaging, terminase interacts with cosB and nicks cosN. The cohesive ends of N15 DNA differ from those of λ at 2/12 positions. Genetic experiments show that phages with chromosomes containing mismatched cohesive ends are functional. In at least some infections, the cohesive end mismatch persists through cyclization and replication, so that progeny phages of both allelic types are produced in the infected cell. N15 possesses an asymmetric packaging specificity: N15 DNA is not packaged by phages λ or 21, but surprisingly, N15-specific terminase packages λ DNA. Implications for genetic interactions among λ-like bacteriophages are discussed.

  7. Vibrio parahaemolyticus and its specific bacteriophages as an indicator in cockles (Anadara granosa) for the risk of V. parahaemolyticus infection in Southern Thailand.

    Science.gov (United States)

    Yingkajorn, Mingkwan; Sermwitayawong, Natthawan; Palittapongarnpimp, Prasit; Nishibuchi, Mitsuaki; Robins, William P; Mekalanos, John J; Vuddhakul, Varaporn

    2014-05-01

    Correlation between the numbers of Vibrio parahaemolyticus and its specific bacteriophages in cockles was investigated from June 2009 to May 2010 in Hat Yai, Songkhla, Thailand. Cockles obtained monthly from a local market were sampled to determine the numbers of V. parahaemolyticus and bacteriophages that could form plaques on ten strains of pandemic and nonpandemic V. parahaemolyticus. In addition, V. parahaemolyticus isolates from clinical samples from Hat Yai hospital over the same period were investigated. All 139 cockles sampled were positive for V. parahaemolyticus. However, only 76 of them were positive for bacteriophages. During the testing period, the number of bacteriophages was not significantly correlated with the incidence of V. parahaemolyticus-infected patients, but the numbers of V. parahaemolyticus isolates from the cockle samples were closely related to the number of infected patients. The bacteriophages isolated from V. parahaemolyticus also infected Vibrio alginolyticus and Vibrio mimicus, suggesting that the broad host range of phages may be a factor of providing the possibility of their participation in the processes of genetic exchange between V. parahaemolyticus and closely related Vibrio spp. In conclusion, this study indicated that the number of V. parahaemolyticus in cockles may be a useful tool for predicting the relative risk of infection by V. parahaemolyticus in this area of Thailand.

  8. Development of prototypes of bioactive packaging materials based on immobilized bacteriophages for control of growth of bacterial pathogens in foods.

    Science.gov (United States)

    Lone, Ayesha; Anany, Hany; Hakeem, Mohammed; Aguis, Louise; Avdjian, Anne-Claire; Bouget, Marina; Atashi, Arash; Brovko, Luba; Rochefort, Dominic; Griffiths, Mansel W

    2016-01-18

    Due to lack of adequate control methods to prevent contamination in fresh produce and growing consumer demand for natural products, the use of bacteriophages has emerged as a promising approach to enhance safety of these foods. This study sought to control Listeria monocytogenes in cantaloupes and RTE meat and Escherichia coli O104:H4 in alfalfa seeds and sprouts under different storage conditions by using specific lytic bacteriophage cocktails applied either free or immobilized. Bacteriophage cocktails were introduced into prototypes of packaging materials using different techniques: i) immobilizing on positively charged modified cellulose membranes, ii) impregnating paper with bacteriophage suspension, and iii) encapsulating in alginate beads followed by application of beads onto the paper. Phage-treated and non-treated samples were stored for various times and at temperatures of 4°C, 12°C or 25°C. In cantaloupe, when free phage cocktail was added, L. monocytogenes counts dropped below the detection limit of the plating technique (<1 log CFU/g) after 5 days of storage at both 4°C and 12°C. However, at 25°C, counts below the detection limit were observed after 3 and 6h and a 2-log CFU/g reduction in cell numbers was seen after 24h. For the immobilized Listeria phage cocktail, around 1-log CFU/g reduction in the Listeria count was observed by the end of the storage period for all tested storage temperatures. For the alfalfa seeds and sprouts, regardless of the type of phage application technique (spraying of free phage suspension, bringing in contact with bacteriophage-based materials (paper coated with encapsulated bacteriophage or impregnated with bacteriophage suspension)), the count of E. coli O104:H4 was below the detection limit (<1 log CFU/g) after 1h in seeds and about a 1-log cycle reduction in E. coli count was observed on the germinated sprouts by day 5. In ready-to-eat (RTE) meat, LISTEX™ P100, a commercial phage product, was able to

  9. The endolysins of bacteriophages CMP1 and CN77 are specific for the lysis of Clavibacter michiganensis strains.

    Science.gov (United States)

    Wittmann, Johannes; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte

    2010-08-01

    Putative endolysin genes of bacteriophages CMP1 and CN77, which infect Clavibacter michiganensis subsp. michiganensis and C. michiganensis subsp. nebraskensis, respectively, were cloned and expressed in Escherichia coli. The His-tagged endolysin of CMP1 consists of 306 amino acids and has a calculated molecular mass of 34.8 kDa, while the His-tagged endolysin of CN77 has 290 amino acids with a molecular mass of 31.9 kDa. The proteins were purified and their bacteriolytic activity was demonstrated. The bacteriolytic activity of both enzymes showed a host range which was limited to the respective C. michiganensis subspecies and did not affect other bacteria, even those closely related to Clavibacter. Due to the high specificity of the CMP1 and CN77 endolysins they may be useful tools for biocontrol of plant-pathogenic C. michiganensis without affecting other bacteria in the soil.

  10. In vitro assessment of the susceptibility of planktonic and attached cells of foodborne pathogens to bacteriophage p22-mediated salmonella lysates.

    Science.gov (United States)

    Ahn, Juhee; Kim, Songrae; Jung, Lae-Seung; Biswas, Debabrata

    2013-12-01

    This study was designed to evaluate the lytic activity of bacteriophage P22 against Salmonella Typhimurium ATCC 19585 (Salmonella Typhimurium P22(-)) at various multiplicities of infections (MOIs), the susceptibility of preattached Salmonella cells against bacteriophage P22, and the effect of P22-mediated bacterial lysates (extracellular DNA) on the attachment ability of Listeria monocytogenes ATCC 7644 and enterohemorrhagic Escherichia coli ATCC 700927 to surfaces. The numbers of attached Salmonella Typhimurium P22(-) cells were effectively reduced to below the detection limit (1 log CFU/ml) at the fixed inoculum levels of 3 × 10(-) CFU/ml (MOI = 3.12) and 3 × 10(3) CFU/ml (MOI = 4.12) by bacteriophage P22. The attached Salmonella Typhimurium P22(-) cells remained more than 2 log CFU/ml, with increasing inoculum levels from 3 × 10(4) to 3 × 10(7) CFU/ml infected with 4 × 10(8) PFU/ml of P22. The number of preattached Salmonella Typhimurium P22(-) cells was noticeably reduced by 2.72 log in the presence of P22. The highest specific attachment ability values for Salmonella Typhimurium P22(-), Salmonella Typhimurium ATCC 23555 carrying P22 prophage (Salmonella Typhimurium P22(+)), L. monocytogenes, and enterohemorrhagic E. coli were 2.09, 1.06, 1.86, and 1.08, respectively, in the bacteriophage-mediated cell-free supernatants (CFS) containing high amounts of extracellular DNA. These results suggest that bacteriophages could potentially be used to effectively eliminate planktonic and preattached Salmonella Typhimurium P22(-) cells with increasing MOI. However, further research is needed to understand the role of bacteriophage-induced lysates in bacterial attachment, which can provide useful information for the therapeutic use of bacteriophage in the food system.

  11. Characterization of phiCFP-1, a virulent bacteriophage specific for Citrobacter freundii.

    Science.gov (United States)

    Zhao, Xiangna; Huang, Simo; Zhao, Jiangtao; He, Xiaoming; Li, Erna; Li, Huan; Liu, Wei; Zou, Dayang; Wei, Xiao; Wang, Xuesong; Dong, Derong; Yang, Zhan; Yan, Xiabei; Shen, Zhiqiang; Yuan, Jing

    2016-05-01

    Citrobacter freundii, a Gram-negative bacterium, causes many opportunistic infections. Bacteriophage phiCFP-1 was isolated and characterized by its ability to lyse the multidrug-resistant clinical C. freundii strain P10159. Transmission electron microscopy showed that the phage has an icosahedral head and a short tail, making it a Podoviridae family member. In a single-step growth experiment, phiCFP-1 exhibited an eclipse period of 20 min and a burst size of 100 particles per cell. Its genome assembled as a circular molecule when genomic sequencing was completed. However, based on genome content and organization, it was categorized as a classic T7-related phage, and such phages are known to have linear genomes with direct terminal repeats. With the quick and simple method established herein, the 38,625-bp linear double-stranded DNA with 229-bp direct terminal repeats was accurately identified. The genome contained 43 putative open reading frames and no tRNA genes. Using a proteomics-based approach, seven viral and two host proteins from purified phiCFP-1 particles were identified. Comparative genomics and recombination analyzes revealed close genetic relatedness among phiCFP-1, phiYeO3-12/vB_YenP_AP5 (from Yersinia enterocolitica O3), and phiSG-JL2 (from Salmonella enterica).

  12. Specific Colon Cancer Cell Cytotoxicity Induced by Bacteriophage E Gene Expression under Transcriptional Control of Carcinoembryonic Antigen Promoter

    Directory of Open Access Journals (Sweden)

    Ana R. Rama

    2015-06-01

    Full Text Available Colorectal cancer is one of the most prevalent cancers in the world. Patients in advanced stages often develop metastases that require chemotherapy and usually show a poor response, have a low survival rate and develop considerable toxicity with adverse symptoms. Gene therapy may act as an adjuvant therapy in attempts to destroy the tumor without affecting normal host tissue. The bacteriophage E gene has demonstrated significant antitumor activity in several cancers, but without any tumor-specific activity. The use of tumor-specific promoters may help to direct the expression of therapeutic genes so they act against specific cancer cells. We used the carcinoembryonic antigen promoter (CEA to direct E gene expression (pCEA-E towards colon cancer cells. pCEA-E induced a high cell growth inhibition of human HTC-116 colon adenocarcinoma and mouse MC-38 colon cancer cells in comparison to normal human CCD18co colon cells, which have practically undetectable levels of CEA. In addition, in vivo analyses of mice bearing tumors induced using MC-38 cells showed a significant decrease in tumor volume after pCEA-E treatment and a low level of Ki-67 in relation to untreated tumors. These results suggest that the CEA promoter is an excellent candidate for directing E gene expression specifically toward colon cancer cells.

  13. The species-specific mode of action of the antimicrobial peptide subtilosin against Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Noll, K.S.; Chikindas, M.L.

    2012-01-01

    Aims: To elucidate the molecular mechanism of action of the antimicrobial peptide subtilosin against the foodborne pathogen Listeria monocytogenes Scott A. Methods and Results: Subtilosin was purified from a culture of Bacillus amylliquefaciens. The minimal inhibitory concentration of subtilosin aga

  14. Bacteriophages with Potential for Inactivation of Fish Pathogenic Bacteria: Survival, Host Specificity and Effect on Bacterial Community Structure

    Directory of Open Access Journals (Sweden)

    Yolanda J. Silva

    2011-11-01

    Full Text Available Phage therapy may represent a viable alternative to antibiotics to inactivate fish pathogenic bacteria. Its use, however, requires the awareness of novel kinetics phenomena not applied to conventional drug treatments. The main objective of this work was to isolate bacteriophages with potential to inactivate fish pathogenic bacteria, without major effects on the structure of natural bacterial communities of aquaculture waters. The survival was determined in marine water, through quantification by the soft agar overlay technique. The host specificity was evaluated by cross infection. The ecological impact of phage addition on the structure of the bacterial community was evaluated by DGGE of PCR amplified 16S rRNA gene fragments. The survival period varied between 12 and 91 days, with a higher viability for Aeromonas salmonicida phages. The phages of Vibrio parahaemolyticus and of A. salmonicida infected bacteria of different families with a high efficacy of plating. The specific phages of pathogenic bacteria had no detectable impact on the structure of the bacterial community. In conclusion, V. parahaemolyticus and A. salmonicida phages show good survival time in marine water, have only a moderated impact on the overall bacterial community structure and the desired specificity for host pathogenic bacteria, being potential candidates for therapy of fish infectious diseases in marine aquaculture systems.

  15. Relevance of Bacteroidales and F-Specific RNA Bacteriophages for Efficient Fecal Contamination Tracking at the Level of a Catchment in France

    Science.gov (United States)

    Mauffret, Aourell; Caprais, Marie-Paule

    2012-01-01

    The relevance of three host-associated Bacteroidales markers (HF183, Rum2Bac, and Pig2Bac) and four F-specific RNA bacteriophage genogroups (FRNAPH I to IV) as microbial source tracking markers was assessed at the level of a catchment (Daoulas, France). They were monitored together with fecal indicators (Escherichia coli and enterococci) and chemophysical parameters (rainfall, temperature, salinity, pH, and turbidity) by monthly sampling over 2 years (n = 240 water samples) and one specific sampling following an accidental pig manure spillage (n = 5 samples). During the 2-year regular monitoring, levels of E. coli, enterococci, total F-specific RNA bacteriophages, and the general Bacteroidales marker AllBac were strongly correlated with one another and with Rum2Bac (r = 0.37 to 0.50, P catchment. PMID:22610433

  16. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase

    DEFF Research Database (Denmark)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana

    2016-01-01

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression of a ...

  17. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase

    DEFF Research Database (Denmark)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana;

    2016-01-01

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression...

  18. Bacteriophages of Clostridium perfringens

    Science.gov (United States)

    The specific aims of the book chapter are to: (1) Briefly review the nomenclature of bacteriophages and how these agents are classified. (2) Discuss the problems associated with addition/removal of antibiotics in commercial animal feeds. (3) Provide a brief overview of Clostridium perfringens biolog...

  19. Specific detection of live Escherichia coli O157:H7 using tetracysteine-tagged PP01 bacteriophage.

    Science.gov (United States)

    Wu, Lina; Song, Yiyi; Luan, Tian; Ma, Ling; Su, Liuqin; Wang, Shuo; Yan, Xiaomei

    2016-12-15

    Sensitive and rapid detection of Escherichia coli O157:H7, one of the most notorious bacterial pathogens, is urgently needed for public health protection. Yet, the existing methods are either lack of speed or limited in discriminating viable and dead cells. Using a recombinant bacteriophage, here we report the development of a rapid and sensitive method for live E. coli O157:H7 detection. First, the wild-type PP01 phage was engineered with a tetracysteine (TC)-tag fused with the small outer capsid (SOC) protein. Then, this PP01-TC phage was used to inoculate bacterial sample for 30min. Specific infection and rapid replication of PP01-TC phage in viable E. coli O157:H7 host cell yields a large number of progeny phages with capsids displaying TC tags that can be fluorescently labeled by a membrane permeable biarsenical dye (FlAsH). The bright green fluorescence of single E. coli O157:H7 cells can be readily detected by flow cytometry (FCM) and fluorescence microscopy. High specificity of the assay was verified with seven other bacterial strains. Practical application in E. coli O157:H7 detection in drinks was successfully demonstrated with artificially contaminated 100% apple juice. In less than three hours (including sample preconcentration) and with 40mL of sample volume, as low as 1cfu/mL E. coli O157:H7 can be detected in the presence of large excess of other nontarget bacteria via fluorescence microscopic measurement. The as-developed TC-PP01-FlAsH approach shows a great potential in the safeguard of liquid food products by providing rapid, sensitive, and specific detection of live E. coli O157:H7.

  20. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase.

    Science.gov (United States)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana; Gritsenko, Natalia; Rask, Lene; Mainbakh, Yuli; Zilberstein, Yael; Yagil, Ezra; Kolot, Mikhail

    2016-04-27

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression of a cytotoxic gene. In the present study we developed a new cancer specific binary expression system activated by the Integrase (Int) of the lambdoid phage HK022. We demonstrate the validity of this system by the specific expression of a luciferase (luc) reporter in human embryonic kidney 293T (HEK293T) cells and in a lung cancer mouse model. Due to the absence viral vectors and of cytotoxicity the Int based binary system offers advantages over previously described counterparts and may therefore be developed into a safer cancer cell killing system.

  1. Broad substrate specificity of phosphotransbutyrylase from Listeria monocytogenes: A potential participant in an alternative pathway for provision of acyl CoA precursors for fatty acid biosynthesis.

    Science.gov (United States)

    Sirobhushanam, Sirisha; Galva, Charitha; Sen, Suranjana; Wilkinson, Brian J; Gatto, Craig

    2016-09-01

    Listeria monocytogenes, the causative organism of the serious food-borne disease listeriosis, has a membrane abundant in branched-chain fatty acids (BCFAs). BCFAs are normally biosynthesized from branched-chain amino acids via the activity of branched chain α-keto acid dehydrogenase (Bkd), and disruption of this pathway results in reduced BCFA content in the membrane. Short branched-chain carboxylic acids (BCCAs) added as media supplements result in incorporation of BCFAs arising from the supplemented BCCAs in the membrane of L. monocytogenes bkd mutant MOR401. High concentrations of the supplements also effect similar changes in the membrane of the wild type organism with intact bkd. Such carboxylic acids clearly act as fatty acid precursors, and there must be an alternative pathway resulting in the formation of their CoA thioester derivatives. Candidates for this are the enzymes phosphotransbutyrylase (Ptb) and butyrate kinase (Buk), the products of the first two genes of the bkd operon. Ptb from L. monocytogenes exhibited broad substrate specificity, a strong preference for branched-chain substrates, a lack of activity with acetyl CoA and hexanoyl CoA, and strict chain length preference (C3-C5). Ptb catalysis involved ternary complex formation. Additionally, Ptb could utilize unnatural branched-chain substrates such as 2-ethylbutyryl CoA, albeit with lower efficiency, consistent with a potential involvement of this enzyme in the conversion of the carboxylic acid additives into CoA primers for BCFA biosynthesis. Published by Elsevier B.V.

  2. Site-specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector.

    Science.gov (United States)

    Van Mellaert, L; Mei, L; Lammertyn, E; Schacht, S; Anné, J

    1998-12-01

    The temperate bacteriophage VWB integrates into the chromosome of Streptomyces venezuelae ETH14630 via site-specific integration. Following recombination of the VWB attP region with the chromosomal attB sequence, the host-phage junctions attL and attR are formed. Nucleotide sequence analysis of attP, attB, attL and attR revealed a 45 bp common core sequence. In attB this 45 bp sequence consists of the 3' end of a putative tRNA Arg(AGG) gene with a 3'-terminal CCA sequence which is typical for prokaryotic tRNAs. Phage DNA integration restores the putative tRNA Arg(AGG) gene in attL. However, following recombination the CCA sequence is missing as is the case for most Streptomyces tRNA genes described so far. Adjacent to VWB attP, an ORF encoding a 427 aa protein was detected. The C-terminal region of this protein shows high similarity to the conserved C-terminal domain of site-specific recombinases belonging to the integrase family. To prove the functionality of this putative integrase gene (int), an integrative vector pKT02 was constructed. This vector consists of a 2.3 kb HindIII-SphI restriction fragment of VWB DNA containing attP and int cloned in a non-replicative Escherichia coli vector carrying a thiostrepton-resistance (tsr) gene. Integration of pKT02 was obtained after transformation of Streptomyces venezuelae ETH14630 and Streptomyces lividans TK24 protoplasts. This vector will thus be useful for a number of additional Streptomyces species in which a suitable tRNA gene can be functional as integration site.

  3. Bacteriophage P70: unique morphology and unrelatedness to other Listeria bacteriophages.

    Science.gov (United States)

    Schmuki, Martina M; Erne, Doris; Loessner, Martin J; Klumpp, Jochen

    2012-12-01

    Listeria monocytogenes is an important food-borne pathogen, and its bacteriophages find many uses in detection and biocontrol of its host. The novel broad-host-range virulent phage P70 has a unique morphology with an elongated capsid. Its genome sequence was determined by a hybrid sequencing strategy employing Sanger and PacBio techniques. The P70 genome contains 67,170 bp and 119 open reading frames (ORFs). Our analyses suggest that P70 represents an archetype of virus unrelated to other known Listeria bacteriophages.

  4. Specific interaction of terminase, the DNA packaging enzyme of bacteriophage lambda, with the portal protein of the prohead.

    Science.gov (United States)

    Yeo, A; Feiss, M

    1995-01-13

    Terminase, the bacteriophage lambda DNA packaging protein, is a heteromultimer of two subunits, gpNu1 and gpA, the products of genes Nu1 and A, resp. Phage 21 is a lambdoid phage that produces a terminase similar to that of lambda terminase, the subunits of 21 terminase, gp1 and gp2, have the same domain structures of their lambda analog, gpNu1 and gpA, respectively. The lambda and 21 terminases have different DNA binding and prohead binding specificities. When the C-terminal 32 amino residues of gpA replace the C-terminal 32 residues of gp2, the resulting chimeric terminase specifically uses lambda proheads, indicating that the C-terminal 32 residues of gpA are a specificity domain for prohead binding. A second chimeric terminase, in which the C-terminal six residues of gpA are replaced by the C-terminal six residues of gp2, is unable to utilize lambda proheads, and a lambda phage producing this terminase, lambda Are636, is unable to form plaques. In the present work, a pseudorevertant of lambda Are636 was isolated that contained a mutation Bms8, affecting the prohead. The B gene encodes the portal protein of lambda proheads, which forms the special vertex that is thought to serve as (1) the site of DNA entry into the prohead during packaging, (2) the site for DNA exit during DNA injection, and (3) the site of tail attachment during virion assembly. Bms8 is predicted to change residue 331 of gpB from proline to serine. Burst size measurements and in vitro DNA packaging experiments demonstrated allele-specific interactions between the Are636 terminase and Bms8 proheads. That is, wild-type terminase interacted more efficiently with wild-type proheads than with Bms8 proheads, and Are636 terminase interacted with Bms8 proheads more efficiently than with wild-type proheads. Prohead binding by lambda terminase is stimulated by an assembly catalyst, gpFI. In vitro packaging extracts lacking gpFI were used under conditions in which packaging was gpFI-independent. In the

  5. A model system for pathogen detection using a two-component bacteriophage/bioluminescent signal amplification assay

    Science.gov (United States)

    Bright, Nathan G.; Carroll, Richard J.; Applegate, Bruce M.

    2004-03-01

    Microbial contamination has become a mounting concern the last decade due to an increased emphasis of minimally processed food products specifically produce, and the recognition of foodborne pathogens such as Campylobacter jejuni, Escherichia coli O157:H7, and Listeria monocytogenes. This research investigates a detection approach utilizing bacteriophage pathogen specificity coupled with a bacterial bioluminescent bioreporter utilizing the quorum sensing molecule from Vibrio fischeri, N-(3-oxohexanoyl)-homoserine lactone (3-oxo-C6-HSL). The 3-oxo-C6-HSL molecules diffuse out of the target cell after infection and induce bioluminescence from a population of 3-oxo-C6-HSL bioreporters (ROLux). E. coli phage M13, a well-characterized bacteriophage, offers a model system testing the use of bacteriophage for pathogen detection through cell-to-cell communication via a LuxR/3-oxo-C6-HSL system. Simulated temperate phage assays tested functionality of the ROLux reporter and production of 3-oxo-C6-HSL by various test strains. These assays showed detection limits of 102cfu after 24 hours in a varietry of detection formats. Assays incorporating the bacteriophage M13-luxI with the ROLux reporter and a known population of target cells were subsequently developed and have shown consistent detection limits of 105cfu target organisms. Measurable light response from high concentrations of target cells was almost immediate, suggesting an enrichment step to further improve detection limits and reduce assay time.

  6. Oligomeric properties and DNA binding specificities of repressor isoforms from the Streptomyces bacteriophage phiC31.

    Science.gov (United States)

    Wilson, S E; Smith, M C

    1998-05-15

    Three protein isoforms (74, 54 and 42 kDa) are expressed from repressor gene c in the Streptomyces temperate bacteriophage phiC31. Because expression of the two smaller isoforms, 54 and 42 kDa, is sufficient for superinfection immunity, the interaction between these isoforms was studied. The native 42 kDa repressor (Nat42) and an N-terminally 6x histidine-tagged 54 kDa isoform (His54) were shown by co-purification on a Ni-NTA column to interact in Streptomyces lividans . In vitro three repressor preparations, containing Nat42, His54 and the native 54 and 42 kDa isoforms expressed together (Nat54&42), were subjected to chemical crosslinking and gel filtration analysis. Homo- and hetero-tetramers were observed. Previous work showed that the smallest isoform bound to 17 bp operators containing aconservedinvertedrepeat (CIR) and that the CIRs were located at 16 loci throughout the phiC31 genome. One of the CIRs (CIR6) is believed to be critical for regulating the lytic pathway. The DNA binding activities of the three repressor preparations were studied using fragments containing CIRs (CIR3-CIR6) from the essential early region as templates for DNase I footprinting. Whereas Nat42 bound to CIR6, poorly to CIR5 but undetectably to CIR3 or CIR4, the Nat54&42 preparation could bind to all CIRs tested, albeit poorly to CIR3 and CIR4. The His54 isoform bound all CIRs tested. Isoforms expressed from the phiC31 repressor gene, like those which are expressed from many eukaryotic transcription factor genes, apparently have different binding specificities.

  7. Isolation of a bacteriophage specific for a new capsular type of Klebsiella pneumoniae and characterization of its polysaccharide depolymerase.

    Directory of Open Access Journals (Sweden)

    Chun-Ru Hsu

    Full Text Available BACKGROUND: Klebsiella pneumoniae is one of the major pathogens causing hospital-acquired multidrug-resistant infections. The capsular polysaccharide (CPS is an important virulence factor of K. pneumoniae. With 78 capsular types discovered thus far, an association between capsular type and the pathogenicity of K. pneumoniae has been observed. METHODOLOGY/PRINCIPAL FINDINGS: To investigate an initially non-typeable K. pneumoniae UTI isolate NTUH-K1790N, the cps gene region was sequenced. By NTUH-K1790N cps-PCR genotyping, serotyping and determination using a newly isolated capsular type-specific bacteriophage, we found that NTUH-K1790N and three other isolates Ca0507, Ca0421 and C1975 possessed a new capsular type, which we named KN2. Analysis of a KN2 CPS(- mutant confirmed the role of capsule as the target recognized by the antiserum and the phage. A newly described lytic phage specific for KN2 K. pneumoniae, named 0507-KN2-1, was isolated and characterized using transmission electron microscopy. Whole-genome sequencing of 0507-KN2-1 revealed a 159 991 bp double-stranded DNA genome with a G+C content of 46.7% and at least 154 open reading frames. Based on its morphological and genomic characteristics, 0507-KN2-1 was classified as a member of the Myoviridae phage family. Further analysis of this phage revealed a 3738-bp gene encoding a putative polysaccharide depolymerase. A recombinant form of this protein was produced and assayed to confirm its enzymatic activity and specificity to KN2 capsular polysaccharides. KN2 K. pneumoniae strains exhibited greater sensitivity to this depolymerase than these did to the cognate phage, as determined by spot analysis. CONCLUSIONS/SIGNIFICANCE: Here we report that a group of clinical strains possess a novel Klebsiella capsular type. We identified a KN2-specific phage and its polysaccharide depolymerase, which could be used for efficient capsular typing. The lytic phage and depolymerase also have potential as

  8. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  9. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  10. Mapping the tail fiber as the receptor binding protein responsible for differential host specificity of Pseudomonas aeruginosa bacteriophages PaP1 and JG004.

    Science.gov (United States)

    Le, Shuai; He, Xuesong; Tan, Yinling; Huang, Guangtao; Zhang, Lin; Lux, Renate; Shi, Wenyuan; Hu, Fuquan

    2013-01-01

    The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy.

  11. Mapping the tail fiber as the receptor binding protein responsible for differential host specificity of Pseudomonas aeruginosa bacteriophages PaP1 and JG004.

    Directory of Open Access Journals (Sweden)

    Shuai Le

    Full Text Available The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP. Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene, which resulted in the replacement of a positively charged lysine (K by an uncharged asparagine (N. We further demonstrated that the replacement of the tail fiber gene (ORF69 of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy.

  12. Genetics of Critical Contacts and Clashes in the DNA Packaging Specificities of Bacteriophages λ and 21

    Science.gov (United States)

    Sippy, Jean; Patel, Priyal; Vahanian, Nicole; Sippy, Rachel; Feiss, Michael

    2016-01-01

    The cos sites in λ and 21 chromosomes contain binding sites that recruit terminase to initiate DNA packaging. The small subunits of terminase, gpNu1 (λ) and gp1 (21), have winged helix-turn-helix DNA binding domains, where the recognition helixes differ in four of nine residues. To initiate packaging, the small subunit binds three R sequences in the cosB subsite. λ and 21 cannot package each other's DNA, due to recognition helix and R sequence differences. In λ and 21 cosBs, two bp, tri1 and tri2, are conserved in the R sequences yet differ between the phages; they are proposed to play a role in phage-specific packaging by λ and 21. Genetic experiments done with mixed and matched terminase and cosB alleles show packaging specificity depends on favorable contacts and clashes. These interactions indicate that the recognition helixes orient with residues 20 and 24 proximal to tri2 and tri1, respectively. PMID:25543962

  13. Genetics of critical contacts and clashes in the DNA packaging specificities of bacteriophages λ and 21.

    Science.gov (United States)

    Sippy, Jean; Patel, Priyal; Vahanian, Nicole; Sippy, Rachel; Feiss, Michael

    2015-02-01

    The cos sites in λ and 21 chromosomes contain binding sites that recruit terminase to initiate DNA packaging. The small subunits of terminase, gpNu1 (λ) and gp1 (21), have winged helix-turn-helix DNA binding domains, where the recognition helixes differ in four of nine residues. To initiate packaging, the small subunit binds three R sequences in the cosB subsite. λ and 21 cannot package each other׳s DNA, due to recognition helix and R sequence differences. In λ and 21 cosBs, two bp, tri1 and tri2, are conserved in the R sequences yet differ between the phages; they are proposed to play a role in phage-specific packaging by λ and 21. Genetic experiments done with mixed and matched terminase and cosB alleles show packaging specificity depends on favorable contacts and clashes. These interactions indicate that the recognition helixes orient with residues 20 and 24 proximal to tri2 and tri1, respectively.

  14. Contribution of hydrological data to the understanding of the spatio-temporal dynamics of F-specific RNA bacteriophages in river water during rainfall-runoff events.

    Science.gov (United States)

    Fauvel, Blandine; Cauchie, Henry-Michel; Gantzer, Christophe; Ogorzaly, Leslie

    2016-05-01

    Heavy rainfall events were previously reported to bring large amounts of microorganisms in surface water, including viruses. However, little information is available on the origin and transport of viral particles in water during such rain events. In this study, an integrative approach combining microbiological and hydrological measurements was investigated to appreciate the dynamics and origins of F-specific RNA bacteriophage fluxes during two distinct rainfall-runoff events. A high frequency sampling (automatic sampler) was set up to monitor the F-specific RNA bacteriophages fluxes at a fine temporal scale during the whole course of the rainfall-runoff events. A total of 276 rainfall-runoff samples were collected and analysed using both infectivity and RT-qPCR assays. The results highlight an increase of 2.5 log10 and 1.8 log10 of infectious F-specific RNA bacteriophage fluxes in parallel of an increase of the water flow levels for both events. Faecal pollution was characterised as being mainly from anthropic origin with a significant flux of phage particles belonging to the genogroup II. At the temporal scale, two successive distinct waves of phage pollution were established and identified through the hydrological measurements. The first arrival of phages in the water column was likely to be linked to the resuspension of riverbed sediments that was responsible for a high input of genogroup II. Surface runoff contributed further to the second input of phages, and more particularly of genogroup I. In addition, an important contribution of infectious phage particles has been highlighted. These findings imply the existence of a close relationship between the risk for human health and the viral contamination of flood water.

  15. Assessment of altered binding specificity of bacteriophage for ciprofloxacin-induced antibiotic-resistant Salmonella Typhimurium.

    Science.gov (United States)

    Kim, Jeongjin; Jo, Ara; Ding, Tian; Lee, Hyeon-Yong; Ahn, Juhee

    2016-08-01

    This study describes a new effort toward understanding the interaction mechanisms between antibiotic-resistant Salmonella Typhimurium and phages. The antibiotic susceptibility, β-lactamase activity, bacterial motility, gene expression, and lytic activity were evaluated in ciprofloxacin-induced antibiotic-sensitive Salmonella Typhimurium (ASST(CIP)) and ciprofloxacin-induced antibiotic-resistant S. Typhimurium (ARST(CIP)), which were compared to the wild-type strains (ASST(WT) and ARST(WT)). The MIC values of ampicillin, norfloxacin, chloramphenicol, and tetracycline were significantly increased to > 512, 16, 16, and 256 μg/ml, respectively, in the ARST(CIP). The lowest and highest extracellular lactamase activities were observed in ASST(WT) (6.85 μmol/min/ml) and ARST(CIP) (48.83 μmol/min/ml), respectively. The acrA, lpfE, and hilA genes were significantly upregulated by more than tenfold in both ASST(CIP) and ARST(CIP). The induction of multiple antibiotic resistance resulted from the increased efflux pump activity (AcrAB-TolC). The highest phage adsorption rates were more than 95 % for ASST(WT), ASST(CIP), and ARST(WT), while the lowest adsorption rate was 52 % for ARST(CIP) at 15 min of infection. The least lytic activity of phage was 20 % against the ARST(CIP), followed by ASST(CIP) (30 %). The adsorption rate of phage against ARST(CIP) was 52 % at 15 min of infection, which resulted in the decrease in lytic activity (12 %). Understanding the interaction of phage and bacteria is essential for the practical application of phage to control and detect antibiotic-resistant bacteria. The results provide useful information for understanding the binding specificity of phages for multiple antibiotic-resistant pathogens.

  16. Salmonella Typhimurium-specific bacteriophage ΦSH19 and the origins of species specificity in the Vi01-like phage family

    Directory of Open Access Journals (Sweden)

    Wilson Ray

    2011-11-01

    Full Text Available Abstract Background Whole genome sequencing of bacteriophages suitable for biocontrol of pathogens in food products is a pre-requisite to any phage-based intervention procedure. Trials involving the biosanitization of Salmonella Typhimurium in the pig production environment identified one such candidate, ΦSH19. Results This phage was sequenced and analysis of its 157,785 bp circular dsDNA genome revealed a number of interesting features. ΦSH19 constitutes another member of the recently-proposed Myoviridae Vi01-like family of phages, containing S. Typhi-specific Vi01 and Shigella-specific SboM-AG3. At the nucleotide level ΦSH19 is highly similar to phage Vi01 (80-98% pairwise identity over the length of the genome, with the major differences lying in the region associated with host-range determination. Analyses of the proteins encoded within this region by ΦSH19 revealed a cluster of three putative tail spikes. Of the three tail spikes, two have protein domains associated with the pectate lyase family of proteins (Tsp2 and P22 tail spike family (Tsp3 with the prospect that these enable Salmonella O antigen degradation. Tail spike proteins of Vi01 and SboM-AG3 are predicted to contain conserved right-handed parallel β-helical structures but the internal protein domains are varied allowing different host specificities. Conclusions The addition or exchange of tail spike protein modules is a major contributor to host range determination in the Vi01-like phage family.

  17. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers--specific application to Listeria monocytogenes and ready-to-eat meat products.

    Science.gov (United States)

    Mataragas, M; Zwietering, M H; Skandamis, P N; Drosinos, E H

    2010-07-31

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required), support growth of pathogens (high initial pH=6.2-6.4 and water activity=0.98-0.99) and has a relatively long period of storage at chilled temperatures with a shelf life equal to 60 days based on manufacturer's instructions. Therefore, in case of post-process contamination, even with low number of cells, the microorganism is able to reach unacceptable levels at the time of consumption. The aim of this study was to conduct a Quantitative Microbiological Risk Assessment (QMRA) on the risk of L. monocytogenes presence in RTE meat products. This may help risk managers to make decisions and apply control measures with ultimate objective the food safety assurance. Examples are given to illustrate the development of practical risk management strategies based on the results obtained from the QMRA model specifically developed for this pathogen/food product combination.

  18. Chlamydia bacteriophages.

    Science.gov (United States)

    Śliwa-Dominiak, Joanna; Suszyńska, Ewa; Pawlikowska, Małgorzata; Deptuła, Wiesław

    2013-11-01

    Phages are called "good viruses" due to their ability to infect and kill pathogenic bacteria. Chlamydia are small, Gram-negative (G-) microbes that can be dangerous to human and animals. In humans, these bacteria are etiological agents of diseases such as psittacosis or respiratory tract diseases, while in animals, the infection may result in enteritis in cattle and chronic bowel diseases, as well as miscarriages in sheep. The first-known representative of chlamydiaphages was Chp1. It was discovered in Chlamydia psittaci isolates. Since then, four more species of chlamydiaphages have been identified [Chp2, Chp3, φCPG1 φCPAR39 (φCpn1) and Chp4]. All of them were shown to infect Chlamydia species. This paper described all known chlamydiaphages. They were characterised in terms of origin, host range, and their molecular structure. The review concerns the characterisation of bacteriophages that infects pathogenic and dangerous bacteria with unusual, intracellular life cycles that are pathogenic. In the era of antibiotic resistance, it is difficult to cure chlamydophilosis. Those bacteriophages can be an alternative to antibiotics, but before this happens, we need to get to know chlamydiaphages better.

  19. [Possibilities of bacteriophage therapy].

    Science.gov (United States)

    Skurnik, Mikael; Kiljunen, Saija

    2016-01-01

    Antibiotic resistance of bacterial pathogens has increased, and new therapies are urgently needed. Bacteriophages (phages), viruses infecting and killing bacteria, are the most abundant organisms on earth. In nature there are several specific phages for every bacterium, controlling bacterial numbers and maintaining ecological balance. Phage therapy, i.e., treating bacterial infections with phages, offers an alternative complementary to antibiotics as phages infect and kill also multi-resistant bacteria. Phages possess narrow host specificity, each phage infecting only a few bacterial species or strains. Thereby phages do not harm the normal microbiota as antibiotics do. We aim to begin clinical trials of phage therapy in Finland.

  20. A human Fab fragment specific for thyroid peroxidase generated by cloning thyroid lymphocyte-derived immunoglobulin genes in a bacteriophage lambda library.

    Science.gov (United States)

    Portolano, S; Seto, P; Chazenbalk, G D; Nagayama, Y; McLachlan, S M; Rapoport, B

    1991-08-30

    A human Fab fragment (SP2) which binds specifically to human thyroid peroxidase has been generated by expressing random combinations of heavy and light chain immunoglobulin genes (derived from Graves' thyroid cDNA) in a bacteriophage lambda library. In common with many serum TPO autoantibodies, the cloned Fab fragment is IgG1 kappa and has a high affinity for TPO (approximately 10(-9) M). On the basis of their nucleotide sequences, the heavy and light chain genes coding for SP2 belong to families VHI, (D), JH3 and VKI, JK2, respectively. These data provide the first characterization at a molecular level of a human thyroid peroxidase antibody associated with autoimmune thyroid disease.

  1. A resolvase-like protein is requered for the site-specific integration of the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.;

    1996-01-01

    . 176:1069-1076, 1994). The phage-encoded elements necessary for integration were localized on a 2.8-kb NsiI-EcoRI fragment including the phage attachment site, attP. This fragment was DNA sequenced, and sequence analysis revealed three putatively expressed open reading frames, Orf1, Orf2, and Orf3....... By the introduction of mutations within the orf1, orf2, and orf3 genes, it was shown that only Orf1 was necessary for the integration process. Furthermore, it was found that Orf1, attP, and a 425-bp region upstream of the orf1 gene are suficent for integration. Orf1 contains 485 amino acids and is located just...... the Int class of site-specific integrases usually found in temperate bacteriophages. The constructed integration vector, pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20% of the transformation efficiency....

  2. The interactome of Streptococcus pneumoniae and its bacteriophages show highly specific patterns of interactions among bacteria and their phages.

    Science.gov (United States)

    Mariano, Rachelle; Wuchty, Stefan; Vizoso-Pinto, Maria G; Häuser, Roman; Uetz, Peter

    2016-04-22

    Although an abundance of bacteriophages exists, little is known about interactions between their proteins and those of their bacterial hosts. Here, we experimentally determined the phage-host interactomes of the phages Dp-1 and Cp-1 and their underlying protein interaction network in the host Streptococcus pneumoniae. We compared our results to the interaction patterns of E. coli phages lambda and T7. Dp-1 and Cp-1 target highly connected host proteins, occupy central network positions, and reach many protein clusters through the interactions of their targets. In turn, lambda and T7 targets cluster to conserved and essential proteins in E. coli, while such patterns were largely absent in S. pneumoniae. Furthermore, targets in E. coli were mutually strongly intertwined, while targets of Dp-1 and Cp-1 were strongly connected through essential and orthologous proteins in their immediate network vicinity. In both phage-host systems, the impact of phages on their protein targets appears to extend from their network neighbors, since proteins that interact with phage targets were located in central network positions, have a strong topologically disruptive effect and touch complexes with high functional heterogeneity. Such observations suggest that the phages, biological impact is accomplished through a surprisingly limited topological reach of their targets.

  3. Restriction fragment differential display of pediocin-resistant Listeria monocytogenes 412 mutants shows consistent overexpression of a putative beta-glucoside-specific PTS system.

    Science.gov (United States)

    Gravesen, A; Warthoe, P; Knochel, S; Thirstrup, K

    2000-06-01

    Pediocin PA-1, which is a bacteriocin produced by lactic acid bacteria, has potential as a biopreservative of food. However, such use may lead to the development of resistance in the target organism. Gene expression in two independent pediocin-resistant mutants of Listeria monocytogenes 412 was compared to the original isolate by restriction fragment differential display PCR (RFDD-PCR). This method amplifies cDNA restriction fragments under stringent PCR conditions, enabled by the use of specific primers complementary to ligated adaptor sequences. RFDD-PCR was very well suited for analysis of listerial gene expression, giving reproducible PCR product profiles. Three gene fragments having increased expression in both resistant mutants were identified. All three had homology to components of beta-glucoside-specific phosphoenolpyruvate-dependent phosphotransferase systems (PTS), one fragment having homology to enzyme II permeases, and the two others to phospho-beta-glucosidases. Overexpression of the putative PTS system was consistently observed in 10 additional pediocin-resistant mutants, isolated at different pH, salt content and temperature. The results suggest that RFDD-PCR is a strong approach for the analysis of prokaryotic gene expression and that the putative beta-glucoside-specific PTS system is involved in mediating pediocin resistance.

  4. Gene insertion and replacement in Schizosaccharomyces pombe mediated by the Streptomyces bacteriophage phiC31 site-specific recombination system.

    Science.gov (United States)

    Thomason, L C; Calendar, R; Ow, D W

    2001-08-01

    The site-specific recombination system used by the Streptomyces bacteriophage phiC31 was tested in the fission yeast Schizosaccharomyces pombe. A target strain with the phage attachment site attP inserted at the leu1 locus was co-transformed with one plasmid containing the bacterial attachment site attB linked to a ura4+ marker, and a second plasmid expressing the phiC31 integrase gene. High-efficiency transformation to the Ura+ phenotype occurred when the integrase gene was expressed. Southern analysis revealed that the attB-ura4+ plasmid integrated into the chromosomal attP site. Sequence analysis showed that the attBxattP recombination was precise. In another approach, DNA with a ura4+ marker flanked by two attB sites in direct orientation was used to transform S. pombe cells bearing an attP duplication. The phiC31 integrase catalyzed two reciprocal cross-overs, resulting in a precise gene replacement. The site-specific insertions are stable, as no excision (the reverse reaction) was observed on maintenance of the integrase gene in the integrant lines. The irreversibility of the phiC31 site-specific recombination system sets it apart from other systems currently used in eukaryotic cells, which reverse readily. Deployment of the phiC31 recombination provides new opportunities for directing transgene and chromosome rearrangements in eukaryotic systems.

  5. Combined Poisson and soft-particle DLVO analysis of the specific and nonspecific adhesion forces measured between L. monocytogenes grown at various temperatures and silicon nitride.

    Science.gov (United States)

    Gordesli, F Pinar; Abu-Lail, Nehal I

    2012-09-18

    Adhesion forces between pathogenic L. monocytogenes EGDe and silicon nitride (Si(3)N(4)) were measured using atomic force microscopy (AFM) under water and at room temperature for cells grown at five different temperatures (10, 20, 30, 37, and 40 °C). Adhesion forces were then decoupled into specific (hydrogen bonding) and nonspecific (electrostatic and Lifshitz-van der Waals) force components using Poisson statistical analysis. The strongest specific and nonspecific attraction forces were observed for cells grown at 30 °C, compared to those observed for cells grown at higher or lower temperatures, respectively. By combining the results of Poisson analysis with the results obtained through soft-particle Derjaguin-Landau-Verwey-Overbeek (DLVO) analysis, the contributions of the Lifshitz-van der Waals and electrostatic forces to the overall nonspecific interaction forces were determined. Our results showed that the Lifshitz-van der Waals attraction forces dominated the total nonspecific adhesion forces for all investigated thermal conditions. However, irrespective of the temperature of growth investigated, hydrogen bonding forces were always stronger than the nonspecific forces. Finally, by combining Poisson analysis with soft-particle analysis of DLVO forces, the closest separation distances where the irreversible bacterial adhesion takes place can be determined relatively easily. For all investigated thermal conditions, the closest separation distances were <1 nm.

  6. Bacteriophage amplification assay for detection of Listeria spp. using virucidal laser treatment

    Directory of Open Access Journals (Sweden)

    I.C. Oliveira

    2012-09-01

    Full Text Available A protocol for the bacteriophage amplification technique was developed for quantitative detection of viable Listeria monocytogenes cells using the A511 listeriophage with plaque formation as the end-point assay. Laser and toluidine blue O (TBO were employed as selective virucidal treatment for destruction of exogenous bacteriophage. Laser and TBO can bring a total reduction in titer phage (ca. 10(8 pfu/mL without affecting the viability of L. monocytogenes cells. Artificially inoculated skimmed milk revealed mean populations of the bacteria as low as between 13 cfu/mL (1.11 log cfu/mL, after a 10-h assay duration. Virucidal laser treatment demonstrated better protection of Listeria cells than the other agents previously tested. The protocol was faster and easier to perform than standard procedures. This protocol constitutes an alternative for rapid, sensitive and quantitative detection of L. monocytogenes.

  7. Occurrence of and Sequence Variation among F-Specific RNA Bacteriophage Subgroups in Feces and Wastewater of Urban and Animal Origins.

    Science.gov (United States)

    Hartard, C; Rivet, R; Banas, S; Gantzer, C

    2015-09-01

    F-specific RNA bacteriophages (FRNAPH) have been widely studied as tools for evaluating fecal or viral pollution in water. It has also been proposed that they can be used to differentiate human from animal fecal contamination. While FRNAPH subgroup I (FRNAPH-I) and FRNAPH-IV are often associated with animal pollution, FRNAPH-II and -III prevail in human wastewater. However, this distribution is not absolute, and variable survival rates in these subgroups lead to misinterpretation of the original distribution. In this context, we studied FRNAPH distribution in urban wastewater and animal feces/wastewater. To increase the specificity, we partially sequenced the genomes of phages of urban and animal origins. The persistence of the genomes and infectivity were also studied, over time in wastewater and during treatment, for each subgroup. FRNAPH-I genome sequences did not show any specific urban or animal clusters to allow development of molecular tools for differentiation. They were the most resistant and as such may be used as fecal or viral indicators. FRNAPH-II's low prevalence and low sequence variability in animal stools, combined with specific clusters formed by urban strains, allowed differentiation between urban and animal pollution by using a specific reverse transcription-PCR (RT-PCR) method. The subgroup's resistance over time was comparable to that of FRNAPH-I, but its surface properties allowed higher elimination rates during activated-sludge treatment. FRNAPH-III's low sequence variability in animal wastewater and specific cluster formation by urban strains also allowed differentiation by using a specific RT-PCR method. Nevertheless, its low resistance restricted it to being used only for recent urban pollution detection. FRNAPH-IV was too rare to be used.

  8. Detection and quantification of Flavobacterium psychrophilum specific bacteriophages in rainbow trout upon different administration methods: Implications for disease control in aquaculture

    DEFF Research Database (Denmark)

    Christiansen, Rói Hammershaimb; Madsen, Lone; Dalsgaard, Inger

    2013-01-01

    Flavobacterium psychrophilum is the pathogen causing the disease rainbow trout fry syndrome (RTFS), which has important implications for aquaculture production and trade worldwide. RTFS can be treated by antibiotic administration, but with the increasing problem of antibiotic resistant bacteria......, the use of lytic bacteriophages is a promising alternative approach to disease control in aquaculture. Bacteriophage control of bacterial infections depends on efficient delivery of the phages to the infected organs, and in this study we therefore examined the occurrence and persistence of phages...

  9. Bacteriophage-based Probiotic Preparation for Managing Shigella Infections

    Science.gov (United States)

    2015-04-16

    for a probiotic preparation – based on naturally occurring bacteriophages – as a way to condition the GI tract’s microflora gently and favorably...The preparation (designated “ShigActive”) is a bacteriophage cocktail that specifically targets Shigella spp. (significant diarrhea-causing pathogens...10-Apr-2013 Approved for Public Release; Distribution Unlimited Final Report: Bacteriophage -based Probiotic Preparation for Managing Shigella

  10. Towards an adequate regulatory framework for bacteriophage therapy

    OpenAIRE

    Verbeken, Gilbert

    2015-01-01

    Summary The worldwide emergence of antibiotic resistant bacteria and constraints to investment in potential solutions may eventually lead to a return to the pre-antibiotic era. As industries’ antibiotic pipeline is virtually dry and infectious diseases are steadily on the increase, the use of bacteriophages (bacteriophages are bacterio-specific viruses) to kill bacteria can be considered as a valuable option. Bacteriophages (meaning “bacteria-eaters”) are the bacteria’s natural enemie...

  11. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth

    2017-01-01

    The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pmonocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112

  12. In Situ Dynamics of F-Specific RNA Bacteriophages in a Small River: New Way to Assess Viral Propagation in Water Quality Studies.

    Science.gov (United States)

    Fauvel, Blandine; Gantzer, Christophe; Cauchie, Henry-Michel; Ogorzaly, Leslie

    2017-03-01

    The occurrence and propagation of enteric viruses in rivers constitute a major public health issue. However, little information is available on the in situ transport and spread of viruses in surface water. In this study, an original in situ experimental approach using the residence time of the river water mass was developed to accurately follow the propagation of F-specific RNA bacteriophages (FRNAPHs) along a 3-km studied river. Surface water and sediment of 9 sampling campaigns were collected and analyzed using both infectivity and RT-qPCR assays. In parallel, some physico-chemical variables such as flow rate, water temperature, conductivity and total suspended solids were measured to investigate the impact of environmental conditions on phage propagation. For campaigns with low flow rate and high temperature, the results highlight a decrease of infectious phage concentration along the river, which was successfully modelled according to a first-order negative exponential decay. The monitoring of infectious FRNAPHs belonging mainly to the genogroup II was confirmed with direct phage genotyping and total phage particle quantification. Reported k decay coefficients according to exponential models allowed for the determination of the actual in situ distance and time necessary for removing 90 % of infectious phage particles. This present work provides a new way to assess the true in situ viral propagation along a small river. These findings can be highly useful in water quality and risk assessment studies to determine the viral contamination spread from a point contamination source to the nearest recreational areas.

  13. Evidence of a dominant lineage of Vibrio cholerae-specific lytic bacteriophages shed by cholera patients over a 10-year period in Dhaka, Bangladesh.

    Science.gov (United States)

    Seed, Kimberley D; Bodi, Kip L; Kropinski, Andrew M; Ackermann, Hans-Wolfgang; Calderwood, Stephen B; Qadri, Firdausi; Camilli, Andrew

    2011-01-01

    Lytic bacteriophages are hypothesized to contribute to the seasonality and duration of cholera epidemics in Bangladesh. However, the bacteriophages contributing to this phenomenon have yet to be characterized at a molecular genetic level. In this study, we isolated and sequenced the genomes of 15 bacteriophages from stool samples from cholera patients spanning a 10-year surveillance period in Dhaka, Bangladesh. Our results indicate that a single novel bacteriophage type, designated ICP1 (for the International Centre for Diarrhoeal Disease Research, Bangladesh cholera phage 1) is present in all stool samples from cholera patients, while two other bacteriophage types, one novel (ICP2) and one T7-like (ICP3), are transient. ICP1 is a member of the Myoviridae family and has a 126-kilobase genome comprising 230 open reading frames. Comparative sequence analysis of ICP1 and related isolates from this time period indicates a high level of genetic conservation. The ubiquitous presence of ICP1 in cholera patients and the finding that the O1 antigen of lipopolysaccharide (LPS) serves as the ICP1 receptor suggest that ICP1 is extremely well adapted to predation of human-pathogenic V. cholerae O1.

  14. Bacteriophages and bacteriophage-derived endolysins as potential therapeutics to combat Gram-positive spore forming bacteria.

    Science.gov (United States)

    Nakonieczna, A; Cooper, C J; Gryko, R

    2015-09-01

    Since their discovery in 1915, bacteriophages have been routinely used within Eastern Europe to treat a variety of bacterial infections. Although initially ignored by the West due to the success of antibiotics, increasing levels and diversity of antibiotic resistance is driving a renaissance for bacteriophage-derived therapy, which is in part due to the highly specific nature of bacteriophages as well as their relative abundance. This review focuses on the bacteriophages and derived lysins of relevant Gram-positive spore formers within the Bacillus cereus group and Clostridium genus that could have applications within the medical, food and environmental sectors.

  15. DNA packaging by lambda-like bacteriophages: mutations broadening the packaging specificity of terminase, the lambda-packaging enzyme.

    Science.gov (United States)

    Feiss, Michael; Reynolds, Erin; Schrock, Morgan; Sippy, Jean

    2010-01-01

    The DNA-packaging specificities of phages lambda and 21 depend on the specific DNA interactions of the small terminase subunits, which have support helix-turn-recognition helix-wing DNA-binding motifs. lambda-Terminase with the recognition helix of 21 preferentially packages 21 DNA. This chimeric terminase's ability to package lambdaDNA is reduced approximately 20-fold. Phage lambda with the chimeric terminase is unable to form plaques, but pseudorevertants are readily obtained. Some pseudorevertants have trans-acting suppressors that change codons of the recognition helix. Some of these codons appear to remove an unfavorable base-pair contact; others appear to create a novel nonspecific DNA contact. Helper-packaging experiments show that these mutant terminases have lost the ability to discriminate between lambda and 21 during DNA packaging. Two cis-acting suppressors affect cosB, the small subunit's DNA-binding site. Each changes a cosB(lambda)-specific base pair to a cosB(21)-specific base pair. These cosB suppressors cause enhanced DNA packaging by 21-specific terminase and reduce packaging by lambda-terminase. Both the cognate support helix and turn are required for strong packaging discrimination. The wing does not contribute to cosB specificity. Evolution of packaging specificity is discussed, including a model in which lambda- and 21-packaging specificities diverged from a common ancestor phage with broad packaging specificity.

  16. DNA Packaging by λ-Like Bacteriophages: Mutations Broadening the Packaging Specificity of Terminase, the λ-Packaging Enzyme

    Science.gov (United States)

    Feiss, Michael; Reynolds, Erin; Schrock, Morgan; Sippy, Jean

    2010-01-01

    The DNA-packaging specificities of phages λ and 21 depend on the specific DNA interactions of the small terminase subunits, which have support helix-turn-recognition helix-wing DNA-binding motifs. λ-Terminase with the recognition helix of 21 preferentially packages 21 DNA. This chimeric terminase's ability to package λDNA is reduced ∼20-fold. Phage λ with the chimeric terminase is unable to form plaques, but pseudorevertants are readily obtained. Some pseudorevertants have trans-acting suppressors that change codons of the recognition helix. Some of these codons appear to remove an unfavorable base-pair contact; others appear to create a novel nonspecific DNA contact. Helper-packaging experiments show that these mutant terminases have lost the ability to discriminate between λ and 21 during DNA packaging. Two cis-acting suppressors affect cosB, the small subunit's DNA-binding site. Each changes a cosBλ-specific base pair to a cosB21-specific base pair. These cosB suppressors cause enhanced DNA packaging by 21-specific terminase and reduce packaging by λ-terminase. Both the cognate support helix and turn are required for strong packaging discrimination. The wing does not contribute to cosB specificity. Evolution of packaging specificity is discussed, including a model in which λ- and 21-packaging specificities diverged from a common ancestor phage with broad packaging specificity. PMID:19841094

  17. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers - specific application to Listeria monocytogenes and ready-to-eat meat products

    NARCIS (Netherlands)

    Mataragas, M.; Zwietering, M.H.; Skandamis, P.N.; Drosinos, E.H.

    2010-01-01

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required),

  18. Bacteriophage Procurement for Therapeutic Purposes.

    Science.gov (United States)

    Weber-Dąbrowska, Beata; Jończyk-Matysiak, Ewa; Żaczek, Maciej; Łobocka, Małgorzata; Łusiak-Szelachowska, Marzanna; Górski, Andrzej

    2016-01-01

    Bacteriophages (phages), discovered 100 years ago, are able to infect and destroy only bacterial cells. In the current crisis of antibiotic efficacy, phage therapy is considered as a supplementary or even alternative therapeutic approach. Evolution of multidrug-resistant and pandrug-resistant bacterial strains poses a real threat, so it is extremely important to have the possibility to isolate new phages for therapeutic purposes. Our phage laboratory and therapy center has extensive experience with phage isolation, characterization, and therapeutic application. In this article we present current progress in bacteriophages isolation and use for therapeutic purposes, our experience in this field and its practical implications for phage therapy. We attempt to summarize the state of the art: properties of phages, the methods for their isolation, criteria of phage selection for therapeutic purposes and limitations of their use. Perspectives for the use of genetically engineered phages to specifically target bacterial virulence-associated genes are also briefly presented.

  19. Bacteriophage biocontrol of foodborne pathogens.

    Science.gov (United States)

    Kazi, Mustafa; Annapure, Uday S

    2016-03-01

    Bacteriophages are viruses that only infect bacterial cells. Phages are categorized based on the type of their life cycle, the lytic cycle cause lysis of the bacterium with the release of multiple phage particles where as in lysogenic phase the phage DNA is incorporated into the bacterial genome. Lysogeny does not result in lysis of the host. Lytic phages have several potential applications in the food industry as biocontrol agents, biopreservatives and as tools for detecting pathogens. They have also been proposed as alternatives to antibiotics in animal health. Two unique features of phage relevant for food safety are that they are harmless to mammalian cells and high host specificity, keeping the natural microbiota undisturbed. However, the recent approval of bacteriophages as food additives has opened the discussion about 'edible viruses'. This article reviews in detail the application of phages for the control of foodborne pathogens in a process known as "biocontrol".

  20. Call for a dedicated European legal framework for bacteriophage therapy.

    Science.gov (United States)

    Verbeken, Gilbert; Pirnay, Jean-Paul; Lavigne, Rob; Jennes, Serge; De Vos, Daniel; Casteels, Minne; Huys, Isabelle

    2014-04-01

    The worldwide emergence of antibiotic resistances and the drying up of the antibiotic pipeline have spurred a search for alternative or complementary antibacterial therapies. Bacteriophages are bacterial viruses that have been used for almost a century to combat bacterial infections, particularly in Poland and the former Soviet Union. The antibiotic crisis has triggered a renewed clinical and agricultural interest in bacteriophages. This, combined with new scientific insights, has pushed bacteriophages to the forefront of the search for new approaches to fighting bacterial infections. But before bacteriophage therapy can be introduced into clinical practice in the European Union, several challenges must be overcome. One of these is the conceptualization and classification of bacteriophage therapy itself and the extent to which it constitutes a human medicinal product regulated under the European Human Code for Medicines (Directive 2001/83/EC). Can therapeutic products containing natural bacteriophages be categorized under the current European regulatory framework, or should this framework be adapted? Various actors in the field have discussed the need for an adapted (or entirely new) regulatory framework for the reintroduction of bacteriophage therapy in Europe. This led to the identification of several characteristics specific to natural bacteriophages that should be taken into consideration by regulators when evaluating bacteriophage therapy. One important consideration is whether bacteriophage therapy development occurs on an industrial scale or a hospital-based, patient-specific scale. More suitable regulatory standards may create opportunities to improve insights into this promising therapeutic approach. In light of this, we argue for the creation of a new, dedicated European regulatory framework for bacteriophage therapy.

  1. Modulation of innate and antigen-specific immune functions directed against Listeria monocytogenes by fungal toxins in vitro.

    Science.gov (United States)

    Herter, I; Geginat, G; Hof, H; Kupfahl, C

    2014-05-01

    Mycotoxins, a large group of secondary fungal metabolites, are ubiquitously present in the environment and are potentially harmful to exposed humans and animals. Despite increasing interest in this group of fungal metabolites it is still difficult to estimate the relative toxic potential of one individual mycotoxin compared with others. We therefore compared the effects of some of the most important mycotoxins on effector cells of the innate and adaptive immune system in an in vitro model. Our data show clear differences of various mycotoxins in regard of their immunotoxic potential on mouse macrophages and T cells. Our results also indicate differences in the susceptibility of specific immune effector functions of macrophages and T cells exposed to mycotoxins. Thus, our results enhance the understanding of role of mycotoxins in the pathogenesis of human and animal diseases.

  2. Genomic diversity of bacteriophages infecting the fish pathogen Flavobacterium psychrophilum.

    Science.gov (United States)

    Castillo, Daniel; Middelboe, Mathias

    2016-12-01

    Bacteriophages infecting the fish pathogen Flavobacterium psychrophilum can potentially be used to prevent and control outbreaks of this bacterium in salmonid aquaculture. However, the application of bacteriophages in disease control requires detailed knowledge on their genetic composition. To explore the diversity of F. pyschrophilum bacteriophages, we have analyzed the complete genome sequences of 17 phages isolated from two distant geographic areas (Denmark and Chile), including the previously characterized temperate bacteriophage 6H. Phage genome size ranged from 39 302 to 89 010 bp with a G+C content of 27%-32%. None of the bacteriophages isolated in Denmark contained genes associated with lysogeny, whereas the Chilean isolates were all putative temperate phages and similar to bacteriophage 6H. Comparative genome analysis showed that phages grouped in three different genetic clusters based on genetic composition and gene content, indicating a limited genetic diversity of F. psychrophilum-specific bacteriophages. However, amino acid sequence dissimilarity (25%) was found in putative structural proteins, which could be related to the host specificity determinants. This study represents the first analysis of genomic diversity and composition among bacteriophages infecting the fish pathogen F. psychrophilum and discusses the implications for the application of phages in disease control. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Application Progress of Recombinant Attenuated Listeria monocytogenes in Tumor Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    Yin Xiaojiao; Bai Lin; Yang Xu

    2015-01-01

    Much progress of application of bacterial vaccine in treatment and prevention of tumor was acquired,which showed broad prospect in clinical study of animals and humans. Listeria monocytogenes( L. monocytogenes) was considered much important by virtue of its special characteristic of biology and immunology.L. monocytogenes was ingested by professional or part-time phagocytes,survived and proliferated in the phagocytes under synergism of toxic factor secreted by itself,meanwhile,the cellular and humoral immune response was induced. Antigenic gene of specific tumor was loaded in the attenuated L. monocytogenes,which can enhance immune response of host cells. Effective cell targeted to enter tumor tissue and acted on tumor cells to induce apoptosis of tumor cells. Tumor degenerated not easy to reappear. Therefore,recombinant attenuated L. monocytogenes was a safe and effective anti-cancer vaccine vector. Now the work of researchers mainly focuses on solving practical problem in clinical application. Biological characteristics of L. monocytogenes,feasibility and superiority of L. monocytogenes as targeted vaccine vector,problem and prospect of L. monocytogenes in clinical application of anti-tumor were reviewed in this paper.

  4. Bacteriophages and cancer.

    Science.gov (United States)

    Budynek, Paulina; Dabrowska, Krystyna; Skaradziński, Grzegorz; Górski, Andrzej

    2010-05-01

    Bacteriophages can be used effectively to cure bacterial infections. They are known to be active against bacteria but inactive against eukaryotic cells. Nevertheless, novel observations suggest that phages are not neutral for higher organisms. They can affect physiological and immunological processes which may be crucial to their expected positive effects in therapies. Bacteriophages are a very differentiated group of viruses and at least some of them can influence cancer processes. Phages may also affect the immunological system. In general, they activate the immunological response, for example cytokine secretion. They can also switch the tumor microenvironment to one advantageous for anticancer treatment. On the other hand, bacteriophages are used as a platform for foreign peptides that may induce anticancer effects. As bacterial debris can interfere with bacteriophage activity, phage purification is significant for the final effect of a phage preparation. In this review, results of the influence of bacteriophages on cancer processes are presented which have implications for the perspective application of phage therapy in patients with cancer and the general understanding of the role of bacteriophages in the human organism.

  5. Bacteriophages and Biofilms

    Science.gov (United States)

    Harper, David R.; Parracho, Helena M. R. T.; Walker, James; Sharp, Richard; Hughes, Gavin; Werthén, Maria; Lehman, Susan; Morales, Sandra

    2014-01-01

    Biofilms are an extremely common adaptation, allowing bacteria to colonize hostile environments. They present unique problems for antibiotics and biocides, both due to the nature of the extracellular matrix and to the presence within the biofilm of metabolically inactive persister cells. Such chemicals can be highly effective against planktonic bacterial cells, while being essentially ineffective against biofilms. By contrast, bacteriophages seem to have a greater ability to target this common form of bacterial growth. The high numbers of bacteria present within biofilms actually facilitate the action of bacteriophages by allowing rapid and efficient infection of the host and consequent amplification of the bacteriophage. Bacteriophages also have a number of properties that make biofilms susceptible to their action. They are known to produce (or to be able to induce) enzymes that degrade the extracellular matrix. They are also able to infect persister cells, remaining dormant within them, but re-activating when they become metabolically active. Some cultured biofilms also seem better able to support the replication of bacteriophages than comparable planktonic systems. It is perhaps unsurprising that bacteriophages, as the natural predators of bacteria, have the ability to target this common form of bacterial life.

  6. Bacteriophages and Biofilms

    Directory of Open Access Journals (Sweden)

    David R. Harper

    2014-06-01

    Full Text Available Biofilms are an extremely common adaptation, allowing bacteria to colonize hostile environments. They present unique problems for antibiotics and biocides, both due to the nature of the extracellular matrix and to the presence within the biofilm of metabolically inactive persister cells. Such chemicals can be highly effective against planktonic bacterial cells, while being essentially ineffective against biofilms. By contrast, bacteriophages seem to have a greater ability to target this common form of bacterial growth. The high numbers of bacteria present within biofilms actually facilitate the action of bacteriophages by allowing rapid and efficient infection of the host and consequent amplification of the bacteriophage. Bacteriophages also have a number of properties that make biofilms susceptible to their action. They are known to produce (or to be able to induce enzymes that degrade the extracellular matrix. They are also able to infect persister cells, remaining dormant within them, but re-activating when they become metabolically active. Some cultured biofilms also seem better able to support the replication of bacteriophages than comparable planktonic systems. It is perhaps unsurprising that bacteriophages, as the natural predators of bacteria, have the ability to target this common form of bacterial life.

  7. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins.

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  8. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  9. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  10. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    OpenAIRE

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  11. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    OpenAIRE

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  12. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers - specific application to Listeria monocytogenes and ready-to-eat meat products

    OpenAIRE

    Mataragas, M.; Zwietering, M. H.; Skandamis, P. N.; Drosinos, E. H.

    2010-01-01

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required), support growth of pathogens (high initial pH = 6.2–6.4 and water activity = 0.98–0.99) and has a relatively long period of storage at chilled temperatures with a shelf life equal to 60 days based o...

  13. Antiviral effect of cationic compounds on bacteriophages

    Directory of Open Access Journals (Sweden)

    Mai Huong eChatain-Ly

    2013-03-01

    Full Text Available The antiviral activity of several cationic compounds - cetytrimethylammonium (CTAB, chitosan, nisin and lysozyme - was investigated on the bacteriophage c2 (DNA head and non-contractile tail infecting Lactococcus strains and the bacteriophage MS2 (F-specific RNA infecting E.coli. Firstly, these activities were evaluated in a phosphate buffer pH 7- 10 mM. The CTAB had a virucidal effect on the Lactococcus bacteriophages, but not on the MS2. After 1 min of contact with 0.125 mM CTAB, the c2 population was reduced from 6 log(pfu/mL to 1,5 log(pfu/mL and completely deactivated at 1 mM. On the contrary, chitosan inhibited the MS2 more than it did the bacteriophages c2. No antiviral effect was observed for the nisin or the lysozyme on bacteriophages after 1 min of treatment. A 1 and 2.5 log reduction was respectively observed for nisin and lysozyme when the treatment time increased (5 or 10 min. These results showed that the antiviral effect depended both on the virus and structure of the antimicrobial compounds. The antiviral activity of these compounds was also evaluated in different physico-chemical conditions and in complex matrices. The antiviral activity of CTAB was impaired in acid pH and with an increase of the ionic strength. These results might be explained by the electrostatic interactions between cationic compounds and negatively charged particles such as bacteriophages or other compounds in a matrix. Milk proved to be protective suggesting the components of food could interfere with antimicrobial compounds.

  14. Synthesis of Bacteriophage M13-Specific Proteins in a DNA-Dependent Cell-Free System II. In Vitro Synthesis of Biologically Active Gene 5 Protein

    Science.gov (United States)

    Konings, Ruud N. H.; Jansen, Josephine; Cuypers, Theo; Schoenmakers, John G. G.

    1973-01-01

    It is shown that gene 5 protein of bacteriophage M13 is one of the major proteins synthesized in vitro under the direction of M13 replicative-form DNA. By means of DNA-cellulose chromatography, this protein has been purified to homogeneity and its biological characteristics have been compared with those of its native counterpart. Like native gene 5 protein, the purified, in vitro-synthesized protein binds tightly and selectively to single-stranded, but not to double-stranded, DNAs. These results suggest that truly functional gene 5 protein is made in the cell-free system. Images PMID:4586780

  15. Bacteriophage therapy against Enterobacteriaceae

    Institute of Scientific and Technical Information of China (English)

    Youqiang; Xu; Yong; Liu; Yang; Liu; Jiangsen; Pei; Su; Yao; Chi; Cheng

    2015-01-01

    The Enterobacteriaceae are a class of gram-negative facultative anaerobic rods, which can cause a variety of diseases, such as bacteremia, septic arthritis, endocarditis, osteomyelitis, lower respiratory tract infections, skin and soft-tissue infections, urinary tract infections, intra-abdominal infections and ophthalmic infections, in humans, poultry, animals and fish. Disease caused by Enterobacteriaceae cause the deaths of millions of people every year, resulting in enormous economic loss. Drug treatment is a useful and efficient way to control Enterobacteriaceae infections. However, with the abuse of antibiotics, drug resistance has been found in growing number of Enterobacteriaceae infections and, as such, there is an urgent need to find new methods of control. Bacteriophage therapy is an efficient alternative to antibiotics as it employs a different antibacterial mechanism. This paper summarizes the history of bacteriophage therapy, its bacteriallytic mechanisms, and the studies that have focused on Enterobacteriaceae and bacteriophage therapy.

  16. Bacteriophage therapy against Enterobacteriaceae.

    Science.gov (United States)

    Xu, Youqiang; Liu, Yong; Liu, Yang; Pei, Jiangsen; Yao, Su; Cheng, Chi

    2015-02-01

    The Enterobacteriaceae are a class of gram-negative facultative anaerobic rods, which can cause a variety of diseases, such as bacteremia, septic arthritis, endocarditis, osteomyelitis, lower respiratory tract infections, skin and soft-tissue infections, urinary tract infections, intra-abdominal infections and ophthalmic infections, in humans, poultry, animals and fish. Disease caused by Enterobacteriaceae cause the deaths of millions of people every year, resulting in enormous economic loss. Drug treatment is a useful and efficient way to control Enterobacteriaceae infections. However, with the abuse of antibiotics, drug resistance has been found in growing number of Enterobacteriaceae infections and, as such, there is an urgent need to find new methods of control. Bacteriophage therapy is an efficient alternative to antibiotics as it employs a different antibacterial mechanism. This paper summarizes the history of bacteriophage therapy, its bacterial lytic mechanisms, and the studies that have focused on Enterobacteriaceae and bacteriophage therapy.

  17. The role of bacteriophages in periodontal health and disease.

    Science.gov (United States)

    Pinto, Graça; Silva, Maria Daniela; Peddey, Mark; Sillankorva, Sanna; Azeredo, Joana

    2016-10-01

    The human periodontium health is commonly compromised by chronic inflammatory conditions and has become a major public health concern. Dental plaque, the precursor of periodontal disease, is a complex biofilm consisting mainly of bacteria, but also archaea, protozoa, fungi and viruses. Viruses that specifically infect bacteria - bacteriophages - are most common in the oral cavity. Despite this, their role in the progression of periodontal disease remains poorly explored. This review aims to summarize how bacteriophages interact with the oral microbiota, their ability to increase bacterial virulence and mediate the transfer of resistance genes and suggests how bacteriophages can be used as an alternative to the current periodontal disease therapies.

  18. Respirable bacteriophages for the treatment of bacterial lung infections.

    Science.gov (United States)

    Hoe, Susan; Semler, Diana D; Goudie, Amanda D; Lynch, Karlene H; Matinkhoo, Sadaf; Finlay, Warren H; Dennis, Jonathan J; Vehring, Reinhard

    2013-12-01

    This review article discusses the development of respiratory therapeutics containing bacteriophages indicated for lung infections, specifically those that have become increasingly difficult to treat because of antibiotic resistance. Recent achievements and remaining problems are presented for each step necessary to develop a bacteriophage-containing dosage form for respiratory drug delivery, including selection of appropriate bacteriophages for therapy, processing and purification of phage preparations, formulation into a stable, solid dosage form, and delivery device selection. Safety and efficacy studies in animals and human subjects are also reviewed.

  19. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation.

  20. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  1. Listeria monocytogenes endocarditis.

    Science.gov (United States)

    Sheinman, B D; Evans, T; Sage, R

    1985-01-01

    A fatal case of endocarditis due to Listeria monocytogenes is reported. Case reports of endocarditis due to this organism are rare but indicate a higher mortality than with many other causes of bacterial endocarditis. The size of the problem may be underestimated because the organism has a "diphtheroid' appearance and may be incorrectly dismissed as a contaminant.

  2. Innate and adaptive immunity in bacteria: mechanisms of programmed genetic variation to fight bacteriophages.

    Science.gov (United States)

    Bikard, David; Marraffini, Luciano A

    2012-02-01

    Bacteria are constantly challenged by bacteriophages (viruses that infect bacteria), the most abundant microorganism on earth. Bacteria have evolved a variety of immunity mechanisms to resist bacteriophage infection. In response, bacteriophages can evolve counter-resistance mechanisms and launch a 'virus versus host' evolutionary arms race. In this context, rapid evolution is fundamental for the survival of the bacterial cell. Programmed genetic variation mechanisms at loci involved in immunity against bacteriophages generate diversity at a much faster rate than random point mutation and enable bacteria to quickly adapt and repel infection. Diversity-generating retroelements (DGRs) and phase variation mechanisms enhance the generic (innate) immune response against bacteriophages. On the other hand, the integration of small bacteriophage sequences in CRISPR loci provide bacteria with a virus-specific and sequence-specific adaptive immune response. Therefore, although using different molecular mechanisms, both prokaryotes and higher organisms rely on programmed genetic variation to increase genetic diversity and fight rapidly evolving infectious agents.

  3. Immunocompatibility of Bacteriophages as Nanomedicines

    Directory of Open Access Journals (Sweden)

    Tranum Kaur

    2012-01-01

    Full Text Available Bacteriophage-based medical research provides the opportunity to develop targeted nanomedicines with heightened efficiency and safety profiles. Filamentous phages also can and have been formulated as targeted drug-delivery nanomedicines, and phage may also serve as promising alternatives/complements to antibiotics. Over the past decade the use of phage for both the prophylaxis and the treatment of bacterial infection, has gained special significance in view of a dramatic rise in the prevalence of antibiotic resistance bacterial strains. Two potential medical applications of phages are the treatment of bacterial infections and their use as immunizing agents in diagnosis and monitoring patients with immunodeficiencies. Recently, phages have been employed as gene-delivery vectors (phage nanomedicine, for nearly half a century as tools in genetic research, for about two decades as tools for the discovery of specific target-binding proteins and peptides, and for almost a decade as tools for vaccine development. As phage applications to human therapeutic development grow at an exponential rate, it will become essential to evaluate host immune responses to initial and repetitive challenges by therapeutic phage in order to develop phage therapies that offer suitable utility. This paper examines and discusses phage nanomedicine applications and the immunomodulatory effects of bacteriophage exposure and treatment modalities.

  4. Bacteriophages as surface and ground water tracers

    Directory of Open Access Journals (Sweden)

    P. Rossi

    1998-01-01

    Full Text Available Bacteriophages are increasingly used as tracers for quantitative analysis in both hydrology and hydrogeology. The biological particles are neither toxic nor pathogenic for other living organisms as they penetrate only a specific bacterial host. They have many advantages over classical fluorescent tracers and offer the additional possibility of multi-point injection for tracer tests. Several years of research make them suitable for quantitative transport analysis and flow boundary delineation in both surface and ground waters, including karst, fractured and porous media aquifers. This article presents the effective application of bacteriophages based on their use in differing Swiss hydrological environments and compares their behaviour to conventional coloured dye or salt-type tracers. In surface water and karst aquifers, bacteriophages travel at about the same speed as the typically referenced fluorescent tracers (uranine, sulphurhodamine G extra. In aquifers of interstitial porosity, however, they appear to migrate more rapidly than fluorescent tracers, albeit with a significant reduction in their numbers within the porous media. This faster travel time implies that a modified rationale is needed for defining some ground water protection area boundaries. Further developments of other bacteriophages and their documentation as tracer methods should result in an accurate and efficient tracer tool that will be a proven alternative to conventional fluorescent dyes.

  5. Bacteriophages as surface and ground water tracers

    Science.gov (United States)

    Rossi, P.; Dörfliger, N.; Kennedy, K.; Müller, I.; Aragno, M.

    Bacteriophages are increasingly used as tracers for quantitative analysis in both hydrology and hydrogeology. The biological particles are neither toxic nor pathogenic for other living organisms as they penetrate only a specific bacterial host. They have many advantages over classical fluorescent tracers and offer the additional possibility of multi-point injection for tracer tests. Several years of research make them suitable for quantitative transport analysis and flow boundary delineation in both surface and ground waters, including karst, fractured and porous media aquifers. This article presents the effective application of bacteriophages based on their use in differing Swiss hydrological environments and compares their behaviour to conventional coloured dye or salt-type tracers. In surface water and karst aquifers, bacteriophages travel at about the same speed as the typically referenced fluorescent tracers (uranine, sulphurhodamine G extra). In aquifers of interstitial porosity, however, they appear to migrate more rapidly than fluorescent tracers, albeit with a significant reduction in their numbers within the porous media. This faster travel time implies that a modified rationale is needed for defining some ground water protection area boundaries. Further developments of other bacteriophages and their documentation as tracer methods should result in an accurate and efficient tracer tool that will be a proven alternative to conventional fluorescent dyes.

  6. A Resolvase-like Protein is required for the Site-Specific Integration of the Temperate Lactococcal Bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.;

    1996-01-01

    for integration were localized on a 2.8 kb NsiI-EcoRI fragment including the phage attachment site, attP. This fragment was DNA sequenced, and sequence analysis revealed three putatively expressed open reading frames Orf1, Orf2, and Orf3. By the introduction of mutations within the orf1, orf2, and orf3 genes......, it was shown that only Orf1 was necessary for the integration process. Furthermore, it was found that Orf1, attP and a 425 base pair region upstream of the orf1 gene was sufficient for integration. Orf1 contains 485 amino acids and is located just upstream of attP. The N-terminal 150-180 amino acids of Orf1...... bacteriophages. The constructed integration vector pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20 % of the transformation efficiency....

  7. Bacteriophage therapy in implant-related infections: an experimental study.

    Science.gov (United States)

    Yilmaz, Cengiz; Colak, Mehmet; Yilmaz, Banu Coskun; Ersoz, Gulden; Kutateladze, Mzia; Gozlugol, Mehmet

    2013-01-16

    Implant-related infections with bacteria resistant to multiple antibiotics represent one of the major problems in orthopaedic surgery. It was our hypothesis that local application of bacteriophages, which are bacteria-destroying viruses, would be effective against biofilm-forming bacteria. An implant-related infection model was created using methicillin-resistant Staphylococcus aureus (MRSA) in forty-eight rats and Pseudomonas aeruginosa in another forty-eight rats. Each group was divided into four subgroups; one subgroup received a bacterium-specific bacteriophage (Sb-1 in the MRSA group and PAT14 in the Pseudomonas aeruginosa group), one received antibiotic for fourteen days (20 mg/kg/day teicoplanin in the MRSA group, and 120 mg/kg/day imipenem + cilastatin and 25 mg/kg/day amikacin in the Pseudomonas group), one received antibiotic and bacteriophage, and one received no treatment. Animals receiving bacteriophage therapy were injected locally with 107 bacteriophages in a 0.1-mL suspension on three consecutive days. All animals were killed on the fifteenth day after initiation of treatment, and the tibia was excised. Results were assessed with use of microbiology, light microscopy, and electron microscopy. In the MRSA group, the antibiotic administration significantly decreased the number of colony-forming units per subject in quantitative cultures (control subgroup, 50,586; bacteriophage, 30,788; antibiotic, 17,165; antibiotic + bacteriophage, 5000; p = 0.004 for the comparison of the latter group with the control). Biofilm was absent only in the antibiotic + bacteriophage subgroup. In the Pseudomonas group, the number of colony-forming units per subject in quantitative cultures was significantly lower in each treatment subgroup compared with the control subgroup (control subgroup, 14,749; bacteriophage, 6484 [p = 0.016]; antibiotic, 2619 [p = 0.01]; antibiotic + bacteriophage, 1705 [p bacteriophage subgroup was also significantly lower than the values in the

  8. Global transcriptional analysis of spontaneous sakacin P-resistant mutant strains of Listeria monocytogenes during growth on different sugars.

    Directory of Open Access Journals (Sweden)

    Girum Tadesse Tessema

    Full Text Available Subclass IIa bacteriocins have strong antilisterial activity and can control the growth of Listeria monocytogenes in food. However, L. monocytogenes may develop resistance towards such bacteriocins. In this follow-up study, the transcriptomes of a high level (L502-1 and a low level (L502-6 spontaneous sakacin P-resistant mutant strain of L. monocytogenes were compared to the wild-type (L502. The growth of the resistant strains was reduced on mannose but not affected on cellobiose and the transcriptomics was performed during growth on these sugars. The mannose phosphotransferase system (PTS encoded by the mptACD operon (mpt is known for transporting mannose and also act as a receptor to class IIa bacteriocins. The mpt was repressed in L502-1 and this is in accordance with abolition of the bacteriocin receptor with resistance to class IIa bacteriocins. In contrast, the mpt was induced in L502-6. Despite the induction of the mpt, L502-6 showed 1,000 times more resistance phenotype and reduced growth on mannose suggesting the mannose-PTS may not be functional in L502-6. The microarray data suggests the presence of other transcriptional responses that may be linked to the sakacin P resistance phenotype particularly in L502-6. Most of commonly regulated genes encode proteins involved in transport and energy metabolism. The resistant strains displayed shift in general carbon catabolite control possibly mediated by the mpt. Our data suggest that the resistant strains may have a reduced virulence potential. Growth sugar- and mutant-specific responses were also revealed. The two resistant strains also displayed difference in stability of the sakacin P resistance phenotype, growth in the presence of both the lytic bacteriophage P100 and activated charcoal. Taken together, the present study showed that a single time exposure to the class IIa bacteriocin sakacin P may elicit contrasting phenotypic and transcriptome responses in L. monocytogenes possibly

  9. Detection of bacteria with bioluminescent reporter bacteriophage.

    Science.gov (United States)

    Klumpp, Jochen; Loessner, Martin J

    2014-01-01

    Bacteriophages are viruses that exclusively infect bacteria. They are ideally suited for the development of highly specific diagnostic assay systems. Bioluminescent reporter bacteriophages are designed and constructed by integration of a luciferase gene in the virus genome. Relying on the host specificity of the phage, the system enables rapid, sensitive, and specific detection of bacterial pathogens. A bioluminescent reporter phage assay is superior to any other molecular detection method, because gene expression and light emission are dependent on an active metabolism of the bacterial cell, and only viable cells will yield a signal. In this chapter we introduce the concept of creating reporter phages, discuss their advantages and disadvantages, and illustrate the advances made in developing such systems for different Gram-negative and Gram-positive pathogens. The application of bioluminescent reporter phages for the detection of foodborne pathogens is emphasized.

  10. [RATIONAL ASPECTS OF BACTERIOPHAGES USE].

    Science.gov (United States)

    Vakarina, A A; Kataeva, L V; Karpukhina, N F

    2015-01-01

    Analysis of existing aspects of bacteriophage use and study features of their lytic activity by using various techniques. Effect of monophages and associated bacteriophages (staphylococci, piopolyvalent and piocombined, intestiphage, pneumonia klebsiella and polyvalent klebsiella produced by "Microgen") was studied with 380 strains of Staphylococcus aureus and 279 cultures of Klebsiella pneumoniae in liquid and solid nutrient media. From patients with intestinal disorder, sensitivity was analyzed to 184 strains of Salmonella genus bacteria 18 serological variants to salmonella bacteriophages, 137 strains of Escherichia coli (lactose-negative, hemolytic), as well as some members of OKA groups (21 serovars) to coli-proteic and piopolyvalent bacteriophages. Lytic ability of the piobacteriophage against Klebsiella and Proteus genus bacteria was determined. Staphylococcus aureus was sensitive to staphylococcus bacteriophage in 71.6% of cases and to piobacteriophage--in 86.15% of cases. A 100% lytic ability of salmonella bacteriophage against Salmonella spp. was established. Sensitivity of E. coli of various serogroups to coli-proteic and piobacteriophage was 66 - 100%. Klebsiella, Proteus genus bacteria were sensitive to piobacteriophage in only 35% and 43.15% of cases, respectively. A more rational use of bacteriophages is necessary: development of a technique, evaluation of sensitivity of bacteria to bacteriophage, introduction of corrections into their production (expansion of bacteriophage spectra, determination and indication of their concentration in accompanying documents).

  11. Bacteriophage-based nanoprobes for rapid bacteria separation

    Science.gov (United States)

    Chen, Juhong; Duncan, Bradley; Wang, Ziyuan; Wang, Li-Sheng; Rotello, Vincent M.; Nugen, Sam R.

    2015-10-01

    The lack of practical methods for bacterial separation remains a hindrance for the low-cost and successful development of rapid detection methods from complex samples. Antibody-tagged magnetic particles are commonly used to pull analytes from a liquid sample. While this method is well-established, improvements in capture efficiencies would result in an increase of the overall detection assay performance. Bacteriophages represent a low-cost and more consistent biorecognition element as compared to antibodies. We have developed nanoscale bacteriophage-tagged magnetic probes, where T7 bacteriophages were bound to magnetic nanoparticles. The nanoprobe allowed the specific recognition and attachment to E. coli cells. The phage magnetic nanprobes were directly compared to antibody-conjugated magnetic nanoprobes. The capture efficiencies of bacteriophages and antibodies on nanoparticles for the separation of E. coli K12 at varying concentrations were determined. The results indicated a similar bacteria capture efficiency between the two nanoprobes.The lack of practical methods for bacterial separation remains a hindrance for the low-cost and successful development of rapid detection methods from complex samples. Antibody-tagged magnetic particles are commonly used to pull analytes from a liquid sample. While this method is well-established, improvements in capture efficiencies would result in an increase of the overall detection assay performance. Bacteriophages represent a low-cost and more consistent biorecognition element as compared to antibodies. We have developed nanoscale bacteriophage-tagged magnetic probes, where T7 bacteriophages were bound to magnetic nanoparticles. The nanoprobe allowed the specific recognition and attachment to E. coli cells. The phage magnetic nanprobes were directly compared to antibody-conjugated magnetic nanoprobes. The capture efficiencies of bacteriophages and antibodies on nanoparticles for the separation of E. coli K12 at varying

  12. STUDIES ON THE PURIFICATION OF BACTERIOPHAGE.

    Science.gov (United States)

    Kalmanson, G; Bronfenbrenner, J

    1939-11-20

    this method of purification to a staphylococcus bacteriophage. Since this organism does not readily grow in synthetic medium, a diffusate of yeast extract medium was employed. The better of two preparations contained about 10(-12) mg. of nitrogen per unit of lytic activity. Although this is about one hundred times the amount of nitrogen found in an active unit of B. coli bacteriophage, nevertheless, the diffusion rate experiments gave results which paralleled those obtained with the coliphage. The diffusible particles of the crude staphylococcus bacteriophage had a radius of about 7 millimicra, and a calculated molecular weight of about 1,000,000, while the particles of the same phage which appeared in the ultrafiltrate through a thin collodion membrane had a radius of about 2.4 millimicra and a calculated molecular weight of about 45,000. It appears, therefore, that the active principle is distributed as particles of widely different sizes. However, since the smaller particles have all the properties of bacteriophage, the larger particles probably do not represent free molecules, but either are aggregates, or more likely, inactive colloids to which the active agent is adsorbed. The protein isolated, which bears the phage activity, is capable of stimulating the production of antilytic antibodies on parenteral injection into rabbits or guinea pigs. It retains its specific antigenicity when inactivated by formalin, but not when inactivated by drying.

  13. Evolutionary dynamics of the accessory genome of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Henk C den Bakker

    Full Text Available Listeria monocytogenes, a foodborne bacterial pathogen, is comprised of four phylogenetic lineages that vary with regard to their serotypes and distribution among sources. In order to characterize lineage-specific genomic diversity within L. monocytogenes, we sequenced the genomes of eight strains from several lineages and serotypes, and characterized the accessory genome, which was hypothesized to contribute to phenotypic differences across lineages. The eight L. monocytogenes genomes sequenced range in size from 2.85-3.14 Mb, encode 2,822-3,187 genes, and include the first publicly available sequenced representatives of serotypes 1/2c, 3a and 4c. Mapping of the distribution of accessory genes revealed two distinct regions of the L. monocytogenes chromosome: an accessory-rich region in the first 65° adjacent to the origin of replication and a more stable region in the remaining 295°. This pattern of genome organization is distinct from that of related bacteria Staphylococcus aureus and Bacillus cereus. The accessory genome of all lineages is enriched for cell surface-related genes and phosphotransferase systems, and transcriptional regulators, highlighting the selective pressures faced by contemporary strains from their hosts, other microbes, and their environment. Phylogenetic analysis of O-antigen genes and gene clusters predicts that serotype 4 was ancestral in L. monocytogenes and serotype 1/2 associated gene clusters were putatively introduced through horizontal gene transfer in the ancestral population of L. monocytogenes lineage I and II.

  14. Methods for generation of reporter phages and immobilization of active bacteriophages on a polymer surface

    Science.gov (United States)

    Applegate, Bruce Michael (Inventor); Perry, Lynda Louise (Inventor); Morgan, Mark Thomas (Inventor); Kothapalli, Aparna (Inventor)

    2012-01-01

    Novel reporter bacteriophages are provided. Provided are compositions and methods that allow bacteriophages that are used for specific detection or killing of E. coli 0157:H7 to be propagated in nonpathogenic E. coli, thereby eliminating the safety and security risks of propagation in E. coli 0157:H7. Provided are compositions and methods for attaching active bacteriophages to the surface of a polymer in order to kill target bacteria with which the phage comes into contact. Provided are modified bacteriophages immobilized to a surface, which capture E. coli 0157:H7 and cause the captured cells to emit light or fluorescence, allowing detection of the bacteria in a sample.

  15. Bacteriophages of Yersinia pestis.

    Science.gov (United States)

    Zhao, Xiangna; Skurnik, Mikael

    2016-01-01

    Bacteriophage play many varied roles in microbial ecology and evolution. This chapter collates a vast body of knowledge and expertise on Yersinia pestis phages, including the history of their isolation and classical methods for their isolation and identification. The genomic diversity of Y. pestis phage and bacteriophage islands in the Y. pestis genome are also discussed because all phage research represents a branch of genetics. In addition, our knowledge of the receptors that are recognized by Y. pestis phage, advances in phage therapy for Y. pestis infections, the application of phage in the detection of Y. pestis, and clustered regularly interspaced short palindromic repeats (CRISPRs) sequences of Y. pestis from prophage DNA are all reviewed here.

  16. Listeriaphages and coagulin C23 act synergistically to kill Listeria monocytogenes in milk under refrigeration conditions.

    Science.gov (United States)

    Rodríguez-Rubio, Lorena; García, Pilar; Rodríguez, Ana; Billington, Craig; Hudson, J Andrew; Martínez, Beatriz

    2015-07-16

    Bacteriophages and bacteriocins are promising biocontrol tools in food. In this work, two Listeria bacteriophages, FWLLm1 and FWLLm3, were assessed in combination with the bacteriocin coagulin C23 to inhibit Listeria monocytogenes. Preliminary results under laboratory conditions demonstrated that both antimicrobials act synergistically when they were applied in suboptimal concentrations. The combined approach was further assessed in milk contaminated with 5×10(4) CFU/ml L. monocytogenes 2000/47 and stored at 4 °C for 10 days. When used alone, phage FWLLm1 added at 5×10(6) PFU/ml, FWLLm3 at 5×10(5) PFU/ml and coagulin C23 at 584 AU/ml kept L. monocytogenes 2000/47 counts lower than the untreated control throughout storage. However, when used in combination, inhibition was enhanced and in the presence of FWLLm1 and coagulin C23, L. monocytogenes 2000/47 counts were under the detection limits (less than 10 CFU/ml) from day 4 until the end of the experiment. Resistant mutants towards phages and coagulin C23 could be obtained, but cross-resistance was not detected. Mutants resistant to FWLLm3 and coagulin C23 were also recovered from surviving colonies after cold storage in milk which may explain the failure of this combination to inhibit L. monocytogenes. Remarkably, the fraction of resistant mutants isolated from the combined treatment was lower than that from each antimicrobial alone, suggesting that synergy between bacteriocins and phages could be due to a lower rate of resistance development and the absence of cross-resistance. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  18. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  19. DNA Packaging in Bacteriophage: Is Twist Important?

    OpenAIRE

    Spakowitz, Andrew James; Wang, Zhen-Gang

    2005-01-01

    We study the packaging of DNA into a bacteriophage capsid using computer simulation, specifically focusing on the potential impact of twist on the final packaged conformation. We perform two dynamic simulations of packaging a polymer chain into a spherical confinement: one where the chain end is rotated as it is fed, and one where the chain is fed without end rotation. The final packaged conformation exhibits distinct differences in these two cases: the packaged conformation from feeding with...

  20. Bacteriophage cocktail for biocontrol of Salmonella in dried pet food.

    Science.gov (United States)

    Heyse, Serena; Hanna, Leigh Farris; Woolston, Joelle; Sulakvelidze, Alexander; Charbonneau, Duane

    2015-01-01

    Human salmonellosis has been associated with contaminated pet foods and treats. Therefore, there is interest in identifying novel approaches for reducing the risk of Salmonella contamination within pet food manufacturing environments. The use of lytic bacteriophages shows promise as a safe and effective way to mitigate Salmonella contamination in various food products. Bacteriophages are safe, natural, highly targeted antibacterial agents that specifically kill bacteria and can be targeted to kill food pathogens without affecting other microbiota. In this study, we show that a cocktail containing six bacteriophages had a broadspectrum activity in vitro against a library of 930 Salmonella enterica strains representing 44 known serovars. The cocktail was effective against 95% of the strains in this tested library. In liquid culture dose-ranging experiments, bacteriophage cocktail concentrations of ≥10(8) PFU/ml inactivated more than 90% of the Salmonella population (10(1) to 10(3) CFU/ml). Dried pet food inoculated with a mixture containing equal proportions of Salmonella serovars Enteritidis (ATCC 4931), Montevideo (ATCC 8387), Senftenberg (ATCC 8400), and Typhimurium (ATCC 13311) and then surface treated with the six-bacteriophage cocktail (≥2.5 ± 1.5 × 10(6) PFU/g) achieved a greater than 1-log (P food that tested positive for Salmonella. Our results indicate that bacteriophage biocontrol of S. enterica in dried pet food is technically feasible.

  1. Genomic impact of CRISPR immunization against bacteriophages.

    Science.gov (United States)

    Barrangou, Rodolphe; Coûté-Monvoisin, Anne-Claire; Stahl, Buffy; Chavichvily, Isabelle; Damange, Florian; Romero, Dennis A; Boyaval, Patrick; Fremaux, Christophe; Horvath, Philippe

    2013-12-01

    CRISPR (clustered regularly interspaced short palindromic repeats) together with CAS (RISPR-associated) genes form the CRISPR-Cas immune system, which provides sequence-specific adaptive immunity against foreign genetic elements in bacteria and archaea. Immunity is acquired by the integration of short stretches of invasive DNA as novel 'spacers' into CRISPR loci. Subsequently, these immune markers are transcribed and generate small non-coding interfering RNAs that specifically guide nucleases for sequence-specific cleavage of complementary sequences. Among the four CRISPR-Cas systems present in Streptococcus thermophilus, CRISPR1 and CRISPR3 have the ability to readily acquire new spacers following bacteriophage or plasmid exposure. In order to investigate the impact of building CRISPR-encoded immunity on the host chromosome, we determined the genome sequence of a BIM (bacteriophage-insensitive mutant) derived from the DGCC7710 model organism, after four consecutive rounds of bacteriophage challenge. As expected, active CRISPR loci evolved via polarized addition of several novel spacers following exposure to bacteriophages. Although analysis of the draft genome sequence revealed a variety of SNPs (single nucleotide polymorphisms) and INDELs (insertions/deletions), most of the in silico differences were not validated by Sanger re-sequencing. In addition, two SNPs and two small INDELs were identified and tracked in the intermediate variants. Overall, building CRISPR-encoded immunity does not significantly affect the genome, which allows the maintenance of important functional properties in isogenic CRISPR mutants. This is critical for the development and formulation of sustainable and robust next-generation starter cultures with increased industrial lifespans.

  2. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  3. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Science.gov (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R

    2013-01-01

    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  4. [Listeria monocytogenes in food].

    Science.gov (United States)

    Mícková, V

    1992-12-01

    As in recent years laboratory diagnostics of listeria has become part of food microbiology, the frequency of occurrence of the bacteria Listeria monocytogenes has been followed in various kinds of foods for a year. A total of 51 strains of L. monocytogenes (7.2%) was isolated from 700 kinds of samples (raw milk, pasteurized milk, meat surface, poultry, cheeses, thermally not treated meat products, food--industry machinery). As can be seen in Tab. I, the highest number of strains was isolated from meat surfaces (13.5%), followed by meat--industry machinery (12.72%), poultry (10%) and cheeses (5%). The lower numbers of strains were found out in thermally not treated meat products (3.8%) and in raw milk (3.3%). Pasteurized milk did not contain any strains. Our findings in raw milk (3.3%) and in pasteurized milk (0) are in agreement with the data cited e. g. by authors from the USA (Lovett et al., 1987), who mention the value of 4.2% in raw milk and the zero value in pasteurized milk. The percentage of strains monitored in cheeses (5%) can be evaluated as low as the assortment of investigated cheeses was small (all strains were isolated from soft ripening cheeses). German authors (Tham et al., 1988) speak about the 2.5% percentage of L. monocytogenes strains; this is in keeping with our findings. The findings in thermally not treated meat products (3.8%) can be evaluated as low although the number of strains found in raw meat was high.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. 76 FR 66187 - Bacteriophage of Clavibacter Michiganensis Subspecies Michiganensis; Exemption From the...

    Science.gov (United States)

    2011-10-26

    ... with strains of Pseudomonas aeruginosa and specific bacteriophages. Canadian Journal of Microbiology 21.... Bacteriophage and bacterial classification. Journal of General Microbiology 12:375-381. 10. Duckworth DH, Gulig... and delicatessen meats. Journal of Food Protection 47:623-626. 17. DePaola A, Motes ML, Chan AM...

  6. Isolation and characterization of a lytic bacteriophage φKp-lyy15 of Klebsiella pneumoniae

    Institute of Scientific and Technical Information of China (English)

    Yinyin; Lu; Hongyan; Shi; Zhe; Zhang; Fang; Han; Jinghua; Li; Yanbo; Sun

    2015-01-01

    <正>Dear Editor,Bacteriophages(phages)are viruses that specifically infect and kill bacteria.They are ubiquitous throughout all environments that bacteria inhabit.Following their discovery by F.W.Twort in 1915 and F.d’Herele in 1917,bacteriophages were recognized as potential agents to treat bacterial diseases and phage therapy has been used

  7. Bacteriophages limit the existence conditions for conjugative plasmids.

    Science.gov (United States)

    Harrison, Ellie; Wood, A Jamie; Dytham, Calvin; Pitchford, Jonathan W; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A

    2015-06-02

    Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. Conjugative plasmids are infectious loops of DNA capable of transmitting DNA between bacterial cells and between species. Because plasmids often carry extra genes that allow bacteria to live in otherwise-inhospitable environments, their dynamics are central to understanding bacterial adaptive evolution. The plasmid-bacterium interaction has typically been studied in isolation, but in natural bacterial communities, bacteriophages, viruses that infect bacteria, are ubiquitous. Using experiments, mathematical models, and computer simulations we show that bacteriophages drive plasmid dynamics through their ecological and evolutionary effects on bacteria and ultimately

  8. Adsorption of T4 bacteriophages on planar indium tin oxide surface via controlled surface tailoring.

    Science.gov (United States)

    Liana, Ayu Ekajayanthi; Chia, Ed Win; Marquis, Christopher P; Gunawan, Cindy; Gooding, J Justin; Amal, Rose

    2016-04-15

    The work investigates the influence of surface physicochemical properties of planar indium tin oxide (ITO) as a model substrate on T4 bacteriophage adsorption. A comparative T4 bacteriophage adsorption study shows a significant difference in bacteriophage adsorption observed on chemically modified planar ITO when compared to similarly modified particulate ITO, which infers that trends observed in virus-particle interaction studies are not necessarily transferrable to predict virus-planar surface adsorption behaviour. We also found that ITO surfaces modified with methyl groups, (resulting in increased surface roughness and hydrophobicity) remained capable of adsorbing T4 bacteriophage. The adsorption of T4 onto bare, amine and carboxylic functionalised planar ITO suggests the presence of a unique binding behaviour involving specific functional groups on planar ITO surface beyond the non-specific electrostatic interactions that dominate phage to particle interactions. The paper demonstrates the significance of physicochemical properties of surfaces on bacteriophage-surface interactions.

  9. Detection and Quantification of Flavobacterium psychrophilum-Specific Bacteriophages In Vivo in Rainbow Trout upon Oral Administration: Implications for Disease Control in Aquaculture

    Science.gov (United States)

    Christiansen, Rói Hammershaimb; Dalsgaard, Inger; Middelboe, Mathias; Lauritsen, Anne H.

    2014-01-01

    The use of bacteriophages in the treatment and prevention of infections by the fish pathogen Flavobacterium psychrophilum has attracted increased attention in recent years. It has been shown recently that phage delivery via the parenteral route resulted in immediate distribution of phages to the circulatory system and the different organs. However, little is known about phage dispersal and survival in vivo in rainbow trout after delivery via the oral route. Here we examined the dispersal and survival of F. psychrophilum phage FpV-9 in vivo in juvenile rainbow trout after administration by three different methods—bath, oral intubation into the stomach, and phage-coated feed—with special emphasis on the oral route of delivery. Phages could be detected in all the organs investigated (intestine, spleen, brain, and kidney) 0.5 h postadministration, reaching concentrations as high as ∼105 PFU mg intestine−1 and ∼103 PFU mg spleen−1 within the first 24 h following the bath and ∼107 PFU mg intestine−1 and ∼104 PFU mg spleen−1 within the first 24 h following oral intubation. The phages were most persistent in the organs for the first 24 h and then decreased exponentially; no phages were detected after 83 h in the organs investigated. Phage administration via feed resulted in the detection of phages in the intestine, spleen, and kidney 1 h after feeding. Average concentrations of ∼104 PFU mg intestine−1 and ∼101 PFU mg spleen−1 were found throughout the experimental period (200 h) following continuous delivery of phages with feed. These experiments clearly demonstrate the ability of the phages to survive passage through the fish stomach and to penetrate the intestinal barrier and enter the circulatory system after oral delivery, although the quantity of phages found in the spleen was 100- to 1,000-fold lower than that in the intestine. It was also shown that phages could tolerate long periods of desiccation on the feed pellets, with 60% survival

  10. Detection and quantification of Flavobacterium psychrophilum-specific bacteriophages in vivo in rainbow trout upon oral administration: implications for disease control in aquaculture.

    Science.gov (United States)

    Christiansen, Rói Hammershaimb; Dalsgaard, Inger; Middelboe, Mathias; Lauritsen, Anne H; Madsen, Lone

    2014-12-01

    The use of bacteriophages in the treatment and prevention of infections by the fish pathogen Flavobacterium psychrophilum has attracted increased attention in recent years. It has been shown recently that phage delivery via the parenteral route resulted in immediate distribution of phages to the circulatory system and the different organs. However, little is known about phage dispersal and survival in vivo in rainbow trout after delivery via the oral route. Here we examined the dispersal and survival of F. psychrophilum phage FpV-9 in vivo in juvenile rainbow trout after administration by three different methods-bath, oral intubation into the stomach, and phage-coated feed-with special emphasis on the oral route of delivery. Phages could be detected in all the organs investigated (intestine, spleen, brain, and kidney) 0.5 h postadministration, reaching concentrations as high as ∼10(5) PFU mg intestine(-1) and ∼10(3) PFU mg spleen(-1) within the first 24 h following the bath and ∼10(7) PFU mg intestine(-1) and ∼10(4) PFU mg spleen(-1) within the first 24 h following oral intubation. The phages were most persistent in the organs for the first 24 h and then decreased exponentially; no phages were detected after 83 h in the organs investigated. Phage administration via feed resulted in the detection of phages in the intestine, spleen, and kidney 1 h after feeding. Average concentrations of ∼10(4) PFU mg intestine(-1) and ∼10(1) PFU mg spleen(-1) were found throughout the experimental period (200 h) following continuous delivery of phages with feed. These experiments clearly demonstrate the ability of the phages to survive passage through the fish stomach and to penetrate the intestinal barrier and enter the circulatory system after oral delivery, although the quantity of phages found in the spleen was 100- to 1,000-fold lower than that in the intestine. It was also shown that phages could tolerate long periods of desiccation on the feed pellets, with 60

  11. Bacteriophages as potential treatment option for antibiotic resistant bacteria.

    Science.gov (United States)

    Bragg, Robert; van der Westhuizen, Wouter; Lee, Ji-Yun; Coetsee, Elke; Boucher, Charlotte

    2014-01-01

    The world is facing an ever-increasing problem with antibiotic resistant bacteria and we are rapidly heading for a post-antibiotic era. There is an urgent need to investigate alterative treatment options while there are still a few antibiotics left. Bacteriophages are viruses that specifically target bacteria. Before the development of antibiotics, some efforts were made to use bacteriophages as a treatment option, but most of this research stopped soon after the discovery of antibiotics. There are two different replication options which bacteriophages employ. These are the lytic and lysogenic life cycles. Both these life cycles have potential as treatment options. There are various advantages and disadvantages to the use of bacteriophages as treatment options. The main advantage is the specificity of bacteriophages and treatments can be designed to specifically target pathogenic bacteria while not negatively affecting the normal microbiota. There are various advantages to this. However, the high level of specificity also creates potential problems, the main being the requirement of highly specific diagnostic procedures. Another potential problem with phage therapy includes the development of immunity and limitations with the registration of phage therapy options. The latter is driving research toward the expression of phage genes which break the bacterial cell wall, which could then be used as a treatment option. Various aspects of phage therapy have been investigated in studies undertaken by our research group. We have investigated specificity of phages to various avian pathogenic E. coli isolates. Furthermore, the exciting NanoSAM technology has been employed to investigate bacteriophage replication and aspects of this will be discussed.

  12. Genetically modified bacteriophages in applied microbiology.

    Science.gov (United States)

    Bárdy, P; Pantůček, R; Benešík, M; Doškař, J

    2016-09-01

    Bacteriophages represent a simple viral model of basic research with many possibilities for practical application. Due to their ability to infect and kill bacteria, their potential in the treatment of bacterial infection has been examined since their discovery. With advances in molecular biology and gene engineering, the phage application spectrum has been expanded to various medical and biotechnological fields. The construction of bacteriophages with an extended host range or longer viability in the mammalian bloodstream enhances their potential as an alternative to conventional antibiotic treatment. Insertion of active depolymerase genes to their genomes can enforce the biofilm disposal. They can also be engineered to transfer various compounds to the eukaryotic organisms and the bacterial culture, applicable for the vaccine, drug or gene delivery. Phage recombinant lytic enzymes can be applied as enzybiotics in medicine as well as in biotechnology for pathogen detection or programmed cell death in bacterial expression strains. Besides, modified bacteriophages with high specificity can be applied as bioprobes in detection tools to estimate the presence of pathogens in food industry, or utilized in the control of food-borne pathogens as part of the constructed phage-based biosorbents.

  13. Polymer-based delivery systems for support and delivery of bacteriophages

    Science.gov (United States)

    Brown, Alyssa Marie

    One of the most urgent problems in the fields of medicine and agriculture is the decreasing effectiveness of antibiotics. Once a miracle drug, antibiotics have recently become associated with the creation of antibiotic-resistant bacteria. The main limitations of these treatments include lack of both adaptability and specificity. To overcome these shortcomings of current antibiotic treatments, there has been a renewed interest in bacteriophage research. Bacteriophages are naturally-occurring viruses that lyse bacteria. They are highly specific, with each bacteriophage type lysing a narrow range of bacteria strains. Bacteriophages are also ubiquitous biological entities, populating environments where bacterial growth is supported. Just as humans are exposed to bacteria in their daily lives, we are exposed to bacteriophages as well. To use bacteriophages in practical applications, they must be delivered to the site of an infection in a controlled-release system. Two systems were studied to observe their support of bacteriophage lytic activity, as well as investigate the possibility of controlling bacteriophage release rates. First, hydrogels were studied, using crosslinking and blending techniques to achieve a range of release profiles. Second, polyanhydride microparticles were studied, evaluating release rates as a function of monomer chemistries.

  14. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    Science.gov (United States)

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    Summary To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or induced to lyse by treatment with ampicillin stimulated pyroptosis. Pyroptosis was independent of the Nlrp3 and Nlrc4 receptors, but dependent on ASC and AIM2. Importantly, wild type L. monocytogenes were also found to lyse, albeit at low levels, and trigger AIM2-dependent pyroptosis. Since AIM2 is activated by DNA, these data suggested that pyroptosis is triggered by bacterial DNA released during lysis. PMID:20417169

  15. Site-specific integration of the temperate bacteriophage phi adh into the Lactobacillus gasseri chromosome and molecular characterization of the phage (attP) and bacterial (attB) attachment sites.

    Science.gov (United States)

    Raya, R R; Fremaux, C; De Antoni, G L; Klaenhammer, T R

    1992-01-01

    The temperate bacteriophage phi adh integrates its genome into the chromosomal DNA of Lactobacillus gasseri ADH by a site-specific recombination process. Southern hybridization analysis of BclI-digested genomic DNA from six relysogenized derivatives of the prophage-cured strain NCK102 displayed phage-chromosomal junction fragments identical to those of the lysogenic parent. The phi adh attachment site sequence, attP, was located within a 365-bp EcoRI-HindIII fragment of phage phi adh. This fragment was cloned and sequenced. DNA sequence analysis revealed striking features common to the attachment sites of other site-specific recombination systems: five direct repeats of the sequence TGTCCCTTTT(C/T) and a 14-bp inverted repeat. Oligonucleotides derived from the sequence of the attP-containing fragment enabled us to amplify predicted junction fragment sequences and thus to identify attL, attR, and attB. The core region was defined as the 16-bp sequence TACACTTCTTAGGAGG. Phage-encoded functions essential for site-specific insertion of phage phi adh were located in a 4.5-kb BclI fragment. This fragment was cloned in plasmid pSA34 to generate the insertional vector pTRK182. Plasmid pTRK182 was introduced into L. gasseri NCK102 by electroporation. Hybridization analysis showed that a single copy of pTRK182 had integrated at the attB site of the NCK102 erythromycin-resistant transformants. This is the first site-specific recombination system described in lactobacilli, as well as the first attP-based site-specific integration vector constructed for L. gasseri ADH. Images PMID:1512192

  16. Bacteriophage-Based Pathogen Detection

    Science.gov (United States)

    Ripp, Steven

    Considered the most abundant organism on Earth, at a population approaching 1031, bacteriophage, or phage for short, mediate interactions with myriad bacterial hosts that has for decades been exploited in phage typing schemes for signature identification of clinical, food-borne, and water-borne pathogens. With over 5,000 phage being morphologically characterized and grouped as to susceptible host, there exists an enormous cache of bacterial-specific sensors that has more recently been incorporated into novel bio-recognition assays with heightened sensitivity, specificity, and speed. These assays take many forms, ranging from straightforward visualization of labeled phage as they attach to their specific bacterial hosts to reporter phage that genetically deposit trackable signals within their bacterial hosts to the detection of progeny phage or other uniquely identifiable elements released from infected host cells. A comprehensive review of these and other phage-based detection assays, as directed towards the detection and monitoring of bacterial pathogens, will be provided in this chapter.

  17. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  18. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Science.gov (United States)

    Zhu, Qi; Gooneratne, Ravi; Hussain, Malik Altaf

    2017-01-01

    Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis). However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water). Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges. PMID:28282938

  19. [Hematometra & Listeria monocytogenes].

    Science.gov (United States)

    Gómez Arzapalo, E; Pérez Mendizábal, A; Herrera Avalos, I; Gorozpe Calvillo, J I

    2001-05-01

    The hematometra is a nosological entity that may not always be attributed to an embryonic defect of the paramesonefros; cervical-vaginal infections such as etiological possibilities due to Listeria monocytogenes (Lm), cervix malignant neoplasias, iatrogenias due to endometrial ablation with Lasser, traumatic bloody uterine curetage and because of cervical cryocoagulation or electrocoagulation are also mentioned. The case to be reported is from a woman in reproductive stage, who is 32 years old, and had menarca at the age of 13, starting her sexual life at 31, not using any method to control her fertility. When having an eight-week amenorrhea after 8 months of marriage, she visited the doctor for assumed pregnancy, within the prenatal analysis a pelvic echographic study was requested, finding out images that we concluded as hematometra, having been drained and demonstrated the presence of LM by anti-Lm antibodies, being administered Azitromicina and Espiramicina.

  20. Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria

    DEFF Research Database (Denmark)

    Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet

    2013-01-01

    Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites...... that formation of backpacks is not specific for L.?monocytogenes, and independent of bacterial pathogenicity or virulence. Hence, backpacking appears to represent a unique and highly effective strategy of Acanthamoeba to trap and feed on motile bacteria....

  1. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  2. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne

    2010-01-01

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L...... monocytogenes in food processing environments and the purpose of the present study was to determine ability of L monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative...... humidities (RHs) during desiccation decreased significantly (p...

  3. Bacteriophage in polar inland waters

    Science.gov (United States)

    Säwström, Christin; Lisle, John; Anesio, A.M.; Priscu, John C.; Laybourn-Parry, J.

    2008-01-01

    Bacteriophages are found wherever microbial life is present and play a significant role in aquatic ecosystems. They mediate microbial abundance, production, respiration, diversity, genetic transfer, nutrient cycling and particle size distribution. Most studies of bacteriophage ecology have been undertaken at temperate latitudes. Data on bacteriophages in polar inland waters are scant but the indications are that they play an active and dynamic role in these microbially dominated polar ecosystems. This review summarises what is presently known about polar inland bacteriophages, ranging from subglacial Antarctic lakes to glacial ecosystems in the Arctic. The review examines interactions between bacteriophages and their hosts and the abiotic and biotic variables that influence these interactions in polar inland waters. In addition, we consider the proportion of the bacteria in Arctic and Antarctic lake and glacial waters that are lysogenic and visibly infected with viruses. We assess the relevance of bacteriophages in the microbial loop in the extreme environments of Antarctic and Arctic inland waters with an emphasis on carbon cycling.

  4. Bacteriophage therapy for safeguarding animal and human health: a review.

    Science.gov (United States)

    Tiwari, Ruchi; Dhama, Kuldeep; Kumar, Amit; Rahal, Anu; Kapoor, Sanjay

    2014-02-01

    Since the discovery of bacteriophages at the beginning of the 19th century their contribution to bacterial evolution and ecology and use in a variety of applications in biotechnology and medicine has been recognized and understood. Bacteriophages are natural bacterial killers, proven as best biocontrol agents due to their ability to lyse host bacterial cells specifically thereby helping in disease prevention and control. The requirement of such therapeutic approach is straight away required in view of the global emergence of Multidrug Resistant (MDR) strains of bacteria and rapidly developing resistance to antibiotics in both animals and humans along with increasing food safety concerns including of residual antibiotic toxicities. Phage typing is a popular tool to differentiate bacterial isolates and to identify and characterize outbreak-associated strains of Salmonella, Campylobacter, Escherichia and Listeria. Numerous methods viz. plaque morphology, ultracentrifugation in the density gradient of CsCl2, and random amplified polymorphic DNA (RAPD) have been found to be effective in detection of various phages. Bacteriophages have been isolated and recovered from samples of animal waste products of different livestock farms. High titer cocktails of broad spectrum lytic bacteriophages are usually used for clinical trial for assessing their therapeutic efficacy against antibiotic unresponsive infections in different animals. Bacteriophage therapy also helps to fight various bacterial infections of poultry viz. colibacillosis, salmonellosis and listeriosis. Moreover, the utility of phages concerning biosafety has raised the importance to explore and popularize the therapeutic dimension of this promising novel therapy which forms the topic of discussion of the present review.

  5. Bacteriophages as an alternative strategy for fighting biofilm development.

    Science.gov (United States)

    Parasion, Sylwia; Kwiatek, Magdalena; Gryko, Romuald; Mizak, Lidia; Malm, Anna

    2014-01-01

    The ability of microbes to form biofilms is an important element of their pathogenicity, and biofilm formation is a serious challenge for today's medicine. Fighting the clinical complications associated with biofilm formation is very difficult and linked to a high risk of failure, especially in a time of increasing bacterial resistance to antibiotics. Bacterial species most commonly isolated from biofilms include coagulase-negative staphylococci, Staphylococcus aureus, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Proteus mirabilis, Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter spp. The frequent failure of antibiotic therapy led researchers to look for alternative methods and experiment with the use of antibacterial factors with a mechanism of action different from that of antibiotics. Experimental studies with bacteriophages and mixtures thereof, expressing lytic properties against numerous biofilm-forming bacterial species showed that bacteriophages may both prevent biofilm formation and contribute to eradication of biofilm bacteria. A specific role is played here by phage depolymerases, which facilitate the degradation of extracellular polymeric substances (EPS) and thus the permeation of bacteriophages into deeper biofilm layers and lysis of the susceptible bacterial cells. Much hope is placed in genetic modifications of bacteriophages that would allow the equipping bacteriophages with the function of depolymerase synthesis. The use of phage cocktails prevents the development of phage-resistant bacteria.

  6. Bacteriophages of methanotrophic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Tyutikow, F.M. (All-Union Research Inst. for Genetics and Selection of Industrial Microorganisms, Moscow, USSR); Bespalova, I.A.; Rebentish, B.A.; Aleksandrushkina, N.N.; Krivisky, A.S.

    1980-10-01

    Bacteriophages of methanotrophic bacteria have been found in 16 out of 88 studied samples (underground waters, pond water, soil, gas and oil installation waters, fermentor cultural fluids, bacterial paste, and rumen of cattle) taken in different geographic zones of the Soviet Union. Altogether, 23 phage strains were isolated. By fine structure, the phages were divided into two types (with very short or long noncontractile tails); by host range and serological properties, they fell into three types. All phages had guanine- and cytosine-rich double-stranded deoxyribonucleic acid consisting of common nitrogen bases. By all of the above-mentioned properties, all phages within each of the groups were completely identical to one another, but differed from phages of other groups.

  7. Genetically modified bacteriophages.

    Science.gov (United States)

    Sagona, Antonia P; Grigonyte, Aurelija M; MacDonald, Paul R; Jaramillo, Alfonso

    2016-04-18

    Phages or bacteriophages, viruses that infect and replicate inside bacteria, are the most abundant microorganisms on earth. The realization that antibiotic resistance poses a substantial risk to the world's health and global economy is revitalizing phage therapy as a potential solution. The increasing ease by which phage genomes can be modified, owing to the influx of new technologies, has led to an expansion of their natural capabilities, and a reduced dependence on phage isolation from environmental sources. This review will discuss the way synthetic biology has accelerated the construction of genetically modified phages and will describe the wide range of their applications. It will further provide insight into the societal and economic benefits that derive from the use of recombinant phages in various sectors, from health to biodetection, biocontrol and the food industry.

  8. A detailed view of the intracellular transcriptome of Listeria monocytogenes in murine macrophages using RNA-seq

    Directory of Open Access Journals (Sweden)

    Tilman Gunter Schultze

    2015-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen and causative agent for the foodborne infection listeriosis, which is mainly a threat for pregnant, elderly or immunocompromised individuals. Due to its ability to invade and colonize diverse eukaryotic cell types including cells from invertebrates, L. monocytogenes has become a well-established model organism for intracellular growth. Almost ten years ago, we and others presented the first whole-genome microarray-based intracellular transcriptome of L. monocytogenes. With the advent of newer technologies addressing transcriptomes in greater detail, we revisit this work, and analyze the intracellular transcriptome of L. monocytogenes during growth in murine macrophages using a deep sequencing based approach.We detected 656 differentially expressed genes of which 367 were upregulated during intracellular growth in macrophages compared to extracellular growth in BHI. This study confirmed ~64% of all regulated genes previously identified by microarray analysis. Many of the regulated genes that were detected in the current study involve transporters for various metals, ions as well as complex sugars such as mannose. We also report changes in antisense transcription, especially upregulations during intracellular bacterial survival. A notable finding was the detection of regulatory changes for a subset of temperate A118-like prophage genes, thereby shedding light on the transcriptional profile of this bacteriophage during intracellular growth. In total, our study provides an updated genome-wide view of the transcriptional landscape of L. monocytogenes during intracellular growth and represents a rich resource for future detailed analysis.

  9. Removal of MS2, Qβ and GA bacteriophages during drinking water treatment at pilot scale.

    Science.gov (United States)

    Boudaud, Nicolas; Machinal, Claire; David, Fabienne; Fréval-Le Bourdonnec, Armelle; Jossent, Jérôme; Bakanga, Fanny; Arnal, Charlotte; Jaffrezic, Marie Pierre; Oberti, Sandrine; Gantzer, Christophe

    2012-05-15

    The removal of MS2, Qβ and GA, F-specific RNA bacteriophages, potential surrogates for pathogenic waterborne viruses, was investigated during a conventional drinking water treatment at pilot scale by using river water, artificially and independently spiked with these bacteriophages. The objective of this work is to develop a standard system for assessing the effectiveness of drinking water plants with respect to the removal of MS2, Qβ and GA bacteriophages by a conventional pre-treatment process (coagulation-flocculation-settling-sand filtration) followed or not by an ultrafiltration (UF) membrane (complete treatment process). The specific performances of three UF membranes alone were assessed by using (i) pre-treated water and (ii) 0.1 mM sterile phosphate buffer solution (PBS), spiked with bacteriophages. These UF membranes tested in this work were designed for drinking water treatment market and were also selected for research purpose. The hypothesis serving as base for this study was that the interfacial properties for these three bacteriophages, in terms of electrostatic charge and the degree of hydrophobicity, could induce variations in the removal performances achieved by drinking water treatments. The comparison of the results showed a similar behaviour for both MS2 and Qβ surrogates whereas it was particularly atypical for the GA surrogate. The infectious character of MS2 and Qβ bacteriophages was mostly removed after clarification followed by sand filtration processes (more than a 4.8-log reduction) while genomic copies were removed at more than a 4.0-log after the complete treatment process. On the contrary, GA bacteriophage was only slightly removed by clarification followed by sand filtration, with less than 1.7-log and 1.2-log reduction, respectively. After the complete treatment process achieved, GA bacteriophage was removed with less than 2.2-log and 1.6-log reduction, respectively. The effectiveness of the three UF membranes tested in terms of

  10. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  11. Interplay Between Bacteriophages and Restriction-Modification Systems in Enterococci

    Directory of Open Access Journals (Sweden)

    Pristas Peter

    2014-06-01

    Full Text Available The complete genomes of Enterococcus faecalis bacteriophages were analyzed for tetranucleotide words avoidance. Very similar tetranucleotide composition was found in all tested genomes with strong underrepresentation of palindromic GATC and GGCC words. This avoidance could be explained as a protection mechanism against host restriction-modification systems as a clear correlation was found between avoidance of palindromic words and the specificity of E. faecalis restriction and modification systems. No similar avoidance of tetranucleotide words was observed for non-palindromic words. A weak correlation was observed between avoidance of tetranucleotide palindromes in bacteriophage genomes and the possession of phage encoded DNA methyltransferases confirming the interrelation between bacteriophage genomes composition and restriction and modification systems in enterococci

  12. Quantifying strain variability in modeling growth of Listeria monocytogenes

    NARCIS (Netherlands)

    Aryani, D.; Besten, den H.M.W.; Hazeleger, W.C.; Zwietering, M.H.

    2015-01-01

    Prediction of microbial growth kinetics can differ from the actual behavior of the target microorganisms. In the present study, the impact of strain variability on maximum specific growth rate (µmax) (h- 1) was quantified using twenty Listeria monocytogenes strains. The µmax was determined as functi

  13. Interleukin-22-Induced Antimicrobial Phospholipase A2 Group IIA Mediates Protective Innate Immunity of Nonhematopoietic Cells against Listeria monocytogenes.

    Science.gov (United States)

    Okita, Yamato; Shiono, Takeru; Yahagi, Ayano; Hamada, Satoru; Umemura, Masayuki; Matsuzaki, Goro

    2015-12-07

    Listeria monocytogenes is a bacterial pathogen which establishes intracellular parasitism in various cells, including macrophages and nonhematopoietic cells, such as hepatocytes. It has been reported that several proinflammatory cytokines have pivotal roles in innate protection against L. monocytogenes infection. We found that a proinflammatory cytokine, interleukin 22 (IL-22), was expressed by CD3(+) CD4(+) T cells at an early stage of L. monocytogenes infection in mice. To assess the influence of IL-22 on L. monocytogenes infection in hepatocytes, cells of a human hepatocellular carcinoma line, HepG2, were treated with IL-22 before L. monocytogenes infection in vitro. Gene expression analysis of the IL-22-treated HepG2 cells identified phospholipase A2 group IIA (PLA2G2A) as an upregulated antimicrobial molecule. Addition of recombinant PLA2G2A to the HepG2 culture significantly suppressed L. monocytogenes infection. Culture supernatant of the IL-22-treated HepG2 cells contained bactericidal activity against L. monocytogenes, and the activity was abrogated by a specific PLA2G2A inhibitor, demonstrating that HepG2 cells secreted PLA2G2A, which killed extracellular L. monocytogenes. Furthermore, colocalization of PLA2G2A and L. monocytogenes was detected in the IL-22-treated infected HepG2 cells, which suggests involvement of PLA2G2A in the mechanism of intracellular killing of L. monocytogenes by HepG2 cells. These results suggest that IL-22 induced at an early stage of L. monocytogenes infection enhances innate immunity against L. monocytogenes in the liver by stimulating hepatocytes to produce an antimicrobial molecule, PLA2G2A.

  14. Isolation and Characterization of Bacteriophages Against Pseudomonas syringae pv. actinidiae Causing Bacterial Canker Disease in Kiwifruit.

    Science.gov (United States)

    Yu, Ji-Gang; Lim, Jeong-A; Song, Yu-Rim; Heu, Sunggi; Kim, Gyoung Hee; Koh, Young Jin; Oh, Chang-Sik

    2016-02-01

    Pseudomonas syringae pv. actinidiae causes bacterial canker disease in kiwifruit. Owing to the prohibition of agricultural antibiotic use in major kiwifruit-cultivating countries, alternative methods need to be developed to manage this disease. Bacteriophages are viruses that specifically infect target bacteria and have recently been reconsidered as potential biological control agents for bacterial pathogens owing to their specificity in terms of host range. In this study, we isolated bacteriophages against P. syringae pv. actinidiae from soils collected from kiwifruit orchards in Korea and selected seven bacteriophages for further characterization based on restriction enzyme digestion patterns of genomic DNA. Among the studied bacteriophages, two belong to the Myoviridae family and three belong to the Podoviridae family, based on morphology observed by transmission electron microscopy. The host range of the selected bacteriophages was confirmed using 18 strains of P. syringae pv. actinidiae, including the Psa2 and Psa3 groups, and some were also effective against other P. syringae pathovars. Lytic activity of the selected bacteriophages was sustained in vitro until 80 h, and their activity remained stable up to 50°C, at pH 11, and under UV-B light. These results indicate that the isolated bacteriophages are specific to P. syringae species and are resistant to various environmental factors, implying their potential use in control of bacterial canker disease in kiwifruits.

  15. Growth kinetics of Listeria monocytogenes and spoilage microorganisms in fresh-cut cantaloupe.

    Science.gov (United States)

    Fang, Ting; Liu, Yanhong; Huang, Lihan

    2013-05-01

    The main objective of this study was to investigate the growth kinetics of Listeria monocytogenes and background microorganisms in fresh-cut cantaloupe. Fresh-cut cantaloupe samples, inoculated with three main serotypes (1/2a, 1/2b, and 4b) of L. monocytogenes, were incubated at different temperatures, ranging from 4 to 43 °C, to develop kinetic growth models. During storage studies, the population of both background microorganisms and L. monocytogenes began to increase almost immediately, with little or no lag phase for most growth curves. All growth curves, except for two growth curves of L. monocytogenes 1/2a at 4 °C, developed to full curves (containing exponential and stationary phases), and can be described by a 3-parameter logistic model. There was no significant difference (P = 0.28) in the growth behaviors and the specific growth rates of three different serotypes of L. monocytogenes inoculated to fresh-cut cantaloupe. The effect of temperature on the growth of L. monocytogenes and spoilage microorganisms was evaluated using three secondary models. For L. monocytogenes, the minimum and maximum growth temperatures were estimated by both the Ratkowsky square-root and Cardinal parameter models, and the optimum temperature and the optimum specific growth rate by the Cardinal parameter model. An Arrhenius-type model provided more accurate estimation of the specific growth rate of L. monocytogenes at temperatures <4 °C. The kinetic models developed in this study can be used by regulatory agencies and food processors for conducting risk assessment of L. monocytogenes in fresh-cut cantaloupe, and for estimating the shelf-life of fresh-cut products.

  16. Membrane filtration immobilization technique-a simple and novel method for primary isolation and enrichment of bacteriophages.

    Science.gov (United States)

    Ghugare, G S; Nair, A; Nimkande, V; Sarode, P; Rangari, P; Khairnar, K

    2017-02-01

    To develop a method for the isolation and enrichment of bacteriophages selectively against specific bacteria coupled with a membrane filtration technique. Rapid isolation and concentration of host-specific bacteriophages was achieved by exposure of the sample suspected to contain bacteriophages to a specific host immobilized on a 0·45 μm membrane in a membrane filtration unit. The principle behind this method is the exploitation of host-specific interaction of bacteriophages with their host and maximizing this interaction using a classic membrane filtration method. This provides a chance for each bacteriophage in the sample to interact with the specific host on the membrane filter fitted with a vacuum pump. Specific bacteriophages of the host are retained on the membrane along with its host cells due to the effect of adsorption and these adsorbed bacteriophages (along with their hosts) on the filter disc are then amplified and enriched in regular nutritive broth tryptose soya broth by incubation. With the help of the plaque assay method, host-specific phages of various bacterial species were isolated, segregated and enriched. The phage concentration method coupled with membrane filtration immobilization of host bacteria was able to isolate and enrich the host-specific bacteriophages by several fold using a lower quantity of an environmental water sample, or other phage suspensions. Enrichment of phages from single plaques was also achieved. The isolation and detection of host-specific bacteriophages from a low density bacteriophage water sample in a single step by the use of a simple and basic microbiological technique can be achieved. Enrichment of phages from low phage titre suspensions is also achieved very effectively. © 2016 The Society for Applied Microbiology.

  17. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin

    2017-01-01

    -supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more...

  18. MHC class Jb-restricted cell responses to Listeria monocytogenes infection.

    Science.gov (United States)

    Kerksiek, K M; Pamer, E G

    1999-12-01

    Murine infection with Listeria monocytogenes induces CD8+ T cell responses specific for bacterial peptides that are presented on the infected cell surface by MHC class Ia and MHC class Ib molecules. We have used MHC tetramers to demonstrate that CD8+ T cells restricted by the H2-M3 MHC class Ib molecules constitute a substantial portion of the T cell response to L. monocytogenes infection. The in vivo size and kinetics of MHC class Ib-restricted T cell populations suggests that they play a prominent role in bacterial clearance following primary L. monocytogenes infection.

  19. Bacteriophages to reduce gut carriage of antibiotic resistant uropathogens with low impact on microbiota composition.

    Science.gov (United States)

    Galtier, Matthieu; De Sordi, Luisa; Maura, Damien; Arachchi, Harindra; Volant, Stevenn; Dillies, Marie-Agnès; Debarbieux, Laurent

    2016-07-01

    Uropathogenic Escherichia coli (UPEC) is the leading cause of urinary tract infections (UTIs) worldwide, causing over 150 million clinical cases annually. There is currently no specific treatment addressing the asymptomatic carriage in the gut of UPEC before they initiate UTIs. This study investigates the efficacy of virulent bacteriophages to decrease carriage of gut pathogens. Three virulent bacteriophages infecting an antibiotic-resistant UPEC strain were isolated and characterized both in vitro and in vivo. A new experimental murine model of gut carriage of E. coli was elaborated and the impact of virulent bacteriophages on colonization levels and microbiota diversity was assessed. A single dose of a cocktail of the three bacteriophages led to a sharp decrease in E. coli levels throughout the gut. We also observed that microbiota diversity was much less affected by bacteriophages than by antibiotics. Therefore, virulent bacteriophages can efficiently target UPEC strains residing in the gut, with potentially profound public health and economic impacts. These results open a new area with the possibility to manipulate specifically the microbiota using virulent bacteriophages, which could have broad applications in many gut-related disorders/diseases and beyond.

  20. Bacteriophage recombination systems and biotechnical applications.

    Science.gov (United States)

    Nafissi, Nafiseh; Slavcev, Roderick

    2014-04-01

    Bacteriophage recombination systems have been widely used in biotechnology for modifying prokaryotic species, for creating transgenic animals and plants, and more recently, for human cell gene manipulation. In contrast to homologous recombination, which benefits from the endogenous recombination machinery of the cell, site-specific recombination requires an exogenous source of recombinase in mammalian cells. The mechanism of bacteriophage evolution and their coexistence with bacterial cells has become a point of interest ever since bacterial viruses' life cycles were first explored. Phage recombinases have already been exploited as valuable genetic tools and new phage enzymes, and their potential application to genetic engineering and genome manipulation, vectorology, and generation of new transgene delivery vectors, and cell therapy are attractive areas of research that continue to be investigated. The significance and role of phage recombination systems in biotechnology is reviewed in this paper, with specific focus on homologous and site-specific recombination conferred by the coli phages, λ, and N15, the integrase from the Streptomyces phage, ΦC31, the recombination system of phage P1, and the recently characterized recombination functions of Yersinia phage, PY54. Key steps of the molecular mechanisms involving phage recombination functions and their application to molecular engineering, our novel exploitations of the PY54-derived recombination system, and its application to the development of new DNA vectors are discussed.

  1. Effect of gamma irradiation on bacteriophages used as viral indicators.

    Science.gov (United States)

    Jebri, Sihem; Hmaied, Fatma; Jofre, Juan; MariemYahya; Mendez, Javier; Barkallah, Insaf; Hamdi, Moktar

    2013-07-01

    This study aimed to examine the susceptibility of indicator bacteriophages towards γ-radiation to evaluate their appropriateness as viral indicators for water quality control. The effects of γ-radiation on naturally occurring somatic coliphages, F-specific coliphages and Escherichia coli were examined in raw sewage and sewage sludge. As well, the effects of radiation on bacteriophages ΦX174 and MS2, and E. coli all grown in the laboratory and seeded in distilled water, autoclaved raw sewage and a 1% peptone solution were evaluated. The inactivation of E. coli was fairly similar in all matrices. In contrast, inactivation of bacteriophages was significantly greater in distilled water than in the other matrices. These results showed the great influence of the matrix characteristics on virus inactivation. Somatic coliphages in raw sewage and sewage sludge and ΦX174 in autoclaved sewage were inactivated similarly and were far more resistant than F-specific coliphages, MS2 and E. coli. As well, F-specific RNA bacteriophages in raw sewage and sewage sludge and MS2 in autoclaved sewage were inactivated similarly and were more resistant than E. coli. In contrast, MS2 was more susceptible to γ-radiation than E. coli in distilled water. Our results showed that ΦX174 is a suitable indicator for estimating virus inactivation by γ-irradiation and corroborate the use of somatic coliphages to survey the viral quality of treated water and sludges.

  2. Construction of specific erythromycin resistance mutations in the temperate lactococcal bacteriophage TP901-1 and their use in studies of phage biology

    DEFF Research Database (Denmark)

    Koch, Birgit; Christiansen, Bettina; Evison, Tim;

    1997-01-01

    A method for the construction and isolation of specifically designed mutations of the temperate lactococcal phage TP901-1 has been developed. Two different erm-labeled mutants were isolated. One was shown to be defective in lysogenization and excision. The other, showing normal lysogenization, wa...

  3. Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Hammer, Karin

    1999-01-01

    Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...

  4. Virulence reduction in Bacteriophage resistant bacteria

    Directory of Open Access Journals (Sweden)

    Marcela eLeón

    2015-04-01

    Full Text Available Bacteriophages can influence the abundance, diversity and evolution of bacterial communities. Several bacteriophages have been reported to add virulence factors to their host and to increase bacterial virulence. However, lytic bacteriophages can also exert a selective pressure allowing the proliferation of strains with reduced virulence. This reduction can be explained because bacteriophages use structures present on the bacterial surface as receptors, which can be virulence factors in different bacterial species. Therefore, strains with modifications in these receptors will be resistant to bacteriophage infection and may also exhibit reduced virulence. This mini-review summarizes the reports on bacteriophage-resistant strains with reductions in virulence, and it discusses the potential consequences in phage therapy and in the use of bacteriophages to select attenuated strains for vaccines.

  5. Optimizing the European regulatory framework for sustainable bacteriophage therapy in human medicine.

    Science.gov (United States)

    Verbeken, Gilbert; Pirnay, Jean-Paul; De Vos, Daniel; Jennes, Serge; Zizi, Martin; Lavigne, Rob; Casteels, Minne; Huys, Isabelle

    2012-06-01

    For practitioners at hospitals seeking to use natural (not genetically modified, as appearing in nature) bacteriophages for treatment of antibiotic-resistant bacterial infections (bacteriophage therapy), Europe's current regulatory framework for medicinal products hinders more than it facilitates. Although many experts consider bacteriophage therapy to be a promising complementary (or alternative) treatment to antibiotic therapy, no bacteriophage-specific framework for documentation exists to date. Decades worth of historical clinical data on bacteriophage therapy (from Eastern Europe, particularly Poland, and the former Soviet republics, particularly Georgia and Russia, as well as from today's 27 EU member states and the US) have not been taken into account by European regulators because these data have not been validated under current Western regulatory standards. Consequently, applicants carrying out standard clinical trials on bacteriophages in Europe are obliged to initiate clinical work from scratch. This paper argues for a reduced documentation threshold for Phase 1 clinical trials of bacteriophages and maintains that bacteriophages should not be categorized as classical medicinal products for at least two reasons: (1) such a categorization is scientifically inappropriate for this specific therapy and (2) such a categorization limits the marketing authorization process to industry, the only stakeholder with sufficient financial resources to prepare a complete dossier for the competent authorities. This paper reflects on the current regulatory framework for medicines in Europe and assesses possible regulatory pathways for the (re-)introduction of bacteriophage therapy in a way that maintains its effectiveness and safety as well as its inherent characteristics of sustainability and in situ self-amplification and limitation.

  6. Bacteriophages Limit the Existence Conditions for Conjugative Plasmids

    Science.gov (United States)

    Wood, A. Jamie; Dytham, Calvin; Pitchford, Jonathan W.; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A.

    2015-01-01

    ABSTRACT Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. PMID:26037122

  7. Pulmonary bacteriophage therapy on Pseudomonas aeruginosa cystic fibrosis strains: first steps towards treatment and prevention.

    Directory of Open Access Journals (Sweden)

    Eric Morello

    Full Text Available Multidrug-resistant bacteria are the cause of an increasing number of deadly pulmonary infections. Because there is currently a paucity of novel antibiotics, phage therapy--the use of specific viruses that infect bacteria--is now more frequently being considered as a potential treatment for bacterial infections. Using a mouse lung-infection model caused by a multidrug resistant Pseudomonas aeruginosa mucoid strain isolated from a cystic fibrosis patient, we evaluated bacteriophage treatments. New bacteriophages were isolated from environmental samples and characterized. Bacteria and bacteriophages were applied intranasally to the immunocompetent mice. Survival was monitored and bronchoalveolar fluids were analysed. Quantification of bacteria, bacteriophages, pro-inflammatory and cytotoxicity markers, as well as histology and immunohistochemistry analyses were performed. A curative treatment (one single dose administrated 2 h after the onset of the infection allowed over 95% survival. A four-day preventive treatment (one single dose resulted in a 100% survival. All of the parameters measured correlated with the efficacy of both curative and preventive bacteriophage treatments. We also showed that in vitro optimization of a bacteriophage towards a clinical strain improved both its efficacy on in vivo treatments and its host range on a panel of 20 P. aeruginosa cystic fibrosis strains. This work provides an incentive to develop clinical studies on pulmonary bacteriophage therapy to combat multidrug-resistant lung infections.

  8. Pulmonary bacteriophage therapy on Pseudomonas aeruginosa cystic fibrosis strains: first steps towards treatment and prevention.

    Science.gov (United States)

    Morello, Eric; Saussereau, Emilie; Maura, Damien; Huerre, Michel; Touqui, Lhousseine; Debarbieux, Laurent

    2011-02-15

    Multidrug-resistant bacteria are the cause of an increasing number of deadly pulmonary infections. Because there is currently a paucity of novel antibiotics, phage therapy--the use of specific viruses that infect bacteria--is now more frequently being considered as a potential treatment for bacterial infections. Using a mouse lung-infection model caused by a multidrug resistant Pseudomonas aeruginosa mucoid strain isolated from a cystic fibrosis patient, we evaluated bacteriophage treatments. New bacteriophages were isolated from environmental samples and characterized. Bacteria and bacteriophages were applied intranasally to the immunocompetent mice. Survival was monitored and bronchoalveolar fluids were analysed. Quantification of bacteria, bacteriophages, pro-inflammatory and cytotoxicity markers, as well as histology and immunohistochemistry analyses were performed. A curative treatment (one single dose) administrated 2 h after the onset of the infection allowed over 95% survival. A four-day preventive treatment (one single dose) resulted in a 100% survival. All of the parameters measured correlated with the efficacy of both curative and preventive bacteriophage treatments. We also showed that in vitro optimization of a bacteriophage towards a clinical strain improved both its efficacy on in vivo treatments and its host range on a panel of 20 P. aeruginosa cystic fibrosis strains. This work provides an incentive to develop clinical studies on pulmonary bacteriophage therapy to combat multidrug-resistant lung infections.

  9. Neuroinfections due to Listeria monocytogenes.

    Science.gov (United States)

    Streharova, A; Babjakova, A; Moravcikova, A; Harnicarova, A; Holeckova, K; Lesnakova, A; Sladeckova, V; Seckova, S; Kisac, P; Beno, P

    2007-11-01

    Listeria monocytogenes is not a rare pathogen causing meningitis, mainly in small children and in close contacts to livestock. The pathogen is naturally resistant to cephalosporins and some glycopeptides as well, therefore despite of syndromologic diagnosis of meningitis and initial therapy with 3rd generation cephalosporins according to the guidelines therapeutic failures with clinical consequences may occur.

  10. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products

    DEFF Research Database (Denmark)

    Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas

    2017-01-01

    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the ....... monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. (C) 2017 Elsevier Ltd. All rights reserved....

  11. Presence of Listeria monocytogenes in silage products of Shahrekord city

    Directory of Open Access Journals (Sweden)

    Ali Sharifzadeh

    2015-06-01

    Full Text Available Objective: To investigate the presence of Listeria monocytogenes in the silage samples. Methods: Silage samples obtained from 150 different farms in Shahrekord city (Iran and after DNA extraction, all samples were analyzed by PCR technique using one pair of primers for presence of this pathogen. The amplified products were detected on 1.5% agarose gel electrophoresis. Results: Listeria monocytogenes was isolated in 4 (2% of the 150 samples. The detection of this bacterium from silage samples in Shahrekord city indicated that these products could create a serious risk in public health of animal and human. The findings showed that in positive silage samples for Listeria monocytogenes, the pH value was about five and it was due to bacterial activity in these products. Conclusions: The quality of silage and hygiene parameters and good herd health management play an important role in the microbiological quality of herd and farm. Considering the high specificity and sensitivity of the employed PCR technique, it is recommended to be useful technique for identification of Listeria monocytogenes.

  12. Bacteriophage endolysins as novel antimicrobials

    Science.gov (United States)

    Endolysins are enzymes used by bacteriophages at the end of their replication cycle to degrade the peptidoglycan of the bacterial host from within, resulting in cell lysis and release of progeny virions. Due to the absence of an outer membrane in the Gram-positive bacterial cell wall, endolysins can...

  13. Bacteriophage: from exploration to exploitation

    NARCIS (Netherlands)

    Nobrega, Franklin L.

    2017-01-01

    Over the past decades, bacteriophage research has revealed the abundance of phages in nature, their morphological and genomic diversity, their influence in the regulation of microbial balance in the ecosystem and their impact on the evolution of microbial diversity. Since the 1950s, phages have also

  14. Bacteriophage therapy in animal production

    Science.gov (United States)

    Concerns over the consequences of bacterial resistance to antibiotics with the use of antibiotics in animal production have led to an increase in research on alternatives to antibiotics. Bacteriophages kill bacteria, are natural, safe, plentiful, self replicating, self limiting, can be used to spec...

  15. Metagenomic analysis of dairy bacteriophages

    DEFF Research Database (Denmark)

    Muhammed, Musemma Kedir; Kot, Witold Piotr; Neve, Horst

    2017-01-01

    Despite their huge potential for characterizing the biodiversity of phages, metagenomic studies are currently not available for dairy bacteriophages, partly due to the lack of a standard procedure for phage extraction. We optimized an extraction method that allows to remove the bulk protein from...

  16. Bacteriophage: from exploration to exploitation

    NARCIS (Netherlands)

    Nobrega, Franklin L.

    2017-01-01

    Over the past decades, bacteriophage research has revealed the abundance of phages in nature, their morphological and genomic diversity, their influence in the regulation of microbial balance in the ecosystem and their impact on the evolution of microbial diversity. Since the 1950s, phages have also

  17. Nanoscale bacteriophage biosensors beyond phage display

    Directory of Open Access Journals (Sweden)

    Lee JW

    2013-10-01

    Full Text Available Jong-Wook Lee,1 Jangwon Song,1,2 Mintai P Hwang,1 Kwan Hyi Lee1,2 1Center for Biomaterials, Biomedical Research Institute, Korea Institute of Science and Technology, Seoul, Korea; 2Department of Biomedical Engineering, University of Science and Technology, Seoul, Korea Abstract: Bacteriophages are traditionally used for the development of phage display technology. Recently, their nanosized dimensions and ease with which genetic modifications can be made to their structure and function have put them in the spotlight towards their use in a variety of biosensors. In particular, the expression of any protein or peptide on the extraluminal surface of bacteriophages is possible by genetically engineering the genome. In addition, the relatively short replication time of bacteriophages offers researchers the ability to generate mass quantities of any given bacteriophage-based biosensor. Coupled with the emergence of various biomarkers in the clinic as a means to determine pathophysiological states, the development of current and novel technologies for their detection and quantification is imperative. In this review, we categorize bacteriophages by their morphology into M13-based filamentous bacteriophages and T4- or T7-based icosahedral bacteriophages, and examine how such advantages are utilized across a variety of biosensors. In essence, we take a comprehensive approach towards recent trends in bacteriophage-based biosensor applications and discuss their outlook with regards to the field of biotechnology. Keywords: biosensing, M13 bacteriophage, T4 bacteriophage, bacterial detection, Escherichia coli, SPR sensor

  18. Molecular studies on bacteriophage endolysins and their potential to control gram-negative bacteria

    OpenAIRE

    Oliveira, Hugo Alexandre Mendes

    2014-01-01

    Thesis for PhD degree in Chemical and Biological Engineeering Bacteriophages are viruses that specifically infect bacterial hosts to reproduce. At the end of the infection cycle, progeny virions are confronted with a rigid cell wall that impedes their release into the environment. Consequently, bacteriophages encode hydrolytic enzymes, called endolysins, to digest the peptidoglycan and cause bacteriolysis. In contrast to their extensively studied counterparts, active against Gram-positi...

  19. Complete Genome Sequences of Five Bacteriophages That Infect Rhodobacter capsulatus.

    Science.gov (United States)

    Bollivar, David W; Bernardoni, Brooke; Bockman, Matthew R; Miller, Brenda M; Russell, Daniel A; Delesalle, Veronique A; Krukonis, Gregory P; Hatfull, Graham F; Cross, Madeline R; Szewczyk, Marlena M; Eppurath, Atul

    2016-05-26

    Five bacteriophages that infect the Rhodobacter capsulatus strain YW1 were isolated from stream water near Bloomington, Illinois, USA. Two distinct genome types are represented in the newly isolated bacteriophages. These genomes are different from other bacteriophage genomes previously described.

  20. Bacteriophages and their role in food safety.

    Science.gov (United States)

    Sillankorva, Sanna M; Oliveira, Hugo; Azeredo, Joana

    2012-01-01

    The interest for natural antimicrobial compounds has increased due to alterations in consumer positions towards the use of chemical preservatives in foodstuff and food processing surfaces. Bacteriophages fit in the class of natural antimicrobial and their effectiveness in controlling bacterial pathogens in agro-food industry has led to the development of different phage products already approved by USFDA and USDA. The majority of these products are to be used in farm animals or animal products such as carcasses, meats and also in agricultural and horticultural products. Treatment with specific phages in the food industry can prevent the decay of products and the spread of bacterial diseases and ultimately promote safe environments in animal and plant food production, processing, and handling. This is an overview of recent work carried out with phages as tools to promote food safety, starting with a general introduction describing the prevalence of foodborne pathogens and bacteriophages and a more detailed discussion on the use of phage therapy to prevent and treat experimentally induced infections of animals against the most common foodborne pathogens, the use of phages as biocontrol agents in foods, and also their use as biosanitizers of food contact surfaces.

  1. Bacteriophages and Their Role in Food Safety

    Directory of Open Access Journals (Sweden)

    Sanna M. Sillankorva

    2012-01-01

    Full Text Available The interest for natural antimicrobial compounds has increased due to alterations in consumer positions towards the use of chemical preservatives in foodstuff and food processing surfaces. Bacteriophages fit in the class of natural antimicrobial and their effectiveness in controlling bacterial pathogens in agro-food industry has led to the development of different phage products already approved by USFDA and USDA. The majority of these products are to be used in farm animals or animal products such as carcasses, meats and also in agricultural and horticultural products. Treatment with specific phages in the food industry can prevent the decay of products and the spread of bacterial diseases and ultimately promote safe environments in animal and plant food production, processing, and handling. This is an overview of recent work carried out with phages as tools to promote food safety, starting with a general introduction describing the prevalence of foodborne pathogens and bacteriophages and a more detailed discussion on the use of phage therapy to prevent and treat experimentally induced infections of animals against the most common foodborne pathogens, the use of phages as biocontrol agents in foods, and also their use as biosanitizers of food contact surfaces.

  2. Multiple roles of genome-attached bacteriophage terminal proteins

    Energy Technology Data Exchange (ETDEWEB)

    Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

    2014-11-15

    Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.

  3. Antimicrobial Tolerance in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Curtis, Thomas Darwin

    There are two ways in which bacteria survive killing by antibiotics. The most well-known, is antibiotic resistance, which results from the acquisition of a resistance gene or mutation that allows bacteria to grow and divide in the presence of antibiotic concentrations that would normally kill other...... that are completely refractory to antibiotics due to the inactivity of cellular processes. Persister cells have been linked to treatment failures in several bacterial infections including Mycobacterium tuberculosis, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. Preceding the start of this Ph......D project, Listeria monocytogenes was observed to form these antibiotic tolerant persister cells. L. monocytogenes is a Gram-positive, foodborne pathogen that causes listeriosis, a rare, but often lethal disease, even with antibiotic treatment. It typically affects pregnant women, neonates, the elderly...

  4. Bacteriophage-based therapy in cystic fibrosis-associated Pseudomonas aeruginosa infections: rationale and current status

    Science.gov (United States)

    Hraiech, Sami; Brégeon, Fabienne; Rolain, Jean-Marc

    2015-01-01

    Pulmonary infections involving Pseudomonas aeruginosa are among the leading causes of the deterioration of the respiratory status of cystic fibrosis (CF) patients. The emergence of multidrug-resistant strains in such populations, favored by iterative antibiotic cures, has led to the urgent need for new therapies. Among them, bacteriophage-based therapies deserve a focus. One century of empiric use in the ex-USSR countries suggests that bacteriophages may have beneficial effects against a large range of bacterial infections. Interest in bacteriophages has recently renewed in Western countries, and the in vitro data available suggest that bacteriophage-based therapy may be of significant interest for the treatment of pulmonary infections in CF patients. Although the clinical data concerning this specific population are relatively scarce, the beginning of the first large randomized study evaluating bacteriophage-based therapy in burn infections suggests that the time has come to assess the effectiveness of this new therapy in CF P. aeruginosa pneumonia. Consequently, the aim of this review is, after a brief history, to summarize the evidence concerning bacteriophage efficacy against P. aeruginosa and, more specifically, the in vitro studies, animal models, and clinical trials targeting CF. PMID:26213462

  5. Bacteriophage-based therapy in cystic fibrosis-associated Pseudomonas aeruginosa infections: rationale and current status.

    Science.gov (United States)

    Hraiech, Sami; Brégeon, Fabienne; Rolain, Jean-Marc

    2015-01-01

    Pulmonary infections involving Pseudomonas aeruginosa are among the leading causes of the deterioration of the respiratory status of cystic fibrosis (CF) patients. The emergence of multidrug-resistant strains in such populations, favored by iterative antibiotic cures, has led to the urgent need for new therapies. Among them, bacteriophage-based therapies deserve a focus. One century of empiric use in the ex-USSR countries suggests that bacteriophages may have beneficial effects against a large range of bacterial infections. Interest in bacteriophages has recently renewed in Western countries, and the in vitro data available suggest that bacteriophage-based therapy may be of significant interest for the treatment of pulmonary infections in CF patients. Although the clinical data concerning this specific population are relatively scarce, the beginning of the first large randomized study evaluating bacteriophage-based therapy in burn infections suggests that the time has come to assess the effectiveness of this new therapy in CF P. aeruginosa pneumonia. Consequently, the aim of this review is, after a brief history, to summarize the evidence concerning bacteriophage efficacy against P. aeruginosa and, more specifically, the in vitro studies, animal models, and clinical trials targeting CF.

  6. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  7. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  8. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  10. Rapid and sensitive detection of Listeria monocytogenes by loop-mediated isothermal amplification.

    Science.gov (United States)

    Tang, Meng-Jun; Zhou, Sheng; Zhang, Xiao-Yan; Pu, Jun-Hua; Ge, Qing-Lian; Tang, Xiu-Jun; Gao, Yu-Shi

    2011-12-01

    Loop-mediated isothermal amplification (LAMP) was designed for detection of Listeria monocytogenes, which is an important food-borne kind of pathogenic bacteria causing human and animal disease. The primers set for the hlyA gene consist of six primers targeting eight regions on specific gene. The LAMP assay could be performed within 40 min at 65°C in a water bath. Amplification products were visualized by calcein and manganous ion and agarose gel electrophoresis. Sensitivity of the LAMP assay for detection of L. monocytogenes in pure cultures was 2.0 CFU per reaction. The LAMP assay was 100-fold higher sensitive than that of the conventional PCR assay. Taking this way, 60 chicken samples were investigated for L. monocytogenes. The accuracy of LAMP was shown to be 100% when compared to the "gold standard" culture-biotechnical, while the PCR assay failed to detect L. monocytogenes in two of the positive samples. It is shown that LAMP assay can be used as a sensitive, rapid, and simple detection tool for the detection of L. monocytogenes and will facilitate the surveillance for contamination of L. monocytogenes in food.

  11. BACTERIOPHAGE ENDOLYSINS AND THEIR USE IN BIOTECHNOLOGICAL PROCESSES

    Directory of Open Access Journals (Sweden)

    Lenka Tišáková

    2014-02-01

    Full Text Available Bacteriophage endolysins are peptidoglycan hydrolases, produced in the lytic system of bacteriophage in order to lyse host peptidoglycan from within and release virions into the environment. Phages infecting Gram-positive bacteria express endolysin genes with the characteristic modular structure, consisting of at least two functional domains: N-terminal enzymatically active domain (EAD and C-terminal cell wall binding domain (CBD. CBDs specifically recognize ligands and bind to the bacterial cell wall, whereas EAD catalyze lysis of the peptidoglycan bonds. The reveal of endolysin modular structure leads to new opportunities for domain swapping, construction of chimeras and production of specifically engineered recombinant endolysins and their functional domains with the diverse biotechnological applications from without, such as in detection, elimination and biocontrol of pathogens, or as anti-bacterials in experimental therapy.

  12. Phage therapy: assessment of the efficacy of a bacteriophage isolated in the treatment of salmonellosis induced by Salmonella enteritidis in mice.

    Science.gov (United States)

    Nikkhahi, Farhad; Soltan Dallal, Mohammad Mehdi; Alimohammadi, Mahmood; Rahimi Foroushani, Abbas; Rajabi, Zahra; Fardsanei, Fatemeh; Imeni, Seyed Mostafa; Torabi Bonab, Parisa

    2017-01-01

    This work aims to isolate and perform comparative studies of a phages active against a Salmonella enteritidis strain from Iran. Also, suitable phage candidates for therapy of mice will be selected. Bacteriophage is of particular interest as a biocontrol agent in the prevention of food-borne illnesses. In recent years tend to use bacteriophages to control pathogenic bacteria has increased. A bacteriophage is considered to be a potent antibiotic alternative for treating bacterial infections. the specific phages against Salmonella Enteritidis was isolated and candidates for therapy of mice will be selected. Mouses divided into the six specific groups. Groups of mice were as follows: A: Bacteri (control) B: Bacteri+ bacteriophage (Simultaneous), C: Bacteri + bacteriophage Four days later, D: Bacteriophage + bacteri four days later E: Bacteri+ Ciprofloxacin (Simultaneous) F: Bacteri+ ciprofloxacin+ bacteriophage (Simultaneous). In this study, a lytic bacteriophage is isolated and it shows that phage has a head size of 46 nm and without a tail, by using an electron microscope. Oral administration of a single dose of 2 × 109 PFU/mouse bacteriophage enable to protect mouse against salmonellosis and it causes treatment of salmonellosis in mice. The use of this phage compared to ciprofloxacin shows that in addition of the treatment of mouse, it also prevents weight loss.

  13. Bacteriophages as Bactericides in Plant Protection

    Directory of Open Access Journals (Sweden)

    Aleksa Obradović

    2009-01-01

    Full Text Available Control of plant pathogenic bacteria is a serious problem in production of many agricultural crops. High multiplication rate, adaptability and life inside plant tissue make bacteria unsuitable and inaccessible for most of control measures. Consequently, the list of bactericides available for plant protection is very short. Lately, biological control measures have been intensively studied as a potential solution of the problem. Investigation of bacteriophages,viruses that attack bacteria, is a fast-expanding area of research in plant protection. Several experiments have shown that they can be used as a very efficient tool for control of plant pathogenic bacteria. The fact that they are widespread natural bacterial enemies, simple for cultivation and management, host-specific, suitable for integration with other control practices, human and environment friendly, provide a great advantage for the application of phages over other bactericides.

  14. An Ensemble Method to Distinguish Bacteriophage Virion from Non-Virion Proteins Based on Protein Sequence Characteristics

    Directory of Open Access Journals (Sweden)

    Lina Zhang

    2015-09-01

    Full Text Available Bacteriophage virion proteins and non-virion proteins have distinct functions in biological processes, such as specificity determination for host bacteria, bacteriophage replication and transcription. Accurate identification of bacteriophage virion proteins from bacteriophage protein sequences is significant to understand the complex virulence mechanism in host bacteria and the influence of bacteriophages on the development of antibacterial drugs. In this study, an ensemble method for bacteriophage virion protein prediction from bacteriophage protein sequences is put forward with hybrid feature spaces incorporating CTD (composition, transition and distribution, bi-profile Bayes, PseAAC (pseudo-amino acid composition and PSSM (position-specific scoring matrix. When performing on the training dataset 10-fold cross-validation, the presented method achieves a satisfactory prediction result with a sensitivity of 0.870, a specificity of 0.830, an accuracy of 0.850 and Matthew’s correlation coefficient (MCC of 0.701, respectively. To evaluate the prediction performance objectively, an independent testing dataset is used to evaluate the proposed method. Encouragingly, our proposed method performs better than previous studies with a sensitivity of 0.853, a specificity of 0.815, an accuracy of 0.831 and MCC of 0.662 on the independent testing dataset. These results suggest that the proposed method can be a potential candidate for bacteriophage virion protein prediction, which may provide a useful tool to find novel antibacterial drugs and to understand the relationship between bacteriophage and host bacteria. For the convenience of the vast majority of experimental Int. J. Mol. Sci. 2015, 16 21735 scientists, a user-friendly and publicly-accessible web-server for the proposed ensemble method is established.

  15. Isolation, characterization, and application of bacteriophages for Salmonella spp. biocontrol in pigs.

    Science.gov (United States)

    Albino, Luiz A A; Rostagno, Marcos H; Húngaro, Humberto M; Mendonça, Regina C S

    2014-08-01

    Foodborne illness due to Salmonella-contaminated pork products is an important public health problem, causing significant economic losses worldwide. The use of bacteriophages is a potential intervention tool that has attracted interest for the control of foodborne pathogens. The objective of this study was to detect the presence of Salmonella in commercial pig farms and to isolate specific autochthonous bacteriophages against Salmonella Typhimurium, to characterize them and to evaluate their lytic capacity against Salmonella Typhimurium in vivo and in vitro. Salmonella was isolated on 50% (4/8) of the farms, with serotype Typhimurium being the most prevalent, detected in 48.2% of samples (13/27). The isolated Salmonella Typhimurium bacteriophages belong to the Podoviridae family, were active against serotypes Abony, Enteritidis, Typhi, and Typhimurium, but not against serotypes Arizonae, Cholerasuis, Gallinarum, and Pullorum. In in vitro tests, bacteriophage at 10(7) PFU/mL and 10(9) PFU/mL significantly reduced (pbacteriophages, Salmonella was identified in 93.3% (28/30) of the fecal samples from the pigs inoculated with 10(6) CFU/mL, and only in 56.6% (17/30) after the treatment consisting of oral administration of the pool of the bacteriophages after the fasting period, simulating a common preslaughter practice. These results indicate that the pool of bacteriophages administered was capable of reducing the colonization of Salmonella in pigs.

  16. Detection of Bacterial Wilt Pathogen and Isolation of Its Bacteriophage from Banana in Lumajang Area, Indonesia

    Directory of Open Access Journals (Sweden)

    Hardian Susilo Addy

    2016-01-01

    Full Text Available Bacterial wilt disease on banana is an important disease in Lumajang District and causes severe yield loss. Utilizing bacteriophage as natural enemy of pathogenic bacteria has been widely known as one of the control strategies. This research was aimed at determining the causing agent of bacterial wilt on banana isolated from Lumajang area, to obtain wide-host range bacteriophages against bacterial wilt pathogen and to know the basic characteristic of bacteriophages, particularly its nucleic acid type. Causative agent of bacterial wilt was isolated from symptomatic banana trees from seven districts in Lumajang area on determinative CPG plates followed by rapid detection by PCR technique using specific pair-primer. Bacteriophages were also isolated from soil of infected banana crop in Sukodono District. Morphological observation showed that all bacterial isolates have similar characteristic as common bacterial wilt pathogen, Ralstonia solanacearum. In addition, detection of FliC region in all isolates confirmed that all isolates were R. solanacearum according to the presence of 400 bp of FliC DNA fragment. Moreover, two bacteriophages were obtained from this experiment (ϕRSSKD1 and ϕRSSKD2, which were able to infect all nine R. solanacearum isolates. Nucleic acid analysis showed that the nucleic acid of bacteriophages was DNA (deoxyribonucleic acid.

  17. Characterization and Detection of Endolysin Gene from Three Acinetobacter baumannii Bacteriophages Isolated from Sewage Water.

    Science.gov (United States)

    Kitti, Thawatchai; Thummeepak, Rapee; Thanwisai, Aunchalee; Boonyodying, Kamala; Kunthalert, Duangkamol; Ritvirool, Pannika; Sitthisak, Sutthirat

    2014-12-01

    Acinetobacter baumannii is an opportunistic pathogen that exists in hospital environments. The emergence of multidrug resistant A. baumannii (MDRAB) has been reported worldwide. It is necessary to find a novel and effective treatment for MDRAB infection. In this study, three bacteriophages, designated as ØABP-01, ØABP-02 and ØABP-04 were selected for analysis. Transmission electron microscopy showed that bacteriophage ØABP-01 belonged to the Podoviridae family and bacteriophage ØABP-02 and ØABP-04 are classified into the family Myoviridae. ØABP-01 had the widest host range. ØABP-01, ØABP-02 and ØABP-04 exhibited a latent period of 15, 20 and 20 min. The burst sizes of the three bacteriophages were 110, 120 and 150 PFU/cell. DNA restriction analysis using EcoRI, HindIII, PstI, SphI, BamHI and SmaI showed different DNA fragment patterns between the three bacteriophages. ØABP-01 and ØABP-04 was positive for the endolysin gene as determined by PCR. In conclusion, bacteriophage ØABP-01 showed broad host-specificity, good lytic activity and a short latency period, making it an appropriate candidate for studying the control and diagnosis associated with MDRAB infections.

  18. A simple and novel modification of comet assay for determination of bacteriophage mediated bacterial cell lysis.

    Science.gov (United States)

    Khairnar, Krishna; Sanmukh, Swapnil; Chandekar, Rajshree; Paunikar, Waman

    2014-07-01

    The comet assay is the widely used method for in vitro toxicity testing which is also an alternative to the use of animal models for in vivo testing. Since, its inception in 1984 by Ostling and Johansson, it is being modified frequently for a wide range of application. In spite of its wide applicability, unfortunately there is no report of its application in bacteriophages research. In this study, a novel application of comet assay for the detection of bacteriophage mediated bacterial cell lysis was described. The conventional methods in bacteriophage research for studying bacterial lysis by bacteriophages are plaque assay method. It is time consuming, laborious and costly. The lytic activity of bacteriophage devours the bacterial cell which results in the release of bacterial genomic material that gets detected by ethidium bromide staining method by the comet assay protocol. The objective of this study was to compare efficacy of comet assay with different assay used to study phage mediated bacterial lysis. The assay was performed on culture isolates (N=80 studies), modified comet assay appear to have relatively higher sensitivity and specificity than other assay. The results of the study showed that the application of comet assay can be an economical, time saving and less laborious alternative to conventional plaque assay for the detection of bacteriophage mediated bacterial cell lysis.

  19. Bacteriophages as indicators of human and animal faecal contamination in raw and treated wastewaters from Tunisia.

    Science.gov (United States)

    Yahya, M; Hmaied, F; Jebri, S; Jofre, J; Hamdi, M

    2015-05-01

    We aimed at quantifying bacteriophages in raw and treated wastewaters of human and animal origin in Tunisia to assess their usefulness for tracking the origin of faecal pollution and in the follow-up of effectiveness of water treatments process. The concentrations of bacteriophages in wastewater samples were determined by double layer agar technique. Somatic coliphages and F-specific RNA bacteriophages were present in all types of samples in high concentrations. The values of Escherichia coli were variable depending on geographical location. On the other hand, bacteriophages infecting strain GA17 were detected preferably when human faecal contamination was occurred. Bacteriophages appear as a feasible and widely applicable manner to detect faecal contamination in Tunisia. On the other hand, phages infecting GA17 could be good markers for tracking the origin of faecal pollution in the area studied. The reuse of treated wastewaters can be a solution to meet the needs of water in the geographical area of study. Bacteriophages seem to predict differently the presence of faecal contamination in water than bacterial indicators. Consequently, they can be a valuable additional tool to improve water resources management for minimizing health risks. © 2015 The Society for Applied Microbiology.

  20. Analysis of the complete DNA sequence of the temperate bacteriophage TP901-1: Evolution, structure, and genome organization of lactococcal bacteriophages

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Østergaard, Solvej; Pedersen, Margit;

    2001-01-01

    A complete analysis of the entire genome of the temperate lactococcal bacteriophage TP901-1 has been performed and the function of 21 of 56 TP901-1-encoded ORFs has been assigned. This knowledge has been used to propose 10 functional modules each responsible for specific functions during bacterio......A complete analysis of the entire genome of the temperate lactococcal bacteriophage TP901-1 has been performed and the function of 21 of 56 TP901-1-encoded ORFs has been assigned. This knowledge has been used to propose 10 functional modules each responsible for specific functions during...... bacteriophage TP901-1 proliferation. Short regions of microhomology in intergenic regions present in several lactococcal bacteriophages and chromosomal fragments of Lactococcus lactis are suggested to be points of exchange of genetic material through homologous recombination. Our results indicate that TP901......-1 may have evolved by homologous recombination between the host chromosome and a mother phage and support the observation that phage remnants as well as prophages located in the Lactococcus chromosome contribute significantly to bacteriophage evolution. Some proteins encoded in the early transcribed...

  1. Gated rotation mechanism of site-specific recombination by  C31 integrase

    National Research Council Canada - National Science Library

    Olorunniji, F. J; Buck, D. E; Colloms, S. D; McEwan, A. R; Smith, M. C. M; Stark, W. M; Rosser, S. J

    2012-01-01

    Integrases, such as that of the Streptomyces temperate bacteriophage [phi]C31, promote site-specific recombination between DNA sequences in the bacteriophage and bacterial genomes to integrate or excise the phage DNA. [phi...

  2. Listeria monocytogenes: survival and adaptation in the gastrointestinal tract

    Directory of Open Access Journals (Sweden)

    Cormac G.M. Gahan

    2014-02-01

    Full Text Available The foodborne pathogen Listeria monocytogenes has the capacity to survive and grow in a diverse range of natural environments. The transition from a food environment to the gastrointestinal tract begins a process of adaptation that may culminate in invasive systemic disease. Here we describe recent advances in our understanding of how L. monocytogenes adapts to the gastrointestinal environment prior to initiating systemic infection. We will discuss mechanisms used by the pathogen to survive encounters with acidic environments (which include the glutamate decarboxylase and arginine deiminase systems, and those which enable the organism to cope with bile acids (including bile salt hydrolase and competition with the resident microbiota. An increased understanding of how the pathogen survives in this environment is likely to inform the future design of novel prophylactic approaches that exploit specific pharmabiotics; including probiotics, prebiotics or phages.

  3. Characterization of specific alleles in InlA and PrfA of Listeria monocytogenes isolated from foods in Osaka, Japan and their ability to invade Caco-2 cells.

    Science.gov (United States)

    Kanki, Masashi; Naruse, Hisayo; Taguchi, Masumi; Kumeda, Yuko

    2015-10-15

    Listeria monocytogenes expresses the surface protein internalin A (InlA), enabling the invasion of human intestinal epithelial cells to cause severe food-borne diseases. Full-length sequence analysis of inlA of 114 food isolates resulted in the detection of 29 isolates with a premature stop codon (PMSC) mutation and 6 isolates with 3-codon deletion mutations (aa 738 to 740) in inlA. The isolates with inlA PMSCs demonstrated a significantly lower level of invasion than the other food isolates in a Caco-2 cell invasion assay (P0.05). According to analysis of the positive regulatory factor A (PrfA) sequences of 114 L. monocytogenes isolates, 7 isolates of serotype 1/2a from chicken samples contained a PrfA protein with a 5-nucleotide deletion from 712 to 716, including a stop codon. Although the isolates with a 5-nucleotide deletion in prfA demonstrated invasion comparable to the isolates with non-truncated InlA and PrfA after growth at 30 °C (P>0.05), they exhibited a significantly higher level of invasion than the other isolates after growth at 20 °C (Pmonocytogenes isolates with the stop-codon deletion of PrfA. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Use of Bacteriophages to control bacterial pathogens

    Science.gov (United States)

    Lytic bacteriophages can provide a natural method and an effective alternative to antibiotics to reduce bacterial pathogens in animals, foods, and other environments. Bacteriophages (phages) are viruses which infect bacterial cells and eventually kill them through lysis, and represent the most abun...

  5. Nanoscale bacteriophage biosensors beyond phage display.

    Science.gov (United States)

    Lee, Jong-Wook; Song, Jangwon; Hwang, Mintai P; Lee, Kwan Hyi

    2013-01-01

    Bacteriophages are traditionally used for the development of phage display technology. Recently, their nanosized dimensions and ease with which genetic modifications can be made to their structure and function have put them in the spotlight towards their use in a variety of biosensors. In particular, the expression of any protein or peptide on the extraluminal surface of bacteriophages is possible by genetically engineering the genome. In addition, the relatively short replication time of bacteriophages offers researchers the ability to generate mass quantities of any given bacteriophage-based biosensor. Coupled with the emergence of various biomarkers in the clinic as a means to determine pathophysiological states, the development of current and novel technologies for their detection and quantification is imperative. In this review, we categorize bacteriophages by their morphology into M13-based filamentous bacteriophages and T4- or T7-based icosahedral bacteriophages, and examine how such advantages are utilized across a variety of biosensors. In essence, we take a comprehensive approach towards recent trends in bacteriophage-based biosensor applications and discuss their outlook with regards to the field of biotechnology.

  6. Nanoscale bacteriophage biosensors beyond phage display

    Science.gov (United States)

    Lee, Jong-Wook; Song, Jangwon; Hwang, Mintai P; Lee, Kwan Hyi

    2013-01-01

    Bacteriophages are traditionally used for the development of phage display technology. Recently, their nanosized dimensions and ease with which genetic modifications can be made to their structure and function have put them in the spotlight towards their use in a variety of biosensors. In particular, the expression of any protein or peptide on the extraluminal surface of bacteriophages is possible by genetically engineering the genome. In addition, the relatively short replication time of bacteriophages offers researchers the ability to generate mass quantities of any given bacteriophage-based biosensor. Coupled with the emergence of various biomarkers in the clinic as a means to determine pathophysiological states, the development of current and novel technologies for their detection and quantification is imperative. In this review, we categorize bacteriophages by their morphology into M13-based filamentous bacteriophages and T4- or T7-based icosahedral bacteriophages, and examine how such advantages are utilized across a variety of biosensors. In essence, we take a comprehensive approach towards recent trends in bacteriophage-based biosensor applications and discuss their outlook with regards to the field of biotechnology. PMID:24143096

  7. Quality-controlled small-scale production of a well-defined bacteriophage cocktail for use in human clinical trials.

    Directory of Open Access Journals (Sweden)

    Maya Merabishvili

    Full Text Available We describe the small-scale, laboratory-based, production and quality control of a cocktail, consisting of exclusively lytic bacteriophages, designed for the treatment of Pseudomonas aeruginosa and Staphylococcus aureus infections in burn wound patients. Based on successive selection rounds three bacteriophages were retained from an initial pool of 82 P. aeruginosa and 8 S. aureus bacteriophages, specific for prevalent P. aeruginosa and S. aureus strains in the Burn Centre of the Queen Astrid Military Hospital in Brussels, Belgium. This cocktail, consisting of P. aeruginosa phages 14/1 (Myoviridae and PNM (Podoviridae and S. aureus phage ISP (Myoviridae was produced and purified of endotoxin. Quality control included Stability (shelf life, determination of pyrogenicity, sterility and cytotoxicity, confirmation of the absence of temperate bacteriophages and transmission electron microscopy-based confirmation of the presence of the expected virion morphologic particles as well as of their specific interaction with the target bacteria. Bacteriophage genome and proteome analysis confirmed the lytic nature of the bacteriophages, the absence of toxin-coding genes and showed that the selected phages 14/1, PNM and ISP are close relatives of respectively F8, phiKMV and phage G1. The bacteriophage cocktail is currently being evaluated in a pilot clinical study cleared by a leading Medical Ethical Committee.

  8. Use of bacteriophage particles displaying influenza virus hemagglutinin for the detection of hemagglutination-inhibition antibodies.

    Science.gov (United States)

    Domm, William; Brewer, Matthew; Baker, Steven F; Feng, Changyong; Martínez-Sobrido, Luis; Treanor, John; Dewhurst, Stephen

    2014-03-01

    Bacteriophage lambda capsids provide a flexible molecular scaffold that can be engineered to display a wide range of exogenous proteins, including full-length viral glycoproteins produced in eukaryotic cells. One application for such particles lies in the detection of virus-specific antibodies, since they may obviate the need to work with infectious stocks of highly pathogenic or emerging viruses that can pose significant biosafety and biocontainment challenges. Bacteriophage lambda capsids were produced that displayed an insect-cell derived, recombinant H5 influenza virus hemagglutinin (HA) on their surface. The particles agglutinated red blood cells efficiently, in a manner that could be blocked using H5 HA-specific monoclonal antibodies. The particles were then used to develop a modified hemagglutinination-inhibition (HAI) assay, which successfully identified human sera with H5 HA-specific HAI activity. These results demonstrate the utility of HA-displaying bacteriophage capsids for the detection of influenza virus-specific HAI antibodies.

  9. Effectiveness of lytic bacteriophages in reducing E. coli O157:H7 populations introduced through cross-contamination on fresh cut lettuce

    Science.gov (United States)

    Previous research has shown that lytic bacteriophages (phages) can kill E. coli O157:H7 on produce surfaces. The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield) at 10^8 PFU/m...

  10. Effect of HZE particles and space hadrons on bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Iurov, S.S.; Akoev, I.G.; Leonteva, G.A.

    1983-01-01

    The effects of particle radiation of the type encountered in space flight on bacteriophages are investigated. Survival and mutagenesis were followed in dry film cultures or liquid suspensions of T4Br(+) bacteriophage exposed to high-energy (HZE) particles during orbital flight, to alpha particles and accelerator-generated hardrons in the laboratory, and to high-energy cosmic rays at mountain altitudes. The HZE particles and high-energy hadrons are found to have a greater relative biological efficiency than standard gamma radiation, while exhibiting a highly inhomogeneous spatial structure in the observed biological and genetic effects. In addition, the genetic lesions observed are specific to the type of radiation exposure, consisting primarily of deletions and multiple lesions of low revertability, with mode of action depending on the linear energy transfer. 18 references.

  11. Bacteriophage immobilized graphene electrodes for impedimetric sensing of bacteria (Staphylococcus arlettae).

    Science.gov (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev K; Mehta, Jyotsana; Mohanta, Girish C; Deep, Akash

    2016-07-15

    Bacteriophages are a class of viruses that specifically infect and replicate within a bacterium. They possess inherent affinity and specificity to the particular bacterial cells. This property of bacteriophages makes them an attractive biorecognition element in the field of biosensor development. In this work, we report the use of an immobilized bacteriophage for the development of a highly sensitive electrochemical sensor for Staphylococcus arlettae, bacteria from the pathogenic family of coagulase-negative staphylococci (CNS). The specific bacteriophages were covalently immobilized on the screen-printed graphene electrodes. Thus, the fabricated bacteriophage biosensor displayed quantitative response for the target bacteria (S. arlettae) for a broad detection range (2.0-2.0 × 10(6) cfu). A fast response time (2 min), low limit of detection (2 cfu), specificity, and stability over a prolonged period (3 months) are some of the important highlights of the proposed sensor. The practical utility of the developed sensor has been demonstrated by the analysis of S. arlettae in spiked water and apple juice samples.

  12. Bacteriophages of Leuconostoc, Oenococcus and Weissella

    Directory of Open Access Journals (Sweden)

    Witold P. Kot

    2014-04-01

    Full Text Available Leuconostoc (Ln., Weissella and Oenococcus form a group of related genera of lactic acid bacteria, which once all shared the name Leuconostoc. They are associated with plants, fermented vegetable products, raw milk, dairy products, meat and fish. Most of industrially relevant Leuconostoc strains can be classified as either Ln. mesenteroides or Ln. pseudomesenteroides. They are important flavor producers in dairy fermentations and they initiate nearly all vegetable fermentations. Therefore bacteriophages attacking Leuconostoc strains may negatively influence the production process. Bacteriophages attacking Leuconostoc strains were first reported in 1946. Since then, the majority of described Leuconostoc phages was isolated from either dairy products or fermented vegetable products. Both lytic and temperate phages of Leuconostoc were reported. Most of Leuconostoc phages examined using electron microscopy belong to the Siphoviridae family and differ in morphological details. Hybridization and comparative genomic studies of Leuconostoc phages suggest that they can be divided into several groups, however overall diversity of Leuconostoc phages is much lower as compared to e.g. lactococcal phages. Several fully sequenced genomes of Leuconostoc phages have been deposited in public databases. Lytic phages of Leuconostoc can be divided into two host species-specific groups with similarly organized genomes that shared very low nucleotide similarity. Phages of dairy Leuconostoc have rather limited host-ranges. The receptor binding proteins of two lytic Ln. pseudomesenteroides phages have been identified. Molecular tools for detection of dairy Leuconostoc phages have been developed. The rather limited data on phages of Oenococcus and Weissella show that i lysogeny seems to be abundant in Oenococcus strains, and ii several phages infecting Weissella cibaria are also able to productively infect strains of other Weissella species and even strains of the genus

  13. Listeria monocytogenes en comidas preparadas

    OpenAIRE

    Vila Brugalla, Montserrat

    2013-01-01

    Tradicionalmente Listeria monocytogenes no era considerado como un importante patógeno transmitido a través de los alimentos y, en consecuencia, no había recibido mucha atención por parte de la industria alimentaria. Los índices de listeriosis en la población humana siempre habían estado enormemente ensombrecidos por otras enfermedades transmitidas por los alimentos como la salmonelosis o la campilobacterosis, y la confirmación de brotes era poco frecuente. Sin embargo, los brotes de listerio...

  14. Bacteriophages and medical oncology: targeted gene therapy of cancer.

    Science.gov (United States)

    Bakhshinejad, Babak; Karimi, Marzieh; Sadeghizadeh, Majid

    2014-08-01

    Targeted gene therapy of cancer is of paramount importance in medical oncology. Bacteriophages, viruses that specifically infect bacterial cells, offer a variety of potential applications in biomedicine. Their genetic flexibility to go under a variety of surface modifications serves as a basis for phage display methodology. These surface manipulations allow bacteriophages to be exploited for targeted delivery of therapeutic genes. Moreover, the excellent safety profile of these viruses paves the way for their potential use as cancer gene therapy platforms. The merge of phage display and combinatorial technology has led to the emergence of phage libraries turning phage display into a high throughput technology. Random peptide libraries, as one of the most frequently used phage libraries, provide a rich source of clinically useful peptide ligands. Peptides are known as a promising category of pharmaceutical agents in medical oncology that present advantages such as inexpensive synthesis, efficient tissue penetration and the lack of immunogenicity. Phage peptide libraries can be screened, through biopanning, against various targets including cancer cells and tissues that results in obtaining cancer-homing ligands. Cancer-specific peptides isolated from phage libraries show huge promise to be utilized for targeting of various gene therapy vectors towards malignant cells. Beyond doubt, bacteriophages will play a more impressive role in the future of medical oncology.

  15. Bacteriophage based probes for pathogen detection.

    Science.gov (United States)

    Singh, Amit; Arutyunov, Denis; Szymanski, Christine M; Evoy, Stephane

    2012-08-01

    Rapid and specific detection of pathogenic bacteria is important for the proper treatment, containment and prevention of human, animal and plant diseases. Identifying unique biological probes to achieve a high degree of specificity and minimize false positives has therefore garnered much interest in recent years. Bacteriophages are obligate intracellular parasites that subvert bacterial cell resources for their own multiplication and production of disseminative new virions, which repeat the cycle by binding specifically to the host surface receptors and injecting genetic material into the bacterial cells. The precision of host recognition in phages is imparted by the receptor binding proteins (RBPs) that are often located in the tail-spike or tail fiber protein assemblies of the virions. Phage host recognition specificity has been traditionally exploited for bacterial typing using laborious and time consuming bacterial growth assays. At the same time this feature makes phage virions or RBPs an excellent choice for the development of probes capable of selectively capturing bacteria on solid surfaces with subsequent quick and automatic detection of the binding event. This review focuses on the description of pathogen detection approaches based on immobilized phage virions as well as pure recombinant RBPs. Specific advantages of RBP-based molecular probes are also discussed.

  16. Towards a systemic understanding of Listeria monocytogenes metabolism during infection

    Directory of Open Access Journals (Sweden)

    Thilo M Fuchs

    2012-02-01

    Full Text Available Listeria monocytogenes is a foodborne human pathogen that can cause invasive infection in susceptible animals and humans. For proliferation within hosts, this facultative intracellular pathogen uses a reservoir of specific metabolic pathways, transporter and enzymatic functions whose expression requires the coordinated activity of a complex regulatory network. The highly adapted metabolism of L. monocytogenes strongly depends on the nutrient composition of various milieus encountered during infection. Transcriptomic and proteomic studies revealed the spatial-temporal dynamic of gene expression of this pathogen during replication within cultured cells or in vivo. Metabolic clues are the utilization of unusual C2- and C3-bodies, the metabolism of pyruvate, thiamine availability, the uptake of peptides, the acquisition or biosynthesis of certain amino acids, and the degradation of glucose-phosphate via the pentose phosphate pathway. These examples illustrate the interference of in vivo conditions with energy, carbon and nitrogen metabolism, thus affecting listerial growth. The exploitation, analysis and modelling of the available data sets served as a first attempt to a systemic understanding of listerial metabolism during infection. L. monocytogenes might serve as a model organism for systems biology of a Gram-positive, facultative intracellular bacterium.

  17. Transcription regulation mechanisms of bacteriophages

    Science.gov (United States)

    Yang, Haiquan; Ma, Yingfang; Wang, Yitian; Yang, Haixia; Shen, Wei; Chen, Xianzhong

    2014-01-01

    Phage diversity significantly contributes to ecology and evolution of new bacterial species through horizontal gene transfer. Therefore, it is essential to understand the mechanisms underlying phage-host interactions. After initial infection, the phage utilizes the transcriptional machinery of the host to direct the expression of its own genes. This review presents a view on the transcriptional regulation mechanisms of bacteriophages, and its contribution to phage diversity and classification. Through this review, we aim to broaden the understanding of phage-host interactions while providing a reference source for researchers studying the regulation of phage transcription. PMID:25482231

  18. You Sank My... Bacteriophage?

    Science.gov (United States)

    Bokor, Julie

    2012-01-01

    Practicing correct pipetting procedure doesn't have to be boring. "Pipetting by Coordinates" is an effective way to teach necessary pipetting skills in an enjoyable manner. Students create designs as they add volumes of colored water to specific wells and gain experience using a basic biotechnology tool.

  19. You Sank My... Bacteriophage?

    Science.gov (United States)

    Bokor, Julie

    2012-01-01

    Practicing correct pipetting procedure doesn't have to be boring. "Pipetting by Coordinates" is an effective way to teach necessary pipetting skills in an enjoyable manner. Students create designs as they add volumes of colored water to specific wells and gain experience using a basic biotechnology tool.

  20. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  1. Simultaneous Identification and Susceptibility Determination to Multiple Antibiotics of Staphylococcus aureus by Bacteriophage Amplification Detection Combined with Mass Spectrometry.

    Science.gov (United States)

    Rees, Jon C; Pierce, Carrie L; Schieltz, David M; Barr, John R

    2015-07-01

    The continued advance of antibiotic resistance in clinically relevant bacterial strains necessitates the development and refinement of assays that can rapidly and cost-effectively identify bacteria and determine their susceptibility to a panel of antibiotics. A methodology is described herein that exploits the specificity and physiology of the Staphylococci bacteriophage K to identify Staphylococcus aureus (S. aureus) and determine its susceptibility to clindamycin and cefoxitin. The method uses liquid chromatography-mass spectrometry to monitor the replication of bacteriophage after it is used to infect samples thought to contain S. aureus. Amplification of bacteriophage K indicates the sample contains S. aureus, for it is only in the presence of a suitable host that bacteriophage K can amplify. If bacteriophage amplification is detected in samples containing the antibiotics clindamycin or cefoxitin, the sample is deemed to be resistant to these antibiotics, respectively, for bacteriophage can only amplify in a viable host. Thus, with a single work flow, S. aureus can be detected in an unknown sample and susceptibility to clindamycin and cefoxitin can be ascertained. This Article discusses implications for the use of bacteriophage amplification in the clinical laboratory.

  2. Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification.

    Science.gov (United States)

    Zhang, Lisha; Huang, Ru; Liu, Weipeng; Liu, Hongxing; Zhou, Xiaoming; Xing, Da

    2016-12-15

    Foodborne pathogens pose a significant threat to human health worldwide. The identification of foodborne pathogens needs to be rapid, accurate and convenient. Here, we constructed a nanoparticle cluster (NPC) catalyzed signal amplification biosensor for foodborne pathogens visual detection. In this work, vancomycin (Van), a glycopeptide antibiotic for Gram-positive bacteria, was used as the first molecular recognition agent to capture Listeria monocytogenes (L. monocytogenes). Fe3O4 NPC modified aptamer, was used as the signal amplification nanoprobe, specifically recognize to the cell wall of L. monocytogenes. As vancomycin and aptamer recognize L. monocytogenes at different sites, the sandwich recognition showed satisfied specificity. Compared to individual Fe3O4 nanoparticle (NP), NPC exhibit collective effect-enhanced catalytic activity for the color reaction of chromogenic substrate. The change in absorbance or color could represent the concentration of target. Using the Fe3O4 NPC-based signal amplification method, L. monocytogenes whole cells could be directly assayed within a linear range of 5.4×10(3)-10(8) cfu/mL and a visual limit of detection of 5.4×10(3) cfu/mL. Fe3O4 NPC-based method was more sensitive than the Fe3O4 NP-based method. All these attractive characteristics of highly sensitivity, visual and labor-saving, make the biosensor possess a potential application for foodborne pathogenic bacteria detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products.

    Science.gov (United States)

    Heo, Eun Jeong; Song, Bo Ra; Park, Hyun Jung; Kim, Young Jo; Moon, Jin San; Wee, Sung Hwan; Kim, Jin-Seok; Yoon, Yohan

    2014-03-01

    The objectives of this study were to evaluate the detection of Listeria monocytogenes in different ready-to-eat foods using real-time PCR (RT-PCR). Various concentrations (10(0) to 10(5) CFU/ml) of L. monocytogenes ATCC 19115 were inoculated into ham, sausage, ground meat, processed milk, cheese, and infant formula. L. monocytogenes ATCC 19115 in the samples was then enumerated on Oxford agar, and DNA was extracted from the samples before and after incubation at 36°C for 4 h. A set of primers and hybridization probe designed in this study was then used to detect the pathogen. The standard curve was then prepared by plotting cycle threshold values for each dilution versus L. monocytogenes cell counts (log CFU). The specificity of the set of primers and hybridization probe was appropriate. A 4-h incubation at 36°C before DNA extraction produced optimum standard curves in comparison to the results for a 0-h incubation. Thus, a 4-h incubation at 36°C was applied for monitoring L. monocytogenes in collected food samples. To monitor L. monocytogenes in foods, 533 samples (ham, 129; sausage, 226; ground meat, 72; processed cheese, 54; processed milk, 42; and infant formula, 10) were collected from retail markets and from the step before pasteurization in plants. Of all 533 samples, 4 samples (0.8%) showed positive signals in RT-PCR. Two samples from hams (1.6%) and two samples from sausages (0.9%) were determined to be positive for L. monocytogenes at processed meat and milk products.

  4. Evolution and Diversity of Listeria monocytogenes from Clinical and Food Samples in Shanghai, China

    Directory of Open Access Journals (Sweden)

    Jianmin Zhang

    2016-07-01

    Full Text Available Listeria monocytogenes is a significant foodborne pathogen causing severe systemic infections in humans with high mortality rates. The objectives of this work were to establish a phylogenetic framework of L. monocytogenes from China and to investigate sequence diversity among different serotypes. We selected 17 L. monocytogenes strains recovered from patients and foods in China representing serotypes 1/2a, 1/2b, and 1/2c. Draft genome sequences were determined using Illumina MiSeq technique and associated protocols. Open reading frames were assigned using prokaryotic genome annotation pipeline by NCBI. Twenty-four published genomes were included for comparative genomic and phylogenetic analysis. More than 154,000 single nucleotide polymorphisms (SNPs were identified from multiple genome alignment and used to reconstruct maximum likelihood phylogenetic tree. The 41 genomes were differentiated into lineages I and II, which consisted of 4 and 11 subgroups, respectively. A clinical strain from China (SHL009 contained significant SNP differences compared to the rest genomes, whereas clinical strain SHL001 shared most recent common ancestor with strain SHL017 from food. Moreover, clinical strains SHL004 and SHL015 clustered together with two strains (08-5578 and 08-5923 recovered from an outbreak in Canada. Partial sequences of a plasmid found in the Canadian strain were also present in SHL004. We investigated the presence of various genes and gene clusters associated with virulence and subgroup-specific genes, including internalins, L. monocytogenes pathogenicity islands (LIPIs, L. monocytogenes genomic islands (LGIs, stress survival islet 1 (SSI-1, and clustered regularly interspaced short palindromic repeats (CRISPR/cas system. A novel genomic island, denoted as LGI-2 was identified. Comparative sequence analysis revealed differences among the L. monocytogenes strains related to virulence, survival abilities, and attributes against foreign genetic

  5. Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments

    Directory of Open Access Journals (Sweden)

    Lucilla Iacumin

    2016-01-01

    Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

  6. Isolation and Identification of Listeria monocytogenes in Processed Meat by a Combined Cultural-molecular Method

    Directory of Open Access Journals (Sweden)

    Angela Ingianni

    2007-01-01

    Full Text Available The isolation and identification of Listeria monocytogenes in processed meat samples by a combined cultural-molecular method is described. It allows the identification of Listeria strains by means of a hybridization technique with a specific DNA probe directed to the listerial internalin gene. The specificity of this method was found to be 100% and sensitivity was as low as 1 CFU/2.5 g of food sample. A total of 278 meat samples were tested in comparison with PCR and conventional cultural assays. A total of 42 (15.4% L. monocytogenes were detected. PCR analysis gave 3 false negative results and culture failed to detect the Listeria in 5 cases. With this cultural-molecular method the identification and quantitative detection of L. monocytogenes were achieved within 36 hours and no false positive or negative tests were obtained, thus fitting most food industry requirements.

  7. Propagating the missing bacteriophages: a large bacteriophage in a new class

    Directory of Open Access Journals (Sweden)

    Hardies Stephen C

    2007-02-01

    Full Text Available Abstract The number of successful propagations/isolations of soil-borne bacteriophages is small in comparison to the number of bacteriophages observed by microscopy (great plaque count anomaly. As one resolution of the great plaque count anomaly, we use propagation in ultra-dilute agarose gels to isolate a Bacillus thuringiensis bacteriophage with a large head (95 nm in diameter, tail (486 × 26 nm, corkscrew-like tail fibers (187 × 10 nm and genome (221 Kb that cannot be detected by the usual procedures of microbiology. This new bacteriophage, called 0305φ8-36 (first number is month/year of isolation; remaining two numbers identify the host and bacteriophage, has a high dependence of plaque size on the concentration of a supporting agarose gel. Bacteriophage 0305φ8-36 does not propagate in the traditional gels used for bacteriophage plaque formation and also does not produce visible lysis of liquid cultures. Bacteriophage 0305φ8-36 aggregates and, during de novo isolation from the environment, is likely to be invisible to procedures of physical detection that use either filtration or centrifugal pelleting to remove bacteria. Bacteriophage 0305φ8-36 is in a new genomic class, based on genes for both structural components and DNA packaging ATPase. Thus, knowledge of environmental virus diversity is expanded with prospect of greater future expansion.

  8. The bacteriophage DNA packaging motor.

    Science.gov (United States)

    Rao, Venigalla B; Feiss, Michael

    2008-01-01

    An ATP-powered DNA translocation machine encapsidates the viral genome in the large dsDNA bacteriophages. The essential components include the empty shell, prohead, and the packaging enzyme, terminase. During translocation, terminase is docked on the prohead's portal protein. The translocation ATPase and the concatemer-cutting endonuclease reside in terminase. Remarkably, terminases, portal proteins, and shells of tailed bacteriophages and herpes viruses show conserved features. These DNA viruses may have descended from a common ancestor. Terminase's ATPase consists of a classic nucleotide binding fold, most closely resembling that of monomeric helicases. Intriguing models have been proposed for the mechanism of dsDNA translocation, invoking ATP hydrolysis-driven conformational changes of portal or terminase powering DNA motion. Single-molecule studies show that the packaging motor is fast and powerful. Recent advances permit experiments that can critically test the packaging models. The viral genome translocation mechanism is of general interest, given the parallels between terminases, helicases, and other motor proteins.

  9. Antibiotic therapy for Listeria monocytogenes bacteremia.

    Science.gov (United States)

    Hung, C C; Chang, S C; Chen, Y C; Hsieh, W C; Luh, K T

    1995-01-01

    Listeria monocytogenes has been recognized as an important pathogen in immunocompromised patients, but it has been rarely reported in Taiwan. We reviewed 13 cases of L. monocytogenes bacteremia at National Taiwan University Hospital over a 12-year period. All of the patients had underlying diseases. Fever was the most common presenting symptom, and neurologic signs were found in 6 patients. Most of the patients received penicillin G, ampicillin or piperacillin with an aminoglycoside. Corticosteroids were used in 9 of 13 patients. The overall mortality directly due to L. monocytogenes bacteremia was 31%. However, patients treated with cephalosporins or oxacillin had higher mortality than those treated with penicillin G, ampicillin or piperacillin (p = 0.05). Given the increasing number of immunosuppressed patients in Taiwan, it is likely that more cases will be encountered. Physicians in Taiwan should be aware of L. monocytogenes bacteremia and its treatment.

  10. FRNA Bacteriophages as Viral Indicators of Faecal Contamination in Mexican Tropical Aquatic Systems

    Science.gov (United States)

    Diaz-Avalos, Carlos; Lopez-Vidal, Yolanda; Castillo-Rojas, Gonzalo; Mazari-Hiriart, Marisa

    2017-01-01

    A particular challenge to water safety in populous intertropical regions is the lack of reliable faecal indicators to detect microbiological contamination of water, while the numerical relationships of specific viral indicators remain largely unexplored. The aim of this study was to investigate the numerical relationships of FRNA-bacteriophage genotypes, adenovirus 41, and human adenoviruses (HADV) in Mexican surface water systems to assess sewage contamination. We studied the presence of HADV, HADV41 and FRNA bacteriophage genotypes in water samples and quantified by qPCR and RT-qPCR. Virus and water quality indicator variances, as analyzed by principal component analysis and partial least squared regression, followed along the major percentiles of water faecal enterococci. FRNA bacteriophages adequately deciphered viral and point source water contamination. The strongest correlation for HADV was with FRNA bacteriophage type II, in water samples higher than the 50th percentiles of faecal enterococci, thus indicating urban pollution. FRNA bacteriophage genotypes I and III virus indicator performances were assisted by their associations with electrical conductivity and faecal enterococci. In combination, our methods are useful for inferring water quality degradation caused by sewage contamination. The methods used have potential for determining source contamination in water and, specifically, the presence of enteric viruses where clean and contaminated water have mixed. PMID:28114378

  11. FRNA Bacteriophages as Viral Indicators of Faecal Contamination in Mexican Tropical Aquatic Systems.

    Science.gov (United States)

    Arredondo-Hernandez, Luis Jose Rene; Diaz-Avalos, Carlos; Lopez-Vidal, Yolanda; Castillo-Rojas, Gonzalo; Mazari-Hiriart, Marisa

    2017-01-01

    A particular challenge to water safety in populous intertropical regions is the lack of reliable faecal indicators to detect microbiological contamination of water, while the numerical relationships of specific viral indicators remain largely unexplored. The aim of this study was to investigate the numerical relationships of FRNA-bacteriophage genotypes, adenovirus 41, and human adenoviruses (HADV) in Mexican surface water systems to assess sewage contamination. We studied the presence of HADV, HADV41 and FRNA bacteriophage genotypes in water samples and quantified by qPCR and RT-qPCR. Virus and water quality indicator variances, as analyzed by principal component analysis and partial least squared regression, followed along the major percentiles of water faecal enterococci. FRNA bacteriophages adequately deciphered viral and point source water contamination. The strongest correlation for HADV was with FRNA bacteriophage type II, in water samples higher than the 50th percentiles of faecal enterococci, thus indicating urban pollution. FRNA bacteriophage genotypes I and III virus indicator performances were assisted by their associations with electrical conductivity and faecal enterococci. In combination, our methods are useful for inferring water quality degradation caused by sewage contamination. The methods used have potential for determining source contamination in water and, specifically, the presence of enteric viruses where clean and contaminated water have mixed.

  12. Bacteriophages as Potential Treatment for Urinary Tract Infections.

    Science.gov (United States)

    Sybesma, Wilbert; Zbinden, Reinhard; Chanishvili, Nino; Kutateladze, Mzia; Chkhotua, Archil; Ujmajuridze, Aleksandre; Mehnert, Ulrich; Kessler, Thomas M

    2016-01-01

    Urinary tract infections (UTIs) are among the most prevalent microbial diseases and their financial burden on society is substantial. The continuing increase of antibiotic resistance worldwide is alarming so that well-tolerated, highly effective therapeutic alternatives are urgently needed. To investigate the effect of bacteriophages on Escherichia coli and Klebsiella pneumoniae strains isolated from the urine of patients suffering from UTIs. Forty-one E. coli and 9 K. pneumoniae strains, isolated from the urine of patients suffering from UTIs, were tested in vitro for their susceptibility toward bacteriophages. The bacteriophages originated from either commercially available bacteriophage cocktails registered in Georgia or from the bacteriophage collection of the George Eliava Institute of Bacteriophage, Microbiology and Virology. In vitro screening of bacterial strains was performed by use of the spot-test method. The experiments were implemented three times by different groups of scientists. The lytic activity of the commercial bacteriophage cocktails on the 41 E. coli strains varied between 66% (Pyo bacteriophage) and 93% (Enko bacteriophage). After bacteriophage adaptation of the Pyo bacteriophage cocktail, its lytic activity was increased from 66 to 93% and only one E. coli strain remained resistant. One bacteriophage of the Eliava collection could lyse all 9 K. pneumoniae strains. Based on the high lytic activity and the potential of resistance optimization by direct adaption of bacteriophages as reported in this study, and in view of the continuing increase of antibiotic resistance worldwide, bacteriophage therapy is a promising treatment option for UTIs highly warranting randomized controlled trials.

  13. Diagnostic Immunization with Bacteriophage ΦX 174 in Patients with Common Variable Immunodeficiency/Hypogammaglobulinemia

    Directory of Open Access Journals (Sweden)

    Lauren L Smith

    2014-08-01

    Full Text Available Purpose: Use of the T cell-dependent neoantigen bacteriophage ΦX 174 has been described since the 1960s as a method to assess specific antibody response in patients with primary immunodeficiencies. We reviewed a cohort of patients at Duke University Medical Center (DUMC who received immunization with bacteriophage and report the clinical utility and safety of the immunization, as well as patient characteristics. Methods: A retrospective chart review was performed of all Duke Immunology Clinic patients (pediatric and adult who received immunizations with bacteriophage, from 1976-2012. Subjects were selected for inclusion if their diagnosis at the time of bacteriophage was either presumed or confirmed common variable immunodeficiency (CVID, hypogammaglobulinemia, transient hypogammaglobulinemia, or antibody deficiency unspecified. Follow up post-immunization was also recorded.Results: One hundred twenty-six patients were identified, 36 adult and 90 pediatric patients. Diagnoses prior to bacteriophage were CVID (n=100, hypogammaglobulinemia (n=23, and antibody deficiency (n=3. Post-immunization diagnoses were CVID (n=65, hypogammaglobulinemia (n=19, unknown (n=23, no primary immune deficiency (n=10, and other primary immunodeficiency (n=9. Seventy-five patients had abnormal bacteriophage results, 37 were normal, and 14 were borderline. There were 257 recorded administrations of the immunization. Information was available on adverse reactions for 171 administrations. Fourteen immunizations were associated with minor adverse events. Nineteen patients stopped their immunoglobulin replacement therapy based on reported normal responses to immunization. Conclusions: Bacteriophage ΦX 174 immunization is a safe, well-tolerated, and clinically useful method to assess antibody response in patients with suspected antibody-mediated immunodeficiencies, particularly those who are on immunoglobulin replacement therapy at the time of immunization

  14. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... understanding of L. monocytogenes prevalence in different types of cheeses and provided results that can be useful as input for quantitative microbiological risk assessment modelling....

  15. Listeria monocytogenes triggers AIM2-mediated pyroptosis upon infrequent bacteriolysis in the macrophage cytosol.

    Science.gov (United States)

    Sauer, John-Demian; Witte, Chelsea E; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A

    2010-05-20

    A host defense strategy against pathogens is the induction of cell death, thereby eliminating the pathogen's intracellular niche. Pyroptosis, one such form of cell death, is dependent on inflammasome activation. In a genetic screen to identify Listeria monocytogenes mutants that induced altered levels of host cell death, we identified a mutation in lmo2473 that caused hyperstimulation of IL-1beta secretion and pyroptosis following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or induced to lyse by treatment with ampicillin stimulated pyroptosis. Pyroptosis was independent of the Nlrp3 and Nlrc4 inflammasome receptors but dependent on the inflammasome adaptor ASC and the cytosolic DNA sensor AIM2. Importantly, wild-type L. monocytogenes were also found to lyse, albeit at low levels, and trigger AIM2-dependent pyroptosis. These data suggested that pyroptosis is triggered by bacterial DNA released during cytosolic lysis. Copyright 2010 Elsevier Inc. All rights reserved.

  16. Internalization of Listeria monocytogenes in Whole Avocado.

    Science.gov (United States)

    Chen, Yi; Evans, Peter; Hammack, Thomas S; Brown, Eric W; Macarisin, Dumitru

    2016-08-01

    In recent years, tree fruits have emerged as a new concern for Listeria monocytogenes contamination. The objective of the current study was to evaluate the potential internalization of L. monocytogenes from the surface of avocados into the edible portions of the fruit during certain postharvest practices simulated in a laboratory setting. One set of intact avocados was spot inoculated with L. monocytogenes on the stem scar, and the second set was hydrocooled in water contaminated with L. monocytogenes. Under these experimental conditions, L. monocytogenes internalized into the avocado pulp through the stem or stem scar after both spot inoculation and hydrocooling. In avocados spot inoculated with 50, 130, 500, and 1,300 CFU per fruit, bacteria were detected in the edible portion adjacent to the stem scar within 15 days postinoculation during storage at 4°C. In avocados hydrocooled in water containing L. monocytogenes at 10(6) and 10(8) CFU/ml, bacteria reached the bottom end of the fruit, and the populations in the edible portion adjacent to the stem scar reached up to 5.90 to 7.19 log CFU/g within 10 to 15 days during storage at 4°C. Dye mixed with inoculum was useful for guiding subsequent sampling, but dye penetration patterns were not always consistent with bacterial penetration.

  17. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  18. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  19. The next generation of bacteriophage therapy.

    Science.gov (United States)

    Lu, Timothy K; Koeris, Michael S

    2011-10-01

    Bacteriophage therapy for bacterial infections is a concept with an extensive but controversial history. There has been a recent resurgence of interest into bacteriophages owing to the increasing incidence of antibiotic resistance and virulent bacterial pathogens. Despite these efforts, bacteriophage therapy remains an underutilized option in Western medicine due to challenges such as regulation, limited host range, bacterial resistance to phages, manufacturing, side effects of bacterial lysis, and delivery. Recent advances in biotechnology, bacterial diagnostics, macromolecule delivery, and synthetic biology may help to overcome these technical hurdles. These research efforts must be coupled with practical and rigorous approaches at academic, commercial, and regulatory levels in order to successfully advance bacteriophage therapy into clinical settings. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  1. Bacteriophages of Leuconostoc, Oenococcus, and Weissella

    DEFF Research Database (Denmark)

    Kot, Witold; Neve, Horst; Heller, Knut J;

    2014-01-01

    can be classified as either Ln. mesenteroides or Ln. pseudomesenteroides. They are important flavor producers in dairy fermentations and they initiate nearly all vegetable fermentations. Therefore, bacteriophages attacking Leuconostoc strains may negatively influence the production process....... Bacteriophages attacking Leuconostoc strains were first reported in 1946. Since then, the majority of described Leuconostoc phages was isolated from either dairy products or fermented vegetable products. Both lytic and temperate phages of Leuconostoc were reported. Most of Leuconostoc phages examined using...

  2. Bacteriophages of Leuconostoc, Oenococcus, and Weissella

    DEFF Research Database (Denmark)

    Kot, Witold; Neve, Horst; Heller, Knut J

    2014-01-01

    can be classified as either Ln. mesenteroides or Ln. pseudomesenteroides. They are important flavor producers in dairy fermentations and they initiate nearly all vegetable fermentations. Therefore, bacteriophages attacking Leuconostoc strains may negatively influence the production process....... Bacteriophages attacking Leuconostoc strains were first reported in 1946. Since then, the majority of described Leuconostoc phages was isolated from either dairy products or fermented vegetable products. Both lytic and temperate phages of Leuconostoc were reported. Most of Leuconostoc phages examined using...

  3. Taking Bacteriophage Therapy Seriously: A Moral Argument

    OpenAIRE

    Gilbert Verbeken; Isabelle Huys; Jean-Paul Pirnay; Serge Jennes; Nina Chanishvili; Jacques Scheres; Andrzej Górski; Daniel De Vos; Carl Ceulemans

    2014-01-01

    The excessive and improper use of antibiotics has led to an increasing incidence of bacterial resistance. In Europe the yearly number of infections caused by multidrug resistant bacteria is more than 400.000, each year resulting in 25.000 attributable deaths. Few new antibiotics are in the pipeline of the pharmaceutical industry. Early in the 20th century, bacteriophages were described as entities that can control bacterial populations. Although bacteriophage therapy was developed and practic...

  4. Changes in Gene Expression during Adaptation of Listeria monocytogenes to the Soil Environment

    Science.gov (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

    2011-01-01

    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production. PMID:21966375

  5. Characterization and purification of bacteriophages using chromatofocusing.

    Science.gov (United States)

    Brorson, Kurt; Shen, Hong; Lute, Scott; Pérez, Jessica Soto; Frey, Douglas D

    2008-10-17

    The technique of chromatofocusing was applied to the characterization and purification of three bacteriophages that are routinely used for testing virus filters: phiX174, PR772, and PP7. Chemically well-defined eluent buffers were used, instead of the more commonly used chromatofocusing polyampholyte buffers. Chromatographic column packings were selected to minimize band broadening by confining bacteriophage adsorption solely to the exterior particle surface. Under the conditions used it was determined that bacteriophages could be made to focus into narrow bands in a retained pH gradient with recoveries of live phage that ranged from 15 to nearly 100% as determined by a plaque-forming assay. Retention times and apparent isoelectric point data were obtained for samples consisting either of purified bacteriophage, or samples consisting of crude preparations of bacteriophages containing host cell impurities. Isoelectric point estimates were obtained using modified, previously described models. The results obtained suggest that chromatofocusing is a simple and rapid method for obtaining approximate isoelectric points for bacteriophages and probably other types of viruses. It is also likely a useful method for purifying these materials.

  6. Taking Bacteriophage Therapy Seriously: A Moral Argument

    Directory of Open Access Journals (Sweden)

    Gilbert Verbeken

    2014-01-01

    Full Text Available The excessive and improper use of antibiotics has led to an increasing incidence of bacterial resistance. In Europe the yearly number of infections caused by multidrug resistant bacteria is more than 400.000, each year resulting in 25.000 attributable deaths. Few new antibiotics are in the pipeline of the pharmaceutical industry. Early in the 20th century, bacteriophages were described as entities that can control bacterial populations. Although bacteriophage therapy was developed and practiced in Europe and the former Soviet republics, the use of bacteriophages in clinical setting was neglected in Western Europe since the introduction of traditional antibiotics. Given the worldwide antibiotic crisis there is now a growing interest in making bacteriophage therapy available for use in modern western medicine. Despite the growing interest, access to bacteriophage therapy remains highly problematic. In this paper, we argue that the current state of affairs is morally unacceptable and that all stakeholders (pharmaceutical industry, competent authorities, lawmakers, regulators, and politicians have the moral duty and the shared responsibility towards making bacteriophage therapy urgently available for all patients in need.

  7. Taking bacteriophage therapy seriously: a moral argument.

    Science.gov (United States)

    Verbeken, Gilbert; Huys, Isabelle; Pirnay, Jean-Paul; Jennes, Serge; Chanishvili, Nina; Scheres, Jacques; Górski, Andrzej; De Vos, Daniel; Ceulemans, Carl

    2014-01-01

    The excessive and improper use of antibiotics has led to an increasing incidence of bacterial resistance. In Europe the yearly number of infections caused by multidrug resistant bacteria is more than 400.000, each year resulting in 25.000 attributable deaths. Few new antibiotics are in the pipeline of the pharmaceutical industry. Early in the 20th century, bacteriophages were described as entities that can control bacterial populations. Although bacteriophage therapy was developed and practiced in Europe and the former Soviet republics, the use of bacteriophages in clinical setting was neglected in Western Europe since the introduction of traditional antibiotics. Given the worldwide antibiotic crisis there is now a growing interest in making bacteriophage therapy available for use in modern western medicine. Despite the growing interest, access to bacteriophage therapy remains highly problematic. In this paper, we argue that the current state of affairs is morally unacceptable and that all stakeholders (pharmaceutical industry, competent authorities, lawmakers, regulators, and politicians) have the moral duty and the shared responsibility towards making bacteriophage therapy urgently available for all patients in need.

  8. Pathogen detection using engineered bacteriophages.

    Science.gov (United States)

    Smartt, Abby E; Xu, Tingting; Jegier, Patricia; Carswell, Jessica J; Blount, Samuel A; Sayler, Gary S; Ripp, Steven

    2012-04-01

    Bacteriophages, or phages, are bacterial viruses that can infect a broad or narrow range of host organisms. Knowing the host range of a phage allows it to be exploited in targeting various pathogens. Applying phages for the identification of microorganisms related to food and waterborne pathogens and pathogens of clinical significance to humans and animals has a long history, and there has to some extent been a recent revival in these applications as phages have become more extensively integrated into novel detection, identification, and monitoring technologies. Biotechnological and genetic engineering strategies applied to phages are responsible for some of these new methods, but even natural unmodified phages are widely applicable when paired with appropriate innovative detector platforms. This review highlights the use of phages as pathogen detector interfaces to provide the reader with an up-to-date inventory of phage-based biodetection strategies.

  9. Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella.

    Science.gov (United States)

    Bardina, Carlota; Colom, Joan; Spricigo, Denis A; Otero, Jennifer; Sánchez-Osuna, Miquel; Cortés, Pilar; Llagostera, Montserrat

    2016-01-01

    Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87) able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs); 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats (DTR) of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic analysis of large

  10. Genomics of three new bacteriophages useful in the biocontrol of Salmonella

    Directory of Open Access Journals (Sweden)

    Carlota eBardina

    2016-04-01

    Full Text Available Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87 able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs; 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic

  11. Genomics of Three New Bacteriophages Useful in the Biocontrol of Salmonella

    Science.gov (United States)

    Bardina, Carlota; Colom, Joan; Spricigo, Denis A.; Otero, Jennifer; Sánchez-Osuna, Miquel; Cortés, Pilar; Llagostera, Montserrat

    2016-01-01

    Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87) able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs); 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats (DTR) of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic analysis of large

  12. Benzalkonium tolerance genes and outcome in Listeria monocytogenes meningitis.

    Science.gov (United States)

    Kremer, P H C; Lees, J A; Koopmans, M M; Ferwerda, B; Arends, A W M; Feller, M M; Schipper, K; Valls Seron, M; van der Ende, A; Brouwer, M C; van de Beek, D; Bentley, S D

    2017-04-01

    Listeria monocytogenes is a food-borne pathogen that can cause meningitis. The listerial genotype ST6 has been linked to increasing rates of unfavourable outcome over time. We investigated listerial genetic variation and the relation with clinical outcome in meningitis. We sequenced 96 isolates from adults with listerial meningitis included in two prospective nationwide cohort studies by whole genome sequencing, and evaluated associations between bacterial genetic variation and clinical outcome. We validated these results by screening listerial genotypes of 445 cerebrospinal fluid and blood isolates from patients over a 30-year period from the Dutch national surveillance cohort. We identified a bacteriophage, phiLMST6 co-occurring with a novel plasmid, pLMST6, in ST6 isolates to be associated with unfavourable outcome in patients (p 2.83e-05). The plasmid carries a benzalkonium chloride tolerance gene, emrC, conferring decreased susceptibility to disinfectants used in the food-processing industry. Isolates harbouring emrC were growth inhibited at higher levels of benzalkonium chloride (median 60 mg/L versus 15 mg/L; p <0.001), and had higher MICs for amoxicillin and gentamicin compared with isolates without emrC (both p <0.001). Transformation of pLMST6 into naive strains led to benzalkonium chloride tolerance and higher MICs for gentamicin. These results show that a novel plasmid, carrying the efflux transporter emrC, is associated with increased incidence of ST6 listerial meningitis in the Netherlands. Suggesting increased disease severity, our findings warrant consideration of disinfectants used in the food-processing industry that select for resistance mechanisms and may, inadvertently, lead to increased risk of poor disease outcome. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  14. Magic-angle spinning NMR of intact bacteriophages: Insights into the capsid, DNA and their interface

    Science.gov (United States)

    Abramov, Gili; Morag, Omry; Goldbourt, Amir

    2015-04-01

    Bacteriophages are viruses that infect bacteria. They are complex macromolecular assemblies, which are composed of multiple protein subunits that protect genomic material and deliver it to specific hosts. Various biophysical techniques have been used to characterize their structure in order to unravel phage morphogenesis. Yet, most bacteriophages are non-crystalline and have very high molecular weights, in the order of tens of MegaDaltons. Therefore, complete atomic-resolution characterization on such systems that encompass both capsid and DNA is scarce. In this perspective article we demonstrate how magic-angle spinning solid-state NMR has and is used to characterize in detail bacteriophage viruses, including filamentous and icosahedral phage. We discuss the process of sample preparation, spectral assignment of both capsid and DNA and the use of chemical shifts and dipolar couplings to probe the capsid-DNA interface, describe capsid structure and dynamics and extract structural differences between viruses.

  15. Implementation of statistical tools to support identification and management of persistent Listeria monocytogenes contamination in smoked fish processing plants.

    Science.gov (United States)

    Malley, Thomas J V; Stasiewicz, Matthew J; Gröhn, Yrjö T; Roof, Sherry; Warchocki, Steven; Nightingale, Kendra; Wiedmann, Martin

    2013-05-01

    Listeria monocytogenes persistence in food processing plants is a key source of postprocessing contamination of ready-to-eat foods. Thus, identification and elimination of sites where L. monocytogenes persists (niches) is critical. Two smoked fish processing plants were used as models to develop and implement environmental sampling plans (i) to identify persistent L. monocytogenes subtypes (EcoRI ribotypes) using two statistical approaches and (ii) to identify and eliminate likely L. monocytogenes niches. The first statistic, a binomial test based on ribotype frequencies, was used to evaluate L. monocytogenes ribotype recurrences relative to reference distributions extracted from a public database; the second statistic, a binomial test based on previous positives, was used to measure ribotype occurrences as a risk factor for subsequent isolation of the same ribotype. Both statistics revealed persistent ribotypes in both plants based on data from the initial 4 months of sampling. The statistic based on ribotype frequencies revealed persistence of particular ribotypes at specific sampling sites. Two adaptive sampling strategies guided plant interventions during the study: sampling multiple times before and during processing and vector swabbing (i.e., sampling of additional sites in different directions [vectors] relative to a given site). Among sites sampled for 12 months, a Poisson model regression revealed borderline significant monthly decreases in L. monocytogenes isolates at both plants (P = 0.026 and 0.076). Our data indicate elimination of an L. monocytogenes niche on a food contact surface; niches on nonfood contact surfaces were not eliminated. Although our data illustrate the challenge of identifying and eliminating L. monocytogenes niches, particularly at nonfood contact sites in small and medium plants, the methods for identification of persistence we describe here should broadly facilitate science-based identification of microbial persistence.

  16. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  17. Transcriptional inhibition of the bacteriophage T7 early promoter region by oligonucleotide triple helix formation.

    Science.gov (United States)

    Ross, C; Samuel, M; Broitman, S L

    1992-12-30

    We have identified a purine-rich triplex binding sequence overlapping a -35 transcriptional early promoter region of the bacteriophage T7. Triplex-forming oligonucleotide designed to bind this target was annealed to T7 templates and introduced into in vitro transcription systems under conditions favoring specific initiation from this promoter. These templates demonstrated significant transcriptional inhibition relative to naked genomic templates and templates mixed with non-triplex-forming oligonucleotide. It is suggested that triplex formation along this target interferes with transcriptional initiation, and this mechanism may hold potential to disrupt bacteriophage T7 early transcription in vivo.

  18. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  19. BIOTECON diagnostics foodproof Listeria monocytogenes Detection Kit, 5' nuclease in combination with the foodproof ShortPrep II Kit.

    Science.gov (United States)

    Junge, Benjamin; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2012-01-01

    A method was developed for the detection of Listeria monocytogenes in food. The method is based on real-time PCR using hydrolysis probes (5' Nuclease). This advanced PCR method was designed to reduce the time necessary to achieve results from PCR reactions and to enable the user to monitor the amplification of the PCR product simultaneously, in real-time. After DNA isolation using the BIOTECON foodproof ShortPrep II Kit designed for the rapid preparation of L. monocytogenes DNA for direct use in PCR, the real-time detection of L. monocytogenes DNA is carried out using the foodproof Listeria monocytogenes Detection Kit. The kit provides primers and hydrolysis probes for sequence-specific detection, convenient premixed reagents, and controls for reliable interpretation of results. For the internal comparison study, three different foods (soft cheese, coalfish, and smoked ham) were analyzed, chosen from the 15 food groups recommended by the AOAC Research Institute for detection of L. monocytogenes. From each food, 20 samples were inoculated with a low level (1-10 CFU/25 g) and 20 samples with a high level (10-50 CFU/25 g) of L. monocytogenes. Additionally, five nonspiked samples were prepared from each food. Depending on the matrix, the food samples were examined with the test kits and compared with the cultural methods according to the U.S. Food and Drug Administration's Bacteriological Analytical Manual or the U.S. Department of Agriculture/Food Safety and Inspection Service Microbiology Laboratory Guidebook.

  20. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  1. Genome comparison of Listeria monocytogenes serotype 4a strain HCC23 with selected lineage I and lineage II L. monocytogenes strains and other Listeria strains

    Directory of Open Access Journals (Sweden)

    Debarati Paul

    2014-12-01

    Full Text Available More than 98% of reported human listeriosis cases are caused by specific serotypes within genetic lineages I and II. The genome sequence of Listeria monocytogenes lineage III strain HCC23 (serotype 4a enables whole genomic comparisons across all three L. monocytogenes lineages. Protein cluster analysis indicated that strain HCC23 has the most unique protein pairs with nonpathogenic species Listeria innocua. Orthology analysis of the genome sequences of representative strains from the three L. monocytogenes genetic lineages and L. innocua (CLIP11262 identified 319 proteins unique to nonpathogenic strains HCC23 and CLIP11262 and 58 proteins unique to pathogenic strains F2365 and EGD-e. BLAST comparison of these proteins with all the sequenced L. monocytogenes and L. innocua revealed 126 proteins unique to serotype 4a and/or L. innocua; 14 proteins were only found in pathogenic serotypes. Some of the 58 proteins unique to pathogenic strains F2365 and EGD-e were previously published and are already known to contribute to listerial virulence.

  2. Bacteriophage-based therapy in cystic fibrosis-associated Pseudomonas aeruginosa infections: rationale and current status

    Directory of Open Access Journals (Sweden)

    Hraiech S

    2015-07-01

    Full Text Available Sami Hraiech,1,2 Fabienne Brégeon,1,3 Jean-Marc Rolain1 1Institut Hospitalo-Universitaire Méditerranée Infection, URMITE CNRS IRD INSERM UMR 7278, 2Réanimation Médicale – Détresses Respiratoires et Infections Sévères, APHM, CHU Nord, 3Service d’Explorations Fonctionnelles Respiratoires, APHM, CHU Nord, Marseille, France Abstract: Pulmonary infections involving Pseudomonas aeruginosa are among the leading causes of the deterioration of the respiratory status of cystic fibrosis (CF patients. The emergence of multidrug-resistant strains in such populations, favored by iterative antibiotic cures, has led to the urgent need for new therapies. Among them, bacteriophage-based therapies deserve a focus. One century of empiric use in the ex-USSR countries suggests that bacteriophages may have beneficial effects against a large range of bacterial infections. Interest in bacteriophages has recently renewed in Western countries, and the in vitro data available suggest that bacteriophage-based therapy may be of significant interest for the treatment of pulmonary infections in CF patients. Although the clinical data concerning this specific population are relatively scarce, the beginning of the first large randomized study evaluating bacteriophage-based therapy in burn infections suggests that the time has come to assess the effectiveness of this new therapy in CF P. aeruginosa pneumonia. Consequently, the aim of this review is, after a brief history, to summarize the evidence concerning bacteriophage efficacy against P. aeruginosa and, more specifically, the in vitro studies, animal models, and clinical trials targeting CF. Keywords: pneumonia, pulmonary infection, bacterial infection, multidrug resistance

  3. [Research advance on bacteriophage therapy in bacterial infection].

    Science.gov (United States)

    Pei, Jingliang; Fu, Yurong

    2013-11-01

    Bacteriophage is a bacterium dependent virus. It has unique advantages in the treatment of bacterial infection, especially infection caused by drug-resistant bacteria. Its metabolic kinetics and route of administration are the current research focus. Bacteriophage lytic enzyme, as a new therapeutic method, has more advantages than active bacteriophage. This review is focused on the recent progress in bacteriophage research, including the mechanism of bacteria lysis, the route of administration, the application of genetic engineering, etc.

  4. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. DNA packaging in bacteriophage: is twist important?

    Science.gov (United States)

    Spakowitz, Andrew James; Wang, Zhen-Gang

    2005-06-01

    We study the packaging of DNA into a bacteriophage capsid using computer simulation, specifically focusing on the potential impact of twist on the final packaged conformation. We perform two dynamic simulations of packaging a polymer chain into a spherical confinement: one where the chain end is rotated as it is fed, and one where the chain is fed without end rotation. The final packaged conformation exhibits distinct differences in these two cases: the packaged conformation from feeding with rotation exhibits a spool-like character that is consistent with experimental and previous theoretical work, whereas feeding without rotation results in a folded conformation inconsistent with a spool conformation. The chain segment density shows a layered structure, which is more pronounced for packaging with rotation. However, in both cases, the conformation is marked by frequent jumps of the polymer chain from layer to layer, potentially influencing the ability to disentangle during subsequent ejection. Ejection simulations with and without Brownian forces show that Brownian forces are necessary to achieve complete ejection of the polymer chain in the absence of external forces.

  6. A quorum-sensing-induced bacteriophage defense mechanism

    DEFF Research Database (Denmark)

    Høyland-Kroghsbo, Nina Molin; Mærkedahl, Rasmus Baadsgaard; Svenningsen, Sine

    2013-01-01

    of uninfected survivor cells after a potent attack by virulent phages. Notably, this mechanism may apply to a broader range of phages, as AHLs also reduce the risk of ¿ phage infection through a different receptor. IMPORTANCE To enable the successful manipulation of bacterial populations, a comprehensive...... sensing plays an important role in determining the susceptibility of E. coli to infection by bacteriophages ¿ and ¿. On the basis of our findings in the classical Escherichia coli-¿ model system, we suggest that quorum sensing may serve as a general strategy to protect bacteria specifically under...

  7. PCR experion automated electrophoresis system to detect Listeria monocytogenes in foods.

    Science.gov (United States)

    Delibato, Elisabetta; Gattuso, Antonietta; Minucci, Angelo; Auricchio, Bruna; De Medici, Dario; Toti, Laura; Castagnola, Massimo; Capoluongo, Ettore; Gianfranceschi, Monica Virginia

    2009-11-01

    Listeria monocytogenes is frequently found as a contaminant in raw and ready-to-eat foods. The ability of L. monocytogenes to multiply at refrigeration temperatures and to grow in a wide range of pH values is of particular concern for food safety. According to the European Union regulation on microbiological criteria for foodstuffs, L. monocytogenes must be absent in some categories of ready-to-eat foods. The standard microbiological method for L. monocytogenes detection in foods (ISO 11290-1: 1996 (ISO, International Organization for Standardization)) is cost and time consuming. Developments of rapid, cost-effective and automated diagnostic methods to detect food-borne pathogens in foods continue to be a major concern for the industry and public health. The aim of this study was the development of a rapid, sensitive and specific molecular detection method for L. monocytogenes. To this purpose, we have applied a capillary electrophoresis method to a PCR protocol (PCR-EES (EES, experion automated electrophoresis system)) for detecting L. monocytogenes in food. In particular, a microfluidic chip-based automated electrophoresis system (experion automated electrophoresis system, Bio-Rad Laboratories, USA) was used for the rapid and automatic analysis of the amplicons. Fifty naturally contaminated samples were analysed with this method and the results were compared with those obtained with ISO method. Moreover, the microfluidic chip-based automated electrophoresis system was compared with classical gel electrophoresis (PCR-CGE). The results showed that after 24 h of culture enrichment, the PCR-EES showed a relative accuracy of 100% with ISO, while using PCR-CGE decreased it down to 96%. After 48 h of enrichment, both PCR-EES and PCR-CGE showed an accuracy of 100% with ISO.

  8. Genome Sequence of the Enterohemorrhagic Escherichia coli Bacteriophage UFV-AREG1

    Science.gov (United States)

    Batalha, Laís Silva; Albino, Luiz Augusto A.; Boggione, Delaine Meireles Gouveia; Gontijo, Marco Tulio Pardini; Bazzolli, Denise M. Soares; Mendonca, Regina C. Santos

    2016-01-01

    Here, we present the genome sequence of the Escherichia coli bacteriophage UFV-AREG1. This phage was isolated from cowshed wastewater and showed specificity for enterohemorrhagic E. coli O157:H7 (ATCC 43895), E. coli 0111 (CDC O11ab) and E. coli (ATCC 23229). PMID:27738021

  9. Campylobacter jejuni motility is required for infection of the flagellotropic bacteriophage F341

    DEFF Research Database (Denmark)

    Baldvinsson, Signe Berg; Sørensen, Martine Camilla Holst; Vegge, Christina Skovgaard;

    2014-01-01

    Previous studies have identified a specific modification of the capsular polysaccharide as receptor for phages that infect Campylobacter jejuni. Using acapsular kpsM mutants of C. jejuni strains NCTC11168 and NCTC12658, we found that bacteriophage F341 infects C. jejuni independently of the capsule...

  10. 21 CFR 866.2050 - Staphylococcal typing bacteriophage.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Staphylococcal typing bacteriophage. 866.2050 Section 866.2050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Staphylococcal typing bacteriophage. (a) Identification. A staphylococcal typing bacteriophage is a...

  11. Elucidation of the mechanisms of action of Bacteriophage K/nano-emulsion formulations against S. aureus via measurement of particle size and zeta potential.

    Science.gov (United States)

    Esteban, Patricia Perez; Jenkins, A Toby A; Arnot, Tom C

    2016-03-01

    In earlier work we have demonstrated the effect that nano-emulsions have on bacterial growth, and most importantly the enhanced bacteriophage infectivity against Staphylococcus aureus in planktonic culture when phage are carried in nano-emulsions. However, the mechanisms of enhancement of the bacteriophage killing effect are not specifically understood. This work focuses on the investigation of the possible interactions between emulsion droplets and bacterial cells, between emulsion droplets and bacteriophages, and finally interactions between all three components: nano-emulsion droplets, bacteria, and bacteriophages. The first approach consists of simple calculations to determine the spatial distribution of the components, based on measurements of particle size. It was found that nano-emulsion droplets are much more numerous than bacteria or bacteriophage, and due to their size and surface area they must be covering the surface of both cells and bacteriophage particles. Stabilisation of bacteriophages due to electrostatic forces and interaction with nano-emulsion droplets is suspected, since bacteriophages may be protected against inactivation due to 'charge shielding'. Zeta potential was measured for the individual components in the system, and for all of them combined. It was concluded that the presence of nano-emulsions could be reducing electrostatic repulsion between bacterial cells and bacteriophage, both of which are very negatively 'charged'. Moreover, nano-emulsions lead to more favourable interaction between bacteriophages and bacteria, enhancing the anti-microbial or killing effect. These findings are relevant since the physicochemical properties of nano-emulsions (i.e. particle size distribution and zeta potential) are key in determining the efficacy of the formulation against infection in the context of responsive burn wound dressings-which is the main target for this work.

  12. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  13. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  14. Detection of Listeria monocytogenes by direct colony hybridization on hydrophobic grid-membrane filters by using a chromogen-labeled DNA probe.

    Science.gov (United States)

    Peterkin, P I; Idziak, E S; Sharpe, A N

    1991-02-01

    A DNA probe specific for Listeria monocytogenes was isolated from a beta-hemolytic recombinant clone of an L. monocytogenes gene bank. It was labeled with horseradish peroxidase and used in a direct colony hybridization method on hydrophobic grid-membrane filters for the detection of the organism. Following color development of the chromogen, a commercial counter (HGMF Interpreter) was able to detect and count the organisms electronically. The method gave a positive reaction with 70 L. monocytogenes strains, while showing a negative reaction with 10 strains of other Listeria spp. and with 20 organisms of other genera.

  15. Characterization of Temperate Bacteriophages of Bacillus subtilis by the Restriction Endonuclease EcoRI: Evidence for Three Different Temperate Bacteriophages

    Science.gov (United States)

    Wilson, G. A.; Williams, M. T.; Baney, H. W.; Young, F. E.

    1974-01-01

    Temperate bacteriophages of Bacillus subtilis were characterized according to host range and digestion of the bacteriophage genome by endonuclease EcoRI. The three bacteriophages, φ3T, SPO2, and φ105, were all heteroimmune, and the DNA digests showed dissimilar patterns by agarose-ethidium bromide gel electrophoresis. Images PMID:4213607

  16. Listeria monocytogenes survival in refrigerator dill pickles.

    Science.gov (United States)

    Kim, Jin Kyung; D'Sa, Elaine M; Harrison, Mark A; Harrison, Judy A; Andress, Elizabeth L

    2005-11-01

    Listeria monocytogenes can survive and grow in refrigerated foods with pH values of approximately 4.0 to 5.0 and salt concentrations of 3 to 4%. Home-fermented refrigerator dill pickles fit this description. Contamination of this product with L. monocytogenes could cause serious problems because these items are not heated prior to consumption. L. monocytogenes survival and growth patterns were investigated in refrigerator dill pickles at 1.3, 3.8, and 7.6% salt concentrations. Pickling cucumbers were dipped into an inoculum of L. monocytogenes, brine mixtures were added, and cucumbers were held at room temperature for 1 week and then refrigerated for up to 3 months. The pH, NaCl percentage, titratable acidity percentage, and total populations of Listeria and aerobic, psychrotrophic, and lactic acid bacteria were measured at the addition of brine, after 2, 4, and 7 days of storage at room temperature, and then weekly during refrigerated storage. The initial Listeria population was 5.4 to 5.6 log CFU/cm2 on cucumber surfaces and 3.9 to 4.6 log CFU/g internally. There was an approximate 0.3- to 1-log increase during room temperature fermentation followed by a population decline during refrigerator storage, with a greater decrease in the brines with the highest NaCl concentration. Up to 49 days, the internal tissue of pickles with 1.3, 3.8, or 7.6% salt concentrations were presumptively positive for L. monocytogenes by the enrichment method, and at 91 days the surfaces of such pickles were still positive for L. monocytogenes. Populations of total aerobes and lactic acid bacteria increased during room temperature storage and decreased gradually during refrigerated storage.

  17. Antibacterial efficacy of lytic bacteriophages against antibiotic-resistant Klebsiella species.

    Science.gov (United States)

    Karamoddini, M Khajeh; Fazli-Bazzaz, B S; Emamipour, F; Ghannad, M Sabouri; Jahanshahi, A R; Saed, N; Sahebkar, A

    2011-07-07

    Bacterial resistance to antibiotics is a leading and highly prevalent problem in the treatment of infectious diseases. Bacteriophages (phages) appear to be effective and safe alternatives for the treatment of resistant infections because of their specificity for bacterial species and lack of infectivity in eukaryotic cells. The present study aimed to isolate bacteriophages against Klebsiella spp. and evaluate their efficacy against antibiotic-resistant species. Seventy-two antibiotic-resistant Klebsiella spp. were isolated from samples of patients who referred to the Ghaem Hospital (Mashhad, Iran). Lytic bacteriophages against Klebsiella spp. were isolated from wastewater of the septic tank of the same hospital. Bactericidal activity of phages against resistant Klebsiella spp. was tested in both liquid (tube method; after 1 and 24 h of incubation) and solid (double-layer agar plate method; after 24 h of incubation) phases. In each method, three different concentrations of bacteriophages (low: 10(7) PFU/mL) were used. Bacteriophages showed promising bactericidal activity at all assessed concentrations, regardless of the test method and duration of incubation. Overall, bactericidal effects were augmented at higher concentrations. In the tube method, higher activity was observed after 24 h of incubation compared to the 1-h incubation. The bactericidal effects were also higher in the tube method compared to the double-layer agar plate method after 24 h of incubation. The findings of the present study suggest that bacteriophages possess effective bactericidal activity against resistant Klebsiella spp. These bactericidal activities are influenced by phage concentration, duration of incubation, and test method.

  18. Treatment of Highly Virulent Extraintestinal Pathogenic Escherichia coli Pneumonia With Bacteriophages.

    Science.gov (United States)

    Dufour, Nicolas; Debarbieux, Laurent; Fromentin, Mélanie; Ricard, Jean-Damien

    2015-06-01

    To study the effect of bacteriophage treatment on highly virulent extraintestinal Escherichia coli pneumonia in mice and compare it with conventional antimicrobial treatment. Animal investigation. University research laboratory. Pathogen-free 8-week-old Balb/cJRj male mice. Two bacteriophages (536_P1 and 536_P7) were isolated from sewage using strain 536, a highly virulent extraintestinal E. coli. Their in vitro and in vivo efficacy against strain 536 and a ventilator-associated pneumonia E. coli were tested. The first group of mice were infected by intranasal instillation of bioluminescent strain 536 and received 536_P1 intranasally, ceftriaxone, or control. The second group of mice was infected with the ventilator-associated pneumonia strain and received 536_P7. Adaptation of 536_P7 to this clinical isolate was also evaluated in vitro and in vivo. In vivo efficacy of bacteriophage and antibiotic treatment were assessed by recording bioluminescence for short-time periods and by recording body weight and survival of mice for longer periods. Both treatments improved survival compared with control (100% vs 0%), and in vivo bioluminescence recordings showed a similar rapid decrease of emitted light, suggesting prompt bacterial clearance. The majority of mice infected by the ventilator-associated pneumonia strain were not rescued by treatment with 536_P7; however, in vitro adaptation of this bacteriophage toward the ventilator-associated pneumonia strain led to isolate a variant which significantly improved in vivo treatment efficacy (animal survival increased from 20% to 75%). Bacteriophage treatment was as effective as antibiotherapy to provide 100% survival rate in a lethal model of highly virulent E. coli pneumonia. Adaptation of a bacteriophage is a rapid solution to improve its efficacy toward specific strains. These results suggest that phage therapy could be a promising therapeutic strategy for ventilator-associated pneumonia.

  19. Antibacterial Efficacy of Lytic Bacteriophages against Antibiotic-Resistant Klebsiella Species

    Directory of Open Access Journals (Sweden)

    M. Khajeh Karamoddini

    2011-01-01

    Full Text Available Bacterial resistance to antibiotics is a leading and highly prevalent problem in the treatment of infectious diseases. Bacteriophages (phages appear to be effective and safe alternatives for the treatment of resistant infections because of their specificity for bacterial species and lack of infectivity in eukaryotic cells. The present study aimed to isolate bacteriophages against Klebsiella spp. and evaluate their efficacy against antibiotic-resistant species. Seventy-two antibiotic-resistant Klebsiella spp. were isolated from samples of patients who referred to the Ghaem Hospital (Mashhad, Iran. Lytic bacteriophages against Klebsiella spp. were isolated from wastewater of the septic tank of the same hospital. Bactericidal activity of phages against resistant Klebsiella spp. was tested in both liquid (tube method; after 1 and 24 h of incubation and solid (double-layer agar plate method; after 24 h of incubation phases. In each method, three different concentrations of bacteriophages (low: 107 PFU/mL were used. Bacteriophages showed promising bactericidal activity at all assessed concentrations, regardless of the test method and duration of incubation. Overall, bactericidal effects were augmented at higher concentrations. In the tube method, higher activity was observed after 24 h of incubation compared to the 1-h incubation. The bactericidal effects were also higher in the tube method compared to the double-layer agar plate method after 24 h of incubation. The findings of the present study suggest that bacteriophages possess effective bactericidal activity against resistant Klebsiella spp. These bactericidal activities are influenced by phage concentration, duration of incubation, and test method.

  20. Performance of viruses and bacteriophages for fecal source determination in a multi-laboratory, comparative study.

    Science.gov (United States)

    Harwood, Valerie J; Boehm, Alexandria B; Sassoubre, Lauren M; Vijayavel, Kannappan; Stewart, Jill R; Fong, Theng-Theng; Caprais, Marie-Paule; Converse, Reagan R; Diston, David; Ebdon, James; Fuhrman, Jed A; Gourmelon, Michele; Gentry-Shields, Jennifer; Griffith, John F; Kashian, Donna R; Noble, Rachel T; Taylor, Huw; Wicki, Melanie

    2013-11-15

    An inter-laboratory study of the accuracy of microbial source tracking (MST) methods was conducted using challenge fecal and sewage samples that were spiked into artificial freshwater and provided as unknowns (blind test samples) to the laboratories. The results of the Source Identification Protocol Project (SIPP) are presented in a series of papers that cover 41 MST methods. This contribution details the results of the virus and bacteriophage methods targeting human fecal or sewage contamination. Human viruses used as source identifiers included adenoviruses (HAdV), enteroviruses (EV), norovirus Groups I and II (NoVI and NoVII), and polyomaviruses (HPyVs). Bacteriophages were also employed, including somatic coliphages and F-specific RNA bacteriophages (FRNAPH) as general indicators of fecal contamination. Bacteriophage methods targeting human fecal sources included genotyping of FRNAPH isolates and plaque formation on bacterial hosts Enterococcus faecium MB-55, Bacteroides HB-73 and Bacteroides GB-124. The use of small sample volumes (≤50 ml) resulted in relatively insensitive theoretical limits of detection (10-50 gene copies or plaques × 50 ml(-1)) which, coupled with low virus concentrations in samples, resulted in high false-negative rates, low sensitivity, and low negative predictive values. On the other hand, the specificity of the human virus methods was generally close to 100% and positive predictive values were ∼40-70% with the exception of NoVs, which were not detected. The bacteriophage methods were generally much less specific toward human sewage than virus methods, although FRNAPH II genotyping was relatively successful, with 18% sensitivity and 85% specificity. While the specificity of the human virus methods engenders great confidence in a positive result, better concentration methods and larger sample volumes must be utilized for greater accuracy of negative results, i.e. the prediction that a human contamination source is absent.

  1. Optical immunosensors for detection of Listeria monocytogenes and Salmonella enteritidis from food

    Science.gov (United States)

    Bhunia, Arun K.; Geng, Tao; Lathrop, Amanda; Valadez, Angela; Morgan, Mark T.

    2004-03-01

    Listeria monocytogenes and Salmonella are two major foodborne pathogens of significant concern. Two optical evanescent wave immunosensors were evaluated for detection: Antibody-coupled fiber-optic biosensor and a surface plasmon resonant (SPR) immunosensor. In the fiber-optic sensor, polyclonal antibodies for the test organisms were immobilized on polystyrene fiber wave -guides using streptavidin - biotin chemistry. Cyanine 5 -labeled monoclonal antibodies C11E9 (for L. monocytogenes) and SF-11 (for Salmonella Enteritidis) were used to generate a specific fluorescent signal. Signal acquisition was performed by launching a laser-light (635 nm) from an Analyte-2000. This immunosensor was able to detect 103 - 109 cfu/ml of L. monocytogenes or 106-109 cfu/ml of Salmonella Enteritidis and the assays were conducted at near real-time with results obtained within one hour of sampling. The assays were specific and showed signal even in the presence of other microorganisms such as E. coli, Enterococcus faecalis or Salmonella Typhimurium. In the SPR system, IAsys instrument (resonant mirror sensor) was used. Monoclonal antibody-C11E9 was directly immobilized onto a carboxylate cuvette. Whole Listeria cells at various concentrations did not yield any signal while surface protein extracts did. Crude protein extracts from L. monocytogenes and L. innocua had average binding responses of around 150 arc sec (0.25 ng/mm2), which was significantly different from L. grayi, L. ivanovii, or L. welshimeri with average responses of Salmonella Enteritidis.

  2. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    Science.gov (United States)

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  3. Photodynamic inactivation of mammalian viruses and bacteriophages.

    Science.gov (United States)

    Costa, Liliana; Faustino, Maria Amparo F; Neves, Maria Graça P M S; Cunha, Angela; Almeida, Adelaide

    2012-07-01

    Photodynamic inactivation (PDI) has been used to inactivate microorganisms through the use of photosensitizers. The inactivation of mammalian viruses and bacteriophages by photosensitization has been applied with success since the first decades of the last century. Due to the fact that mammalian viruses are known to pose a threat to public health and that bacteriophages are frequently used as models of mammalian viruses, it is important to know and understand the mechanisms and photodynamic procedures involved in their photoinactivation. The aim of this review is to (i) summarize the main approaches developed until now for the photodynamic inactivation of bacteriophages and mammalian viruses and, (ii) discuss and compare the present state of the art of mammalian viruses PDI with phage photoinactivation, with special focus on the most relevant mechanisms, molecular targets and factors affecting the viral inactivation process.

  4. Photodynamic Inactivation of Mammalian Viruses and Bacteriophages

    Directory of Open Access Journals (Sweden)

    Liliana Costa

    2012-06-01

    Full Text Available Photodynamic inactivation (PDI has been used to inactivate microorganisms through the use of photosensitizers. The inactivation of mammalian viruses and bacteriophages by photosensitization has been applied with success since the first decades of the last century. Due to the fact that mammalian viruses are known to pose a threat to public health and that bacteriophages are frequently used as models of mammalian viruses, it is important to know and understand the mechanisms and photodynamic procedures involved in their photoinactivation. The aim of this review is to (i summarize the main approaches developed until now for the photodynamic inactivation of bacteriophages and mammalian viruses and, (ii discuss and compare the present state of the art of mammalian viruses PDI with phage photoinactivation, with special focus on the most relevant mechanisms, molecular targets and factors affecting the viral inactivation process.

  5. Photodynamic Inactivation of Mammalian Viruses and Bacteriophages

    Science.gov (United States)

    Costa, Liliana; Faustino, Maria Amparo F.; Neves, Maria Graça P. M. S.; Cunha, Ângela; Almeida, Adelaide

    2012-01-01

    Photodynamic inactivation (PDI) has been used to inactivate microorganisms through the use of photosensitizers. The inactivation of mammalian viruses and bacteriophages by photosensitization has been applied with success since the first decades of the last century. Due to the fact that mammalian viruses are known to pose a threat to public health and that bacteriophages are frequently used as models of mammalian viruses, it is important to know and understand the mechanisms and photodynamic procedures involved in their photoinactivation. The aim of this review is to (i) summarize the main approaches developed until now for the photodynamic inactivation of bacteriophages and mammalian viruses and, (ii) discuss and compare the present state of the art of mammalian viruses PDI with phage photoinactivation, with special focus on the most relevant mechanisms, molecular targets and factors affecting the viral inactivation process. PMID:22852040

  6. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    Directory of Open Access Journals (Sweden)

    Budniak Sylwia

    2016-12-01

    Full Text Available Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Specific amplification products were obtained for both multiplex PCR assays, which confirmed the tested strains as Listeria spp. and L. monocytogenes, respectively. Isolates of other species did not yield PCR products. Conclusion: Both multiplex PCR assays proved to be significantly sensitive and highly-specific methods for the detection of Listeria strains.

  7. Genetic dissection of DivIVA functions in Listeria monocytogenes.

    Science.gov (United States)

    Kaval, Karan Gautam; Hauf, Samuel; Rismondo, Jeanine; Hahn, Birgitt; Halbedel, Sven

    2017-10-02

    DivIVA is a membrane binding protein that clusters at curved membrane regions such as the cell poles and the membrane invaginations occurring during cell division. DivIVA proteins recruit many other proteins to these subcellular sites through direct protein-protein interactions. DivIVA-dependent functions are typically associated with cell growth and division, even though species-specific differences in the spectrum of DivIVA functions and their causative interaction partners exist. DivIVA from the Gram-positive human pathogen Listeria monocytogenes has at least three different functions. In this bacterium, DivIVA is required for precise positioning of the septum at mid-cell, it contributes to secretion of autolysins required for breakdown of peptidoglycan at the septum after completion of cell division, and it is essential for flagellar motility. While the DivIVA interaction partners for control of division site selection are well-established, the proteins connecting DivIVA with autolysin secretion or swarming motility are completely unknown. We set out to identify divIVA alleles, in which these three DivIVA functions could be separated, since the question of the degree to which the three functions of L. monocytogenes DivIVA are interlinked could not be answered before. Here, we identify such alleles, and our results show that division site selection, autolysin secretion, and swarming represent three discrete pathways that are independently influenced by DivIVA. These findings provide the required basis for the identification of DivIVA interaction partners controlling autolysin secretion and swarming in the future.IMPORTANCE DivIVA of the pathogenic bacterium Listeria monocytogenes is a central scaffold protein that influences at least three different cellular processes, namely cell division, protein secretion and bacterial motility. How DivIVA coordinates these rather unrelated processes is not known. We here identify variants of L. monocytogenes DivIVA, in which

  8. Bacteriophages as Potential Treatment for Urinary Tract Infections

    Science.gov (United States)

    Sybesma, Wilbert; Zbinden, Reinhard; Chanishvili, Nino; Kutateladze, Mzia; Chkhotua, Archil; Ujmajuridze, Aleksandre; Mehnert, Ulrich; Kessler, Thomas M.

    2016-01-01

    Background: Urinary tract infections (UTIs) are among the most prevalent microbial diseases and their financial burden on society is substantial. The continuing increase of antibiotic resistance worldwide is alarming so that well-tolerated, highly effective therapeutic alternatives are urgently needed. Objective: To investigate the effect of bacteriophages on Escherichia coli and Klebsiella pneumoniae strains isolated from the urine of patients suffering from UTIs. Material and methods: Forty-one E. coli and 9 K. pneumoniae strains, isolated from the urine of patients suffering from UTIs, were tested in vitro for their susceptibility toward bacteriophages. The bacteriophages originated from either commercially available bacteriophage cocktails registered in Georgia or from the bacteriophage collection of the George Eliava Institute of Bacteriophage, Microbiology and Virology. In vitro screening of bacterial strains was performed by use of the spot-test method. The experiments were implemented three times by different groups of scientists. Results: The lytic activity of the commercial bacteriophage cocktails on the 41 E. coli strains varied between 66% (Pyo bacteriophage) and 93% (Enko bacteriophage). After bacteriophage adaptation of the Pyo bacteriophage cocktail, its lytic activity was increased from 66 to 93% and only one E. coli strain remained resistant. One bacteriophage of the Eliava collection could lyse all 9 K. pneumoniae strains. Conclusions: Based on the high lytic activity and the potential of resistance optimization by direct adaption of bacteriophages as reported in this study, and in view of the continuing increase of antibiotic resistance worldwide, bacteriophage therapy is a promising treatment option for UTIs highly warranting randomized controlled trials. PMID:27148173

  9. Comparative evaluation of the VIDAS Listeria monocytogenes Xpress (LMX) for the detection of Listeria monocytogenes in a variety of foods.

    Science.gov (United States)

    Johnson, Ronald; Mills, John; Pittet, Jean-Louis; Hughes, Denise

    2013-01-01

    The VIDAS Listeria monocytogenes Xpress (LMX) test is an enzyme-linked fluorescent immunoassay designed for use with the automated VIDAS or mini-VIDAS instruments for the specific detection of L. monocytogenes using a 26 h proprietary enrichment broth. The VIDAS LMX method was validated according to harmonized AOAC Research Institute (RI) and Official Methods of Analysis guidelines in both the AOAC Performance Tested Method (PTM) and GovVal programs. In the PTM comparison studies, the VIDAS LMX method was compared to the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook, the U.S. Food and Drug Administration Bacteriological Analytical Manual, and AOAC Official Methods. The comparative food studies consisted of two main parts: internal testing and AOAC independent laboratory testing, which included seven food matrixes (deli ham, processed cheese, vanilla ice cream, cooked shrimp, smoked white fish, frozen spinach, and peanut butter). As part of the AOAC R1 GovVal program, the VIDAS LMX method was compared to the Health Canada MFHPB-30 method for the detection of L. monocytogenes in five ready-to-eat (RTE) meats (hot dogs, deli turkey, deli ham, fermented sausage, and liver paté). Twenty replicates of each inoculation level and five uninoculated controls were evaluated in each study. The LMX method also included the use ofchromogenic media, chromID Ottaviani Agosti agar and chromID L. mono. agar, for confirmation of LMX presumptive results. In both the PTM and GovVal evaluations, there were no significant differences in the Chi-square values for the LMX method when compared to reference methods. The additional parameters tested in the PTM evaluation (inclusivity, exclusivity, ruggedness, stability, and lot-to-lot) satisfied the AOAC RI performance requirements. In both the PTM and GovVal validation studies, the VIDAS LMX method demonstrated reliability as a rapid qualitative method for next-day detection of L

  10. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  11. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  12. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  13. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  14. Comparative Study of the Effects of Citral on the Growth and Injury of Listeria innocua and Listeria monocytogenes Cells

    Science.gov (United States)

    Silva-Angulo, Angela B.; Zanini, Surama F.; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio

    2015-01-01

    This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 102 and 106 cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral. PMID:25643164

  15. The bacteriophage DNA packaging machine.

    Science.gov (United States)

    Feiss, Michael; Rao, Venigalla B

    2012-01-01

    Large dsDNA bacteriophages and herpesviruses encode a powerful ATP-driven DNA-translocating machine that encapsidates a viral genome into a preformed capsid shell or prohead. The key components of the packaging machine are the packaging enzyme (terminase, motor) and the portal protein that forms the unique DNA entrance vertex of prohead. The terminase complex, comprised of a recognition subunit (small terminase) and an endonuclease/translocase subunit (large terminase), cuts viral genome concatemers. The terminase-viral DNA complex docks on the portal vertex, assembling a motor complex containing five large terminase subunits. The pentameric motor processively translocates DNA until the head shell is full with one viral genome. The motor cuts the DNA again and dissociates from the full head, allowing head-finishing proteins to assemble on the portal, sealing the portal, and constructing a platform for tail attachment. A body of evidence from molecular genetics and biochemical, structural, and biophysical approaches suggests that ATP hydrolysis-driven conformational changes in the packaging motor (large terminase) power DNA motion. Various parts of the motor subunit, such as the ATPase, arginine finger, transmission domain, hinge, and DNA groove, work in concert to translocate about 2 bp of DNA per ATP hydrolyzed. Powerful single-molecule approaches are providing precise delineation of steps during each translocation event in a motor that has a speed as high as a millisecond/step. The phage packaging machine has emerged as an excellent model for understanding the molecular machines, given the mechanistic parallels between terminases, helicases, and numerous motor proteins.

  16. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased sequencing of L. monocytogenes isolates in combination with stress tolerance profiling, will enhance the ability to identify genetic elements

  17. Toward modern inhalational bacteriophage therapy: nebulization of bacteriophages of Burkholderia cepacia complex.

    Science.gov (United States)

    Golshahi, Laleh; Seed, Kimberley D; Dennis, Jonathan J; Finlay, Warren H

    2008-12-01

    Antibiotic-resistant bacterial infections have renewed interest in finding substitute methods of treatment. The purpose of the present in vitro study was to investigate the possibility of respiratory delivery of a Burkholderia cepacia complex (BCC) bacteriophage by nebulized aerosol administration. Bacteriophages in isotonic saline were aerosolized with Pari LC star and eFlow nebulizers, at titers with mean value (standard deviation) of 2.15 x 10(8) (1.63 x 10(8)) plaque-forming unit (PFU)/mL in 2.5-mL nebulizer fills. The breathing pattern of an adult was simulated using a pulmonary waveform generator. During breath simulation, the size distributions of the nebulized aerosol were measured using phase doppler anemometry (PDA). Efficiency of nebulizer delivery was subsequently determined by collection of aerosol on low resistance filters and measurement of bacteriophage titers. These filter titers were used as input data to a mathematical lung deposition model to predict regional deposition of bacteriophages in the lung and initial bacteriophage titers in the liquid surface layer of each conducting airway generation. The results suggest that BCC bacteriophages can be nebulized successfully within a reasonable delivery time and predicted titers in the lung indicate that this method may hold potential for treatment of bacterial lung infections common among cystic fibrosis patients.

  18. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  19. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

    Science.gov (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

    2015-10-23

    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes.

  20. QUANTIFICATION OF LISTERIA MONOCYTOGENES IN MILK BY MPN-PCR AND MPN-CULTURE METHODS

    Directory of Open Access Journals (Sweden)

    Mahzad Hosseini

    2014-10-01

    Full Text Available The aim of this study was to compare the MPN-PCR (Most Probable Number- Polymerase Chain Reaction and MPN-Culture methods in enumerating of Listeria monocytogenes in milk. In order to compare the accuracy of these methods, 103 cell/ml Listeria monocytogenes and different background bacteria which may be present in raw milk, were inoculated in sterilized milk. After preparing serial dilutions, three replicates per dilution were inoculated in tubes containing listeria enrichment broth. After 48 hours of incubation, for MPN-Culture three inoculated replicates were subcultured on Oxford agar and suspected colonies were confirmed by performing by biochemical tests. For MPN-PCR assay, the DNA extraction was performed from the three inoculated replicates which were already used for MPN-Culture and PCR assay was performed using primers specific for Listeria monocytogenes. The experiment was repeated three times and the average of enumerated bacteria was calculated by each method separately. Statistical analysis using one sample Wilcoxon signed rank test showed that enumeration by MPN-PCR method was more accurate than enumeration by MPN-Culture method. The result of this study showed that MPN-PCR method in comparision with MPN-Culture even in the presence of different background microorganisms is more rapid and reliable. It is concluded that MPN-PCR method facilitates the enumeration of Listeria monocytogenes without excessive work and could be considered as an alternative to MPN-Culture technique.

  1. The evolution and epidemiology of Listeria monocytogenes in Europe and the United States.

    Science.gov (United States)

    Lomonaco, Sara; Nucera, Daniele; Filipello, Virginia

    2015-10-01

    Listeria monocytogenes is an opportunistic food-borne pathogen responsible for listeriosis, a disease associated with high mortality rates. L. monocytogenes causes invasive syndromes and case-fatality can be as high as 30%, in specific high-risk population groups such as the elderly, immuno-compromised individuals, fetuses and newborns. Acquisition of the disease is mainly due to consumption of contaminated (predominantly ready-to-eat) food. We aimed to provide a state-of-the-art collection of different likely evolutionary models, based on recombination and positive selection, and the phylogenetic relationship between lineages of L. monocytogenes and between them and other Listeria species. We described the most recent findings in comparative pan-genomics, considering the core and accessory genome in relation to virulence and adaptation to different environments. Finally, this review illustrates L. monocytogenes epidemiology and transmission in humans, foods and animals, the surveillance systems of the European Union and United States and the application of molecular techniques as a core tool in epidemiological investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. The human P-glycoprotein transporter enhances the type I interferon response to Listeria monocytogenes infection.

    Science.gov (United States)

    Sigal, Nadejda; Kaplan Zeevi, Millie; Weinstein, Shiri; Peer, Dan; Herskovits, Anat A

    2015-06-01

    Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the human multidrug transporter P-glycoprotein (P-gp) (also named MDR1 and ABCB1) is transcriptionally induced in the monocytic cell line THP-1 upon infection with the human intracellular bacterial pathogen Listeria monocytogenes. Notably, we found that P-gp is important for full activation of the type I interferon response elicited against L. monocytogenes bacteria. Both inhibition of P-gp function by verapamil and inhibition of its transcription using mRNA silencing led to a reduction in the magnitude of the type I response in infected cells. This function of P-gp was specific to type I interferon cytokines elicited against cytosolic replicating bacteria and was not observed in response to cyclic di-AMP (c-di-AMP), a molecule that was shown to be secreted by L. monocytogenes during infection and to trigger type I interferons. Moreover, P-gp was not involved in activation of other proinflammatory cytokines, such as those triggered by vacuolar-restricted L. monocytogenes or lipopolysaccharide (LPS). Taken together, these findings demonstrate a role for P-gp in proper development of an innate immune response against intracellular pathogens, highlighting the complexity in employing therapeutic strategies that involve inhibition of multidrug resistance (MDR) efflux pumps.

  3. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  4. VIDAS Listeria monocytogenes II (LMO2).

    Science.gov (United States)

    Johnson, Ronald; Mills, John

    2013-01-01

    This AOAC GovVal study compared the VIDAS Listeria monocytogenes II (LMO2) to the Health Products and Food Branch MFHPB-30 reference method for detection of L. monocytogenes in ready-to-eat (RTE) meats. The VIDAS LMO2 test is an automated enzyme-linked fluorescent immunoassay for the detection of L. monocytogenes in foods. The LMO2 test, following the enrichment procedure from the MFLP-33 method, also included use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LMO2 presumptive results. In previous AOAC validation studies comparing the VIDAS LMO2 method to the U.S. Food and Drug Administration Bacteriological Analytical Manual and U.S. Department of Agriculture-Food Safety and Inspection Service reference methods, LMO2 was approved as AOAC Official Method 2004.02 for the detection of L. monocytogenes in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry. The GovVal comparative study included 20 replicate test portions, each at two contamination levels for each matrix, where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. Chi-square analysis of the comparative data in this study indicates no statistical differences between the VIDAS LMO2 and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LMO2 results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data demonstrate that the VIDAS LMO2 method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of L. monocytogenes in RTE meats, including liver paté, hot dogs, raw fermented sausage, sliced deli turkey, and sliced deli ham.

  5. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

    Science.gov (United States)

    Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

    2015-12-03

    Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  6. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP for Rapid Detection and Differentiation of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2015-12-01

    Full Text Available Here, a novel model of loop-mediated isothermal amplification (LAMP, termed multiple inner primers-LAMP (MIP-LAMP, was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD, or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  7. A stochastic model for bacteriophage therapies

    CERN Document Server

    Bardina, Xavier; Rovira, Carles; Tindel, Samy

    2011-01-01

    In this article, we analyze a system modeling bacteriophage treatments for infections in a noisy context. In the small noise regime, we show that after a reasonable amount of time the system is close to a sane equilibrium (which is a relevant biologic information) with high probability. Mathematically speaking, our study hinges on concentration techniques for delayed stochastic differential equations.

  8. ADSORPTION OF BACTERIOPHAGES ON CLAY MINERALS

    Science.gov (United States)

    Theability to predict the fate of microorganisms in soil is dependent on an understanding of the process of their sorption on soil and subsurface materials. Presently, we have focused on studying the thermodynamics of sorption of bacteriophages (T-2, MS-2, and

  9. ADSORPTION OF BACTERIOPHAGES ON CLAY MINERALS

    Science.gov (United States)

    Theability to predict the fate of microorganisms in soil is dependent on an understanding of the process of their sorption on soil and subsurface materials. Presently, we have focused on studying the thermodynamics of sorption of bacteriophages (T-2, MS-2, and

  10. Comparative genomics of Shiga toxin encoding bacteriophages

    Directory of Open Access Journals (Sweden)

    Smith Darren L

    2012-07-01

    Full Text Available Abstract Background Stx bacteriophages are responsible for driving the dissemination of Stx toxin genes (stx across their bacterial host range. Lysogens carrying Stx phages can cause severe, life-threatening disease and Stx toxin is an integral virulence factor. The Stx-bacteriophage vB_EcoP-24B, commonly referred to as Ф24B, is capable of multiply infecting a single bacterial host cell at a high frequency, with secondary infection increasing the rate at which subsequent bacteriophage infections can occur. This is biologically unusual, therefore determining the genomic content and context of Ф24B compared to other lambdoid Stx phages is important to understanding the factors controlling this phenomenon and determining whether they occur in other Stx phages. Results The genome of the Stx2 encoding phage, Ф24B was sequenced and annotated. The genomic organisation and general features are similar to other sequenced Stx bacteriophages induced from Enterohaemorrhagic Escherichia coli (EHEC, however Ф24B possesses significant regions of heterogeneity, with implications for phage biology and behaviour. The Ф24B genome was compared to other sequenced Stx phages and the archetypal lambdoid phage, lambda, using the Circos genome comparison tool and a PCR-based multi-loci comparison system. Conclusions The data support the hypothesis that Stx phages are mosaic, and recombination events between the host, phages and their remnants within the same infected bacterial cell will continue to drive the evolution of Stx phage variants and the subsequent dissemination of shigatoxigenic potential.

  11. Putative link between Staphylococcus aureus bacteriophage serotype and community association.

    Science.gov (United States)

    Mohamed, D H; Saberesheikh, S; Kearns, A M; Saunders, N A

    2012-07-01

    Methicillin-resistant Staphylococcus aureus (MRSA) from humans can be broadly separated into 3 groups: healthcare-associated (HA), community-associated (CA), and livestock-associated (LA) MRSA. Initially based on epidemiological features, division into these classes is becoming increasingly problematic. The sequencing of S. aureus genomes has highlighted variations in their accessory components, which likely account for differences in pathogenicity and epidemicity. In particular, temperate bacteriophages have been regarded as key players in bacterial pathogenesis. Bacteriophage-associated Panton-Valentine leukocidin genes (luk-PV) are regarded as epidemiological markers of the CA-MRSA due to their high prevalence in CA strains. This paper describes the development and application of a partial composite S. aureus virulence-associated gene microarray. Epidemic, pandemic, and sporadic lineages of UK HA and CA S. aureus were compared. Phage structural genes linked with CA isolates were identified and in silico analysis revealed these to be correlated with phage serogroup. CA strains predominantly carried a PVL-associated phage either of the A or Fb serogroup, whilst HA strains predominantly carried serogroup Fa or B phages. We speculate that carriage of a serogroup A/Fb PVL-associated phage rather than the luk-PV genes specifically is correlated with CA status.

  12. Phenotypic and genotypic variations within a single bacteriophage species

    Directory of Open Access Journals (Sweden)

    Kulakov Leonid

    2011-03-01

    Full Text Available Abstract Background Although horizontal gene transfer plays a pivotal role in bacteriophage evolution, many lytic phage genomes are clearly shaped by vertical evolution. We investigated the influence of minor genomic deletions and insertions on various phage-related phenotypic and serological properties. Findings We collected ten different isolates of Pseudomonas aeruginosa bacteriophage ϕKMV. All sequenced genomes (42-43 kb, long direct terminal repeats are nearly identical, which intuitively implied strongly similar infections cycles. However, their latent periods vary between 21 and 28 minutes and they are able to lyse between 5 and 58% of a collection of 107 clinical P. aeruginosa strains. We also noted that phages with identical tail structures displayed profound differences in host spectra. Moreover, point mutations in tail and spike proteins were sufficient to evade neutralization by two phage-specific antisera, isolated from rabbits. Conclusion Although all analyzed phages are 83-97% identical at the genome level, they display a surprisingly large variation in various phenotypic properties. The small overlap in host spectrum and their ability to readily escape immune defences against a nearly identical phage are promising elements for the application of these phages in phage therapy.

  13. Bacteriophages and their applications in the diagnosis and treatment of hepatitis B virus infection

    Science.gov (United States)

    Bakhshinejad, Babak; Sadeghizadeh, Majid

    2014-01-01

    Hepatitis B virus (HBV) infection is a major global health challenge leading to serious disorders such as cirrhosis and hepatocellular carcinoma. Currently, there exist various diagnostic and therapeutic approaches for HBV infection. However, prevalence and hazardous effects of chronic viral infection heighten the need to develop novel methodologies for the detection and treatment of this infection. Bacteriophages, viruses that specifically infect bacterial cells, with a long-established tradition in molecular biology and biotechnology have recently been introduced as novel tools for the prevention, diagnosis and treatment of HBV infection. Bacteriophages, due to tremendous genetic flexibility, represent potential to undergo a huge variety of surface modifications. This property has been the rationale behind introduction of phage display concept. This powerful approach, together with combinatorial chemistry, has shaped the concept of phage display libraries with diverse applications for the detection and therapy of HBV infection. This review aims to offer an insightful overview of the potential of bacteriophages in the development of helpful prophylactic (vaccine design), diagnostic and therapeutic strategies for HBV infection thereby providing new perspectives to the growing field of bacteriophage researches directing towards HBV infection. PMID:25206272

  14. Evidence of translation efficiency adaptation of the coding regions of the bacteriophage lambda.

    Science.gov (United States)

    Goz, Eli; Mioduser, Oriah; Diament, Alon; Tuller, Tamir

    2017-08-01

    Deciphering the way gene expression regulatory aspects are encoded in viral genomes is a challenging mission with ramifications related to all biomedical disciplines. Here, we aimed to understand how the evolution shapes the bacteriophage lambda genes by performing a high resolution analysis of ribosomal profiling data and gene expression related synonymous/silent information encoded in bacteriophage coding regions.We demonstrated evidence of selection for distinct compositions of synonymous codons in early and late viral genes related to the adaptation of translation efficiency to different bacteriophage developmental stages. Specifically, we showed that evolution of viral coding regions is driven, among others, by selection for codons with higher decoding rates; during the initial/progressive stages of infection the decoding rates in early/late genes were found to be superior to those in late/early genes, respectively. Moreover, we argued that selection for translation efficiency could be partially explained by adaptation to Escherichia coli tRNA pool and the fact that it can change during the bacteriophage life cycle.An analysis of additional aspects related to the expression of viral genes, such as mRNA folding and more complex/longer regulatory signals in the coding regions, is also reported. The reported conclusions are likely to be relevant also to additional viruses. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  15. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage.

    Science.gov (United States)

    Brasino, Michael; Lee, Ju Hun; Cha, Jennifer N

    2015-02-01

    For early detection of many diseases, it is critical to be able to diagnose small amounts of biomarkers in blood or serum. One of the most widely used sensing assays is the enzyme-linked immunosorbent assay (ELISA), which typically uses detection monoclonal antibodies conjugated to enzymes to produce colorimetric signals. To increase the overall sensitivities of these sensors, we demonstrate the use of a dually modified version of filamentous bacteriophage Fd that produces significantly higher colorimetric signals in ELISAs than what can be achieved using antibodies alone. Because only a few proteins at the tip of the micron-long bacteriophage are involved in antigen binding, the approximately 4000 other coat proteins can be augmented-by either chemical functionalization or genetic engineering-with hundreds to thousands of functional groups. In this article, we demonstrate the use of bacteriophage that bear a large genomic fusion that allows them to bind specific antibodies on coat protein 3 (p3) and multiple biotin groups on coat protein 8 (p8) to bind to avidin-conjugated enzymes. In direct ELISAs, the anti-rTNFα (recombinant human tumor necrosis factor alpha)-conjugated bacteriophage show approximately 3- to 4-fold gains in signal over that of anti-rTNFα, demonstrating their use as a platform for highly sensitive protein detection.

  16. Bacteriophages and their applications in the diagnosis and treatment of hepatitis B virus infection.

    Science.gov (United States)

    Bakhshinejad, Babak; Sadeghizadeh, Majid

    2014-09-07

    Hepatitis B virus (HBV) infection is a major global health challenge leading to serious disorders such as cirrhosis and hepatocellular carcinoma. Currently, there exist various diagnostic and therapeutic approaches for HBV infection. However, prevalence and hazardous effects of chronic viral infection heighten the need to develop novel methodologies for the detection and treatment of this infection. Bacteriophages, viruses that specifically infect bacterial cells, with a long-established tradition in molecular biology and biotechnology have recently been introduced as novel tools for the prevention, diagnosis and treatment of HBV infection. Bacteriophages, due to tremendous genetic flexibility, represent potential to undergo a huge variety of surface modifications. This property has been the rationale behind introduction of phage display concept. This powerful approach, together with combinatorial chemistry, has shaped the concept of phage display libraries with diverse applications for the detection and therapy of HBV infection. This review aims to offer an insightful overview of the potential of bacteriophages in the development of helpful prophylactic (vaccine design), diagnostic and therapeutic strategies for HBV infection thereby providing new perspectives to the growing field of bacteriophage researches directing towards HBV infection.

  17. Analysing and modelling the growth behaviour of Listeria monocytogenes on RTE cooked meat products after a high pressure treatment at 400 MPa

    DEFF Research Database (Denmark)

    Hereu, A.; Dalgaard, Paw; Garriga, M.

    2014-01-01

    Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes......) and subsequently stored at 4,8 and 12 degrees C. The Logistic model with delay was used to estimate lag phase (lambda) and maximum specific growth rate (mu(max)) values from the obtained growth curves. The effect of storage temperature on mu(max) and lambda was modelled using the Ratkowsky square root model...... of L. monocytogenes 100-fold (2-log) higher than the cell concentration prior to the pressure treatment was similar for the two studied physiological states of the inoculum. Two secondary models were necessary to describe the different growth behaviour of L. monocytogenes on ready-to-eat cooked ham...

  18. The ability of Listeria monocytogenes PI-PLC to facilitate escape from the macrophage phagosome is dependent on host PKCbeta.

    Science.gov (United States)

    Poussin, Mathilde A; Leitges, Michael; Goldfine, Howard

    2009-01-01

    Listeria monocytogenes are facultative intracellular pathogenic bacteria that can infect macrophages as well as non-professional phagocytes. After entry in the host cell, the bacteria escape from the phagosome into the cytoplasm. In murine macrophages and in cell lines derived from these cells, escape of L. monocytogenes from the phagosome is absolutely dependent on listeriolysin O (LLO) and facilitated by a secreted phosphatidylinositol-specific phospholipase C (PI-PLC). Work in this laboratory has previously demonstrated a LLO and PI-PLC-dependent translocation of host PKCbeta isoforms. Pharmacological inhibition of PKCbeta resulted in a significant reduction in permeabilization of the phagosome, and in the number of bacteria reaching the cytosol. These findings led to the prediction that the bacterial PI-PLC promotes escape through the production of diacylglycerol leading to the activation of host PKCbeta. To test this hypothesis, bone marrow-derived macrophages (BMMf) obtained from PKCbeta knockout (PKCbetaKO) or C57Bl/6 mice were infected with L. monocytogenes. We observed that wild-type L. monocytogenes escapes from the phagosome of PKCbetaKO BMMf as well as from C57Bl/6 BMMf. However, in PKCbetaKO BMMf, L. monocytogenes uses a PI-PLC-independent, but phosphatidylcholine-preferring PLC (PC-PLC)-dependent pathway to facilitate escape. These findings strongly support the hypothesis that PI-PLC promotes escape through mobilization of host PKCbeta.

  19. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  20. Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria.

    Science.gov (United States)

    Doyscher, Dominik; Fieseler, Lars; Dons, Lone; Loessner, Martin J; Schuppler, Markus

    2013-02-01

    Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L. monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L. monocytogenes is unable to persist in Acanthamoeba castellanii and A. polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites, forming large aggregates of densely packed bacteria that we termed backpacks. While the assembly of backpacks is dependent on bacterial motility, flagellation alone is not sufficient. Electron micrographs showed that the aggregates are held together by filaments of likely amoebal origin. Time-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L. monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating that formation of backpacks is not specific for L. monocytogenes, and independent of bacterial pathogenicity or virulence. Hence, backpacking appears to represent a unique and highly effective strategy of Acanthamoeba to trap and feed on motile bacteria.

  1. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  2. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  3. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2010-08-01

    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  4. Oral immunization with recombinant listeria monocytogenes controls virus load after vaginal challenge with feline immunodeficiency virus.

    Science.gov (United States)

    Stevens, Rosemary; Howard, Kristina E; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A

    2004-08-01

    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and delivers an FIV Env-expressing DNA vaccine (LMgag/pND14-Lc-env). Control cats were either sham immunized or immunized with wild-type L. monocytogenes (LM-wt). At 1 year after vaginal challenge, provirus could not be detected in any of the nine tissues evaluated from cats immunized with the recombinant bacteria but was detected in at least one tissue in 8 of 10 control animals. Virus was isolated from bone marrow of four of five LMgag/pND14-Lc-env-immunized cats by use of a stringent coculture system but required CD8(+) T-cell depletion, indicating CD8(+) T-cell suppression of virus replication. Control animals had an inverted CD4:CD8 ratio in mesenteric lymph node and were depleted of both CD4(+) and CD8(+) intestinal epithelial T cells, while LMgag/pND14-Lc-env-immunized animals showed no such abnormalities. Vaginal FIV-specific immunoglobulin A was present at high titer in three LMgag/pND14-Lc-env-immunized cats before challenge and in all five at 1 year postchallenge. This study demonstrates that recombinant L. monocytogenes conferred some control of viral load after vaginal challenge with FIV.

  5. Listeria monocytogenes meningoencephalitis: molecular methods for diagnosis and for monitoring the response to chemotherapy

    Directory of Open Access Journals (Sweden)

    Andrea Piana

    2005-03-01

    Full Text Available

    Background. Listeria monocytogenes is one of the most important human foodborne pathogens; it may be responsible for several disorders, like meningoencephalitis. Listerial isolation in cerebrospinal fluid (CSF is often difficult using microbiologic traditional assays. The aim of this study is to evaluate the reliability of molecular techniques as an alternative tool in order to identify Listeria monocytogenes meningitis and in particular, to evaluate a real-time PCR and a conventional PCR for the target hlyA gene.

    Methods. In 2000-2004, 145 patients, without T-cell immunodeficiency, affected by meningoencephalitis of unknown origin were admitted to the Infectious Diseases Institute of Sassari, Italy; a lumbar puncture was performed at the time of hospital admission. Two different PCR techniques, i.e. RT-PCR and a conventional PCR, were performed in order to detect CNS listerial infection, in conjunction with traditional microbiologic assays.

    Results. We identified fourteen patients affected by listerial meningitis using RT-PCR and conventional PCR. All but one of the CSF cultures were negative for L. monocytogenes. Molecular techniques were performed on the CSF samples collected during follow-up revealing that signal intensity decreased by 40%, 80% and 100% at day 15, 30 and 55 respectively, from the start of antibiotic treatment.

    Conclusions. Considering the seriousness of CNS involvement caused by L. monocytogenes infection, prompt diagnosis is necessary in order to rapidly start specific treatment. Conventional PCR and RT-PCR are rapid assays for L. monocytogenes diagnosis and they might be useful for monitoring the efficacy of antibiotic therapy

  6. Determination of Listeria monocytogenes Growth during Mushroom Production and Distribution

    Directory of Open Access Journals (Sweden)

    Dara Leong

    2013-11-01

    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if its numbers do not exceed 100 CFU/g throughout the shelf-life of the food. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Challenge studies to determine the ability of a food to support growth of L. monocytogenes are essential as predictive modelling often overestimates the growth ability of L. monocytogenes. The aim of this study was to determine if growth of L. monocytogenes was supported during the production and distribution of mushrooms. A three-strain mixture of L. monocytogenes was inoculated onto three independent batches of whole mushrooms, sliced mushrooms, mushroom casing and mushroom substrate at a concentration of about 100–1000 CFU/g. The batches were incubated at potential abuse temperatures, as a worst case scenario, and at intervals during storage L. monocytogenes numbers, % moisture and pH were determined. The results showed that the sliced and whole mushrooms had the ability to support growth, while mushroom casing allowed survival but did not support growth. Mushroom substrate showed a rich background microflora that grew on Listeria selective media and this hindered enumeration of L. monocytogenes. In the case of this study, Combase predictions were not always accurate, indicating that challenge studies may be a necessary part of growth determination of L. monocytogenes.

  7. Adaptive growth responses of Listeria monocytogenes to acid and osmotic shifts above and across the growth boundaries.

    Science.gov (United States)

    Belessi, C-I A; Le Marc, Y; Merkouri, S I; Gounadaki, A S; Schvartzman, S; Jordan, K; Drosinos, E H; Skandamis, P N

    2011-01-01

    The effect of acid and osmotic shifts on the growth of Listeria monocytogenes was evaluated at 10°C. Two types of shifts were tested: (i) within the range of pH and water activity (a(w)) levels that allow growth of L. monocytogenes and (ii) after habituation at no-growth conditions back to growth-permitting conditions. A L. monocytogenes cheese isolate, with high survival capacity during cheesemaking, was inoculated (10(2) CFU/ml) in tryptic soy broth supplemented with 0.6% yeast extract at six pH levels (5.1 to 7.2; adjusted with lactic acid) and 0.5% NaCl (a(w) 0.995), or four a(w) levels (0.995 to 0.93, adjusted with 0.5 to 10.5% NaCl) at pH 7.2 and grown to early stationary phase. L. monocytogenes was then shifted (at 10(2) CFU/ml) to each of the aforementioned growth-permitting pH and a(w) levels and incubated at 10°C. Shifts from no-growth to growth-permitting conditions were carried out by transferring L. monocytogenes habituated at pH 4.9 or a(w) 0.90 (12.5% NaCl) for 1, 5, and 10 days to all pH and a(w) levels permitting growth. Reducing a(w) or pH at different levels in the range of 0.995 to 0.93 and 7.2 to 5.1, respectively, decreased the maximum specific growth rate of L. monocytogenes. The lag time of the organism increased with all osmotic downshifts, as well as by the reduction of pH to 5.1. Conversely, any type of shift within pH 5.5 to 7.2 did not markedly affect the lag times of L. monocytogenes. The longer the cells were incubated at no-growth a(w) (0.90), the faster they initiated growth subsequently, suggesting adaptation to osmotic stress. Conversely, extended habituation at pH 4.9 had the opposite effect on subsequent growth of L. monocytogenes, possibly due to cell injury. These results suggest that there is an adaptation or injury rate induced at conditions inhibiting the growth of the pathogen. Thus, quantifying adaptation phenomena under growth-limiting environments, such as in fermented dairy and meat products or products preserved in

  8. In vitro evaluation of a novel bacteriophage cocktail as a preventative for bovine coliform mastitis.

    Science.gov (United States)

    Porter, J; Anderson, J; Carter, L; Donjacour, E; Paros, M

    2016-03-01

    The objective of this study was to investigate the potential use of bacteriophage in preventing Escherichia coli mastitis on dairies. A cocktail consisting of 4 distinct bacteriophages was generated by screening against 36 E. coli isolates from dairy cows in Washington State with clinical mastitis. The bacteriophage significantly inhibited growth of 58% of the Washington State isolates and 54% of E. coli mastitis isolates from New York State, suggesting that the cocktail of phages had a relatively broad spectrum of action against relevant strains from 2 distinct geographies. The ability to suppress bacterial growth of these isolates in a liquid growth medium was not affected by the ratio of bacteriophage particles to bacterial cells (multiplicity of infection, MOI). For those E. coli that were completely inhibited by the phage cocktail, an MOI as low as 10 had the same effect as 10 µg/mL of ceftiofur on the growth rate of E. coli over a 12-h period using optical density measurements. A 3.3- to 5.6-log reduction of growth was achieved when E. coli was co-incubated with our phage cocktail in raw milk over a 12-h period at physiologic temperature. A modified gentamicin protection assay using bovine mammary epithelial cells provided a model to test whether bacteriophage could prevent cell attachment and invasion by chronic coliform mastitis strains. Pretreatment of cell cultures with the phage cocktail significantly reduced adhesion and intracellular survival of E. coli compared with controls. When combined with a bismuth-based teat sealant, the phage cocktail was able to inhibit bacterial growth when challenged with 1.6 × 10(3) cfu/mL of a clinical mastitis E. coli strain. In vitro results show bactericidal activity by our phage in raw milk and mammary tissue culture systems. Before a bacteriophage-based dry-cow treatment becomes a potential option for dairies, in vivo studies must be able to demonstrate that a specific dose of bacteriophage can protect cows from

  9. Ability of bacteriophage in resolving wound infection caused by multidrug-resistant Acinetobacter baumannii in uncontrolled diabetic rats.

    Science.gov (United States)

    Shivaswamy, VinodKumar Chickmangalure; Kalasuramath, Suneeta Basavaraj; Sadanand, Chethan Kumar; Basavaraju, Abhishek Kilagere; Ginnavaram, Varsha; Bille, Sumanth; Ukken, Sanjay Saju; Pushparaj, Usha Nandini

    2015-04-01

    Acinetobacter baumannii, a substantial nosocomial pathogen, has developed resistance to almost all available antimicrobial drugs. Bacteriophage therapy is a possible alternative treatment for multidrug-resistant (MDR) bacterial infections. In this study, we have successfully isolated bacteriophage active against clinical strains of A. baumannii by enrichment from hospital sewage sludge using representatives of those strains. The bacteriophage isolated against A. baumannii formed plaques against beta-lactamases producing strains of A. baumannii. The utility of bacteriophage specific for A. baumannii to resolve wound infection in uncontrolled diabetic rats was evaluated. Five groups of uncontrolled diabetic rats were used. Group I was noninfected (Control), Group II was infected with MDR A. baumannii and challenged with bacteriophage, Group III was infected with MDR A. baumannii, Group IV was infected with MDR A. baumannii and challenged with antibiotic colistin, and Group V consisted of noninfected rats and sprayed with phage (Phage control). A significant decrease in infection, period of epithelization, and wound contraction was observed in the phage-challenged group when compared with antibiotic-treated uncontrolled diabetic rats and the control group. To conclude the study, new insights are provided into the biology of the broad host range of A. baumannii phage, demonstrating that A. baumannii phage has prospects for the treatment of infections caused by the MDR A. baumannii.

  10. Bacteriophage removal efficiency as a validation and operational monitoring tool for virus reduction in wastewater reclamation: Review.

    Science.gov (United States)

    Amarasiri, Mohan; Kitajima, Masaaki; Nguyen, Thanh H; Okabe, Satoshi; Sano, Daisuke

    2017-09-15

    The multiple-barrier concept is widely employed in international and domestic guidelines for wastewater reclamation and reuse for microbiological risk management, in which a wastewater reclamation system is designed to achieve guideline values of the performance target of microbe reduction. Enteric viruses are one of the pathogens for which the target reduction values are stipulated in guidelines, but frequent monitoring to validate human virus removal efficacy is challenging in a daily operation due to the cumbersome procedures for virus quantification in wastewater. Bacteriophages have been the first choice surrogate for this task, because of the well-characterized nature of strains and the presence of established protocols for quantification. Here, we performed a meta-analysis to calculate the average log10 reduction values (LRVs) of somatic coliphages, F-specific phages, MS2 coliphage and T4 phage by membrane bioreactor, activated sludge, constructed wetlands, pond systems, microfiltration and ultrafiltration. The calculated LRVs of bacteriophages were then compared with reported human enteric virus LRVs. MS2 coliphage LRVs in MBR processes were shown to be lower than those of norovirus GII and enterovirus, suggesting it as a possible validation and operational monitoring tool. The other bacteriophages provided higher LRVs compared to human viruses. The data sets on LRVs of human viruses and bacteriophages are scarce except for MBR and conventional activated sludge processes, which highlights the necessity of investigating LRVs of human viruses and bacteriophages in multiple treatment unit processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Bacteriophage-resistant mutants in Yersinia pestis: identification of phage receptors and attenuation for mice.

    Directory of Open Access Journals (Sweden)

    Andrey A Filippov

    Full Text Available BACKGROUND: Bacteriophages specific for Yersinia pestis are routinely used for plague diagnostics and could be an alternative to antibiotics in case of drug-resistant plague. A major concern of bacteriophage therapy is the emergence of phage-resistant mutants. The use of phage cocktails can overcome this problem but only if the phages exploit different receptors. Some phage-resistant mutants lose virulence and therefore should not complicate bacteriophage therapy. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this work was to identify Y. pestis phage receptors using site-directed mutagenesis and trans-complementation and to determine potential attenuation of phage-resistant mutants for mice. Six receptors for eight phages were found in different parts of the lipopolysaccharide (LPS inner and outer core. The receptor for R phage was localized beyond the LPS core. Most spontaneous and defined phage-resistant mutants of Y. pestis were attenuated, showing increase in LD₅₀ and time to death. The loss of different LPS core biosynthesis enzymes resulted in the reduction of Y. pestis virulence and there was a correlation between the degree of core truncation and the impact on virulence. The yrbH and waaA mutants completely lost their virulence. CONCLUSIONS/SIGNIFICANCE: We identified Y. pestis receptors for eight bacteriophages. Nine phages together use at least seven different Y. pestis receptors that makes some of them promising for formulation of plague therapeutic cocktails. Most phage-resistant Y. pestis mutants become attenuated and thus should not pose a serious problem for bacteriophage therapy of plague. LPS is a critical virulence factor of Y. pestis.

  12. Characterization of a novel bacteriophage, Phda1, infecting the histamine-producing Photobacterium damselae subsp. damselae.

    Science.gov (United States)

    Yamaki, S; Kawai, Y; Yamazaki, K

    2015-06-01

    Photobacterium damselae subsp. damselae is a potent histamine-producing micro-organism. The aim of this study was to isolate and characterize a bacteriophage Phda1 that infected P. damselae subsp. damselae to inhibit its growth and histamine accumulation. Phda1 was isolated from a raw oyster, and the host range, morphology and the bacteriophage genome size were analysed. Phda1 formed a clear plaque only against P. damselae subsp. damselae JCM8969 among five Gram-positive and 32 Gram-negative bacterial strains tested. Phda1 belongs to the family Myoviridae, and its genome size was estimated as 35·2-39·5 kb. According to the one-step growth curve analysis, the latent period, rise period and burst size of Phda1 were 60 min, 50 min and 19 plaque-forming units per infected cell, respectively. Divalent cations, especially Ca(2+) and Mg(2+) , strongly improved Phda1 adsorption to the host cells and its propagation. Phda1 treatment delayed the growth and histamine production of P. damselae subsp. damselae in an in vitro challenge test. The bacteriophage Phda1 might serve as a potential antimicrobial agent to inhibit the histamine poisoning caused by P. damselae subsp. damselae. This is the first description of a bacteriophage specifically infecting P. damselae subsp. damselae and its potential applications. Bacteriophage therapy could prove useful in the prevention of histamine poisoning. © 2015 The Society for Applied Microbiology.

  13. Evolution and the complexity of bacteriophages

    Directory of Open Access Journals (Sweden)

    Serwer Philip

    2007-03-01

    Full Text Available Abstract Background The genomes of both long-genome (> 200 Kb bacteriophages and long-genome eukaryotic viruses have cellular gene homologs whose selective advantage is not explained. These homologs add genomic and possibly biochemical complexity. Understanding their significance requires a definition of complexity that is more biochemically oriented than past empirically based definitions. Hypothesis Initially, I propose two biochemistry-oriented definitions of complexity: either decreased randomness or increased encoded information that does not serve immediate needs. Then, I make the assumption that these two definitions are equivalent. This assumption and recent data lead to the following four-part hypothesis that explains the presence of cellular gene homologs in long bacteriophage genomes and also provides a pathway for complexity increases in prokaryotic cells: (1 Prokaryotes underwent evolutionary increases in biochemical complexity after the eukaryote/prokaryote splits. (2 Some of the complexity increases occurred via multi-step, weak selection that was both protected from strong selection and accelerated by embedding evolving cellular genes in the genomes of bacteriophages and, presumably, also archaeal viruses (first tier selection. (3 The mechanisms for retaining cellular genes in viral genomes evolved under additional, longer-term selection that was stronger (second tier selection. (4 The second tier selection was based on increased access by prokaryotic cells to improved biochemical systems. This access was achieved when DNA transfer moved to prokaryotic cells both the more evolved genes and their more competitive and complex biochemical systems. Testing the hypothesis I propose testing this hypothesis by controlled evolution in microbial communities to (1 determine the effects of deleting individual cellular gene homologs on the growth and evolution of long genome bacteriophages and hosts, (2 find the environmental conditions that

  14. Colovesical fistula presenting as Listeria monocytogenes bacteraemia.

    Science.gov (United States)

    Hobbs, Mark

    2015-03-31

    We present a case of colovesical fistula presenting with a clinical syndrome of urosepsis subsequently demonstrated to be due to Listeria monocytogenes bacteraemia. The patient had a history of previous rectal cancer with a low anterior resection and a covering ileostomy that had been reversed 6 months prior to this presentation. L. monocytogenes was also isolated among mixed enteric organisms on urine culture. There were no symptoms or signs of acute gastrointestinal listeriosis or meningoencephalitis. This unusual scenario prompted concern regarding the possibility of communication between bowel and bladder, which was subsequently confirmed with CT and a contrast enema. The patient recovered well with intravenous amoxicillin and to date has declined surgical management of his colovesical fistula. This case illustrates the importance of considering bowel pathology when enteric organisms such as Listeria are isolated from unusual sites.

  15. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech

    2013-01-01

    The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...... bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP...

  16. Bacteriophage therapy: a potential solution for the antibiotic resistance crisis.

    Science.gov (United States)

    Golkar, Zhabiz; Bagasra, Omar; Pace, Donald Gene

    2014-02-13

    The emergence of multiple drug-resistant bacteria has prompted interest in alternatives to conventional antimicrobials. One of the possible replacement options for antibiotics is the use of bacteriophages as antimicrobial agents. Phage therapy is an important alternative to antibiotics in the current era of drug-resistant pathogens. Bacteriophages have played an important role in the expansion of molecular biology and have been used as antibacterial agents since 1966. In this review, we describe a brief history of bacteriophages and clinical studies on their use in bacterial disease prophylaxis and therapy. We discuss the advantages and disadvantages of bacteriophages as therapeutic agents in this regard.

  17. A first step toward liposome-mediated intracellular bacteriophage therapy.

    Science.gov (United States)

    Nieth, Anita; Verseux, Cyprien; Barnert, Sabine; Süss, Regine; Römer, Winfried

    2015-01-01

    The emergence of antibiotic-resistant bacteria presents a severe challenge to medicine and public health. While bacteriophage therapy is a promising alternative to traditional antibiotics, the general inability of bacteriophages to penetrate eukaryotic cells limits their use against resistant bacteria, causing intracellular diseases like tuberculosis. Bacterial vectors show some promise in carrying therapeutic bacteriophages into cells, but also bring a number of risks like an overload of bacterial antigens or the acquisition of virulence genes from the pathogen. As a first step in the development of a non-bacterial vector for bacteriophage delivery into pathogen-infected cells, we attempted to encapsulate bacteriophages into liposomes. Here we report effective encapsulation of the model bacteriophage λeyfp and the mycobacteriophage TM4 into giant liposomes. Furthermore, we show that liposome-associated bacteriophages are taken up into eukaryotic cells more efficiently than free bacteriophages. These are important milestones in the development of an intracellular bacteriophage therapy that might be useful in the fight against multi-drug-resistant intracellular pathogens like Mycobacterium tuberculosis.

  18. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  19. T4-related bacteriophage LIMEstone isolates for the control of soft rot on potato caused by 'Dickeya solani'.

    Directory of Open Access Journals (Sweden)

    Evelien M Adriaenssens

    Full Text Available The bacterium 'Dickeya solani', an aggressive biovar 3 variant of Dickeya dianthicola, causes rotting and blackleg in potato. To control this pathogen using bacteriophage therapy, we isolated and characterized two closely related and specific bacteriophages, vB_DsoM_LIMEstone1 and vB_DsoM_LIMEstone2. The LIMEstone phages have a T4-related genome organization and share DNA similarity with Salmonella phage ViI. Microbiological and molecular characterization of the phages deemed them suitable and promising for use in phage therapy. The phages reduced disease incidence and severity on potato tubers in laboratory assays. In addition, in a field trial of potato tubers, when infected with 'Dickeya solani', the experimental phage treatment resulted in a higher yield. These results form the basis for the development of a bacteriophage-based biocontrol of potato plants and tubers as an alternative for the use of antibiotics.

  20. The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne

    conditions in a resD mutant strain compared to the wild type. The majority of these were involved in motility and chemotaxis and in carbohydrate uptake such as mannose and cellobiose specific PTS uptake systems. The role of ResD for metabolism in L. monocytogenes was also studied by northern blot analysis...

  1. Application of bacteriophages in sensor development.

    Science.gov (United States)

    Peltomaa, Riikka; López-Perolio, Irene; Benito-Peña, Elena; Barderas, Rodrigo; Moreno-Bondi, María Cruz

    2016-03-01

    Bacteriophage-based bioassays are a promising alternative to traditional antibody-based immunoassays. Bacteriophages, shortened to phages, can be easily conjugated or genetically engineered. Phages are robust, ubiquitous in nature, and harmless to humans. Notably, phages do not usually require inoculation and killing of animals; and thus, the production of phages is simple and economical. In recent years, phage-based biosensors have been developed featuring excellent robustness, sensitivity, and selectivity in combination with the ease of integration into transduction devices. This review provides a critical overview of phage-based bioassays and biosensors developed in the last few years using different interrogation methods such as colorimetric, enzymatic, fluorescence, surface plasmon resonance, quartz crystal microbalance, magnetoelastic, Raman, or electrochemical techniques.

  2. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  3. Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

    Science.gov (United States)

    Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

    2017-05-01

    Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  4. Bacteriophages as recognition and identification agents

    Energy Technology Data Exchange (ETDEWEB)

    Teodorescu, M.C.; Gaspar, A.

    1987-04-23

    Bacteriophages are employed as agents for recognition and identification of molecules and cellular materials, using their ability to recognize their bacterial host, by coating them with antibodies or by selecting them to perform in a manner analogous to antibodies. Visibility for identification is effected by incorporating a fluorescent agent, a radioisotope, a metal, an enzyme, or other staining material. The method of this invention may be utilized in selected clinical procedures, and is adaptable to use in an assay kit.

  5. Going viral: designing bioactive surfaces with bacteriophage.

    Science.gov (United States)

    Hosseinidoust, Zeinab; Olsson, Adam L J; Tufenkji, Nathalie

    2014-12-01

    Bacteriophage-functionalized bioactive surfaces are functional materials that can be used as antimicrobial surfaces in medical applications (e.g., indwelling medical devices or wound dressings) or as biosensors for bacterial capture and detection. Despite offering immense potential, designing efficient phage-functionalized bioactive surfaces is hampered by a number of challenges. This review offers an overview of the current state of knowledge in this field and presents a critical perspective of the technological promises and challenges.

  6. Surface plasmon resonance detection of E. coli and methicillin-resistant S. aureus using bacteriophages.

    Science.gov (United States)

    Tawil, Nancy; Sacher, Edward; Mandeville, Rosemonde; Meunier, Michel

    2012-01-01

    Early diagnosis and appropriate treatment of Escherichia coli (E. coli) O157:H7 and methicillin-resistant Staphylococcus aureus (MRSA) are key elements in preventing resultant life-threatening illnesses, such as hemorrhagic colitis, hemolytic uremic syndrome, and septicemia. In this report, we describe the use of surface plasmon resonance (SPR) for the biodetection of pathogenic bacteria, using bacteriophages as the recognition elements. T4 bacteriophages were used to detect E. coli, while a novel, highly specific phage was used to detect MRSA. We found that the system permits label-free, real-time, specific, rapid and cost-effective detection of pathogens, for concentrations of 10(3) colony forming units/milliliter, in less than 20 min. This system promises to become a diagnostic tool for bacteria that cause major public concern for food safety, bioterrorism, and nosocomial infections.

  7. Listeria monocytogenes infection in macrophages induces vacuolar-dependent host miRNA response.

    Directory of Open Access Journals (Sweden)

    Anna K D Schnitger

    Full Text Available Listeria monocytogenes is a gram-positive facultative intracellular pathogen, causing serious illness in immunocompromised individuals and pregnant women. Upon detection by macrophages, which are key players of the innate immune response against infection, L. monocytogenes induces specific host cell responses which need to be tightly controlled at transcriptional and post-transcriptional levels. Here, we ask whether and how host miRNAs, which represent an important mechanism of post-transcriptional regulation in a wide array of biological processes, are altered by a model pathogen upon live infection of murine bone marrow derived macrophages. We first report that L. monocytogenes subverts the host genome-wide miRNA profile of macrophages in vitro. Specifically, we show that miR-155, miR-146a, miR-125a-3p/5p and miR-149 were amongst the most significantly regulated miRNAs in infected macrophages. Strikingly, these miRNAs were highly upregulated upon infection with the Listeriolysin-deficient L. monocytogenes mutant Δhly, that cannot escape from the phagosome thus representing a vacuolar-contained infection. The vacuolar miRNA response was significantly reduced in macrophages deficient for MyD88. In addition, miR-146a and miR-125a-3p/5p were regulated at transcriptional levels upon infection, and miR-125a-3p/5p were found to be TLR2 responsive. Furthermore, miR-155 transactivation in infection was regulated by NF-κB p65, while miR-146a and miR-125a-3p/5p expression was unaffected in p65-deficient primary macrophages upon L. monocytogenes infection. Our results demonstrate that L. monocytogenes promotes significant changes in the miRNA expression profile in macrophages, and reveal a vacuolar-dependent miRNA signature, listeriolysin-independent and MyD88-dependent. These miRNAs are predicted to target immune genes and are therefore most likely involved in regulation of the macrophage innate immune response against infection at post

  8. Isolation and characterization of bacteriophages of Salmonella enterica serovar Pullorum.

    Science.gov (United States)

    Bao, H; Zhang, H; Wang, R

    2011-10-01

    In this study, 2 bacteriophages of Salmonella Pullorum were isolated using an enrichment protocol and the double agar layer method. They were named PSPu-95 and PSPu-4-116, respectively, against clinical isolates of Salmonella Pullorum SPu-95 and SPu-116. The host ranges of the 2 bacteriophages were determined by performing spot tests with 20 bacteria strains. Both bacteriophages had wide host ranges. Bacteriophage PSPu-95 had a lytic effect on 17 of the 20 isolates (85%), and PSPu-4-116 produced a lytic effect on 14 isolates (70%) and was the only bacteriophage that produced a clear plaque on enterotoxigenic Escherichia coli K88. Transmission electron microscopy revealed the bacteriophages belonged to the order Caudovirales. Bacteriophage PSPu-95 was a member of the family Siphoviridae, but bacteriophage PSPu-4-116 belonged to the family Myoviridae. Both had a double-stranded DNA, which was digested with HindIII or EcoRI, that was estimated to be 58.3 kbp (PSPu-95) and 45.2 kbp (PSPu-4-116) by 1% agar electrophoresis. One-step growth kinetics showed that the latent periods were all less than 20 min, and the burst size was 77.5 pfu/cell for PSPu-95 and 86 pfu/cell for PSPu-4-116. The bacteriophages were able to survive in a pH range between 4 and 10, and they were able to survive in a treatment of 70°C for 60 min. The characterizations of these 2 bacteriophages were helpful in establishing a basis for adopting the most effective bacteriophage to control bacteria in the poultry industry.

  9. Modelling the interaction between bacteriophages and their bacterial hosts.

    Science.gov (United States)

    Beke, Gabor; Stano, Matej; Klucar, Lubos

    2016-09-01

    A mathematical model simulating the interaction between bacteriophages and their bacterial hosts has been developed. It is based on other known models describing this type of interaction, enhanced with an ability to model the system influenced by other environmental factor such as pH and temperature. This could be used for numerous estimations of growth rate, when the pH and/or the temperature of the environment are not constant. The change of pH or the temperature greatly affects the specific growth rate which has an effect on the final results of the simulation. Since the model aims on practical application and easy accessibility, an interactive website has been developed where users can run simulations with their own parameters and easily calculate and visualise the result of simulation. The web simulation is accessible at the URL http://www.phisite.org/model.

  10. Application of bacteriophages for detection of foodborne pathogens.

    Science.gov (United States)

    Schmelcher, Mathias; Loessner, Martin J

    2014-01-01

    Bacterial contamination of food products presents a challenge for the food industry and poses a high risk for the consumer. Despite increasing awareness and improved hygiene measures, foodborne pathogens remain a threat for public health, and novel methods for detection of these organisms are needed. Bacteriophages represent ideal tools for diagnostic assays because of their high target cell specificity, inherent signal-amplifying properties, easy and inexpensive production, and robustness. Every stage of the phage lytic multiplication cycle, from the initial recognition of the host cell to the final lysis event, may be harnessed in several ways for the purpose of bacterial detection. Besides intact phage particles, phage-derived affinity molecules such as cell wall binding domains and receptor binding proteins can serve for this purpose. This review provides an overview of existing phage-based technologies for detection of foodborne pathogens, and highlights the most recent developments in this field, with particular emphasis on phage-based biosensors.

  11. Bacteriophages-potential for application in wastewater treatment processes

    Energy Technology Data Exchange (ETDEWEB)

    Withey, S. [School of Water Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Cartmell, E. [School of Water Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom)]. E-mail: e.cartmell@cranfield.ac.uk; Avery, L.M. [School of Water Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Stephenson, T. [School of Water Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom)

    2005-03-01

    Bacteriophages are viruses that infect and lyse bacteria. Interest in the ability of phages to control bacterial populations has extended from medical applications into the fields of agriculture, aquaculture and the food industry. Here, the potential application of phage techniques in wastewater treatment systems to improve effluent and sludge emissions into the environment is discussed. Phage-mediated bacterial mortality has the potential to influence treatment performance by controlling the abundance of key functional groups. Phage treatments have the potential to control environmental wastewater process problems such as: foaming in activated sludge plants; sludge dewaterability and digestibility; pathogenic bacteria; and to reduce competition between nuisance bacteria and functionally important microbial populations. Successful application of phage therapy to wastewater treatment does though require a fuller understanding of wastewater microbial community dynamics and interactions. Strategies to counter host specificity and host cell resistance must also be developed, as should safety considerations regarding pathogen emergence through transduction.

  12. Crystal structure of the bacteriophage P2 integrase catalytic domain.

    Science.gov (United States)

    Skaar, Karin; Claesson, Magnus; Odegrip, Richard; Högbom, Martin; Haggård-Ljungquist, Elisabeth; Stenmark, Pål

    2015-11-30

    Bacteriophage P2 is a temperate phage capable of integrating its DNA into the host genome by site-specific recombination upon lysogenization. Integration and excision of the phage genome requires P2 integrase, which performs recognition, cleavage and joining of DNA during these processes. This work presents the high-resolution crystal structure of the catalytic domain of P2 integrase, and analysis of the structure-function relationship of several previously identified non-functional P2 integrase mutants. The DNA binding area is characterized by a large positively charged patch, harboring key residues. The structure reveals potential for large dimer flexibility, likely essential for rearrangement of DNA strands upon integration and excision of the phage DNA.

  13. 78 FR 23901 - Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-04-23

    ... Food Safety and Inspection Service Interagency Risk Assessment--Listeria monocytogenes in Retail... risk assessment (QRA), ``Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens... and on the FSIS Web site at http://www.fsis.usda.gov/PDF/Listeria-Transcript_062309.pdf ). II....

  14. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  15. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  16. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health concer

  17. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  18. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  19. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  20. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  1. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  2. Detection of premature stop codons leading to truncated internalin A among food and clinical strains of Listeria monocytogenes.

    Science.gov (United States)

    Ferreira da Silva, Margarida; Ferreira, Vânia; Magalhães, Rui; Almeida, Gonçalo; Alves, Artur; Teixeira, Paula

    2017-05-01

    Listeria monocytogenes is a food-borne pathogen responsible for outbreaks and sporadic cases of listeriosis, a severe invasive disease. Internalin A (InlA) a protein encoded by inlA has a key role in the mechanism of pathogenesis in L. monocytogenes infection, specifically in the invasion of human intestinal epithelial cells. Studies on inlA have shown that mutations leading to premature stop codons (PMSCs) occur naturally and are associated with impaired virulence of L. monocytogenes strains. Increasing evidence suggests that inlA PMSCs mutations are frequent in strains from foods, but rare among clinical isolates. In this study, 22 L. monocytogenes strains collected in Portugal from the processing environment of a bakery industry (n = 1), different food products (n = 10) and human clinical cases (n = 11) were analysed for mutations in inlA and invasion efficiency in Caco-2 cells. Sequencing revealed previously reported mutations types leading to PMSCs in three food and one clinical strain presenting different molecular serotypes (i.e., IIa, IIb and IIc). The remaining 18 isolates did not show PMSCs in inlA. The four strains with PMSCs in inlA presented lower invasiveness efficiencies in Caco-2 cells (below 8.9%) when compared to the control strain (full-length InlA). In addition, one clinical isolate showed reduced invasion efficiency but no PMSCs in inlA. This isolate showed increased inlA transcript levels to that obtained for the laboratory control strain. Our data support the hypothesis that L. monocytogenes isolated from food have attenuated invasion due to the presence of inlA PMSCs. This information would be critically needed for adequate risk-assessments of the foodborne illness burden associated with L. monocytogenes strains. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material.

    Science.gov (United States)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne; Gram, Lone

    2010-06-15

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L. monocytogenes in food processing environments and the purpose of the present study was to determine ability of L. monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative humidities (RHs) during desiccation decreased significantly (pDesiccation in physiological peptone saline (PPS) reduced survivors by 3-5 log units whereas bacterial cells suspended in bacteriological growth substrates (tryptone soy broth with 1% glucose, TSB-glu) or PPS with 5% NaCl only were reduced by 1-3 log units. At RHs of 2, 43 and 75%, surfaces were visibly dry after 1, 3 and 5days of incubation, respectively. The lowest RH resulted in the most significant loss of viability, however, 10(3)-10(4)CFU/cm(2) remained viable regardless of the desiccation treatment (i.e., presence of TSB-glu and/or salt). At 75% RH, the bacterial counts remained almost constant when desiccated in TSB-glu. When bacteria were grown and desiccated (15 degrees C, 43% RH) in salmon or smoked salmon juice, survivors decreased slowly resulting in low numbers (10(2)-10(3)CFU/cm(2)) from all eight strains remaining viable after 3months. Whilst conditions during desiccation had a pronounced influence on inactivation kinetics and the number of survivors, persistent L. monocytogenes were not more tolerant to desiccation than presumed non-persistent isolates. Our study shows that the ability to survive for months during desiccated conditions may be a factor explaining the ability of L. monocytogenes to persist in food processing environments. Copyright 2010 Elsevier B.V. All rights reserved.

  4. Fragmentation of bacteriophage S13 replicative from DNA by restriction endonucleases from Hemophilus influenzae and Hemophilus aegyptius.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); K.M. Ojamaa; J.H. Spencer

    1976-01-01

    textabstractThe restriction enzymes Hind from Hemophilus influenzae and HaeIII from Hemophilus aegyptius cleave bacteriophage S13 replicative form (RF) DNA into 13 and 10 specific fragments, respectively. The sizes of these fragments were estimated by gel electrophoresis, electron microscopy, and py

  5. Utilization of Lambda bacteriophage as an Apoptin effective delivery platform to the BT-474 human breast carcinoma

    Directory of Open Access Journals (Sweden)

    Narmin Ghaderi

    2014-02-01

    Conclusion: Utilization of recombinant Lambda bacteriophage as a safe expression vector has been confirmed. Apoptin was induced apoptosis specifically in the tumors in vivo. Use of such construct is a very safe way to treat cancer in human. The results presented here reveal important features of λ nanobioparticles to serve as safe delivery and expression platform for human cancer therapy.

  6. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......, and addition of heme caused the pinpoint isolates to revert to normal colony size. Triclosan-induced gentamicin-resistant isolates had mutations in several different genes, and it cannot be directly concluded how the different mutations caused gentamicin resistance. However, since many of the mutations...

  7. Bactericidal Antibiotics Do Not Appear To Cause Oxidative Stress in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Feld, Louise; Knudsen, Gitte Maegaard; Gram, Lone

    2012-01-01

    self-destruction by internal production of hydroxyl radicals. The purpose of the present study was to determine if a similar mechanism is involved in antibiotic killing of the infectious human pathogen, Listeria monocytogenes. We treated wild-type L. monocytogenes and oxidative stress mutants (Δsod......Oxidative stress can be an important contributor to the lethal effect of bactericidal antibiotics in some bacteria, such as Escherichia coli and Staphylococcus aureus. Thus, despite the different target-specific actions of bactericidal antibiotics, they have a common mechanism leading to bacterial...... and Δfri) with three different bactericidal antibiotics and found no difference in killing kinetics. In contrast, wild-type E. coli and an oxidative stress mutant (ΔsodA ΔsodB) differed significantly in their sensitivity to bactericidal antibiotics. We conclude that bactericidal antibiotics did not appear...

  8. Bacteriophages: The viruses for all seasons of molecular biology

    Directory of Open Access Journals (Sweden)

    Karam Jim D

    2005-03-01

    Full Text Available Abstract Bacteriophage research continues to break new ground in our understanding of the basic molecular mechanisms of gene action and biological structure. The abundance of bacteriophages in nature and the diversity of their genomes are two reasons why phage research brims with excitement. The pages of Virology Journal will reflect the excitement of the "New Phage Biology."

  9. Experience of the Eliava Institute in bacteriophage therapy

    Institute of Scientific and Technical Information of China (English)

    Mzia; Kutateladze

    2015-01-01

    <正>The rapid propagation of multidrug resistant bacterial strains is leading to renewed interest in bacteriophage therapy.With challenges in the treatment of bacterial infections,it is essential for people worldwide to understand how alternative approaches,such as bacteriophages,could be used to combat antibiotic resistant bacteria.The Eliava Institute

  10. Prevalence of Listeria monocytogenes in Idiazabal cheese Prevalencia de Listeria monocytogenes en queso Idiazabal

    Directory of Open Access Journals (Sweden)

    E. Arrese

    2012-12-01

    Full Text Available Introduction: Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. Objective: To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. Methodology: A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. Results and conclusion: All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.Introducción: Listeria monocytogenes se ha asociado a quesos elaborados a partir de leche cruda, lo que supone un importante riesgo de salud pública debido a la listeriosis. Objetivo: Estudiar la prevalencia y los niveles de L. monocytogenes en quesos Idiazabal semi-curados de distintos productores del País Vasco, a nivel de consumidor. Metodología: Se analizaron 51 muestras de queso Idiazabal procedentes de 10 establecimientos de venta al público; el muestreo fue aleatorio y estratificado. Los análisis se hicieron según el método de detección y de enumeración del procedimiento estandarizado ISO 11290-1. Resultados y conclusión: Todas las muestras dieron negativo para L. monocytogenes. Sin embargo, el 9,8% dio positivo para Listeria spp., distinta de L. monocytogenes. Las muestras positivas procedían de dos marcas, dos eran quesos naturales y tres ahumados. La presencia de Listeria spss. sugiere que el procesado del queso y la higiene durante el ordeño o durante la fabricación podr

  11. Detection of Listeria monocytogenes with short peptide fragments from class IIa bacteriocins as recognition elements.

    Science.gov (United States)

    Azmi, Sarfuddin; Jiang, Keren; Stiles, Michael; Thundat, Thomas; Kaur, Kamaljit

    2015-03-09

    We employed a direct peptide-bacteria binding assay to screen peptide fragments for high and specific binding to Listeria monocytogenes. Peptides were screened from a peptide array library synthesized on cellulose membrane. Twenty four peptide fragments (each a 14-mer) were derived from three potent anti-listerial peptides, Leucocin A, Pediocin PA1, and Curvacin A, that belong to class IIa bacteriocins. Fragment Leu10 (GEAFSAGVHRLANG), derived from the C-terminal region of Leucocin A, displayed the highest binding among all of the library fragments toward several pathogenic Gram-positive bacteria, including L. monocytogenes, Enterococcus faecalis, and Staphylococcus aureus. The specific binding of Leu10 to L. monocytogenes was further validated using microcantilever (MCL) experiments. Microcantilevers coated with gold were functionalized with peptides by chemical conjugation using a cysteamine linker to yield a peptide density of ∼4.8×10(-3) μmol/cm2 for different peptide fragments. Leu10 (14-mer) functionalized MCL was able to detect Listeria with same sensitivity as that of Leucocin A (37-mer) functionalized MCL, validating the use of short peptide fragments in bacterial detection platforms. Fragment Leu10 folded into a helical conformation in solution, like that of native Leucocin A, suggesting that both Leu10 and Leucocin A may employ a similar mechanism for binding target bacteria. The results show that peptide-conjugated microcantilevers can function as highly sensitive platforms for Listeria detection and hold potential to be developed as biosensors for pathogenic bacteria.

  12. [THE IDENTIFICATION AND DIFFERENTIATION OF BACTERIOPHAGES OF HUMAN PATHOGENIC VIBRIO].

    Science.gov (United States)

    Gaevskaia, N E; Kudriakova, T A; Makedonova, L D; Kachkina, G V

    2015-04-01

    The issue of identification and differentiation of large group of bacteriophages of human pathogenic vibrio is still unresolved. In research and practical applied purposes it is important to consider characteristics of bacteriophages for establishing similarity and differences between them. The actual study was carried out to analyze specimens of DNA-containing bacteriophages of pathogenic vibrio. The overwhelming majority of them characterized by complicated type of symmetry--phages with double-helical DNA and also phages with mono-helical DNA structure discovered recently in vibrio. For the first time, the general framework of identification and differentiation of bacteriophages of pathogenic vibrio was developed. This achievement increases possibility to establish species assignment of phages and to compare with phages registered in the database. "The collection of bacteriophages and test-strains of human pathogenic vibrio" (No2010620549 of 24.09.210).

  13. POSSIBILITES OF BACTERIOPHAGES APPLICATION IN SURGERY AND TRANSPLANTATION

    Directory of Open Access Journals (Sweden)

    N.I. Gabrielyan

    2012-01-01

    Full Text Available The review of the modern data about bacteriophages and to their application to surgery is presented. Interest to bacteriophages is closely connected with an urgency of a problem of postoperative infectious complications and to resistance increase nosocomial species microbes to antibiotics. Successful demonstrative application of bacteriophages on experimental models for a reduction of is conditional-pathogenic microbes in biofilms, for treatment septicemia at the animals, caused resistance species P. aeruginosa, Klebsiella spp., Staphylococcus and other microbes is described. Positive results on application of bacteriophages in surgery are received at treatment of the infected wounds, peritonitis, infectious complications after liver and kidney transplantation. New mechanisms of action of bacteriophages, including their influence on transplantology immunity are resulted. Use of phages as alternatives of treatment and preventive maintenance of a superinfection at imunocomprometive patients is perspective. 

  14. The effects of bacteriophage and nanoparticles on microbial processes

    Science.gov (United States)

    Moody, Austin L.

    There are approximately 1031 tailed phages in the biosphere, making them the most abundant organism. Bacteriophages are viruses that infect bacteria. Due to the large diversity and abundance, no two bacteriophages that have been isolated are genetically the same. Phage products have potential in disease therapy to solve bacteria-related problems, such as infections resulting from resistant strains of Staphylococcus aureus. A bacteriophage capable of infecting methicillin-resistant S. aureus (MRSA) was isolated from bovine hair. The bacteriophage, named JB phage, was characterized using purification, amplification, cesium chloride banding, scanning electron microscopy, and transmission electron microscopy. JB phage and nanoparticles were used in various in vitro and in vivo models to test their effects on microbial processes. Scanning and transmission electron microscopy studies revealed strong interactions between JB phage and nanoparticles, which resulted in increased bacteriophage infectivity. JB phage and nanoparticle cocktails were used as a therapeutic to treat skin and systemic infections in mice caused by MRSA.

  15. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  16. Lack of PPARγ in myeloid cells confers resistance to Listeria monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Zeinab Abdullah

    Full Text Available The peroxisomal proliferator-activated receptor γ (PPARγ is a nuclear receptor that controls inflammation and immunity. Innate immune defense against bacterial infection appears to be compromised by PPARγ. The relevance of PPARγ in myeloid cells, that organize anti-bacterial immunity, for the outcome of immune responses against intracellular bacteria such as Listeria monocytogenes in vivo is unknown. We found that Listeria monocytogenes infection of macrophages rapidly led to increased expression of PPARγ. This prompted us to investigate whether PPARγ in myeloid cells influences innate immunity against Listeria monocytogenes infection by using transgenic mice with myeloid-cell specific ablation of PPARγ (LysMCre×PPARγ(flox/flox. Loss of PPARγ in myeloid cells results in enhanced innate immune defense against Listeria monocytogenes infection both, in vitro and in vivo. This increased resistance against infection was characterized by augmented levels of bactericidal factors and inflammatory cytokines: ROS, NO, IFNγ TNF IL-6 and IL-12. Moreover, myeloid cell-specific loss of PPARγ enhanced chemokine and adhesion molecule expression leading to improved recruitment of inflammatory Ly6C(hi monocytes to sites of infection. Importantly, increased resistance against Listeria infection in the absence of PPARγ was not accompanied by enhanced immunopathology. Our results elucidate a yet unknown regulatory network in myeloid cells that is governed by PPARγ and restrains both listeriocidal activity and recruitment of inflammatory monocytes during Listeria infection, which may contribute to bacterial immune escape. Pharmacological interference with PPARγ activity in myeloid cells might represent a novel strategy to overcome intracellular bacterial infection.

  17. Effectiveness of bacteriophages in the sputum of cystic fibrosis patients.

    Science.gov (United States)

    Saussereau, E; Vachier, I; Chiron, R; Godbert, B; Sermet, I; Dufour, N; Pirnay, J-P; De Vos, D; Carrié, F; Molinari, N; Debarbieux, L

    2014-12-01

    Bacteriophages have been shown to be effective for treating acute infections of the respiratory tract caused by antibiotic-resistant bacteria in animal models, but no evidence has yet been presented of their activity against pathogens in complex biological samples from chronically infected patients. We assessed the efficacy of a cocktail of ten bacteriophages infecting Pseudomonas aeruginosa following its addition to 58 sputum samples from cystic fibrosis (CF) patients collected at three different hospitals. Ten samples that did not contain P. aeruginosa were not analysed further. In the remaining 48 samples, the addition of bacteriophages led to a significant decrease in the levels of P. aeruginosa strains, as shown by comparison with controls, taking two variables (time and bacteriophages) into account (p = 0.024). In 45.8% of these samples, this decrease was accompanied by an increase in the number of bacteriophages. We also tested each of the ten bacteriophages individually against 20 colonies from each of these 48 samples and detected bacteriophage-susceptible bacteria in 64.6% of the samples. An analysis of the clinical data revealed no correlation between patient age, sex, duration of P. aeruginosa colonization, antibiotic treatment, FEV1 (forced expiratory volume in the first second) and the efficacy of bacteriophages. The demonstration that bacteriophages infect their bacterial hosts in the sputum environment, regardless of the clinical characteristics of the patients, represents a major step towards the development of bacteriophage therapy to treat chronic lung infections. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  18. Bacteriophages as viral indicators for radiation processing of water: a chemical approach

    Energy Technology Data Exchange (ETDEWEB)

    Gehringer, Peter E-mail: peter.gehringer@arcs.ac.at; Eschweiler, Helmut; Leth, Hermann; Pribil, Walter; Pfleger, Silvia; Cabaj, Alexander; Haider, Thomas; Sommer, Regina

    2003-06-01

    Inactivation of the bacteriophages PHI X 174 (somatic coliphage), MS2 (F-specific coliphage) and B40-8 (phage infecting Bacteroides fragilis) suspended in tap water was studied applying gamma and electron beam irradiation as well. PHI X 174 phage was found to be a suitable viral indicator for water disinfection by means of ionizing radiation. The nutrient broths introduced simultaneously with the bacteriophages into the water when it is spiked with the phages for the experiments did not significantly change the scavenging capacity of the water matrix. No dose rate effect was observed with MS2 and B40-8 phages but PHI X 174 phage showed a clear dose rate effect. It was found that in water MS2 phage is significantly more sensitive to ionizing radiation than Escherichia coli.

  19. Streptomyces lipmanii expresses two restriction systems that inhibit plasmid transformation and bacteriophage plaque formation.

    Science.gov (United States)

    Matsushima, P; Baltz, R H

    1989-06-01

    Bacteriophage host range studies suggested that several beta-lactam-producing streptomycetes express similar restriction-modification systems. Streptomyces lipmanii LE32 expressed two restriction-modification systems, designated SliI and SliII. A mutant strain, PM87, was defective only in SliI restriction but expressed both SliI and SliII modification. Streptomyces sp. strain A57986, a natural isolate partially deficient in the expression of SliI and SliII restriction, nevertheless modified bacteriophage DNA for both SliI and SliII specificities. Protoplasts of PM87 and A57986 were transformed by several plasmids, and the modified plasmids isolated from these strains transformed wild-type S. lipmanii efficiently.

  20. Recent advances in M13 bacteriophage-based optical sensing applications

    Science.gov (United States)

    Kim, Inhong; Moon, Jong-Sik; Oh, Jin-Woo

    2016-10-01

    Recently, M13 bacteriophage has started to be widely used as a functional nanomaterial for various electrical, chemical, or optical applications, such as battery components, photovoltaic cells, sensors, and optics. In addition, the use of M13 bacteriophage has expanded into novel research, such as exciton transporting. In these applications, the versatility of M13 phage is a result of its nontoxic, self-assembling, and specific binding properties. For these reasons, M13 phage is the most powerful candidate as a receptor for transducing chemical or optical phenomena of various analytes into electrical or optical signal. In this review, we will overview the recent progress in optical sensing applications of M13 phage. The structural and functional characters of M13 phage will be described and the recent results in optical sensing application using fluorescence, surface plasmon resonance, Förster resonance energy transfer, and surface enhanced Raman scattering will be outlined.

  1. Bacteriophage functional genomics and its role in bacterial pathogen detection.

    Science.gov (United States)

    Klumpp, Jochen; Fouts, Derrick E; Sozhamannan, Shanmuga

    2013-07-01

    Emerging and reemerging bacterial infectious diseases are a major public health concern worldwide. The role of bacteriophages in the emergence of novel bacterial pathogens by horizontal gene transfer was highlighted by the May 2011 Escherichia coli O104:H4 outbreaks that originated in Germany and spread to other European countries. This outbreak also highlighted the pivotal role played by recent advances in functional genomics in rapidly deciphering the virulence mechanism elicited by this novel pathogen and developing rapid diagnostics and therapeutics. However, despite a steady increase in the number of phage sequences in the public databases, boosted by the next-generation sequencing technologies, few functional genomics studies of bacteriophages have been conducted. Our definition of 'functional genomics' encompasses a range of aspects: phage genome sequencing, annotation and ascribing functions to phage genes, prophage identification in bacterial sequences, elucidating the events in various stages of phage life cycle using genomic, transcriptomic and proteomic approaches, defining the mechanisms of host takeover including specific bacterial-phage protein interactions and identifying virulence and other adaptive features encoded by phages and finally, using prophage genomic information for bacterial detection/diagnostics. Given the breadth and depth of this definition and the fact that some of these aspects (especially phage-encoded virulence/adaptive features) have been treated extensively in other reviews, we restrict our focus only on certain aspects. These include phage genome sequencing and annotation, identification of prophages in bacterial sequences and genetic characterization of phages, functional genomics of the infection process and finally, bacterial identification using genomic information.

  2. PATOGENESIS DE Listeria monocytogenes, MICROORGANISMO ZOONOTICO EMERGENTE.

    OpenAIRE

    Torres, Kirvis; Sierra, Sara; Potou, Raul; Carrascal, Ana; Mercado, Marcela

    2005-01-01

    Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertido en sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelular de otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismo cuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria de alimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de ...

  3. Interactions of the cell-wall glycopolymers of lactic acid bacteria with their bacteriophages

    Directory of Open Access Journals (Sweden)

    Marie-Pierre eChapot-Chartier

    2014-05-01

    Full Text Available Lactic acid bacteria (LAB are Gram positive bacteria widely used in the production of fermented food in particular cheese and yoghurts. Bacteriophage infections during fermentation processes have been for many years a major industrial concern and have stimulated numerous research efforts. Better understanding of the molecular mechanisms of bacteriophage interactions with their host bacteria is required for the development of efficient strategies to fight against infections. The bacterial cell wall plays key roles in these interactions. First, bacteriophages must adsorb at the bacterial surface through specific interactions with receptors that are cell wall components. At next step, phages must overcome the barrier constituted by cell wall peptidoglycan to inject DNA inside bacterial cell. Also at the end of the infection cycle, phages synthesize endolysins able to hydrolyze peptidoglycan and lyse bacterial cells to release phage progeny. In the last decade, concomitant development of genomics and structural analysis of cell wall components allowed considerable advances in the knowledge of their structure and function in several model LAB. Here, we describe the present knowledge on the structure of the cell wall glycopolymers of the best characterized LAB emphasizing their structural variations and we present the available data regarding their role in bacteria-phage specific interactions at the different steps of the infection cycle.

  4. Discrimination of bacteriophage infected cells using locked nucleic acid fluorescent in situ hybridization (LNA-FISH).

    Science.gov (United States)

    Vilas Boas, Diana; Almeida, Carina; Sillankorva, Sanna; Nicolau, Ana; Azeredo, Joana; Azevedo, Nuno F

    2016-01-01

    Bacteriophage-host interaction studies in biofilm structures are still challenging due to the technical limitations of traditional methods. The aim of this study was to provide a direct fluorescence in situ hybridization (FISH) method based on locked nucleic acid (LNA) probes, which targets the phage replication phase, allowing the study of population dynamics during infection. Bacteriophages specific for two biofilm-forming bacteria, Pseudomonas aeruginosa and Acinetobacter, were selected. Four LNA probes were designed and optimized for phage-specific detection and for bacterial counterstaining. To validate the method, LNA-FISH counts were compared with the traditional plaque forming unit (PFU) technique. To visualize the progression of phage infection within a biofilm, colony-biofilms were formed and infected with bacteriophages. A good correlation (r = 0.707) was observed between LNA-FISH and PFU techniques. In biofilm structures, LNA-FISH provided a good discrimination of the infected cells and also allowed the assessment of the spatial distribution of infected and non-infected populations.

  5. Targeted binding of the M13 bacteriophage to thiamethoxam organic crystals.

    Science.gov (United States)

    Cho, Whirang; Fowler, Jeffrey D; Furst, Eric M

    2012-04-10

    Phage display screening with a combinatorial library was used to identify M13-type bacteriophages that express peptides with selective binding to organic crystals of thiamethoxam. The six most strongly binding phages exhibit at least 1000 times the binding affinity of wild-type M13 and express heptapeptide sequences that are rich in hydrophobic, hydrogen-bonding amino acids and proline. Among the peptide sequences identified, M13 displaying the pIII domain heptapeptide ASTLPKA exhibits the strongest binding to thiamethoxam in competitive binding assays. Electron and confocal microscopy confirm the specific binding affinity of ASTLPKA to thiamethoxam. Using atomic force microscope (AFM) probes functionalized with ASTLPKA expressing phage, we found that the average adhesion force between the bacteriophage and a thiamethoxam surface is 1.47 ± 0.80 nN whereas the adhesion force of wild-type M13KE phage is 0.18 ± 0.07 nN. Such a strongly binding bacteriophage could be used to modify the surface chemistry of thiamethoxam crystals and other organic solids with a high degree of specificity.

  6. Biomimetic self-templating optical structures fabricated by genetically engineered M13 bacteriophage.

    Science.gov (United States)

    Kim, Won-Geun; Song, Hyerin; Kim, Chuntae; Moon, Jong-Sik; Kim, Kyujung; Lee, Seung-Wuk; Oh, Jin-Woo

    2016-11-15

    Here, we describe a highly sensitive and selective surface plasmon resonance sensor system by utilizing self-assembly of genetically engineered M13 bacteriophage. About 2700 copies of genetically expressed peptide copies give superior selectivity and sensitivity to M13 phage-based SPR sensor. Furthermore, the sensitivity of the M13 phage-based SPR sensor was enhanced due to the aligning of receptor matrix in specific direction. Incorporation of specific binding peptide (His Pro Gln: HPQ) gives M13 bacteriophage high selectivity for the streptavidin. Our M13 phage-based SPR sensor takes advantage of simplicity of self-assembly compared with relatively complex photolithography techniques or chemical conjugations. Additionally, designed structure which is composed of functionalized M13 bacteriophage can simultaneously improve the sensitivity and selectivity of SPR sensor evidently. By taking advantages of the genetic engineering and self-assembly, we propose the simple method for fabricating novel M13 phage-based SPR sensor system which has a high sensitivity and high selectivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Inactivation of Escherichia coli O157:H7 attached to spinach harvester blade using bacteriophage.

    Science.gov (United States)

    Patel, Jitendra; Sharma, Manan; Millner, Patricia; Calaway, Todd; Singh, Manpreet

    2011-04-01

    Outbreaks associated with leafy greens have focused attention on the transfer of human pathogens to these commodities during harvest with commercial equipment. Attachment of Escherichia coli O157:H7 on new or rusty spinach harvester blades immersed in spinach extract or 10% tryptic soy broth (TSB) was investigated. Bacteriophages specific for E. coli O157:H7 were evaluated to kill cells attached to blade. A cocktail of five nalidixic acid-resistant E. coli O157:H7 isolates was transferred to 25 mL of spinach extract or 10% TSB. A piece of sterilized spinach harvester blade (2×1") was placed in above spinach extract or 10% TSB and incubated at room (22 °C) or dynamic (30 °C day, 20 °C night) temperatures. E. coli O157:H7 populations attached to blade during incubation in spinach extract or 10% TSB were determined. When inoculated at 1 log CFU/mL, E. coli O157:H7 attachment to blades after 24 and 48 h incubation at dynamic temperature (6.09 and 6.37 log CFU/mL) was significantly higher than when incubated at 22 °C (4.84 and 5.68 log CFU/mL), respectively. After 48 h incubation, two blades were sprayed on each side with a cocktail of E. coli O157-specific bacteriophages before scraping the blade, and subsequent plating on Sorbitol MacConkey media-nalidixic acid. Application of bacteriophages reduced E. coli O157:H7 populations by 4.5 log CFU on blades after 2 h of phage treatment. Our study demonstrates that E. coli O157:H7 can attach to and proliferate on spinach harvester blades under static and dynamic temperature conditions, and bacteriophages are able to reduce E. coli O157:H7 populations adhered to blades.

  8. Inhibition of Listeria monocytogenes by Enterococcus mundtii isolated from soil.

    Science.gov (United States)

    Bigwood, T; Hudson, J A; Cooney, J; McIntyre, L; Billington, C; Heinemann, J A; Wall, F

    2012-12-01

    Two bacterial isolates with inhibitory activity against Listeria monocytogenes and Enterococcus faecalis were obtained from soil. Genotypic and phenotypic characterization identified them as Enterococcus mundtii, a species whose ability to compete with L. monocytogenes is relatively unexplored compared to other members of the genus. The thermal stability of the inhibitory factor and its sensitivity to proteolytic enzymes indicate that it is most likely a bacteriocin. Both isolates grew at comparable rates to L. monocytogenes at 5 °C and 10 °C in vitro. One isolate killed L. monocytogenes when it reached concentrations of 10(6)-10(8) CFU ml(-1). Minimum inocula of 10(6) and 10(5) CFU ml(-1) of E. mundtii were required to reduce and maintain L. monocytogenes concentrations beneath the level of detection at 5 °C and 10 °C, respectively. In situ experiments at 5 °C showed that E. mundtii inhibited the growth of L. monocytogenes on vacuum-packed cold smoked salmon during its four week shelf life. E. mundtii could, therefore, control the growth of L. monocytogenes at low temperatures, indicating a potential application in controlling this pathogen in chilled foods. To control growth of Listeria, the concentration of E. mundtii needs to be high, but it is possible that a purified bacteriocin could be used to achieve the same effect.

  9. STUDIES ON THE BACTERIOPHAGE OF D'HERELLE : VIII. THE MECHANISM OF LYSIS OF DEAD BACTERIA IN THE PRESENCE OF BACTERIOPHAGE.

    Science.gov (United States)

    Bronfenbrenner, J; Muckenfuss, R

    1927-04-30

    We have been able to confirm the observations of Twort as well as of Gratia, that dead staphylococcus may undergo lysis if, in addition to a suitable bacteriophage, there is also present live staphylococcus. Moreover, we have endeavored to ascertain the mechanism of this phenomenon and have found that in order to elicit it it is necessary to control the numbers of live and dead bacteria in the mixture. An excess of dead bacteria interferes with lysis by adsorbing the bacteriophage before it has the opportunity to initiate necessary changes in the live bacteria, so that all lysis is prevented. The phenomenon is specific, that is, the lysis of live bacteria is accompanied by lysis of dead bacteria of the same species only. Lysis of dead bacteria occurs best with staphylococcus, an organism which easily undergoes spontaneous autolysis under appropriate conditions. In the case of B. coli or B. dysenteriae the lysis of the dead bacteria is uncertain. Dead bacteria need not be present in the mixture at the beginning of the experiment; they will be dissolved if added any time before, during, or after the completion of lysis of live bacteria. If the test is performed so that a suitable semipermeable membrane is interposed between the dead and live bacteria, the dead bacteria are not dissolved, in spite of the lysis of live bacteria on the other side of the membrane. The agent determining the lysis of dead bacteria is not diffusible, while the principle initiating the lysis of live bacteria diffuses freely and is demonstrably present on both sides of the membrane. The complete independence of the agent causing dissolution of dead bacteria from bacteriophage can also be shown by separating the two agents by means of filtration, or by adsorption on bacteria. The ferment-like substance responsible for the lysis of dead bacteria is different from the bacteriophage. It is not diffusible through collodion, it is easily adsorbed on clay filters, it is heat-labile, and is

  10. M13 Bacteriophage Based Protein Sensors

    Science.gov (United States)

    Lee, Ju Hun

    Despite significant progress in biotechnology and biosensing, early detection and disease diagnosis remains a critical issue for improving patient survival rates and well-being. Many of the typical detection schemes currently used possess issues such as low sensitivity and accuracy and are also time consuming to run and expensive. In addition, multiplexed detection remains difficult to achieve. Therefore, developing advanced approaches for reliable, simple, quantitative analysis of multiple markers in solution that also are highly sensitive are still in demand. In recent years, much of the research has primarily focused on improving two key components of biosensors: the bio-recognition agent (bio-receptor) and the transducer. Particular bio-receptors that have been used include antibodies, aptamers, molecular imprinted polymers, and small affinity peptides. In terms of transducing agents, nanomaterials have been considered as attractive candidates due to their inherent nanoscale size, durability and unique chemical and physical properties. The key focus of this thesis is the design of a protein detection and identification system that is based on chemically engineered M13 bacteriophage coupled with nanomaterials. The first chapter provides an introduction of biosensors and M13 bacteriophage in general, where the advantages of each are provided. In chapter 2, an efficient and enzyme-free sensor is demonstrated from modified M13 bacteriophage to generate highly sensitive colorimetric signals from gold nanocrystals. In chapter 3, DNA conjugated M13 were used to enable facile and rapid detection of antigens in solution that also provides modalities for identification. Lastly, high DNA loadings per phage was achieved via hydrozone chemistry and these were applied in conjunction with Raman active DNA-gold/silver core/shell nanoparticles toward highly sensitive SERS sensing.

  11. Ecological study of bacteriophages of Vibrio natriegens

    Energy Technology Data Exchange (ETDEWEB)

    Zachary, A.

    1978-03-01

    Effects of temperature and anaerobic conditions on the replication of two bacteriophages, nt-1 and nt-6, of the estuarine bacterium Vibrio natriegens were studied. Reduction in temperature resulted in longer latent periods and reduced burst sizes for both phages. Replication under anaerobic conditions resulted in longer latent periods; however, phage nt-6 had a reduced burst size, whereas phage nt-1 had an increased burst size, resulting in a rate of phage production nearly equal to that observed under aerobic conditions. Therefore the distribution of the phages in marsh areas could be influenced by temperature and anaerobiosis.

  12. Bacteriophage biosensors for antibiotic-resistant bacteria.

    Science.gov (United States)

    Sorokulova, Irina; Olsen, Eric; Vodyanoy, Vitaly

    2014-03-01

    An increasing number of disease-causing bacteria are resistant to one or more anti-bacterial drugs utilized for therapy. Early and speedy detection of these pathogens is therefore very important. Traditional pathogen detection techniques, that include microbiological and biochemical assays are long and labor-intensive, while antibody or DNA-based methods require substantial sample preparation and purification. Biosensors based on bacteriophages have demonstrated remarkable potential to surmount these restrictions and to offer rapid, efficient and sensitive detection technique for antibiotic-resistant bacteria.

  13. A mechanical model of bacteriophage DNA ejection

    Science.gov (United States)

    Arun, Rahul; Ghosal, Sandip

    2017-08-01

    Single molecule experiments on bacteriophages show an exponential scaling for the dependence of mobility on the length of DNA within the capsid. It has been suggested that this could be due to the ;capstan mechanism; - the exponential amplification of friction forces that result when a rope is wound around a cylinder as in a ship's capstan. Here we describe a desktop experiment that illustrates the effect. Though our model phage is a million times larger, it exhibits the same scaling observed in single molecule experiments.

  14. Genetic Exclusion in Bacteriophage T4.

    Science.gov (United States)

    1987-01-01

    ofI resource acquisition, but their genetic determinants are physicall .- linked and possibly co-regiulated or, the same sect ion of DNA. Thec o-eria...7473-7481. Garen, A. (1968). Sense and Nonsense in the Genetic Lode. Science 160:149-159. ( elIer, A. I . and A. rich (1980). A LGA ferarinatio...Mutants Deficient in rni Exclusion. Science 158:1588-1589. 11saio, C. L. and L. W. Black (1977). DNA Plackaging- and the Pathway of Bacteriophage T4

  15. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  16. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  17. Comparison of the hydrophobic grid-membrane filter DNA probe method and the Health Protection Branch standard method for the detection of Listeria monocytogenes in foods.

    Science.gov (United States)

    Yan, W; Malik, M N; Peterkin, P I; Sharpe, A N

    1996-07-01

    The standard Health Protection Branch (HPB) method for the detection of L. monocytogenes in foods involves lengthy enrichment, selection and biochemical testing, requiring up to 8 days to complete. A hydrophobic grid-membrane filter (HGMF) method employing a digoxigenin-labelled listeriolysin O probe required 5 days to complete, and included an image-analysis system for electronic data acquisition. A total of 200 food samples encompassing 8 high-risk food groups (soft and semi-soft cheeses, packaged raw vegetables, frozen cooked shrimp, ground poultry, ground pork, ground beef, jellied meats, and pâté) were screened for the presence of L. monocytogenes by the two methods. Overall, 32 (16%) and 30 (15%) of the naturally-contaminated food samples tested positive for L. monocytogenes by the HPB and DNA methods, respectively. The DNA probe method was highly specific in discriminating L. monocytogenes from other Listeria spp. present in 50 of the samples tested. Results showed 94% sensitivity and 100% specificity between the two methods. The HGMF DNA probe method is an efficient and reliable alternative to the HPB standard method for detecting L. monocytogenes in foods.

  18. A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

    Science.gov (United States)

    Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

    2017-03-21

    Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity.IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis, are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role for

  19. Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

    Directory of Open Access Journals (Sweden)

    Ninoska eCordero

    2016-03-01

    Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

  20. Bacteria detection based on the evolution of enzyme-generated volatile organic compounds: determination of Listeria monocytogenes in milk samples.

    Science.gov (United States)

    Tait, Emma; Perry, John D; Stanforth, Stephen P; Dean, John R

    2014-10-27

    The rapid detection of Listeria monocytogenes contamination in food is essential to prevent food-borne illness in humans. The aim of this study was to differentiate non-contaminated milk from milk contaminated with L. monocytogenes using enzyme substrates coupled with the analysis of volatile organic compounds (VOCs). The method is based on the activity of β-glucosidase and hippuricase enzymes and the detection of a specific VOC i.e. 2-nitrophenol and 3-fluoroaniline, respectively. VOCs were extracted, separated and detected by headspace-solid phase microextraction coupled to gas chromatography-mass spectrometry (HS-SPME GC-MS). This approach required the inclusion of the selective agent's cycloheximide, nalidixic acid and acriflavine HCl in the growth medium to inhibit interfering bacteria. The VOCs were liberated by L. monocytogenes provided that samples contained at least 1-1.5×10(2) CFU ml(-1) of milk prior to overnight incubation. This approach shows potential for future development as a rapid method for the detection of L. monocytogenes contaminated milk.

  1. Interaction of Bacteriophage λ with Its E. coli Receptor, LamB

    Science.gov (United States)

    Chatterjee, Sujoy; Rothenberg, Eli

    2012-01-01

    The initial step of viral infection is the binding of a virus onto the host cell surface. This first viral-host interaction would determine subsequent infection steps and the fate of the entire infection process. A basic understating of the underlining mechanism of initial virus-host binding is a prerequisite for establishing the nature of viral infection. Bacteriophage λ and its host Escherichia coli serve as an excellent paradigm for this purpose. λ phages bind to specific receptors, LamB, on the host cell surface during the infection process. The interaction of bacteriophage λ with the LamB receptor has been the topic of many studies, resulting in wealth of information on the structure, biochemical properties and molecular biology of this system. Recently, imaging studies using fluorescently labeled phages and its receptor unveil the role of spatiotemporal dynamics and divulge the importance of stochasticity from hidden variables in the infection outcomes. The scope of this article is to review the present state of research on the interaction of bacteriophage λ and its E. coli receptor, LamB. PMID:23202520

  2. Efficacy of lytic Staphylococcus aureus bacteriophage against multidrug-resistant Staphylococcus aureus in mice.

    Science.gov (United States)

    Oduor, Joseph Michael Ochieng'; Onkoba, Nyamongo; Maloba, Fredrick; Arodi, Washingtone Ouma; Nyachieo, Atunga

    2016-11-24

    The use of bacteriophages as an alternative treatment method against multidrug-resistant bacteria has not been explored in Kenya. This study sought to determine the efficacy of environmentally obtained lytic bacteriophage against multidrug-resistant Staphylococcus aureus (MDRSA) bacterium in mice. Staphylococcus aureus bacterium and S. aureus-specific lytic phage were isolated from sewage and wastewater collected within Nairobi County, Kenya. Thirty mice were randomly assigned into three groups: MDRSA infection group (n = 20), phage-infection group (n = 5), and non-infection group (n = 5). The MDRSA infection group was further subdivided into three groups: clindamycin treatment (8 mg/kg; n = 5), lytic phage treatment (108 PFU/mL (n = 5), and a combination treatment of clindamycin and lytic phage (n = 5). Treatments were done at either 24 or 72 hours post-infection (p.i), and data on efficacy, bacterial load, and animal physical health were collected. Treatment with phage was more effective (100%) than with clindamycin (62.25% at 24 hours p.i and 87.5% at 72 hours p.i.) or combination treatment (75% at 24 hours p.i. and 90% at 72 hours p.i.) (p aureus lytic bacteriophage has therapeutic potential against MDRSA bacterium in mice.

  3. Complete Genome Sequence of Phytopathogenic Pectobacterium atrosepticum Bacteriophage Peat1.

    Science.gov (United States)

    Kalischuk, Melanie; Hachey, John; Kawchuk, Lawrence

    2015-08-13

    Pectobacterium atrosepticum is a common phytopathogen causing significant economic losses worldwide. To develop a biocontrol strategy for this blackleg pathogen of solanaceous plants, P. atrosepticum bacteriophage Peat1 was isolated and its genome completely sequenced. Interestingly, morphological and sequence analyses of the 45,633-bp genome revealed that phage Peat1 is a member of the family Podoviridae and most closely resembles the Klebsiella pneumoniae bacteriophage KP34. This is the first published complete genome sequence of a phytopathogenic P. atrosepticum bacteriophage, and details provide important information for the development of biocontrol by advancing our understanding of phage-phytopathogen interactions.

  4. Comparative analysis of the biological and physical properties of Enterococcus faecalis bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis bacteriophage vB_SmM_GEC-SmitisM_2.

    Science.gov (United States)

    Rigvava, Sophio; Tchgkonia, Irina; Jgenti, Darejan; Dvalidze, Teona; Carpino, James; Goderdzishvili, Marina

    2013-01-01

    Enterococcus faecalis and Streptococcus mitis are common commensal inhabitants of the human gastrointestinal and genitourinary tracts. However, both species can be opportunistic pathogens and cause disease in nosocomial settings. These infections can be difficult to treat because of the frequency of antibiotic resistance among these strains. Bacteriophages are often suggested as an alternative therapeutic agent against these infections. In this study, E. faecalis and S. mitis strains were isolated from female patients with urinary tract infections. Bacteriophages active against these strains were isolated from sewage water from the Mtkvari River. Two phages, designated vB_EfaS_GEC-EfS_3 (Syphoviridae) and vB_SmM_GEC-SmitisM_2 (Myoviridae), were specific for E. faecalis and S. mitis, respectively. Each phage's growth patterns and adsorption rates were quantified. Sensitivity to ultraviolet light and temperature was determined, as was host range and serology. The S. mitis bacteriophage was found to be more resistant to ultraviolet light and exposure to high temperatures than the E. faecalis bacteriophage, despite having a much greater rate of replication. While each phage was able to infect a broad range of strains of the same species as the host species from which they were isolated, they were unable to infect other host species tested.

  5. Direct Quantitative Detection and Identification of Lactococcal Bacteriophages from Milk and Whey by Real-Time PCR: Application for the Detection of Lactococcal Bacteriophages in Goat's Raw Milk Whey in France

    Directory of Open Access Journals (Sweden)

    Mai Huong Ly-Chatain

    2011-01-01

    Full Text Available The presence of Lactococcus bacteriophages in milk can partly or completely inhibit milk fermentation. To prevent the problems associated with the bacteriophages, the real-time PCR was developed in this study for direct detection from whey and milk of three main groups of Lactococcus bacteriophages, c2, 936, and P335. The optimization of DNA extraction protocol from complex matrices such as whey and milk was optimized allowed the amplification of PCR without any matrix and nontarget contaminant interference. The real-time PCR program was specific and with the detection limit of 102 PFU/mL. The curve slopes were −3.49, −3.69, and −3.45 with the amplification efficiency estimated at 94%, 94%, and 98% and the correlation coefficient (2 of 0.999, 0.999, and 0.998 for c2, 936 and P335 group, respectively. This method was then used to detect the bacteriophages in whey and goat's raw milk coming from three farms located in the Rhône-Alpes region (France.

  6. Genome landscapes and bacteriophage codon usage.

    Directory of Open Access Journals (Sweden)

    Julius B Lucks

    2008-02-01

    Full Text Available Across all kingdoms of biological life, protein-coding genes exhibit unequal usage of synonymous codons. Although alternative theories abound, translational selection has been accepted as an important mechanism that shapes the patterns of codon usage in prokaryotes and simple eukaryotes. Here we analyze patterns of codon usage across 74 diverse bacteriophages that infect E. coli, P. aeruginosa, and L. lactis as their primary host. We use the concept of a "genome landscape," which helps reveal non-trivial, long-range patterns in codon usage across a genome. We develop a series of randomization tests that allow us to interrogate the significance of one aspect of codon usage, such as GC content, while controlling for another aspect, such as adaptation to host-preferred codons. We find that 33 phage genomes exhibit highly non-random patterns in their GC3-content, use of host-preferred codons, or both. We show that the head and tail proteins of these phages exhibit significant bias towards host-preferred codons, relative to the non-structural phage proteins. Our results support the hypothesis of translational selection on viral genes for host-preferred codons, over a broad range of bacteriophages.

  7. A Look inside the Listeria monocytogenes Biofilms Extracellular Matrix

    Directory of Open Access Journals (Sweden)

    Angelo Colagiorgi

    2016-07-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen able to persist in food industry and is responsible for a severe illness called listeriosis. The ability of L. monocytogenes to persist in environments is due to its capacity to form biofilms that are a sessile community of microorganisms embedded in a self-produced matrix of extracellular polymeric substances (EPS’s. In this review, we summarized recent efforts performed in order to better characterize the polymeric substances that compose the extracellular matrix (ECM of L. monocytogenes biofilms. EPS extraction and analysis led to the identification of polysaccharides, proteins, extracellular DNA, and other molecules within the listerial ECM. All this knowledge will be useful for increasing food protection, suggesting effective strategies for the minimization of persistence of L. monocytogenes in food industry environments.

  8. FDA Bacteriological Analytical Manual, Chapter 10, 2003: Listeria monocytogenes

    Science.gov (United States)

    FDA Bacteriological Analytical Manual, Chapter 10 describes procedures for analysis of food samples and may be adapted for assessment of solid, particulate, aerosol, liquid and water samples containing Listeria monocytogenes.

  9. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  10. Pyelonephritis with bacteremia caused by Listeria monocytogenes: A case report.

    Science.gov (United States)

    Uno, Shunsuke; Hase, Ryota; Toguchi, Akihiro; Otsuka, Yoshihito; Hosokawa, Naoto

    2017-02-01

    Listeria monocytogenes is a well-known cause of meningitis, colitis, and bacteremia; however, obstructive pyelonephritis caused by L. monocytogenes has never been reported. We herein report on a 90-year-old Japanese woman with obstructive pyelonephritis and bacteremia due to uterus carcinoma invading the ureter. She was admitted to our hospital complaining of fever and chills, and her physical examination revealed left costovertebral angle tenderness. Computed tomography showed hydronephrosis and complete ureteral obstruction due to tumor invasion. Blood and urine cultures upon nephrostomy revealed the growth of L. monocytogenes. We treated the patient with two weeks of intravenous ampicillin and an additional one-week treatment of oral sulfamethoxazole/trimethoprim. This case shows the importance to recognize L. monocytogenes as a potential causative agent of urinary tract infection. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  11. Reassessment of the Listeria monocytogenes pan-genome reveals dynamic integration hotspots and mobile genetic elements as major components of the accessory genome

    Directory of Open Access Journals (Sweden)

    Kuenne Carsten

    2013-01-01

    Full Text Available Abstract Background Listeria monocytogenes is an important food-borne pathogen and model organism for host-pathogen interaction, thus representing an invaluable target considering research on the forces governing the evolution of such microbes. The diversity of this species has not been exhaustively explored yet, as previous efforts have focused on analyses of serotypes primarily implicated in human listeriosis. We conducted complete genome sequencing of 11 strains employing 454 GS FLX technology, thereby achieving full coverage of all serotypes including the first complete strains of serotypes 1/2b, 3c, 3b, 4c, 4d, and 4e. These were comparatively analyzed in conjunction with publicly available data and assessed for pathogenicity in the Galleria mellonella insect model. Results The species pan-genome of L. monocytogenes is highly stable but open, suggesting an ability to adapt to new niches by generating or including new genetic information. The majority of gene-scale differences represented by the accessory genome resulted from nine hyper variable hotspots, a similar number of different prophages, three transposons (Tn916, Tn554, IS3-like, and two mobilizable islands. Only a subset of strains showed CRISPR/Cas bacteriophage resistance systems of different subtypes, suggesting a supplementary function in maintenance of chromosomal stability. Multiple phylogenetic branches of the genus Listeria imply long common histories of strains of each lineage as revealed by a SNP-based core genome tree highlighting the impact of small mutations for the evolution of species L. monocytogenes. Frequent loss or truncation of genes described to be vital for virulence or pathogenicity was confirmed as a recurring pattern, especially for strains belonging to lineages III and II. New candidate genes implicated in virulence function were predicted based on functional domains and phylogenetic distribution. A comparative analysis of small regulatory RNA candidates

  12. Nanoscale detection of bacteriophage triggered ion cascade (Invited Paper)

    Science.gov (United States)

    Dobozi-King, Maria; Seo, Sungkyu; Kim, Jong U.; Cheng, Mosong; Kish, Laszlo B.; Young, Ryland

    2005-05-01

    In an era of potential bioterrorism and pandemics of antibiotic-resistant microbes, bacterial contaminations of food and water supplies is a major concern. There is an urgent need for the rapid, inexpensive and specific identification of bacteria under field conditions. Here we describe a method that combines the specificity and avidity of bacteriophages with fluctuation analysis of electrical noise. The method is based on the massive, transitory ion leakage that occurs at the moment of phage DNA injection into the host cell. The ion fluxes require only that the cells be physiologically viable (i.e., have energized membranes) and can occur within seconds after mixing the cells with sufficient concentrations of phage particles. To detect these fluxes, we have constructed a nano-well, a lateral, micron-size capacitor of titanium electrodes with gap size of 150 nm, and used it to measure the electrical field fluctuations in microliter (mm3) samples containing phage and bacteria. In mixtures where the analyte bacteria were sensitive to the phage, large stochastic waves with various time and amplitude scales were observed, with power spectra of approximately 1/f2 shape over at 1 - 10 Hz. Development of this SEPTIC (SEnsing of Phage-Triggered Ion Cascades) technology could provide rapid detection and identification of live, pathogenic bacteria on the scale of minutes, with unparalleled specificity. The method has a potential ultimate sensitivity of 1 bacterium/microliter (1 bacterium/mm3).

  13. Detection and enumeration of F-specific bacteriophages

    NARCIS (Netherlands)

    Mooijman KA; Bahar M; Havelaar AH; MGB

    2000-01-01

    Tijdens het EU-project 'Bacteriofagen in zwemwater' (januari 1996 - juni 1999) werd onderzoek uitgevoerd ten behoeve van de optimalisatie van de methode voor de detectie en enumeratie van F-specifieke (RNA) fagen in water. Er werd gekeken of verdere optimalisatie van de procedure zoals be

  14. Caratterizzazione biomolecolare di listeria monocytogenes in suini regolarmente macellati

    OpenAIRE

    Santoro, Cristina

    2009-01-01

    Listeria monocytogenes è un batterio patogeno responsabile di una malattia potenzialmente molto grave per l’uomo. L’infezione avviene soprattutto tramite l’ingestione di alimenti di origine animale contaminati, e può propagarsi per via transplacentare al feto. Il potenziale patogeno di L. monocytogenes è dovuto soprattutto a caratteristici fattori di virulenza con i quali alcuni ceppi sono in grado di attaccare la cellula dell’organismo ospite potendo aderire, invadere, moltiplicare e prop...

  15. Stabilization of T4 bacteriophage at acidic and basic pH by adsorption on paper.

    Science.gov (United States)

    Meyer, Abigail; Greene, Melissa; Kimmelshue, Chad; Cademartiri, Rebecca

    2017-09-05

    Bacteriophages find applications in agriculture, medicine, and food safety. Many of these applications can expose bacteriophages to stresses that inactivate them including acidic and basic pH. Bacteriophages can be stabilized against these stresses by materials including paper, a common material in packaging and consumer products. Combining paper and bacteriophages creates antibacterial materials, which can reduce the use of antibiotics. Here we show that adsorption on paper protects T4, T5, and T7 bacteriophage from acidic and basic pH. We added bacteriophages to filter paper functionalized with carboxylic acid (carboxyl methyl cellulose) or amine (chitosan) groups, and exposed them to pH from 5.6 to 14. We determined the number of infective bacteriophages after exposure directly on the paper. All papers extended the lifetime of infective bacteriophage by at least a factor of four with some papers stabilizing bacteriophages for up to one week. The degree of stabilization depended on five main factors (i) the family of the bacteriophage, (ii) the charge of the paper and bacteriophages, (iii) the location of the bacteriophages within the paper, (iv) the ability of the paper to prevent bacteriophage-bacteriophage aggregation, and (v) the sensitivity of the bacteriophage proteins to the tested pH. Even when adsorbed on paper the bacteriophages were able to remove E. coli in milk. Choosing the right paper modification or material will protect bacteriophages adsorbed on that material against detrimental pH and other environmental challenges increasing the range of applications of bacteriophages on materials. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. 基于DPO引物的多重PCR在检测单增李斯特菌中的应用%Multiplex PCR for Detection of Listeria monocytogenes with DPO Primers

    Institute of Scientific and Technical Information of China (English)

    刘纯真; 王云龙; 景建洲

    2011-01-01

    Dual priming oligonucleotide(DPO) primers of three genes, hly, prfA and iap, of Listeria monocytogenes were applied for the detection of L. Monocytogenes by multiplex polymerase chain reaction (PCR), and compared with 3 pairs of regular primers. The results showed that DPO primers had high specificity compared with conventional PCR primers, could detect L. Monocytogenes accurately and quickly.%根据单增李斯特菌(Listeria monocytogenes)的hly、prfA和iap基因设计了3对常规引物和DPO(Dual priming oligonucleotide)引物,采用多重PCR的方法,建立了单增李斯特菌的快速检测体系,并比较了常规引物和DPO引物的优劣,结果表明DPO引物的特异性强,能够快速准确地检测单增李斯特菌.

  17. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  18. Isolation and Identification of Listeria monocytogenes from Retail

    Directory of Open Access Journals (Sweden)

    A.D.I. Alsheikh

    2013-02-01

    Full Text Available Listeria species are widely distributed in environment and L. monocytogenes are the causal agent of Listeriosis, the disease that can be serious and fatal to human and animals. The objectives of this study were to detect, isolate and identify Listeria monocytogenes from retail broiler chicken ready to eat meat products in restaurants-Khartoum state, Sudan. A total of 250 retail broiler chicken ready to eat meat products were collected from restaurants in Khartoum State, 50 sample from frozen chicken burger, 50 sample from frozen chicken sausages, 50 sample from frozen chicken meat balls (kofta, 50 sample from chicken shawerma and 50 sample from chicken mortedella, Listeria spp. were isolated by the conventional International Organization for Standardization method and L. monocytogenes identified by biochemical test. The results showed that out of total 250 samples, 95 (38% were found to be contaminated with Listeria spp. the isolation rate was as follows: L. monocytogenes (13.6%, L. ivanovi (20.8%, L. grayi (1.6%, L. seeligeri (0.8% and L. welshimeri (1.2%. The results presented in this study indicate the contamination of retail broiler chicken ready to eat meat products with L. monocytogenes. This study reported the occurrence and distribution of L. monocytogenes and other Listeria species in retail meat products (frozen chicken burger, frozen chicken sausages, frozen chicken meat balls (kofta, chicken shawerma and chicken mortedella, purchased from restaurants in Khartoum state Sudan.

  19. Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga.

    Science.gov (United States)

    Akya, Alisha; Pointon, Andrew; Thomas, Connor

    2010-03-01

    Listeria monocytogenes is a ubiquitous bacterium capable of infecting humans, particularly pregnant women and immunocompromised individuals. Although the intracellular invasion and pathogenesis of listeriosis in mammalian tissues has been well studied, little is known about the ecology of L. monocytogenes , and in particular the environmental reservoir for this bacterium has not been identified. This study used short-term co-culture at 15, 22 and 37 degrees C to examine the interaction of L. monocytogenes strains with Acanthamoeba polyphaga ACO12. Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within a few hours post-phagocytosis, irrespective of the incubation temperature used. Wild-type L. monocytogenes and a phenotypic listeriolysin O mutant were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls were able to survive and multiply within A. polyphaga trophozoites. The data presented indicate that A. polyphaga ACO12 is unlikely to harbour L. monocytogenes, or act as an environmental reservoir for this bacterium.

  20. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  1. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection.

  2. Listeria monocytogenes a pathogen down-to-earth

    Directory of Open Access Journals (Sweden)

    Anne-Laure eVivant

    2013-11-01

    Full Text Available Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavour of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  3. Effect of salt types and concentrations on the high-pressure inactivation of Listeria monocytogenes in ground chicken.

    Science.gov (United States)

    Balamurugan, S; Ahmed, Rafath; Chibeu, Andrew; Gao, Anli; Koutchma, Tatiana; Strange, Phil

    2016-02-01

    National and international health agencies have recommended a significant reduction in daily intake of sodium by reducing the amount of NaCl in foods, specifically processed meats. However, sodium reduction could increase the risk of survival and growth of spoilage and pathogenic microorganisms on these products. Therefore, alternate processing technologies to improve safety of sodium reduced foods are necessary. This study examined the effects of three different salt types and concentrations on high-pressure inactivation of Listeria monocytogenes in pre-blended ground chicken formulations. Ground chicken formulated with three salt types (NaCl, KCl, CaCl2), at three concentrations (0, 1.5, 2.5%) and inoculated with a four strain cocktail of L. monocytogenes (10(8) CFU g(-1)) were subjected to four pressure treatments (0, 100, 300, 600 MPa) and two durations (60, 180 s) in an experiment with factorial design. Surviving cells were enumerated by plating on Oxford agar and analysed by factorial ANOVA. Pressure treatments at 100 or 300 MPa did not significantly (P=0.19-050) reduce L. monocytogenes populations. Neither salt type nor concentration had a significant effect on L. monocytogenes populations at these pressure levels. At 600 MPa, salt types, concentrations and duration of pressure treatment all had a significant effect on L. monocytogenes populations. Formulations with increasing concentrations of NaCl or KCl showed significantly lower reduction in L. monocytogenes, while increase in CaCl2 concentration resulted in a significantly higher L. monocytogenes reduction. For instance, increase in NaCl concentration from 0 to 1.5 or 2.5% resulted in a log reduction of 6.16, 2.49 and 1.29, respectively, when exposed to 600 MPa for 60s. In the case of CaCl2, increase from 0 to 1.5 or 2.5% resulted in a log reduction of 6.16, 7.28 and 7.47, respectively. These results demonstrate that high-pressure processing is a viable process to improve microbial safety of sodium

  4. Diversity and persistence of Listeria monocytogenes within the Gorgonzola PDO production chain and comparison with clinical isolates from the same area.

    Science.gov (United States)

    Filipello, Virginia; Gallina, Silvia; Amato, Ettore; Losio, Marina Nadia; Pontello, Mirella; Decastelli, Lucia; Lomonaco, Sara

    2017-03-20

    Listeria monocytogenes causes invasive syndromes with high fatality rates in specific population groups. Cheeses have been commonly implicated in outbreaks worldwide. Gorgonzola is a cheese only produced in Northwestern Italy (it is the third Italian cheese in terms of production and export) and L. monocytogenes is frequently isolated from the production chain. The aims of this study were to assess the distribution of L. monocytogenes Virulence Types (VTs) in isolates collected in Gorgonzola processing plants and to determine the presence of Epidemic Clones (ECs). Fifty-Six L. monocytogenes strains collected between 2004 and 2016 from cheese and environmental samples were subtyped with Multi-Virulence-Locus Sequence Typing (MVLST) and compared to previously typed strains. Most isolates (n=50) belonged to two new VTs (VT113 and VT114). The remaining isolates belonged to previously identified VTs: VT14-ECVIII (milk chocolate outbreak, 1994, USA) and VT80 (ricotta salata outbreak, 2012, USA). VT14, VT80 and VT113 were shared with isolates from apparently sporadic human cases in the same geographical area and temporal period (Piedmont and Lombardy, 2005-2016). The overall L. monocytogenes population appears to be homogeneous and may be characteristic of Gorgonzola production. Nevertheless, the detection in cheese and environmental samples of VTs observed in clinical isolates or outbreak related strains (VT80, VT14) contributed to better describe the current scenario and pointed out the need for increased surveillance.

  5. Plasmonic Enzyme-Linked Immunosorbent Assay Using Nanospherical Brushes as a Catalase Container for Colorimetric Detection of Ultralow Concentrations of Listeria monocytogenes.

    Science.gov (United States)

    Chen, Rui; Huang, Xiaolin; Xu, Hengyi; Xiong, Yonghua; Li, Yanbin

    2015-12-30

    Plasmonic enzyme-linked immunosorbent assay (pELISA) based on catalase (CAT)-mediated gold nanoparticle growth exhibits ultrahigh sensitivity for detecting disease-related biomarkers using sandwich formats. However, the limit of detection (LOD) of this strategy for Listeria monocytogenes is only around 10(3) CFU/mL, which considerably exceeds the amount of L. monocytogenes commonly present in food products (container" to increase enzyme loading for enhancing the detection signal. Under optimal conditions, the proposed pELISA exhibits good specificity and excellent sensitivity for L. monocytogenes with a LOD of 8 × 10(1) CFU/mL in 0.01 M phosphate-buffered saline, via a reaction that can be discriminated by the naked eye. The LOD obtained by this method was 2 and 5 orders of magnitude lower than that of conventional CAT-based pELISA and horseradish peroxidase (HRP)-based conventional ELISA, respectively. Coupled with large-volume immunomagnetic separation, the LOD for L. monocytogenes-spiked lettuce samples reached 8 × 10(1) CFU/g. The improved pELISA also exhibited a great potential in detecting a single cell of L. monocytogenes in 100 μL of solution.

  6. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  7. BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Lea

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  8. IL-17A-producing resident memory γδ T cells orchestrate the innate immune response to secondary oral Listeria monocytogenes infection.

    Science.gov (United States)

    Romagnoli, Pablo A; Sheridan, Brian S; Pham, Quynh-Mai; Lefrançois, Leo; Khanna, Kamal M

    2016-07-26

    Memory γδ T cells are important for the clearance of Listeria monocytogenes infection in the intestinal mucosa. However, the mechanisms by which memory γδ T cells provide protection against secondary oral infection are poorly understood. Here we used a recombinant strain of L. monocytogenes that efficiently invades the intestinal epithelium to show that Vγ4(+) memory γδ T cells represent a resident memory (Trm) population in the mesenteric lymph nodes (MLNs). The γδ Trm exhibited a remarkably static pattern of migration that radically changed following secondary oral L. monocytogenes infection. The γδ Trms produced IL-17A early after rechallenge and formed organized clusters with myeloid cells surrounding L. monocytogenes replication foci only after a secondary oral infection. Antibody blocking studies showed that in addition to IL-17A, the chemokine receptor C-X-C chemokine receptor 3 (CXCR3) is also important to enable the local redistribution of γδ Trm cells and myeloid cells specifically near the sites of L. monocytogenes replication within the MLN to restrict bacterial growth and spread. Our findings support a role for γδ Trms in orchestrating protective immune responses against intestinal pathogens.

  9. 单增李斯特菌鉴定方法比较研究%COMPARATIVE EVALUATION ON THREE METHODS OF IDENTIFICATION OF LISTERIA MONOCYTOGENES

    Institute of Scientific and Technical Information of China (English)

    李秀娟; 徐保红; 高伟利; 李波; 宋红梅; 张仁伟

    2011-01-01

    [Objective] To evaluate the methods on identification of the Listeria monocytogenes. [Methods] 17 strains of Listeria monocytogenes were identified with API assay and 16S rRNA gene sequence analysis, pyrosequencing assay. [Re-sylts] Three methods all can identify 17 strains of Iisteria monocytogenes. [Conclusion] The pyrosequencing technology provides a specific, rapid, and real-time method for detection of Iisteria monocytogenes. It is helpful for the rapid and high-flux identification of Iisteria monocytogenes.%[目的]对单增李斯特菌鉴定方法进行研究.[方法]分别用API检测方法、16S rRNA序列分析法和焦磷酸测序法对17株单核细胞增生李斯特菌进行检测.[结果]3种方法均能准确鉴定单增李斯特菌.[结论]焦磷酸测序方法检测单增李斯特菌特异性强、经济、操作简便、检测快速,为单增李斯特菌的快速、高通量检测提供了一种新的手段.

  10. A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA, but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival

    Directory of Open Access Journals (Sweden)

    Grischa Y. Chen

    2017-03-01

    Full Text Available Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK, an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA, an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity.

  11. Extraction and Study of Bacteriophages, Used against Agents of Potato Soft Rot

    Directory of Open Access Journals (Sweden)

    Magda D. Davitashvili

    2012-12-01

    Full Text Available The use of specific bacteriophages and their complex mixtures against bacterial diseases is very effective. As for causative agent of potato soft rot Erwinia carotovora, specific phages (25 phages in total were extracted from diseased potato, soil and sewage. The study of their biological properties showed the diversity of phages in terms of lytic action, virion plaque and morphology, as well as in relation to different environmental factors. Phages showed explicit antibacterial activity in vitro in liquid and solid media, as well as during model tests of potato tubers artificial inoculation.

  12. Antimicrobial bacteriophage-derived proteins and therapeutic applications

    Science.gov (United States)

    Antibiotics have the remarkable power to control bacterial infections. Unfortunately, widespread use, whether regarded as prudent or not, has favored the emergence and persistence of antibiotic resistant strains of human pathogenic bacteria, resulting in a global health threat. Bacteriophages (pha...

  13. Bacteria vs. Bacteriophages: Parallel Evolution of Immune Arsenals.

    Science.gov (United States)

    Shabbir, Muhammad A B; Hao, Haihong; Shabbir, Muhammad Z; Wu, Qin; Sattar, Adeel; Yuan, Zonghui

    2016-01-01

    Bacteriophages are the most common entities on earth and represent a constant challenge to bacterial populations. To fend off bacteriophage infection, bacteria evolved immune systems to avert phage adsorption and block invader DNA entry. They developed restriction-modification systems and mechanisms to abort infection and interfere with virion assembly, as well as newly recognized clustered regularly interspaced short palindromic repeats (CRISPR). In response to bacterial immune systems, bacteriophages synchronously evolved resistance mechanisms, such as the anti-CRISPR systems to counterattack bacterial CRISPR-cas systems, in a continuing evolutionary arms race between virus and host. In turn, it is fundamental to the survival of the bacterial cell to evolve a system to combat bacteriophage immune strategies.

  14. Bacteriophages as potential new therapeutics to replace or supplement antibiotics.

    Science.gov (United States)

    Kutateladze, Mzia; Adamia, Revaz

    2010-12-01

    Over recent decades, a growing body of literature has validated the use of bacteriophages for therapy and prophylaxis in the war against drug-resistant bacteria. Today, much more is known about bacteriophages than in the 1930s when phage therapy first appeared and began to spread to many countries. With rapid dissemination of multi-drug-resistant bacterial pathogens, the interest in alternative remedies to antibiotics, including bacteriophage treatments, is gaining new ground. Based on recent experience and current results of bacteriophage applications against bacterial infections in countries where this alternative therapy is approved, many scientists and companies have come to believe that the use of phages for treating and preventing bacterial diseases will be successful.

  15. Bacteria vs. bacteriophages: parallel evolution of immune arsenals

    Directory of Open Access Journals (Sweden)

    Muhammad Abu Bakr Shabbir

    2016-08-01

    Full Text Available Bacteriophages are the most common entities on earth and represent a constant challenge to bacterial populations. To fend off bacteriophage infection, bacteria evolved immune systems to avert phage adsorption and block invader DNA entry. They developed restriction-modification systems and mechanisms to abort infection and interfere with virion assembly, as well as newly recognized clustered regularly interspaced short palindromic repeats (CRISPR. In response to bacterial immune systems, bacteriophages synchronously evolved resistance mechanisms, such as the anti-CRISPR systems to counterattack bacterial CRISPR-cas systems, in a continuing evolutionary arms race between virus and host. In turn, it is fundamental to the survival of the bacterial cell to evolve a system to combat bacteriophage immune strategies.

  16. Bacteriophage therapy: an alternative to antibiotic therapy in aquaculture?

    National Research Council Canada - National Science Library

    Morrison, S; Rainnie, D.J

    2004-01-01

    This report documents one aspect of the atypical furunculosis research program, namely a literature reiew of bacteriophage treatment, either by itself or in combination with other approaches to disease intervention. Le...

  17. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism.

  18. Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

    Directory of Open Access Journals (Sweden)

    Ivy Reid A

    2008-11-01

    Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

  19. Inactivation of Escherichia coli, Listeria monocytogenes and Yersinia enterocolitica in fermented sausages during maturation/storage.

    Science.gov (United States)

    Lindqvist, Roland; Lindblad, Mats

    2009-01-31

    The purpose of this study was to evaluate maturation and storage conditions as a way to increase the safety of non-heat treated fermented sausages. The specific objectives were to investigate the effects of storage time and temperature on the levels of Escherichia coli, Listeria monocytogenes and Yersinia enterocolitica in fermented sausages and in broth, and to validate how well the broth experiments and some published models can predict inactivation in sausage. One strain each of E. coli, L. monocytogenes and Y. enterocolitica with induced acid tolerance was inoculated into sausage batters representing a typical Swedish recipe for cold-smoked sausages. The sausages were fermented at 27 degrees C for 39 or 48 h and then stored at different temperatures (8, 15, or 20-22 degrees C) for up to 44 days. The levels of the experimental strains, lactic acid bacteria, and pH, a(w), and lactic acid was measured during the maturation/storage period. Inactivation in BHI broths adjusted to pH 4.4 or 4.6, water activity of 0.93, and with 1, 1.3 or 2% lactic acid added was also studied. For all strains inactivation rates increased with temperature in both broths and sausages. At 8 degrees C the storage time required for a one-log reduction in sausage ranged from 21 days for E. coli, >16 days for L. monocytogenes, to 18 days for Y. enterocolitica. At temperatures of 20 degrees C or more, the storage time needed for a one log reduction was shorter: between 7 to 11 days for E. coli, 4 to 7 days for L. monocytogenes, and 1 to 4 days for Y. enterocolitica. A published model based on temperature only yielded a good prediction of E. coli inactivation in sausage. A linear model based on the rate estimated in broth yielded a fair prediction of L. monocytogenes inactivation. The performance of other inactivation models validated was unsatisfactory. Significant E. coli growth which occurred in batters without salt during initial phases of fermentation resulted in a subsequent increased

  20. Purification of phage display-modified bacteriophage T4 by affinity chromatography

    Directory of Open Access Journals (Sweden)

    Figura Grzegorz

    2011-05-01

    Full Text Available Abstract Background Affinity chromatography is one of the most efficient protein purification strategies. This technique comprises a one-step procedure with a purification level in the order of several thousand-fold, adaptable for various proteins, differentiated in their size, shape, charge, and other properties. The aim of this work was to verify the possibility of applying affinity chromatography in bacteriophage purification, with the perspective of therapeutic purposes. T4 is a large, icosahedral phage that may serve as an efficient display platform for foreign peptides or proteins. Here we propose a new method of T4 phage purification by affinity chromatography after its modification with affinity tags (GST and Histag by in vivo phage display. As any permanent introduction of extraneous DNA into a phage genome is strongly unfavourable for medical purposes, integration of foreign motifs with the phage genome was not applied. The phage was propagated in bacteria expressing fusions of the phage protein Hoc with affinity tags from bacterial plasmids, independently from the phage expression system. Results Elution profiles of phages modified with the specific affinity motifs (compared to non-specific phages document their binding to the affinity resins and effective elution with standard competitive agents. Non-specific binding was also observed, but was 102-105 times weaker than the specific one. GST-modified bacteriophages were also effectively released from glutathione Sepharose by proteolytic cleavage. The possibility of proteolytic release was designed at the stage of expression vector construction. Decrease in LPS content in phage preparations was dependent on the washing intensity; intensive washing resulted in preparations of 11-40 EU/ml. Conclusions Affinity tags can be successfully incorporated into the T4 phage capsid by the in vivo phage display technique and they strongly elevate bacteriophage affinity to a specific resin. Affinity

  1. Sequence and comparative analysis of Leuconostoc dairy bacteriophages

    DEFF Research Database (Denmark)

    Kot, Witold; Hansen, Lars Henrik; Neve, Horst

    2014-01-01

    and protein levels was observed. Genome comparison also revealed very high conservation of the overall genomic organization between the classes. The genes were organized in functional modules responsible for replication, packaging, head and tail morphogenesis, cell lysis and regulation and modification......Bacteriophages attacking Leuconostoc species may significantly influence the quality of the final product. There is however limited knowledge of this group of phages in the literature. We have determined the complete genome sequences of nine Leuconostoc bacteriophages virulent to either Leuconostoc...

  2. Methods for initial characterization of Campylobacter jejuni bacteriophages

    DEFF Research Database (Denmark)

    Sørensen, Martine Camilla Holst; Gencay, Yilmaz Emre; Brøndsted, Lone

    2017-01-01

    Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity.......Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity....

  3. Complete Genome Sequence of Phytopathogenic Pectobacterium atrosepticum Bacteriophage Peat1

    OpenAIRE

    Kalischuk, Melanie; Hachey, John; Kawchuk, Lawrence

    2015-01-01

    Pectobacterium atrosepticum is a common phytopathogen causing significant economic losses worldwide. To develop a biocontrol strategy for this blackleg pathogen of solanaceous plants, P. atrosepticum bacteriophage Peat1 was isolated and its genome completely sequenced. Interestingly, morphological and sequence analyses of the 45,633-bp genome revealed that phage Peat1 is a member of the family Podoviridae and most closely resembles the Klebsiella pneumoniae bacteriophage KP34. This is the fir...

  4. Bacteriophages, revitalized after 100 years in the shadow of antibiotics

    Institute of Scientific and Technical Information of China (English)

    Hongping; Wei

    2015-01-01

    <正>The year 2015 marks 100 years since Dr.Frederick Twort discovered the"filterable lytic factor",which was later independently discovered and named "bacteriophage" by Dr.Felix d’Herelle.On this memorable centennial,it is exciting to see a special issue published by Virologica Sinica on Phages and Therapy.In this issue,readers will not only fi nd that bacteriophage research is a

  5. Genome Sequences of Three Novel Bacillus cereus Bacteriophages

    OpenAIRE

    Julianne H Grose; Jensen, Jordan D.; Merrill, Bryan D.; Fisher, Joshua N. B.; Burnett, Sandra H.; Breakwell, Donald P

    2014-01-01

    The Bacillus cereus group is an assemblage of highly related firmicute bacteria that cause a variety of diseases in animals, including insects and humans. We announce three high-quality, complete genome sequences of bacteriophages we isolated from soil samples taken at the bases of fruit trees in Utah County, Utah. While two of the phages (Shanette and JL) are highly related myoviruses, the bacteriophage Basilisk is a siphovirus.

  6. Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

    Science.gov (United States)

    Djordjevic, Marko

    2005-11-01

    Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely

  7. Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE.

    Science.gov (United States)

    Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne

    2013-08-16

    Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

  8. The effect of micro-architectural structure of cabbage substratum and or background bacterial flora on the growth of Listeria monocytogenes.

    Science.gov (United States)

    Ongeng, Duncan; Ryckeboer, Jaak; Vermeulen, An; Devlieghere, Frank

    2007-11-01

    The effect of micro-architectural structure of cabbage (Brassica oleracea var. capitata L.) substratum and or background bacterial flora on the growth of Listeria monocytogenes as a function of incubation temperature was investigated. A cocktail mixture of Pseudomonas fluorescens, Pantoea agglomerans and Lactobacillus plantarum was constituted to a population density of approximately 5 log CFU/ml in order to pseudo-simulate background bacterial flora of fresh-cut cabbage. This mixture was co-inoculated with L. monocytogenes (approximately 3 log CFU/ml) on fresh-cut cabbage or in autoclaved cabbage juice followed by incubation at different temperatures (4-30 degrees C). Data on growth of L. monocytogenes were fitted to the primary growth model of Baranyi in order to generate the growth kinetic parameters of the pathogen. During storage, microbial ecology was dominated by P. fluorescens and L. plantarum at refrigeration and abuse temperature, respectively. At all temperatures investigated, lag duration (lambda, h), maximum specific growth rate (micro(max), h(-1)) and maximum population density (MPD, log CFU/ml) of L. monocytogenes were only affected by medium micro-architectural structure, except at 4 degrees C where it had no effect on the micro(max) of the pathogen. Comparison of observed values of micro(max) with those obtained from the Pathogen Modelling Program (PMP), showed that PMP overestimated the growth rate of L. monocytogenes on fresh-cut cabbage and in cabbage juice, respectively. Temperature dependency of micro(max) of L. monocytogenes, according to the models of Ratkowsky and Arrhenius, showed linearity for temperature range of 4-15 degrees C, discontinuities and linearity again for temperature range of 20-30 degrees C. The results of this experiment have shown that the constituted background bacterial flora had no effect on the growth of L. monocytogenes and that micro-architectural structure of the vegetable was the primary factor that limited the

  9. Spontaneous release of bacteriophage particles by Lactobacillus rhamnosus pen.

    Science.gov (United States)

    Jarocki, Piotr; Podleśny, Marcin; Pawelec, Jarosław; Malinowska, Agata; Kowalczyk, Sylwia; Targoński, Zdzisław

    2013-03-01

    The identification of bacteriophage proteins on the surface of Lactobacillus rhamnosus Pen was performed by LC-MS/MS analysis. Among the identified proteins, we found a phage-derived major tail protein, two major head proteins, a portal protein, and a host specificity protein. Electron microscopy of a cell surface extract revealed the presence of phage particles in the analyzed samples. The partial sequence of genes encoding the major tail protein for all tested L. rhamnosus strains was determined with specific primers designed in this study. Next, RT-PCR analysis allowed detection of the expression of the major tail protein gene in L. rhamnosus strain Pen at all stages of bacterial growth. The transcription of genes encoding the major tail protein was also proved for other L. rhamnosus strains used in this study. The present work demonstrates the spontanous release of prophage-encoded particles by a commercial probiotic L. rhamnosus strain, which did not significantly affect the bacterial growth of the analyzed strain.

  10. Bacteriophages as indicators of faecal pollution and enteric ...

    Science.gov (United States)

    Bacteriophages are an attractive alternative to fecal indicator bacteria (FIB), particularly as surrogates of enteric virus fate and transport due to their closer morphological and biological properties compared to FIB. Based on a meta-analysis of published data, we summarize concentrations of coliphages (F+ and somatic), Bacteroides spp. and enterococci bacteriophages (phages) in human waste, non-human waste, fresh and marine waters as well as removal through wastewater treatment processes. We also provide comparisons with FIB and enteric viruses whenever possible. Lastly, we examine fate and transport characteristics in the environment and provide an overview of the methods available for detection and enumeration of bacteriophages. In summary, concentrations of FIB bacteriophages in various sources were consistently lower than FIB, but more reflective of infectious enteric virus levels. Our investigation supports use of bacteriophages as viral surrogates especially for wastewater treatment processes, while additional research is needed to clarify their utility as indicators of viral fate and transport in the ambient water. Describes concentrations and removal through environmental and engineered systems of bacteriophages, fecal indicator bacteria and viral pathogens.

  11. Predicting growth rates and growth boundary of Listeria monocytogenes - An international validation study with focus on processed and ready-to-eat meat and seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Gunvig, A.; Borggaard, C.

    2010-01-01

    they take into account. The most complex model included the effect of nine environmental parameters and it performed better than the other less complex models both for prediction of maximum specific growth rates (mu(max) values) and for the growth boundary of L. monocytogenes. For this model bias...... and accuracy factors for growth rate predictions were 1.0 and 1.5, respectively, and 89% of the growth/no-growth responses were correctly predicted. The performance of three other models, including the effect of five to seven environmental parameters, was considered acceptable with bias factors of 1.2 to 1...... to accurately predict growth responses of L. monocytogenes in the wide range of food evaluated in the present study. When complexity of L monocytogenes growth models matches the complexity of foods of interest. i.e. the number of hurdles to microbial growth, then predicted growth responses of the pathogen can...

  12. Effects of high-pressure processing on Listeria monocytogenes , spoilage microflora and multiple compound quality indices in chilled cold-smoked salmon

    DEFF Research Database (Denmark)

    Lakshmanan, R.; Dalgaard, Paw

    2004-01-01

    ), 150, 200 and 250 MPa. Secondly, storage trials with the naturally contaminated product and HPP at 0.1 (control) and 200 MPa were realized. Shelf-life, microbial changes and chemical changes were determined and existing predictive models and multiple compound quality indices evaluated. HPP with 250 MPa...... did not inactivate L. monocytogenes but significant lag phases of 17 and 10 days were observed at ca 5 and 10degreesC, respectively. HPP with 200 MPa had a marked effect on both colour and texture of CSS.Conclusions: High-pressure processing was unable to prevent growth of L. monocytogenes or spoilage......