WorldWideScience

Sample records for monocytogenes specific bacteriophages

  1. Receptor binding proteins of Listeria monocytogenes bacteriophages A118 and P35 recognize serovar-specific teichoic acids

    Energy Technology Data Exchange (ETDEWEB)

    Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)

    2015-03-15

    Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.

  2. Effect of a bacteriophage cocktail in combination with modified atmosphere packaging in controlling Listeria monocytogenes on fresh-cut spinach

    Directory of Open Access Journals (Sweden)

    Boyacioglu O.

    2016-06-01

    Full Text Available A Listeria monocytogenes-specific bacteriophage cocktail was evaluated for its activity against a nalidixic acid-resistant L. monocytogenes (Lm-NalR isolate on fresh-cut spinach stored under modified atmosphere packaging at various temperatures. Pieces (~2 × 2 cm2 of fresh spinach inoculated with 4.5 log CFU/cm2 Lm-NalR were sprayed with the phage cocktail (6.5 log plaque-forming units [PFU]/cm2 or a control. The samples were stored at 4°C or 10°C for up to 14 d in sealed packages filled with either atmospheric air (AA or modified atmosphere (MA. At 4°C under AA, the phages significantly (P ≤ 0.05 lowered the Lm-NalR populations on spinach, compared to control-treated inoculated samples, by 1.12 and 1.51 log CFU/cm2 after 1 and 14 d, respectively. At 4°C under MA, Lm-NalR was significantly reduced by 1.95 log CFU/cm2 compared to control leaves after both 1 and 14 d. At 10°C under AA, the phages significantly reduced Lm-NalR by 1.50 and 2.51 log CFU/cm2 after 1 and 14 d compared to the control. Again at 10°C under MA, the phages significantly reduced Lm-NalR by 1.71 and 3.24 log CFU/cm2 compared to control after 1 and 14 d, respectively. The results support the potential of lytic bacteriophages in effectively reducing populations of L. monocytogenes on freshcut leafy produce, under both AA and MA conditions.

  3. Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

    Science.gov (United States)

    Guenther, Susanne; Loessner, Martin J

    2011-03-01

    Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

  4. 40 CFR 180.1261 - Xanthomonas campestris pv. vesicatoria and Pseudomonas syringae pv. tomato specific Bacteriophages.

    Science.gov (United States)

    2010-07-01

    ... and Pseudomonas syringae pv. tomato specific Bacteriophages. 180.1261 Section 180.1261 Protection of.... vesicatoria and Pseudomonas syringae pv. tomato specific Bacteriophages. An exemption from the requirement of... syringae pv. tomato specific bacteriophages in or on pepper and tomato. [74 FR 26536, June 3, 2009] ...

  5. 21 CFR 172.785 - Listeria-specific bacteriophage preparation.

    Science.gov (United States)

    2010-04-01

    ... application to meat and poultry products that comply with the ready-to-eat definition in 9 CFR 430.1. Current... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Listeria-specific bacteriophage preparation. 172.785 Section 172.785 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  6. Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2014-01-01

    To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

  7. Bacteriophages

    International Nuclear Information System (INIS)

    Klieve, A.V.

    2005-01-01

    Bacteriophages or phages are bacterial viruses and are present in the rumen in large numbers. They are obligate pathogens of bacteria and are ubiquitous to the rumen ecosystem. Bacteriophages are capable of lysing their bacterial hosts within the rumen and are therefore regarded as contributing to protein recycling within the rumen, a process identified as reducing the efficiency of feed utilization. However, their presence may not be entirely detrimental to the ecosystem, and it has been argued that phages may also be involved in the maintenance of a balanced ecosystem and may play a role in recycling limiting nutrients within the rumen. Furthermore, phage therapy is enjoying a renaissance and the use of phages to control or eliminate detrimental or unwanted microbes from the gastro-intestinal tract, such as Shiga-toxin producing E. coli (food-borne disease), Streptococcus bovis (acidosis in grain-fed cattle) and methanogens (produce the greenhouse gas methane), is the focus of current investigation. In order to be able to study the interaction between individual bacteriophages and their bacterial hosts, it is necessary to: (a) isolate the phage of interest from other viruses in the source material; (b) to derive stock cultures of known phage concentration; (c) store the isolated phages; and (d) determine basic physical characteristics, such as morphology. These procedures are achieved using classical microbiological procedures and this will be the methodology described in this chapter. It is also necessary to determine nucleic acid characteristics of the phage genome and to fingerprint the phage population in the rumen using molecular biological techniques. These will be described and discussed in Chapter 4.2

  8. UV ability to destroy poliovirus end FRNA specific bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Baron, J.; Joret, J.C.; Lesavre, J.; Perrot, J.Y.

    1996-01-01

    In France, the use of ultraviolet radiation to disinfect secondary effluents is only in its initial stage. The aim of this study was to examine the ability of UV to destroy Poliovirus Type 1 and FRNA specific bacteriophages (laboratory MS2 phages and indigenous phages). Concentrated viral solutions were mixed with secondary effluents artificially enriched with suspended solids and then irradiated at various UV dose in a collimated beam. Bacteriological analysis of Escherichia coli and enterococci were performed at the same time. UV were very efficient to kill Poliovirus : Inactivation of 3 and 5 log units were observed respectively at UV doses of 20 and 40 mW/cm{sup 2}. The Poliovirus disinfection rate was almost the same than Escherichia coli. Enterococci were more resistant than E. coli. Inactivation of MS2 bacteriophages was significantly correlated to UV dose following the relationship MS2 Inactivation = 0.047{sup *} Dose + 0,396. At UV dose of 20 mWs/cm{sup 2}, MS2 phages were 2.3 times more resistant to UV than Poliovirus, i.e. they need UV dose 2,3 times greater to be disinfected at the same level. A review of the literature has also shown that viruses more resistant to UV treatment have never been reported. All this would tend to confirm the interest of this group of virus as indicators of the disinfection efficiency of UV, which could indicate, on site, the inactivation of pathogenic viruses. Inactivation rates obtained for FRNA phages proved the good virucidal activity of UV. The inactivation of indigenous FRNA bacteriophages was not correlated with E. coli inactivation. On the other hand, it was correlated with enterococci inactivation. (Author). 23 refs., 7 figs., 4 tabs.

  9. Fluorescent nanodiamond-bacteriophage conjugates maintain host specificity.

    Science.gov (United States)

    Trinh, Jimmy T; Alkahtani, Masfer H; Rampersaud, Isaac; Rampersaud, Arfaan; Scully, Marlan; Young, Ryland F; Hemmer, Philip; Zeng, Lanying

    2018-06-01

    Rapid identification of specific bacterial strains within clinical, environmental, and food samples can facilitate the prevention and treatment of disease. Fluorescent nanodiamonds (FNDs) are being developed as biomarkers in biology and medicine, due to their excellent imaging properties, ability to accept surface modifications, and lack of toxicity. Bacteriophages, the viruses of bacteria, can have exquisite specificity for certain hosts. We propose to exploit the properties of FNDs and phages to develop phages conjugated with FNDs as long-lived fluorescent diagnostic reagents. In this study, we develop a simple procedure to create such fluorescent probes by functionalizing the FNDs and phages with streptavidin and biotin, respectively. We find that the FND-phage conjugates retain the favorable characteristics of the individual components and can discern their proper host within a mixture. This technology may be further explored using different phage/bacteria systems, different FND color centers and alternate chemical labeling schemes for additional means of bacterial identification and new single-cell/virus studies. © 2018 Wiley Periodicals, Inc.

  10. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  11. Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

    Science.gov (United States)

    Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

    2016-10-01

    Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

  12. RNAi screen reveals host cell kinases specifically involved in Listeria monocytogenes spread from cell to cell.

    Directory of Open Access Journals (Sweden)

    Ryan Chong

    Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin

  13. Effectiveness of cooking to reduce norovirus and infectious F-specific RNA bacteriophage concentrations in Mytilus edulis.

    Science.gov (United States)

    Flannery, J; Rajko-Nenow, P; Winterbourn, J B; Malham, S K; Jones, D L

    2014-08-01

    The aim of this study was to determine if domestic cooking practices can reduce concentrations of norovirus (NoV) and F-specific RNA (FRNA) bacteriophage in experimentally contaminated mussels. Mussels (n = 600) contaminated with NoV and FRNA bacteriophage underwent four different cooking experiments performed in triplicate at ~70°C and >90°C. Concentrations of infectious FRNA bacteriophage (using a plaque assay) were compared with concentrations of FRNA bacteriophage and NoV determined using a standardised RT-qPCR. Initial concentrations of infectious FRNA bacteriophage (7·05 log10  PFU g(-1) ) in mussels were not significantly reduced in simmering water (~70°C); however, cooking at higher temperatures (>90°C) reduced infectious FRNA bacteriophage to undetected levels within 3 min. Further investigation determined the time required for a 1-log reduction of infectious FRNA bacteriophage at 90°C to be 42 s therefore a >3-log reduction in infectious virus can be obtained by heating mussel digestive tissue to 90°C for 126 s. Domestic cooking practices based on shell opening alone do not inactivate infectious virus in mussels, however, cooking mussels at high temperatures is effective to reduce infectious virus concentrations and the risk of illness in consumers. The data will contribute towards evidence-based cooking recommendations for shellfish to provide a safe product for human consumption. © 2014 The Society for Applied Microbiology.

  14. Bacteriophage Assembly

    Directory of Open Access Journals (Sweden)

    Anastasia A. Aksyuk

    2011-02-01

    Full Text Available Bacteriophages have been a model system to study assembly processes for over half a century. Formation of infectious phage particles involves specific protein-protein and protein-nucleic acid interactions, as well as large conformational changes of assembly precursors. The sequence and molecular mechanisms of phage assembly have been elucidated by a variety of methods. Differences and similarities of assembly processes in several different groups of bacteriophages are discussed in this review. The general principles of phage assembly are applicable to many macromolecular complexes.

  15. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  16. Sequence specificity of mutagenesis in the cI gene of bacteriophage lambda

    International Nuclear Information System (INIS)

    Skopek, T.R.; Wood, R.D.; Hutchinson, F.

    1985-01-01

    Studies of DNA base sequence alterations have shown that for every agent the mutagenic process is specific with respect to the types of base changes induced and the location of the changes in the DNA. Analysis of the types of mutations produced by mutagenic agents can provide insight into the mechanism of mutation and can suggest which DNA lesions may be involved in the actual mutagenic event. We have developed a system for the analysis of chemically induced base sequence alterations in the cI repressor gene of bacteriophage lambda using DNA sequencing techniques. To illustrate the utility of this type of analysis, we present the results obtained with ultraviolet light (UV). Irradiation of target DNA with UV alone, or UV followed by photoreactivating light (which removes dimers), produces mostly transitions at pyrimidine-pyrimidine sites. Conversely, irradiation with 313 nm light plus acetophenone (which produces only thymine dimers) produces mostly transversions at low efficiency. This and other evidence suggests that the actual premutagenic UV lesion in E. coli may not be pyrimidine-pyrimidine dimers, but rather pyr(6-4)pyo photoproducts

  17. Specificity of interactions among the DNA-packaging machine components of T4-related bacteriophages.

    Science.gov (United States)

    Gao, Song; Rao, Venigalla B

    2011-02-04

    Tailed bacteriophages use powerful molecular motors to package the viral genome into a preformed capsid. Packaging at a rate of up to ∼2000 bp/s and generating a power density twice that of an automobile engine, the phage T4 motor is the fastest and most powerful reported to date. Central to DNA packaging are dynamic interactions among the packaging components, capsid (gp23), portal (gp20), motor (gp17, large "terminase"), and regulator (gp16, small terminase), leading to precise orchestration of the packaging process, but the mechanisms are poorly understood. Here we analyzed the interactions between small and large terminases of T4-related phages. Our results show that the gp17 packaging ATPase is maximally stimulated by homologous, but not heterologous, gp16. Multiple interaction sites are identified in both gp16 and gp17. The specificity determinants in gp16 are clustered in the diverged N- and C-terminal domains (regions I-III). Swapping of diverged region(s), such as replacing C-terminal RB49 region III with that of T4, switched ATPase stimulation specificity. Two specificity regions, amino acids 37-52 and 290-315, are identified in or near the gp17-ATPase "transmission" subdomain II. gp16 binding at these sites might cause a conformational change positioning the ATPase-coupling residues into the catalytic pocket, triggering ATP hydrolysis. These results lead to a model in which multiple weak interactions between motor and regulator allow dynamic assembly and disassembly of various packaging complexes, depending on the functional state of the packaging machine. This might be a general mechanism for regulation of the phage packaging machine and other complex molecular machines.

  18. Bacteriophages for detection of bacterial pathogens

    International Nuclear Information System (INIS)

    Kutateladze, M.

    2009-01-01

    The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

  19. DEPENDENCE BETWEEN ACYLATION DEGREE AND SPECIFIC LYSIS ACTITIVY OF THE PSEUDOMONAS AERUGINOSA М6 BACTERIOPHAGE

    Directory of Open Access Journals (Sweden)

    Martynov A. V.

    2016-06-01

    Full Text Available Introduction. The purpose of this work is to study the influence of various degrees of protein’s acylation on lytic activity and other biological properties of Pseudomonas M6 bacteriophage. Materials and methods. The subject of the study were samples of the Pseudomonas O 12 bacteriophage, hereinafter named the M6 phage. Pure phage lines were obtained from individual standard-morphology phage plaques (plaque-forming units, or PFUs after ten passes over the indicator strain. In subsequent experiments, M6 phage samples were selected that had a sufficient level of purity (homogeneous in the morphology of virions that inactivated the homologic antiphage serum by no less than 99.0% and the heterologic antibacterial serum by no more than 1%, and a titer no lower than 10 PFU per ml (PFU/ml. Titration of the phages was conducted using the standard bilayer agar. The crude protein content in the phage suspensions was determined using the spectroscopic method (at 280 and 260 nm. Succinylation of the phage samples was conducted according to the method developed by T.J. Molenaar. The phage’s lytic activity spectrum was determined through spot tests on 224 strains of the Pseudomonas genus and 106 strains of other genera (correspondingly, of strains Enterobacter -40, Escherichia -10, Citrobacter -8, Hafnia -7, Serratia -6, Shigella -10, Salmonella -8, Proteus -7 through the use of a phage suspension containing 10 5 - 10 6 PFU/ml. (This concentration of infectious phage corpuscles corresponds with the critical distribution of the M6 phage. The results of the research were subjected to statistical processing using single-factor dispersion analysis. Results and discussion. One hundred percent phage protein acylation leads to a loss of adsorption ability on sensitive cells and is accompanied by a significant (more than 103 times decrease in the level of specific lytic activity in the phage preparations. The succinylation type being studied does not cause

  20. RNA Packing Specificity and Folding during Assembly of the Bacteriophage MS2

    Directory of Open Access Journals (Sweden)

    Ottar Rolfsson

    2008-01-01

    Full Text Available Using a combination of biochemistry, mass spectrometry, NMR spectroscopy and cryo-electron microscopy (cryo-EM, we have been able to show that quasi-equivalent conformer switching in the coat protein (CP of an RNA bacteriophage (MS2 is controlled by a sequence-specific RNA–protein interaction. The RNA component of this complex is an RNA stem-loop encompassing just 19 nts from the phage genomic RNA, which is 3569 nts in length. This binding results in the conversion of a CP dimer from a symmetrical conformation to an asymmetric one. Only when both symmetrical and asymmetrical dimers are present in solution is assembly of the T = 3 phage capsid efficient. This implies that the conformers, we have characterized by NMR correspond to the two distinct quasi-equivalent conformers seen in the 3D structure of the virion. An icosahedrally-averaged single particle cryo-EM reconstruction of the wild-type phage (to ∼9 Å resolution has revealed icosahedrally ordered density encompassing up to 90% of the single-stranded RNA genome. The RNA is seen with a novel arrangement of two concentric shells, with connections between them along the 5-fold symmetry axes. RNA in the outer shell interacts with each of the 90 CP dimers in the T = 3 capsid and although the density is icosahedrally averaged, there appears to be a different average contact at the different quasi-equivalent protein dimers: precisely the result that would be expected if protein conformer switching is RNA-mediated throughout the assembly pathway. This unprecedented RNA structure provides new constraints for models of viral assembly and we describe experiments aimed at probing these. Together, these results suggest that viral genomic RNA folding is an important factor in efficient assembly, and further suggest that RNAs that could sequester viral CPs but not fold appropriately could act as potent inhibitors of viral assembly.

  1. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  2. Comparison of the cleavage of pyrimidine dimers by the bacteriophage T4 and Micrococcus luteus uv-specific endonucleases

    International Nuclear Information System (INIS)

    Gordon, L.K.; Haseltine, W.A.

    1980-01-01

    A comparison was made of the activity of the uv-specific endonucleases of bacteriophage T4 (T4 endonuclease V) and of Micrococcus luteus on ultraviolet light-irradiated DNA substrates of defined sequence. The two enzyms cleave DNA at the site of pyrimidine dimers with the same frequency. The products of the cleavage reaction are the same. The pyrimidine dimer DNA-glycosylase activity of both enzymes is more active on double-stranded DNA than it is on single-stranded DNA

  3. Occurrence of male-specific bacteriophage in feral and domestic animal wastes, human feces, and human-associated wastewaters.

    Science.gov (United States)

    Calci, K R; Burkhardt, W; Watkins, W D; Rippey, S R

    1998-12-01

    Male-specific bacteriophage (MSB) densities were determined in animal and human fecal wastes to assess their potential impact on aquatic environments. Fecal samples (1,031) from cattle, chickens, dairy cows, dogs, ducks, geese, goats, hogs, horses, seagulls, sheep, and humans as well as 64 sewerage samples were examined for MSB. All animal species were found to harbor MSB, although the great majority excreted these viruses at very low levels. The results from this study demonstrate that in areas affected by both human and animal wastes, wastewater treatment plants are the principal contributors of MSB to fresh, estuarine, and marine waters.

  4. Isolation and characterization of specific bacteriophage Va1 to Vibrio alginolyticus

    Directory of Open Access Journals (Sweden)

    Carla Fernández Espinel

    2017-04-01

    Full Text Available Vibrio alginolyticus is associated with diseases in aquaculture. The misuse of antibiotics has led to the search for alternatives in the treatment of bacterial diseases, among them the application of bacteriophages that infect and destroy bacteria selectively. In this way, a highly lytic V. alginolyticus bacteriophage, termed Va1, was isolated, with the aim to evaluate its physical chemical parameters. For this purpose, different temperature, pH, chloroform exposure and host range conditions were evaluated. The temperature stability of phage Va1 showed higher titers at 20 and 30 °C decreasing from 40 °C. With respect to pH, the highest titers for the bacteriophage were between 5 and 8, and chloroform exposure reduced viability of the Va1 phage by 25%. The one-step curve determined that the latency period and the burst size were 20 minutes and 192 PFU / infective center respectively. Under the transmission electron microscope, the Va1 phage showed an icosahedral head and a non-contractile tail, belonging to the Podoviridae family. In conclusion, Va1 phage presents potential characteristics for use in phage therapy.

  5. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Directory of Open Access Journals (Sweden)

    Jessica A. Gray

    2018-04-01

    Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

  6. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

    Science.gov (United States)

    Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  7. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Science.gov (United States)

    Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  8. Nano/Micro Formulations for Bacteriophage Delivery.

    Science.gov (United States)

    Cortés, Pilar; Cano-Sarabia, Mary; Colom, Joan; Otero, Jennifer; Maspoch, Daniel; Llagostera, Montserrat

    2018-01-01

    Encapsulation methodologies allow the protection of bacteriophages for overcoming critical environmental conditions. Moreover, they improve the stability and the controlled delivery of bacteriophages which is of great innovative value in bacteriophage therapy. Here, two different encapsulation methodologies of bacteriophages are described using two biocompatible materials: a lipid cationic mixture and a combination of alginate with the antacid CaCO 3 . To perform bacteriophage encapsulation, a purified lysate highly concentrated (around 10 10 -10 11  pfu/mL) is necessary, and to dispose of a specific equipment. Both methodologies have been successfully applied for encapsulating Salmonella bacteriophages with different morphologies. Also, the material employed does not modify the antibacterial action of bacteriophages. Moreover, both technologies can also be adapted to any bacteriophage and possibly to any delivery route for bacteriophage therapy.

  9. DNA Packaging Specificity of Bacteriophage N15 with an Excursion into the Genetics of a Cohesive End Mismatch.

    Directory of Open Access Journals (Sweden)

    Michael Feiss

    Full Text Available During DNA replication by the λ-like bacteriophages, immature concatemeric DNA is produced by rolling circle replication. The concatemers are processed into mature chromosomes with cohesive ends, and packaged into prohead shells, during virion assembly. Cohesive ends are generated by the viral enzyme terminase, which introduces staggered nicks at cos, an approx. 200 bp-long sequence containing subsites cosQ, cosN and cosB. Interactions of cos subsites of immature concatemeric DNA with terminase orchestrate DNA processing and packaging. To initiate DNA packaging, terminase interacts with cosB and nicks cosN. The cohesive ends of N15 DNA differ from those of λ at 2/12 positions. Genetic experiments show that phages with chromosomes containing mismatched cohesive ends are functional. In at least some infections, the cohesive end mismatch persists through cyclization and replication, so that progeny phages of both allelic types are produced in the infected cell. N15 possesses an asymmetric packaging specificity: N15 DNA is not packaged by phages λ or 21, but surprisingly, N15-specific terminase packages λ DNA. Implications for genetic interactions among λ-like bacteriophages are discussed.

  10. Identification of the origin of faecal contamination in estuarine oysters using Bacteroidales and F-specific RNA bacteriophage markers.

    Science.gov (United States)

    Mieszkin, S; Caprais, M P; Le Mennec, C; Le Goff, M; Edge, T A; Gourmelon, M

    2013-09-01

    The aim of this study was to identify the origin of faecal pollution impacting the Elorn estuary (Brittany, France) by applying microbial source tracking (MST) markers in both oysters and estuarine waters. The MST markers used were as follows: (i) human-, ruminant- and pig-associated Bacteroidales markers by real-time PCR and (ii) human genogroup II and animal genogroup I of F-specific RNA bacteriophages (FRNAPH) by culture/genotyping and by direct real-time reverse-transcriptase PCR. The higher occurrence of the human genogroup II of F-specific RNA bacteriophages using a culture/genotyping method, and human-associated Bacteroidales marker by real-time PCR, allowed the identification of human faecal contamination as the predominant source of contamination in oysters (total of 18 oyster batches tested) and waters (total of 24 water samples tested). The importance of using the intravalvular liquids instead of digestive tissues, when applying host-associated Bacteroidales markers in oysters, was also revealed. This study has shown that the application of a MST toolbox of diverse bacterial and viral methods can provide multiple lines of evidence to identify the predominant source of faecal contamination in shellfish from an estuarine environment. Application of this MST toolbox is a useful approach to understand the origin of faecal contamination in shellfish harvesting areas in an estuarine setting. © 2013 The Society for Applied Microbiology.

  11. A resolvase-like protein is requered for the site-specific integration of the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.

    1996-01-01

    upstream of attP. The N-terminal 150 to 1180 amino acids of Orf1 showed 38 to 44% similarity to the resolvase group of site-specific integrases, while no similarity to know proteins was found in the C-terminal end. Bacteriophage 'TP901-1 therefore contains a unique integration system that does not resemble...... the Int class of site-specific integrases usually found in temperate bacteriophages. The constructed integration vector, pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20% of the transformation efficiency....

  12. Ex vivo and in vivo evaluation of microemulsion based transdermal delivery of E. coli specific T4 bacteriophage: A rationale approach to treat bacterial infection.

    Science.gov (United States)

    Rastogi, Vaibhav; Yadav, Pragya; Verma, Anurag; Pandit, Jayanta K

    2017-09-30

    This study is focused on the development and evaluation of transdermal delivery of E. coli-specific T4 bacteriophages both ex-vivo and in-vivo using microemulsion as delivery carrier in eradicating the infection caused by E. coli. Microemulsions were prepared by mixing selected oil, surfactants and aqueous phase containing bacteriophages. The formulations were subjected to physicochemical characterization, ex-vivo and in-vivo permeation, stability studies, histological and immunofluorescence examination. The colloidal system exhibits a uniform size distribution, of finite size (150-320nm). Transmission electron microscopy revealed the encapsulation of bacteriophage in the aqueous globule. Ex-vivo permeation across skin was successfully achieved as 6×10 6 PFU/mL and 6.7×10 6 PFU/mL of T4 permeated from ME 6% and 10%, respectively. ME 6% was found to be thermodynamically stable and in-vivo permeation resulted in 5.49×10 5 PFU/mL of bacteriophages in the blood of the E. coli challenged rats, while 2.48×10 5 PFU/mL was detected in germ free rats, at the end of the study. Infected rats that were treated with bacteriophage were survived while significant mortality was observed in others. Histological and IL-6 immunofluorescence examination of the tissues revealed the efficacy/safety of the therapy. The microemulsion-based transdermal delivery of bacteriophage could be a promising approach to treat the infections caused by antibiotic-resistant bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Microencapsulation of Clostridium difficile specific bacteriophages using microfluidic glass capillary devices for colon delivery using pH triggered release.

    Directory of Open Access Journals (Sweden)

    Gurinder K Vinner

    Full Text Available The prevalence of pathogenic bacteria acquiring multidrug antibiotic resistance is a global health threat to mankind. This has motivated a renewed interest in developing alternatives to conventional antibiotics including bacteriophages (viruses as therapeutic agents. The bacterium Clostridium difficile causes colon infection and is particularly difficult to treat with existing antibiotics; phage therapy may offer a viable alternative. The punitive environment within the gastrointestinal tract can inactivate orally delivered phages. C. difficile specific bacteriophage, myovirus CDKM9 was encapsulated in a pH responsive polymer (Eudragit® S100 with and without alginate using a flow focussing glass microcapillary device. Highly monodispersed core-shell microparticles containing phages trapped within the particle core were produced by in situ polymer curing using 4-aminobenzoic acid dissolved in the oil phase. The size of the generated microparticles could be precisely controlled in the range 80 μm to 160 μm through design of the microfluidic device geometry and by varying flow rates of the dispersed and continuous phase. In contrast to free 'naked' phages, those encapsulated within the microparticles could withstand a 3 h exposure to simulated gastric fluid at pH 2 and then underwent a subsequent pH triggered burst release at pH 7. The significance of our research is in demonstrating that C. difficile specific phage can be formulated and encapsulated in highly uniform pH responsive microparticles using a microfluidic system. The microparticles were shown to afford significant protection to the encapsulated phage upon prolonged exposure to an acid solution mimicking the human stomach environment. Phage encapsulation and subsequent release kinetics revealed that the microparticles prepared using Eudragit® S100 formulations possess pH responsive characteristics with phage release triggered in an intestinal pH range suitable for therapeutic

  14. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase

    DEFF Research Database (Denmark)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana

    2016-01-01

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression of a ...

  15. Bacteriophage populations

    International Nuclear Information System (INIS)

    Klieve, A.V.; Gilbert, R.A.

    2005-01-01

    Bacteriophages are ubiquitous to the rumen ecosystem; they have a role in nitrogen metabolism through bacterial lysis in the rumen, they may help to regulate bacterial population densities, be an agent for genetic exchange and be of use in biocontrol of bacterial populations through phage therapy. In Chapter 2.1, classical methodologies to enable the isolation, enumeration, storage and morphological characterization of phages were presented. In addition to these classic procedures, molecular biological techniques have resulted in a range of methodologies to investigate the type, topology and size of phage nucleic acids, to fingerprint individual phage strains and to create a profile of ruminal phage populations. Different phage families possess all the currently identified combinations of double-stranded or single-stranded RNA or DNA and may also possess unusual bases such as 5-hydroxymethylcytosine (found in T-even phage) or 5- hydroxymethyluracil and uracil in place of thymidine. In all morphological groups of phage except the filamentous phages, the nucleic acid is contained within a head or polyhedral structure, predominantly composed of protein. Filamentous phages have their nucleic acid contained inside the helical filament, occupying much of its length. Many of the procedures used with phage nucleic acids and double-stranded (ds) DNA, in particular, are not specific to ruminal phages but are the same as in other areas where nucleic acids are investigated and are covered elsewhere in the literature and this chapter. Most applications with rumen phages are similar to those reported for phages of non-ruminal bacteria and are covered in general texts such as Maniatis et al. In this chapter, we will concentrate on aspects of methodology as they relate to ruminal phages

  16. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  17. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo; Zhu, Bin; Hamdan, Samir; Richardson, Charles C.

    2010-01-01

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical

  18. Specificity of binding to four-way junctions in DNA by bacteriophage T7 endonuclease I.

    OpenAIRE

    Parsons, C A; West, S C

    1990-01-01

    T7 endonuclease I binds specifically to four-way junctions in duplex DNA and promotes their resolution into linear duplexes. Under conditions in which the nuclease activity is blocked by the absence of divalent cations, the enzyme forms a distinct protein-DNA complex with the junction, as detected by gel retardation and filter binding assays. The formation of this complex is structure-specific and contrasts with the short-lived binding complexes formed on linear duplex DNA. The binding comple...

  19. Isolation of a bacteriophage specific for a new capsular type of Klebsiella pneumoniae and characterization of its polysaccharide depolymerase.

    Directory of Open Access Journals (Sweden)

    Chun-Ru Hsu

    Full Text Available BACKGROUND: Klebsiella pneumoniae is one of the major pathogens causing hospital-acquired multidrug-resistant infections. The capsular polysaccharide (CPS is an important virulence factor of K. pneumoniae. With 78 capsular types discovered thus far, an association between capsular type and the pathogenicity of K. pneumoniae has been observed. METHODOLOGY/PRINCIPAL FINDINGS: To investigate an initially non-typeable K. pneumoniae UTI isolate NTUH-K1790N, the cps gene region was sequenced. By NTUH-K1790N cps-PCR genotyping, serotyping and determination using a newly isolated capsular type-specific bacteriophage, we found that NTUH-K1790N and three other isolates Ca0507, Ca0421 and C1975 possessed a new capsular type, which we named KN2. Analysis of a KN2 CPS(- mutant confirmed the role of capsule as the target recognized by the antiserum and the phage. A newly described lytic phage specific for KN2 K. pneumoniae, named 0507-KN2-1, was isolated and characterized using transmission electron microscopy. Whole-genome sequencing of 0507-KN2-1 revealed a 159 991 bp double-stranded DNA genome with a G+C content of 46.7% and at least 154 open reading frames. Based on its morphological and genomic characteristics, 0507-KN2-1 was classified as a member of the Myoviridae phage family. Further analysis of this phage revealed a 3738-bp gene encoding a putative polysaccharide depolymerase. A recombinant form of this protein was produced and assayed to confirm its enzymatic activity and specificity to KN2 capsular polysaccharides. KN2 K. pneumoniae strains exhibited greater sensitivity to this depolymerase than these did to the cognate phage, as determined by spot analysis. CONCLUSIONS/SIGNIFICANCE: Here we report that a group of clinical strains possess a novel Klebsiella capsular type. We identified a KN2-specific phage and its polysaccharide depolymerase, which could be used for efficient capsular typing. The lytic phage and depolymerase also have potential as

  20. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  1. Contribution of hydrological data to the understanding of the spatio-temporal dynamics of F-specific RNA bacteriophages in river water during rainfall-runoff events.

    Science.gov (United States)

    Fauvel, Blandine; Cauchie, Henry-Michel; Gantzer, Christophe; Ogorzaly, Leslie

    2016-05-01

    Heavy rainfall events were previously reported to bring large amounts of microorganisms in surface water, including viruses. However, little information is available on the origin and transport of viral particles in water during such rain events. In this study, an integrative approach combining microbiological and hydrological measurements was investigated to appreciate the dynamics and origins of F-specific RNA bacteriophage fluxes during two distinct rainfall-runoff events. A high frequency sampling (automatic sampler) was set up to monitor the F-specific RNA bacteriophages fluxes at a fine temporal scale during the whole course of the rainfall-runoff events. A total of 276 rainfall-runoff samples were collected and analysed using both infectivity and RT-qPCR assays. The results highlight an increase of 2.5 log10 and 1.8 log10 of infectious F-specific RNA bacteriophage fluxes in parallel of an increase of the water flow levels for both events. Faecal pollution was characterised as being mainly from anthropic origin with a significant flux of phage particles belonging to the genogroup II. At the temporal scale, two successive distinct waves of phage pollution were established and identified through the hydrological measurements. The first arrival of phages in the water column was likely to be linked to the resuspension of riverbed sediments that was responsible for a high input of genogroup II. Surface runoff contributed further to the second input of phages, and more particularly of genogroup I. In addition, an important contribution of infectious phage particles has been highlighted. These findings imply the existence of a close relationship between the risk for human health and the viral contamination of flood water. Copyright © 2016 Luxembourg institute of Science and Technology. Published by Elsevier Ltd.. All rights reserved.

  2. Salmonella Typhimurium-specific bacteriophage ΦSH19 and the origins of species specificity in the Vi01-like phage family

    Directory of Open Access Journals (Sweden)

    Wilson Ray

    2011-11-01

    Full Text Available Abstract Background Whole genome sequencing of bacteriophages suitable for biocontrol of pathogens in food products is a pre-requisite to any phage-based intervention procedure. Trials involving the biosanitization of Salmonella Typhimurium in the pig production environment identified one such candidate, ΦSH19. Results This phage was sequenced and analysis of its 157,785 bp circular dsDNA genome revealed a number of interesting features. ΦSH19 constitutes another member of the recently-proposed Myoviridae Vi01-like family of phages, containing S. Typhi-specific Vi01 and Shigella-specific SboM-AG3. At the nucleotide level ΦSH19 is highly similar to phage Vi01 (80-98% pairwise identity over the length of the genome, with the major differences lying in the region associated with host-range determination. Analyses of the proteins encoded within this region by ΦSH19 revealed a cluster of three putative tail spikes. Of the three tail spikes, two have protein domains associated with the pectate lyase family of proteins (Tsp2 and P22 tail spike family (Tsp3 with the prospect that these enable Salmonella O antigen degradation. Tail spike proteins of Vi01 and SboM-AG3 are predicted to contain conserved right-handed parallel β-helical structures but the internal protein domains are varied allowing different host specificities. Conclusions The addition or exchange of tail spike protein modules is a major contributor to host range determination in the Vi01-like phage family.

  3. Replication of bacteriophage lambda DNA

    International Nuclear Information System (INIS)

    Tsurimoto, T.; Matsubara, K.

    1983-01-01

    In this paper results of studies on the mechanism of bacteriophage lambda replication using molecular biological and biochemical approaches are reported. The purification of the initiator proteins, O and P, and the role of the O and P proteins in the initiation of lambda DNA replication through interactions with specific DNA sequences are described. 47 references, 15 figures

  4. The structures of bacteriophages K1E and K1-5 explain processive degradation of polysaccharide capsules and evolution of new host specificities.

    Science.gov (United States)

    Leiman, Petr G; Battisti, Anthony J; Bowman, Valorie D; Stummeyer, Katharina; Mühlenhoff, Martina; Gerardy-Schahn, Rita; Scholl, Dean; Molineux, Ian J

    2007-08-17

    External polysaccharides of many pathogenic bacteria form capsules protecting the bacteria from the animal immune system and phage infection. However, some bacteriophages can digest these capsules using glycosidases displayed on the phage particle. We have utilized cryo-electron microscopy to determine the structures of phages K1E and K1-5 and thereby establish the mechanism by which these phages attain and switch their host specificity. Using a specific glycosidase, both phages penetrate the capsule and infect the neuroinvasive human pathogen Escherichia coli K1. In addition to the K1-specific glycosidase, each K1-5 particle carries a second enzyme that allows it to infect E. coli K5, whose capsule is chemically different from that of K1. The enzymes are organized into a multiprotein complex attached via an adapter protein to the virus portal vertex, through which the DNA is ejected during infection. The structure of the complex suggests a mechanism for the apparent processivity of degradation that occurs as the phage drills through the polysaccharide capsule. The enzymes recognize the adapter protein by a conserved N-terminal sequence, providing a mechanism for phages to acquire different enzymes and thus to evolve new host specificities.

  5. Bacteriophage amplification assay for detection of Listeria spp. using virucidal laser treatment

    Directory of Open Access Journals (Sweden)

    I.C. Oliveira

    2012-09-01

    Full Text Available A protocol for the bacteriophage amplification technique was developed for quantitative detection of viable Listeria monocytogenes cells using the A511 listeriophage with plaque formation as the end-point assay. Laser and toluidine blue O (TBO were employed as selective virucidal treatment for destruction of exogenous bacteriophage. Laser and TBO can bring a total reduction in titer phage (ca. 10(8 pfu/mL without affecting the viability of L. monocytogenes cells. Artificially inoculated skimmed milk revealed mean populations of the bacteria as low as between 13 cfu/mL (1.11 log cfu/mL, after a 10-h assay duration. Virucidal laser treatment demonstrated better protection of Listeria cells than the other agents previously tested. The protocol was faster and easier to perform than standard procedures. This protocol constitutes an alternative for rapid, sensitive and quantitative detection of L. monocytogenes.

  6. Highly specific salt bridges govern bacteriophage P22 icosahedral capsid assembly: identification of the site in coat protein responsible for interaction with scaffolding protein.

    Science.gov (United States)

    Cortines, Juliana R; Motwani, Tina; Vyas, Aashay A; Teschke, Carolyn M

    2014-05-01

    Icosahedral virus assembly requires a series of concerted and highly specific protein-protein interactions to produce a proper capsid. In bacteriophage P22, only coat protein (gp5) and scaffolding protein (gp8) are needed to assemble a procapsid-like particle, both in vivo and in vitro. In scaffolding protein's coat binding domain, residue R293 is required for procapsid assembly, while residue K296 is important but not essential. Here, we investigate the interaction of scaffolding protein with acidic residues in the N-arm of coat protein, since this interaction has been shown to be electrostatic. Through site-directed mutagenesis of genes 5 and 8, we show that changing coat protein N-arm residue 14 from aspartic acid to alanine causes a lethal phenotype. Coat protein residue D14 is shown by cross-linking to interact with scaffolding protein residue R293 and, thus, is intimately involved in proper procapsid assembly. To a lesser extent, coat protein N-arm residue E18 is also implicated in the interaction with scaffolding protein and is involved in capsid size determination, since a cysteine mutation at this site generated petite capsids. The final acidic residue in the N-arm that was tested, E15, is shown to only weakly interact with scaffolding protein's coat binding domain. This work supports growing evidence that surface charge density may be the driving force of virus capsid protein interactions. Bacteriophage P22 infects Salmonella enterica serovar Typhimurium and is a model for icosahedral viral capsid assembly. In this system, coat protein interacts with an internal scaffolding protein, triggering the assembly of an intermediate called a procapsid. Previously, we determined that there is a single amino acid in scaffolding protein required for P22 procapsid assembly, although others modulate affinity. Here, we identify partners in coat protein. We show experimentally that relatively weak interactions between coat and scaffolding proteins are capable of driving

  7. F-Specific RNA Bacteriophages, Especially Members of Subgroup II, Should Be Reconsidered as Good Indicators of Viral Pollution of Oysters.

    Science.gov (United States)

    Hartard, C; Leclerc, M; Rivet, R; Maul, A; Loutreul, J; Banas, S; Boudaud, N; Gantzer, C

    2018-01-01

    Norovirus (NoV) is the leading cause of gastroenteritis outbreaks linked to oyster consumption. In this study, we investigated the potential of F-specific RNA bacteriophages (FRNAPH) as indicators of viral contamination in oysters by focusing especially on FRNAPH subgroup II (FRNAPH-II). These viral indicators have been neglected because their behavior is sometimes different from that of NoV in shellfish, especially during the depuration processes usually performed before marketing. However, a significant bias needs to be taken into account. This bias is that, in the absence of routine culture methods, NoV is targeted by genome detection, while the presence of FRNAPH is usually investigated by isolation of infectious particles. In this study, by targeting both viruses using genome detection, a significant correlation between the presence of FRNAPH-II and that of NoV in shellfish collected from various European harvesting areas impacted by fecal pollution was observed. Moreover, during their depuration, while the long period of persistence of NoV was confirmed, a similar or even longer period of persistence of the FRNAPH-II genome, which was over 30 days, was observed. Such a striking genome persistence calls into question the relevance of molecular methods for assessing viral hazards. Targeting the same virus (i.e., FRNAPH-II) by culture and genome detection in specimens from harvesting areas as well as during depuration, we concluded that the presence of genomes in shellfish does not provide any information on the presence of the corresponding infectious particles. In view of these results, infectious FRNAPH detection should be reconsidered as a valuable indicator in oysters, and its potential for use in assessing viral hazard needs to be investigated. IMPORTANCE This work brings new data about the behavior of viruses in shellfish, as well as about the relevance of molecular methods for their detection and evaluation of the viral hazard. First, a strong

  8. The Listeria monocytogenes Bile Stimulon under Acidic Conditions Is Characterized by Strain-Specific Patterns and the Upregulation of Motility, Cell Wall Modification Functions, and the PrfA Regulon

    Science.gov (United States)

    Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.

    2018-01-01

    Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736

  9. Cationic antimicrobial peptides inactivate Shiga toxin-encoding bacteriophages

    Science.gov (United States)

    Del Cogliano, Manuel E.; Hollmann, Axel; Martinez, Melina; Semorile, Liliana; Ghiringhelli, Pablo D.; Maffía, Paulo C.; Bentancor, Leticia V.

    2017-12-01

    Shiga toxin (Stx) is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC) infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs) are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: 1) direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, 2) cationic properties are necessary but not sufficient for bacteriophage inactivation, and 3) inactivation by cationic peptides could be sequence (or structure) specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

  10. Cationic Antimicrobial Peptides Inactivate Shiga Toxin-Encoding Bacteriophages

    Directory of Open Access Journals (Sweden)

    Manuel E. Del Cogliano

    2017-12-01

    Full Text Available Shiga toxin (Stx is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non-alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: (1 direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, (2 cationic properties are necessary but not sufficient for bacteriophage inactivation, and (3 inactivation by cationic peptides could be sequence (or structure specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

  11. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Patricia Hingston

    Full Text Available The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA profiling to characterize the bacterium's cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3× were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431 and magnitude (>1,000-fold of differentially expressed genes (>2-fold, p<0.05 in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12 biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5× observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold

  12. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin

    2017-01-01

    The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain....... This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more...... genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pcold. A core set of 22 genes was upregulated at all growth phases, including nine genes...

  13. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth

    2017-01-01

    The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pmonocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112

  14. Sequence-specific 1H NMR assignments and secondary structure of the Arc repressor of bacteriophage P22, as determined by two-dimensional 1H NMR spectroscopy

    International Nuclear Information System (INIS)

    Breg, J.N.; Boelens, R.; George, A.V.E.; Kaptein, R.

    1989-01-01

    The Arc repressor of bacteriophage P22 is a DNA binding protein that does not belong to any of the known classes of such proteins. The authors have undertaken a 1 H NMR study of the protein with the aim of elucidating its three-dimensional structure in solution and its mode of binding of operator DNA. Here the authors present the 1 H nuclear magnetic resonance (NMR) assignments of all backbone protons an most of the side-chain protons of Arc repressor. Elements of secondary structure have been identified on the basis of networks of characteristics sequential and medium-range nuclear Overhauser enhancements (NOEs). Two α-helical regions have been found in the peptide regions 16-29 and 35-45. The ends of the helices could not yet be firmly established and could extend to residue 31 for the first helix and to residue 49 for the second. Immediately before the first helix, between residues 8 and 14, a region is present with β-sheet characteristics dominated by a close proximity of the α-protons of residues 9 and 13. Because of the dimeric nature of the protein there are still two possible ways in which the NOEs in the β-sheet region can be interpreted. While the data presently do not allow an unambiguous choice between these two possibilities, some evidence is discussed that favors the latter (β-sheet between monomers). Since the N-terminal region of Arc is responsible for the sequence-specific recognition of its operator, the findings suggest the existence of a DNA binding motif in which a β-sheet region is present

  15. Yersinia enterocolitica-Specific Infection by Bacteriophages TG1 and ϕR1-RT Is Dependent on Temperature-Regulated Expression of the Phage Host Receptor OmpF.

    Science.gov (United States)

    Leon-Velarde, Carlos G; Happonen, Lotta; Pajunen, Maria; Leskinen, Katarzyna; Kropinski, Andrew M; Mattinen, Laura; Rajtor, Monika; Zur, Joanna; Smith, Darren; Chen, Shu; Nawaz, Ayesha; Johnson, Roger P; Odumeru, Joseph A; Griffiths, Mansel W; Skurnik, Mikael

    2016-09-01

    Bacteriophages present huge potential both as a resource for developing novel tools for bacterial diagnostics and for use in phage therapy. This potential is also valid for bacteriophages specific for Yersinia enterocolitica To increase our knowledge of Y. enterocolitica-specific phages, we characterized two novel yersiniophages. The genomes of the bacteriophages vB_YenM_TG1 (TG1) and vB_YenM_ϕR1-RT (ϕR1-RT), isolated from pig manure in Canada and from sewage in Finland, consist of linear double-stranded DNA of 162,101 and 168,809 bp, respectively. Their genomes comprise 262 putative coding sequences and 4 tRNA genes and share 91% overall nucleotide identity. Based on phylogenetic analyses of their whole-genome sequences and large terminase subunit protein sequences, a genus named Tg1virus within the family Myoviridae is proposed, with TG1 and ϕR1-RT (R1RT in the ICTV database) as member species. These bacteriophages exhibit a host range restricted to Y. enterocolitica and display lytic activity against the epidemiologically significant serotypes O:3, O:5,27, and O:9 at and below 25°C. Adsorption analyses of lipopolysaccharide (LPS) and OmpF mutants demonstrate that these phages use both the LPS inner core heptosyl residues and the outer membrane protein OmpF as phage receptors. Based on RNA sequencing and quantitative proteomics, we also demonstrate that temperature-dependent infection is due to strong repression of OmpF at 37°C. In addition, ϕR1-RT was shown to be able to enter into a pseudolysogenic state. Together, this work provides further insight into phage-host cell interactions by highlighting the importance of understanding underlying factors which may affect the abundance of phage host receptors on the cell surface. Only a small number of bacteriophages infecting Y. enterocolitica, the predominant causative agent of yersiniosis, have been previously described. Here, two newly isolated Y. enterocolitica phages were studied in detail, with the aim of

  16. DNA Packaging by λ-Like Bacteriophages: Mutations Broadening the Packaging Specificity of Terminase, the λ-Packaging Enzyme

    OpenAIRE

    Feiss, Michael; Reynolds, Erin; Schrock, Morgan; Sippy, Jean

    2010-01-01

    The DNA-packaging specificities of phages λ and 21 depend on the specific DNA interactions of the small terminase subunits, which have support helix-turn-recognition helix-wing DNA-binding motifs. λ-Terminase with the recognition helix of 21 preferentially packages 21 DNA. This chimeric terminase's ability to package λDNA is reduced ∼20-fold. Phage λ with the chimeric terminase is unable to form plaques, but pseudorevertants are readily obtained. Some pseudorevertants have trans-acting suppre...

  17. A screen for kinase inhibitors identifies antimicrobial imidazopyridine aminofurazans as specific inhibitors of the Listeria monocytogenes PASTA kinase PrkA.

    Science.gov (United States)

    Schaenzer, Adam J; Wlodarchak, Nathan; Drewry, David H; Zuercher, William J; Rose, Warren E; Striker, Rob; Sauer, John-Demian

    2017-10-13

    Bacterial signaling systems such as protein kinases and quorum sensing have become increasingly attractive targets for the development of novel antimicrobial agents in a time of rising antibiotic resistance. The family of bacterial P enicillin-binding-protein A nd S erine/ T hreonine kinase- A ssociated (PASTA) kinases is of particular interest due to the role of these kinases in regulating resistance to β-lactam antibiotics. As such, small-molecule kinase inhibitors that target PASTA kinases may prove beneficial as treatments adjunctive to β-lactam therapy. Despite this interest, only limited progress has been made in identifying functional inhibitors of the PASTA kinases that have both activity against the intact microbe and high kinase specificity. Here, we report the results of a small-molecule screen that identified GSK690693, an imidazopyridine aminofurazan-type kinase inhibitor that increases the sensitivity of the intracellular pathogen Listeria monocytogenes to various β-lactams by inhibiting the PASTA kinase PrkA. GSK690693 potently inhibited PrkA kinase activity biochemically and exhibited significant selectivity for PrkA relative to the Staphylococcus aureus PASTA kinase Stk1. Furthermore, other imidazopyridine aminofurazans could effectively inhibit PrkA and potentiate β-lactam antibiotic activity to varying degrees. The presence of the 2-methyl-3-butyn-2-ol (alkynol) moiety was important for both biochemical and antimicrobial activity. Finally, mutagenesis studies demonstrated residues in the back pocket of the active site are important for GSK690693 selectivity. These data suggest that targeted screens can successfully identify PASTA kinase inhibitors with both biochemical and antimicrobial specificity. Moreover, the imidazopyridine aminofurazans represent a family of PASTA kinase inhibitors that have the potential to be optimized for selective PASTA kinase inhibition.

  18. Bacteriophages and Biofilms

    Directory of Open Access Journals (Sweden)

    David R. Harper

    2014-06-01

    Full Text Available Biofilms are an extremely common adaptation, allowing bacteria to colonize hostile environments. They present unique problems for antibiotics and biocides, both due to the nature of the extracellular matrix and to the presence within the biofilm of metabolically inactive persister cells. Such chemicals can be highly effective against planktonic bacterial cells, while being essentially ineffective against biofilms. By contrast, bacteriophages seem to have a greater ability to target this common form of bacterial growth. The high numbers of bacteria present within biofilms actually facilitate the action of bacteriophages by allowing rapid and efficient infection of the host and consequent amplification of the bacteriophage. Bacteriophages also have a number of properties that make biofilms susceptible to their action. They are known to produce (or to be able to induce enzymes that degrade the extracellular matrix. They are also able to infect persister cells, remaining dormant within them, but re-activating when they become metabolically active. Some cultured biofilms also seem better able to support the replication of bacteriophages than comparable planktonic systems. It is perhaps unsurprising that bacteriophages, as the natural predators of bacteria, have the ability to target this common form of bacterial life.

  19. A novel type of peptidoglycan-binding domain highly specific for amidated D-Asp cross-bridge, identified in Lactobacillus casei bacteriophage endolysins.

    Science.gov (United States)

    Regulski, Krzysztof; Courtin, Pascal; Kulakauskas, Saulius; Chapot-Chartier, Marie-Pierre

    2013-07-12

    Peptidoglycan hydrolases (PGHs) are responsible for bacterial cell lysis. Most PGHs have a modular structure comprising a catalytic domain and a cell wall-binding domain (CWBD). PGHs of bacteriophage origin, called endolysins, are involved in bacterial lysis at the end of the infection cycle. We have characterized two endolysins, Lc-Lys and Lc-Lys-2, identified in prophages present in the genome of Lactobacillus casei BL23. These two enzymes have different catalytic domains but similar putative C-terminal CWBDs. By analyzing purified peptidoglycan (PG) degradation products, we showed that Lc-Lys is an N-acetylmuramoyl-L-alanine amidase, whereas Lc-Lys-2 is a γ-D-glutamyl-L-lysyl endopeptidase. Remarkably, both lysins were able to lyse only Gram-positive bacterial strains that possess PG with D-Ala(4)→D-Asx-L-Lys(3) in their cross-bridge, such as Lactococcus casei, Lactococcus lactis, and Enterococcus faecium. By testing a panel of L. lactis cell wall mutants, we observed that Lc-Lys and Lc-Lys-2 were not able to lyse mutants with a modified PG cross-bridge, constituting D-Ala(4)→L-Ala-(L-Ala/L-Ser)-L-Lys(3); moreover, they do not lyse the L. lactis mutant containing only the nonamidated D-Asp cross-bridge, i.e. D-Ala(4)→D-Asp-L-Lys(3). In contrast, Lc-Lys could lyse the ampicillin-resistant E. faecium mutant with 3→3 L-Lys(3)-D-Asn-L-Lys(3) bridges replacing the wild-type 4→3 D-Ala(4)-D-Asn-L-Lys(3) bridges. We showed that the C-terminal CWBD of Lc-Lys binds PG containing mainly D-Asn but not PG with only the nonamidated D-Asp-containing cross-bridge, indicating that the CWBD confers to Lc-Lys its narrow specificity. In conclusion, the CWBD characterized in this study is a novel type of PG-binding domain targeting specifically the D-Asn interpeptide bridge of PG.

  20. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers - specific application to Listeria monocytogenes and ready-to-eat meat products

    NARCIS (Netherlands)

    Mataragas, M.; Zwietering, M.H.; Skandamis, P.N.; Drosinos, E.H.

    2010-01-01

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required),

  1. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  2. Guidelines for Bacteriophage Product Certification.

    Science.gov (United States)

    Fauconnier, Alan

    2018-01-01

    Following decades in the wilderness, bacteriophage therapy is now appearing as a credible antimicrobial strategy. However, this reemerging therapy does not rekindle without raising sensitive regulatory concerns. Indeed, whereas the European regulatory framework has been basically implemented to tackle ready-to-use pharmaceuticals produced on a large scale, bacteriophage therapy relies on a dynamic approach requiring a regulation on personalized medicine, nonexistent at present. Because of this, no guideline are currently available for addressing the scientific and regulatory issues specifically related to phage therapy medicinal products (PTMP).Pending to the implementation of an appropriate regulatory framework and to the development of ensuing guidelines, several avenues which might lead to PTMP regulatory compliance are explored here. Insights might come from the multi-strain dossier approach set up for particular animal vaccines, from the homologous group concept developed for the allergen products or from the licensing process for veterinary autogenous vaccines. Depending on national legislations, customized preparations prescribed as magistral formulas or to be used on a named-patient basis are possible regulatory approaches to be considered. However, these schemes are not optimal and should thus be regarded as transitional.

  3. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  4. Targeting Antibacterial Agents by Using Drug-Carrying Filamentous Bacteriophages

    OpenAIRE

    Yacoby, Iftach; Shamis, Marina; Bar, Hagit; Shabat, Doron; Benhar, Itai

    2006-01-01

    Bacteriophages have been used for more than a century for (unconventional) therapy of bacterial infections, for half a century as tools in genetic research, for 2 decades as tools for discovery of specific target-binding proteins, and for nearly a decade as tools for vaccination or as gene delivery vehicles. Here we present a novel application of filamentous bacteriophages (phages) as targeted drug carriers for the eradication of (pathogenic) bacteria. The phages are genetically modified to d...

  5. Bacteriophage-based Probiotic Preparation for Managing Shigella Infections

    Science.gov (United States)

    2015-04-16

    The preparation (designated “ShigActive”) is a bacteriophage cocktail that specifically targets Shigella spp. (significant diarrhea-causing pathogens...phages lytic for Shigella , and we have developed a murine model in which the in vivo efficacy of our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND...10-Apr-2013 Approved for Public Release; Distribution Unlimited Final Report: Bacteriophage-based Probiotic Preparation for Managing Shigella

  6. Isolating E.Coli Bacteriophage from Raw Sewage and Determining its Selectivity to the Host Cell

    Directory of Open Access Journals (Sweden)

    SM Imeni

    2016-05-01

    Full Text Available Introduction: Bacteriophages are viruses that infect and destroy prokaryote cells, specifically the bacteria. They act too selective, so as each bacteriophage affects only on specific type of bacteria. Due to their specific features, bacteriophages can be used as an appropriate substitute for antibiotics in infectious diseases treatment. Therefore, this study aimed to isolate E. coli-specific bacteriophage from raw sewage. Methods: Eight samples of raw sewage, each containing approximately 50 ml of raw sewage with 10 minute gap, were prepared from Zargandeh wastewater treatment plant, Tehran, Iran. The sewages were mixed with Brain-heart infusion medium (BHI as a liquid culture medium in order to let the microorganisms grow. Incubation, purification and determination of bacteria were followed repeatedly to isolate the bacteriophage. Then it was tested on E.coli (ATCC 25922, Enterococcus faecalis (ATCC 19433, Staphylococcus aureus (ATCC 2392, and Yersinia enterocolitica (ATCC 9610 in order to determine the bacteriophage selectivity. Results: The E.coli bacteriophages were successfully isolated from all the eight samples, that were completely able to lyse and destroy E.coli bacterial cells, though no effect was observed on other types of bacteria. Conclusion: The study findings revealed that bacteriophages act selectively. Considering the raise of antibiotic resistance in the world, bacteriophages can serve as a good substitute for antibiotics in treating infectious diseases.

  7. Bacteriophages of Yersinia pestis.

    Science.gov (United States)

    Zhao, Xiangna; Skurnik, Mikael

    2016-01-01

    Bacteriophage play many varied roles in microbial ecology and evolution. This chapter collates a vast body of knowledge and expertise on Yersinia pestis phages, including the history of their isolation and classical methods for their isolation and identification. The genomic diversity of Y. pestis phage and bacteriophage islands in the Y. pestis genome are also discussed because all phage research represents a branch of genetics. In addition, our knowledge of the receptors that are recognized by Y. pestis phage, advances in phage therapy for Y. pestis infections, the application of phage in the detection of Y. pestis, and clustered regularly interspaced short palindromic repeats (CRISPRs) sequences of Y. pestis from prophage DNA are all reviewed here.

  8. Methods for generation of reporter phages and immobilization of active bacteriophages on a polymer surface

    Science.gov (United States)

    Morgan, Mark Thomas (Inventor); Kothapalli, Aparna (Inventor); Applegate, Bruce Michael (Inventor); Perry, Lynda Louise (Inventor)

    2012-01-01

    Novel reporter bacteriophages are provided. Provided are compositions and methods that allow bacteriophages that are used for specific detection or killing of E. coli 0157:H7 to be propagated in nonpathogenic E. coli, thereby eliminating the safety and security risks of propagation in E. coli 0157:H7. Provided are compositions and methods for attaching active bacteriophages to the surface of a polymer in order to kill target bacteria with which the phage comes into contact. Provided are modified bacteriophages immobilized to a surface, which capture E. coli 0157:H7 and cause the captured cells to emit light or fluorescence, allowing detection of the bacteria in a sample.

  9. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  10. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Bacteriophage cocktail for biocontrol of Salmonella in dried pet food.

    Science.gov (United States)

    Heyse, Serena; Hanna, Leigh Farris; Woolston, Joelle; Sulakvelidze, Alexander; Charbonneau, Duane

    2015-01-01

    Human salmonellosis has been associated with contaminated pet foods and treats. Therefore, there is interest in identifying novel approaches for reducing the risk of Salmonella contamination within pet food manufacturing environments. The use of lytic bacteriophages shows promise as a safe and effective way to mitigate Salmonella contamination in various food products. Bacteriophages are safe, natural, highly targeted antibacterial agents that specifically kill bacteria and can be targeted to kill food pathogens without affecting other microbiota. In this study, we show that a cocktail containing six bacteriophages had a broadspectrum activity in vitro against a library of 930 Salmonella enterica strains representing 44 known serovars. The cocktail was effective against 95% of the strains in this tested library. In liquid culture dose-ranging experiments, bacteriophage cocktail concentrations of ≥10(8) PFU/ml inactivated more than 90% of the Salmonella population (10(1) to 10(3) CFU/ml). Dried pet food inoculated with a mixture containing equal proportions of Salmonella serovars Enteritidis (ATCC 4931), Montevideo (ATCC 8387), Senftenberg (ATCC 8400), and Typhimurium (ATCC 13311) and then surface treated with the six-bacteriophage cocktail (≥2.5 ± 1.5 × 10(6) PFU/g) achieved a greater than 1-log (P contamination in samples taken from an undistributed lot of commercial dried dog food that tested positive for Salmonella. Our results indicate that bacteriophage biocontrol of S. enterica in dried pet food is technically feasible.

  12. Bacteriophage Infectivity Against Pseudomonas aeruginosa in Saline Conditions

    KAUST Repository

    Scarascia, Giantommaso

    2018-05-02

    Pseudomonas aeruginosa is a ubiquitous member of marine biofilm, and reduces thiosulfate to produce toxic hydrogen sulfide gas. In this study, lytic bacteriophages were isolated and applied to inhibit the growth of P. aeruginosa in planktonic mode at different temperature, pH, and salinity. Bacteriophages showed optimal infectivity at a multiplicity of infection of 10 in saline conditions, and demonstrated lytic abilities over all tested temperature (25, 30, 37, and 45°C) and pH 6–9. Planktonic P. aeruginosa exhibited significantly longer lag phase and lower specific growth rates upon exposure to bacteriophages. Bacteriophages were subsequently applied to P. aeruginosa-enriched biofilm and were determined to lower the relative abundance of Pseudomonas-related taxa from 0.17 to 5.58% in controls to 0.01–0.61% in treated microbial communities. The relative abundance of Alphaproteobacteria, Pseudoalteromonas, and Planococcaceae decreased, possibly due to the phage-induced disruption of the biofilm matrix. Lastly, when applied to mitigate biofouling of ultrafiltration membranes, bacteriophages were determined to reduce the transmembrane pressure increase by 18% when utilized alone, and by 49% when used in combination with citric acid. The combined treatment was more effective compared with the citric acid treatment alone, which reported ca. 30% transmembrane pressure reduction. Collectively, the findings demonstrated that bacteriophages can be used as a biocidal agent to mitigate undesirable P. aeruginosa-associated problems in seawater applications.

  13. K. OXYTOCA BACTERIOPHAGES ISOLATION METHODS IMPROVEMENT

    Directory of Open Access Journals (Sweden)

    G. R. Sadrtdinova

    2017-01-01

    against the desired species of microorganism. The second stage consisted in a comparative analysis of the indices of cultivation of the isolated phages on standard meat-peptone agar and the proposed medium for isolation of bacteriophages. The main biological properties of the phages studied were also determined: morphology of negative colonies, lytic activity, specificity. The negative colonies formed on the compared media were classified as one type. The lytic activity of the studied phages on meat-peptone agar and Aph medium was the same. According to Grazia 2 × 107 BOE/ml for bacteriophage KO-3 UGSHA, (3–4 × 108BOE/ml for bacteriophage KO-8724 UGSHA. The isolated bacteriophages showed no lytic activity against strains of heterogeneous crops (Escherichia spp., Citrobacter spp., Serratia spp., Hafnia spp., Yersinia spp.. 

  14. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

    Science.gov (United States)

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

    2014-01-02

    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  15. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  16. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  17. Polymer-based delivery systems for support and delivery of bacteriophages

    Science.gov (United States)

    Brown, Alyssa Marie

    One of the most urgent problems in the fields of medicine and agriculture is the decreasing effectiveness of antibiotics. Once a miracle drug, antibiotics have recently become associated with the creation of antibiotic-resistant bacteria. The main limitations of these treatments include lack of both adaptability and specificity. To overcome these shortcomings of current antibiotic treatments, there has been a renewed interest in bacteriophage research. Bacteriophages are naturally-occurring viruses that lyse bacteria. They are highly specific, with each bacteriophage type lysing a narrow range of bacteria strains. Bacteriophages are also ubiquitous biological entities, populating environments where bacterial growth is supported. Just as humans are exposed to bacteria in their daily lives, we are exposed to bacteriophages as well. To use bacteriophages in practical applications, they must be delivered to the site of an infection in a controlled-release system. Two systems were studied to observe their support of bacteriophage lytic activity, as well as investigate the possibility of controlling bacteriophage release rates. First, hydrogels were studied, using crosslinking and blending techniques to achieve a range of release profiles. Second, polyanhydride microparticles were studied, evaluating release rates as a function of monomer chemistries.

  18. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  19. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  20. 75 - 78 Samira - BACTERIOPHAGES FINAL

    African Journals Online (AJOL)

    DR. AMIN

    Bayero Journal of Pure and Applied Sciences, 4(1): 75 - 78. Received: ... It involves the use of bacteriophages (small viruses that predate bacteria) to ..... Since the 1940s, research with ... phages is recognized by the appearance of plaques or.

  1. Detection and quantification of Flavobacterium psychrophilum-specific bacteriophages in vivo in rainbow trout upon oral administration: implications for disease control in aquaculture.

    Science.gov (United States)

    Christiansen, Rói Hammershaimb; Dalsgaard, Inger; Middelboe, Mathias; Lauritsen, Anne H; Madsen, Lone

    2014-12-01

    The use of bacteriophages in the treatment and prevention of infections by the fish pathogen Flavobacterium psychrophilum has attracted increased attention in recent years. It has been shown recently that phage delivery via the parenteral route resulted in immediate distribution of phages to the circulatory system and the different organs. However, little is known about phage dispersal and survival in vivo in rainbow trout after delivery via the oral route. Here we examined the dispersal and survival of F. psychrophilum phage FpV-9 in vivo in juvenile rainbow trout after administration by three different methods-bath, oral intubation into the stomach, and phage-coated feed-with special emphasis on the oral route of delivery. Phages could be detected in all the organs investigated (intestine, spleen, brain, and kidney) 0.5 h postadministration, reaching concentrations as high as ∼10(5) PFU mg intestine(-1) and ∼10(3) PFU mg spleen(-1) within the first 24 h following the bath and ∼10(7) PFU mg intestine(-1) and ∼10(4) PFU mg spleen(-1) within the first 24 h following oral intubation. The phages were most persistent in the organs for the first 24 h and then decreased exponentially; no phages were detected after 83 h in the organs investigated. Phage administration via feed resulted in the detection of phages in the intestine, spleen, and kidney 1 h after feeding. Average concentrations of ∼10(4) PFU mg intestine(-1) and ∼10(1) PFU mg spleen(-1) were found throughout the experimental period (200 h) following continuous delivery of phages with feed. These experiments clearly demonstrate the ability of the phages to survive passage through the fish stomach and to penetrate the intestinal barrier and enter the circulatory system after oral delivery, although the quantity of phages found in the spleen was 100- to 1,000-fold lower than that in the intestine. It was also shown that phages could tolerate long periods of desiccation on the feed pellets, with 60

  2. EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on the evaluation of the safety and efficacy of ListexTM P100 for the removal of Listeria monocytogenes surface contamination of raw fish

    DEFF Research Database (Denmark)

    Hald, Tine

    Studies evaluating the safety and efficacy of Listex™ P100 to reduce Listeria monocytogenes contamination on raw fish were assessed. The material should not present human toxicological problems because the bacteriophage P100, used as active principle, is not regarded as harmful to consumers nor...

  3. Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

    Science.gov (United States)

    Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

    2009-03-01

    The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

  4. Deletion mutations of bacteriophage

    International Nuclear Information System (INIS)

    Ryo, Yeikou

    1975-01-01

    Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

  5. Bacteriophage therapy for safeguarding animal and human health: a review.

    Science.gov (United States)

    Tiwari, Ruchi; Dhama, Kuldeep; Kumar, Amit; Rahal, Anu; Kapoor, Sanjay

    2014-02-01

    Since the discovery of bacteriophages at the beginning of the 19th century their contribution to bacterial evolution and ecology and use in a variety of applications in biotechnology and medicine has been recognized and understood. Bacteriophages are natural bacterial killers, proven as best biocontrol agents due to their ability to lyse host bacterial cells specifically thereby helping in disease prevention and control. The requirement of such therapeutic approach is straight away required in view of the global emergence of Multidrug Resistant (MDR) strains of bacteria and rapidly developing resistance to antibiotics in both animals and humans along with increasing food safety concerns including of residual antibiotic toxicities. Phage typing is a popular tool to differentiate bacterial isolates and to identify and characterize outbreak-associated strains of Salmonella, Campylobacter, Escherichia and Listeria. Numerous methods viz. plaque morphology, ultracentrifugation in the density gradient of CsCl2, and random amplified polymorphic DNA (RAPD) have been found to be effective in detection of various phages. Bacteriophages have been isolated and recovered from samples of animal waste products of different livestock farms. High titer cocktails of broad spectrum lytic bacteriophages are usually used for clinical trial for assessing their therapeutic efficacy against antibiotic unresponsive infections in different animals. Bacteriophage therapy also helps to fight various bacterial infections of poultry viz. colibacillosis, salmonellosis and listeriosis. Moreover, the utility of phages concerning biosafety has raised the importance to explore and popularize the therapeutic dimension of this promising novel therapy which forms the topic of discussion of the present review.

  6. Synthetic Biology to Engineer Bacteriophage Genomes.

    Science.gov (United States)

    Rita Costa, Ana; Milho, Catarina; Azeredo, Joana; Pires, Diana Priscila

    2018-01-01

    Recent advances in the synthetic biology field have enabled the development of new molecular biology techniques used to build specialized bacteriophages with new functionalities. Bacteriophages have been engineered towards a wide range of applications including pathogen control and detection, targeted drug delivery, or even assembly of new materials.In this chapter, two strategies that have been successfully used to genetically engineer bacteriophage genomes are addressed: a yeast-based platform and bacteriophage recombineering of electroporated DNA.

  7. Occurrence and numbers of bacteriophages and bacterial indicators in faeces of yellow-legged seagull (Larus cachinnans).

    Science.gov (United States)

    Muniesa, M; Jofre, J; Lucena, F

    1999-12-01

    Faeces from feral populations of yellow-legged seagulls from the northern coastal area of Catalonia (North-eastern Spain) contained variable amounts of faecal coliforms, faecal streptococci, somatic coliphages, F-specific bacteriophages and Bacteroides fragilis bacteriophages. Occurrence and numbers of bacterial indicators and bacteriophages in the faeces of yellow-legged seagulls are in the ranges described in the faeces of different animals. The ratios between numbers of bacterial indicators and numbers of bacteriophages are much higher in faeces of seagulls than in treated or raw sewage contributed by out-falls of the same area.

  8. [Bacteriophages in the battle against multidrug resistant bacteria

    NARCIS (Netherlands)

    Meer, J.W.M. van der; Vandenbroucke-Grauls, C.

    2018-01-01

    Bacteriophages are viruses that infect bacteria. They are highly specific for a bacterial species. The so-called 'lytic phages' can lyse bacteria when they infect them; these phages can be used to treat bacterial infections. Despite a century of experience with phage therapy, the evidence for

  9. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  10. Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Hammer, Karin

    1999-01-01

    Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...

  11. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  12. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  13. Pulmonary bacteriophage therapy on Pseudomonas aeruginosa cystic fibrosis strains: first steps towards treatment and prevention.

    Directory of Open Access Journals (Sweden)

    Eric Morello

    Full Text Available Multidrug-resistant bacteria are the cause of an increasing number of deadly pulmonary infections. Because there is currently a paucity of novel antibiotics, phage therapy--the use of specific viruses that infect bacteria--is now more frequently being considered as a potential treatment for bacterial infections. Using a mouse lung-infection model caused by a multidrug resistant Pseudomonas aeruginosa mucoid strain isolated from a cystic fibrosis patient, we evaluated bacteriophage treatments. New bacteriophages were isolated from environmental samples and characterized. Bacteria and bacteriophages were applied intranasally to the immunocompetent mice. Survival was monitored and bronchoalveolar fluids were analysed. Quantification of bacteria, bacteriophages, pro-inflammatory and cytotoxicity markers, as well as histology and immunohistochemistry analyses were performed. A curative treatment (one single dose administrated 2 h after the onset of the infection allowed over 95% survival. A four-day preventive treatment (one single dose resulted in a 100% survival. All of the parameters measured correlated with the efficacy of both curative and preventive bacteriophage treatments. We also showed that in vitro optimization of a bacteriophage towards a clinical strain improved both its efficacy on in vivo treatments and its host range on a panel of 20 P. aeruginosa cystic fibrosis strains. This work provides an incentive to develop clinical studies on pulmonary bacteriophage therapy to combat multidrug-resistant lung infections.

  14. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  15. Proteins of bacteriophage phi6

    International Nuclear Information System (INIS)

    Sinclair, J.F.; Tzagoloff, A.; Levine, D.; Mindich, L.

    1975-01-01

    We investigated the protein composition of the lipid-containing bacteriophage phi 6. We also studied the synthesis of phage-specific proteins in the host bacterium Pseudomonas phaseolicola HB10Y. The virion was found to contain 10 proteins of the following molecular weights: P1, 93,000; P2, 88,000; P3, 84,000; P4, 36,800; P5, 24,000; P6, 21,000; P7, 19,900; P8, 10,500; P9, 8,700; and P10, less than 6,000. Proteins P3, P9, and P10 were completely extracted from the virion with 1 percent Triton X-100. Protein P6 was partially extracted. Proteins P8 and P9 were purified by column chromatography. The amino acid composition of P9 was determined and was found to lack methionine. Labeling of viral proteins with [ 35 S]methionine in infected cells indicated that proteins P5, P9, P10, and P11 lacked methionine. Treatment of host cells with uv light before infection allowed the synthesis of P1, P2, P4, and P7; however, the extent of viral protein synthesis fell off exponentially with increasing delay time between irradiation and infection. Treatment of host cells with rifampin during infection allowed preferential synthesis of viral proteins, but the extent of synthesis also fell off exponentially with increasing delay time between the addition of rifampin and the addition of radioactive amino acids. All of the virion proteins were seen in gels prepared from rifampin-treated infected cells. In addition, two proteins, P11 and P12, were observed; their molecular weights were 25,200 and 20,100, respectively. Proteins P1, P2, P4, and P7 were synthesized early, whereas the rest began to increase at 45 min post-infection

  16. Unusual Structure of the attB Site of the Site-Specific Recombination System of Lactobacillus delbrueckii Bacteriophage mv4

    Science.gov (United States)

    Auvray, Frédéric; Coddeville, Michèle; Ordonez, Romy Catoira; Ritzenthaler, Paul

    1999-01-01

    The temperate phage mv4 integrates its genome into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus by site-specific recombination within the 3′ end of a tRNASer gene. Recombination is catalyzed by the phage-encoded integrase and occurs between the phage attP site and the bacterial attB site. In this study, we show that the mv4 integrase functions in vivo in Escherichia coli and we characterize the bacterial attB site with a site-specific recombination test involving compatible plasmids carrying the recombination sites. The importance of particular nucleotides within the attB sequence was determined by site-directed mutagenesis. The structure of the attB site was found to be simple but rather unusual. A 16-bp DNA fragment was sufficient for function. Unlike most genetic elements that integrate their DNA into tRNA genes, none of the dyad symmetry elements of the tRNASer gene were present within the minimal attB site. No inverted repeats were detected within this site either, in contrast to the lambda site-specific recombination model. PMID:10572145

  17. Metagenomic Analysis of Dairy Bacteriophages

    DEFF Research Database (Denmark)

    Muhammed, Musemma K.; Kot, Witold; Neve, Horst

    2017-01-01

    Despite their huge potential for characterizing the biodiversity of phages, metagenomic studies are currently not available for dairy bacteriophages, partly due to the lack of a standard procedure for phage extraction. We optimized an extraction method that allows to remove the bulk protein from...

  18. Immuno compatibility of Bacteriophages as Nano medicines

    International Nuclear Information System (INIS)

    Kaur, T.; Nafissi, N.; Wasfi, O.; Sheldon, K.; Wettig, Sh.; Slavcev, R.

    2012-01-01

    Bacteriophage-based medical research provides the opportunity to develop targeted nano medicines with heightened efficiency and safety profiles. Filamentous phages also can and have been formulated as targeted drug-delivery nano medicines, and phage may also serve as promising alternatives/complements to antibiotics. Over the past decade the use of phage for both the prophylaxis and the treatment of bacterial infection, has gained special significance in view of a dramatic rise in the prevalence of antibiotic resistance bacterial strains. Two potential medical applications of phages are the treatment of bacterial infections and their use as immunizing agents in diagnosis and monitoring patients with immunodeficiencies. Recently, phages have been employed as gene-delivery vectors (phage nano medicine), for nearly half a century as tools in genetic research, for about two decades as tools for the discovery of specific target-binding proteins and peptides, and for almost a decade as tools for vaccine development. As phage applications to human therapeutic development grow at an exponential rate, it will become essential to evaluate host immune responses to initial and repetitive challenges by therapeutic phage in order to develop phage therapies that offer suitable utility. This paper examines and discusses phage nano medicine applications and the immunomodulatory effects of bacteriophage exposure and treatment modalities.

  19. Bacteriophages and Their Role in Food Safety

    Directory of Open Access Journals (Sweden)

    Sanna M. Sillankorva

    2012-01-01

    Full Text Available The interest for natural antimicrobial compounds has increased due to alterations in consumer positions towards the use of chemical preservatives in foodstuff and food processing surfaces. Bacteriophages fit in the class of natural antimicrobial and their effectiveness in controlling bacterial pathogens in agro-food industry has led to the development of different phage products already approved by USFDA and USDA. The majority of these products are to be used in farm animals or animal products such as carcasses, meats and also in agricultural and horticultural products. Treatment with specific phages in the food industry can prevent the decay of products and the spread of bacterial diseases and ultimately promote safe environments in animal and plant food production, processing, and handling. This is an overview of recent work carried out with phages as tools to promote food safety, starting with a general introduction describing the prevalence of foodborne pathogens and bacteriophages and a more detailed discussion on the use of phage therapy to prevent and treat experimentally induced infections of animals against the most common foodborne pathogens, the use of phages as biocontrol agents in foods, and also their use as biosanitizers of food contact surfaces.

  20. Multiple roles of genome-attached bacteriophage terminal proteins

    International Nuclear Information System (INIS)

    Redrejo-Rodríguez, Modesto; Salas, Margarita

    2014-01-01

    Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer

  1. Multiple roles of genome-attached bacteriophage terminal proteins

    Energy Technology Data Exchange (ETDEWEB)

    Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

    2014-11-15

    Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.

  2. Molecular studies on bacteriophage endolysins and their potential to control gram-negative bacteria

    OpenAIRE

    Oliveira, Hugo Alexandre Mendes

    2014-01-01

    Thesis for PhD degree in Chemical and Biological Engineeering Bacteriophages are viruses that specifically infect bacterial hosts to reproduce. At the end of the infection cycle, progeny virions are confronted with a rigid cell wall that impedes their release into the environment. Consequently, bacteriophages encode hydrolytic enzymes, called endolysins, to digest the peptidoglycan and cause bacteriolysis. In contrast to their extensively studied counterparts, active against Gram-positi...

  3. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  4. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

    Science.gov (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

    2010-08-01

    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  5. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  6. A simple and novel modification of comet assay for determination of bacteriophage mediated bacterial cell lysis.

    Science.gov (United States)

    Khairnar, Krishna; Sanmukh, Swapnil; Chandekar, Rajshree; Paunikar, Waman

    2014-07-01

    The comet assay is the widely used method for in vitro toxicity testing which is also an alternative to the use of animal models for in vivo testing. Since, its inception in 1984 by Ostling and Johansson, it is being modified frequently for a wide range of application. In spite of its wide applicability, unfortunately there is no report of its application in bacteriophages research. In this study, a novel application of comet assay for the detection of bacteriophage mediated bacterial cell lysis was described. The conventional methods in bacteriophage research for studying bacterial lysis by bacteriophages are plaque assay method. It is time consuming, laborious and costly. The lytic activity of bacteriophage devours the bacterial cell which results in the release of bacterial genomic material that gets detected by ethidium bromide staining method by the comet assay protocol. The objective of this study was to compare efficacy of comet assay with different assay used to study phage mediated bacterial lysis. The assay was performed on culture isolates (N=80 studies), modified comet assay appear to have relatively higher sensitivity and specificity than other assay. The results of the study showed that the application of comet assay can be an economical, time saving and less laborious alternative to conventional plaque assay for the detection of bacteriophage mediated bacterial cell lysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Silk Route to the Acceptance and Re-Implementation of Bacteriophage Therapy—Part II

    Directory of Open Access Journals (Sweden)

    Expert round table on acceptance and re-implementation of bacteriophage therapy

    2018-04-01

    Full Text Available This perspective paper follows up on earlier communications on bacteriophage therapy that we wrote as a multidisciplinary and intercontinental expert-panel when we first met at a bacteriophage conference hosted by the Eliava Institute in Tbilisi, Georgia in 2015. In the context of a society that is confronted with an ever-increasing number of antibiotic-resistant bacteria, we build on the previously made recommendations and specifically address how the Nagoya Protocol might impact the further development of bacteriophage therapy. By reviewing a number of recently conducted case studies with bacteriophages involving patients with bacterial infections that could no longer be successfully treated by regular antibiotic therapy, we again stress the urgency and significance of the development of international guidelines and frameworks that might facilitate the legal and effective application of bacteriophage therapy by physicians and the receiving patients. Additionally, we list and comment on several recently started and ongoing clinical studies, including highly desired double-blind placebo-controlled randomized clinical trials. We conclude with an outlook on how recently developed DNA editing technologies are expected to further control and enhance the efficient application of bacteriophages.

  8. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  9. Bacteriophages show promise as antimicrobial agents.

    Science.gov (United States)

    Alisky, J; Iczkowski, K; Rapoport, A; Troitsky, N

    1998-01-01

    The emergence of antibiotic-resistant bacteria has prompted interest in alternatives to conventional drugs. One possible option is to use bacteriophages (phage) as antimicrobial agents. We have conducted a literature review of all Medline citations from 1966-1996 that dealt with the therapeutic use of phage. There were 27 papers from Poland, the Soviet Union, Britain and the U.S.A. The Polish and Soviets administered phage orally, topically or systemically to treat a wide variety of antibiotic-resistant pathogens in both adults and children. Infections included suppurative wound infections, gastroenteritis, sepsis, osteomyelitis, dermatitis, empyemas and pneumonia; pathogens included Staphylococcus, Streptococcus, Klebsiella, Escherichia, Proteus, Pseudomonas, Shigella and Salmonella spp. Overall, the Polish and Soviets reported success rates of 80-95% for phage therapy, with rare, reversible gastrointestinal or allergic side effects. However, efficacy of phage was determined almost exclusively by qualitative clinical assessment of patients, and details of dosages and clinical criteria were very sketchy. There were also six British reports describing controlled trials of phage in animal models (mice, guinea pigs and livestock), measuring survival rates and other objective criteria. All of the British studies raised phage against specific pathogens then used to create experimental infections. Demonstrable efficacy against Escherichia, Acinetobacter, Pseudomonas and Staphylococcus spp. was noted in these model systems. Two U.S. papers dealt with improving the bioavailability of phage. Phage is sequestered in the spleen and removed from circulation. This can be overcome by serial passage of phage through mice to isolate mutants that resist sequestration. In conclusion, bacteriophages may show promise for treating antibiotic resistant pathogens. To facilitate further progress, directions for future research are discussed and a directory of authors from the reviewed

  10. Bacteriophages of Leuconostoc, Oenococcus and Weissella

    Directory of Open Access Journals (Sweden)

    Witold P. Kot

    2014-04-01

    Full Text Available Leuconostoc (Ln., Weissella and Oenococcus form a group of related genera of lactic acid bacteria, which once all shared the name Leuconostoc. They are associated with plants, fermented vegetable products, raw milk, dairy products, meat and fish. Most of industrially relevant Leuconostoc strains can be classified as either Ln. mesenteroides or Ln. pseudomesenteroides. They are important flavor producers in dairy fermentations and they initiate nearly all vegetable fermentations. Therefore bacteriophages attacking Leuconostoc strains may negatively influence the production process. Bacteriophages attacking Leuconostoc strains were first reported in 1946. Since then, the majority of described Leuconostoc phages was isolated from either dairy products or fermented vegetable products. Both lytic and temperate phages of Leuconostoc were reported. Most of Leuconostoc phages examined using electron microscopy belong to the Siphoviridae family and differ in morphological details. Hybridization and comparative genomic studies of Leuconostoc phages suggest that they can be divided into several groups, however overall diversity of Leuconostoc phages is much lower as compared to e.g. lactococcal phages. Several fully sequenced genomes of Leuconostoc phages have been deposited in public databases. Lytic phages of Leuconostoc can be divided into two host species-specific groups with similarly organized genomes that shared very low nucleotide similarity. Phages of dairy Leuconostoc have rather limited host-ranges. The receptor binding proteins of two lytic Ln. pseudomesenteroides phages have been identified. Molecular tools for detection of dairy Leuconostoc phages have been developed. The rather limited data on phages of Oenococcus and Weissella show that i lysogeny seems to be abundant in Oenococcus strains, and ii several phages infecting Weissella cibaria are also able to productively infect strains of other Weissella species and even strains of the genus

  11. Biocontrol of Pectobacterium carotovorum subsp. carotovorum using bacteriophage PP1.

    Science.gov (United States)

    Lim, Jeong-A; Jee, Samnyu; Lee, Dong Hwan; Roh, Eunjung; Jung, Kyusuk; Oh, Changsik; Heu, Sunggi

    2013-08-01

    Pectobacterium carotovorum subsp. carotovorum (formerly Erwinia carotovora subsp. carotovora) is a plant pathogen that causes soft rot and stem rot diseases in several crops, including Chinese cabbage, potato, and tomato. To control this bacterium, we isolated a bacteriophage, PP1, with lytic activity against P. carotovorum subsp. carotovorum. Transmission electron microscopy revealed that the PP1 phage belongs to the Podoviridae family of the order Caudovirales, which exhibit icosahedral heads and short non-contractile tails. PP1 phage showed high specificity for P. carotovorum subsp. carotovorum, and several bacteria belonging to different species and phyla were resistant to PP1. This phage showed rapid and strong lytic activity against its host bacteria in liquid medium and was stable over a broad range of pH values. Disease caused by P. carotovorum subsp. carotovorum was significantly reduced by PP1 treatment. Overall, PP1 bacteriophage effectively controls P. carotovorum subsp. carotovorum.

  12. Effect of HZE particles and space hadrons on bacteriophages

    International Nuclear Information System (INIS)

    Iurov, S.S.; Akoev, I.G.; Leonteva, G.A.

    1983-01-01

    The effects of particle radiation of the type encountered in space flight on bacteriophages are investigated. Survival and mutagenesis were followed in dry film cultures or liquid suspensions of T4Br(+) bacteriophage exposed to high-energy (HZE) particles during orbital flight, to alpha particles and accelerator-generated hardrons in the laboratory, and to high-energy cosmic rays at mountain altitudes. The HZE particles and high-energy hadrons are found to have a greater relative biological efficiency than standard gamma radiation, while exhibiting a highly inhomogeneous spatial structure in the observed biological and genetic effects. In addition, the genetic lesions observed are specific to the type of radiation exposure, consisting primarily of deletions and multiple lesions of low revertability, with mode of action depending on the linear energy transfer. 18 references

  13. Effectiveness of lytic bacteriophages in reducing E. coli O157:H7 populations introduced through cross-contamination on fresh cut lettuce

    Science.gov (United States)

    Previous research has shown that lytic bacteriophages (phages) can kill E. coli O157:H7 on produce surfaces. The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield) at 10^8 PFU/m...

  14. Propagating the missing bacteriophages: a large bacteriophage in a new class

    Directory of Open Access Journals (Sweden)

    Hardies Stephen C

    2007-02-01

    Full Text Available Abstract The number of successful propagations/isolations of soil-borne bacteriophages is small in comparison to the number of bacteriophages observed by microscopy (great plaque count anomaly. As one resolution of the great plaque count anomaly, we use propagation in ultra-dilute agarose gels to isolate a Bacillus thuringiensis bacteriophage with a large head (95 nm in diameter, tail (486 × 26 nm, corkscrew-like tail fibers (187 × 10 nm and genome (221 Kb that cannot be detected by the usual procedures of microbiology. This new bacteriophage, called 0305φ8-36 (first number is month/year of isolation; remaining two numbers identify the host and bacteriophage, has a high dependence of plaque size on the concentration of a supporting agarose gel. Bacteriophage 0305φ8-36 does not propagate in the traditional gels used for bacteriophage plaque formation and also does not produce visible lysis of liquid cultures. Bacteriophage 0305φ8-36 aggregates and, during de novo isolation from the environment, is likely to be invisible to procedures of physical detection that use either filtration or centrifugal pelleting to remove bacteria. Bacteriophage 0305φ8-36 is in a new genomic class, based on genes for both structural components and DNA packaging ATPase. Thus, knowledge of environmental virus diversity is expanded with prospect of greater future expansion.

  15. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  16. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  18. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo

    2015-11-01

    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  19. Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

    Science.gov (United States)

    Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

    2012-06-01

    The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

  20. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  1. Analysis of the complete DNA sequence of the temperate bacteriophage TP901-1: Evolution, structure, and genome organization of lactococcal bacteriophages

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Østergaard, Solvej; Pedersen, Margit

    2001-01-01

    A complete analysis of the entire genome of the temperate lactococcal bacteriophage TP901-1 has been performed and the function of 21 of 56 TP901-1-encoded ORFs has been assigned. This knowledge has been used to propose 10 functional modules each responsible for specific functions during...

  2. Genomics of three new bacteriophages useful in the biocontrol of Salmonella

    Directory of Open Access Journals (Sweden)

    Carlota eBardina

    2016-04-01

    Full Text Available Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87 able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs; 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic

  3. Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments.

    Science.gov (United States)

    Iacumin, Lucilla; Manzano, Marisa; Comi, Giuseppe

    2016-01-05

    The anti-listerial activity of generally recognized as safe (GRAS) bacteriophage Listex P100 (phage P100) was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b) of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm² or 3 log CFU/cm² of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C) seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm² was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm² was required to completely eliminate 2 log L. monocytogenes/cm² and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm² and with a P100 inoculum ranging from 1 to 7 log PFU/cm². P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm² from an initial phage treatment of approximately 8 log PFU/cm². Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm² is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

  4. Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments

    Directory of Open Access Journals (Sweden)

    Lucilla Iacumin

    2016-01-01

    Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

  5. Encapsulation Strategies of Bacteriophage (Felix O1) for Oral Therapeutic Application.

    Science.gov (United States)

    Islam, Golam S; Wang, Qi; Sabour, Parviz M

    2018-01-01

    Due to emerging antibiotic-resistant strains among the pathogens, a variety of strategies, including therapeutic application of bacteriophages, have been suggested as a possible alternative to antibiotics in food animal production. As pathogen-specific biocontrol agents, bacteriophages are being studied intensively. Primarily their applications in the food industry and animal production have been recognized in the USA and Europe, for pathogens including Salmonella, Campylobacter, Escherichia coli, and Listeria. However, the viability of orally administered phage may rapidly reduce under the harsh acidic conditions of the stomach, presence of enzymes and bile. It is evident that bacteriophages, intended for phage therapy by oral administration, require efficient protection from the acidic environment of the stomach and should remain active in the animal's gastrointestinal tract where pathogen colonizes. Encapsulation of phages by spray drying or extrusion methods can protect phages from the simulated hostile gut conditions and help controlled release of phages to the digestive system when appropriate formulation strategy is implemented.

  6. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  7. A bacteriophage endolysin that eliminates intracellular streptococci

    Science.gov (United States)

    Shen, Yang; Barros, Marilia; Vennemann, Tarek; Gallagher, D Travis; Yin, Yizhou; Linden, Sara B; Heselpoth, Ryan D; Spencer, Dennis J; Donovan, David M; Moult, John; Fischetti, Vincent A; Heinrich, Frank; Lösche, Mathias; Nelson, Daniel C

    2016-01-01

    PlyC, a bacteriophage-encoded endolysin, lyses Streptococcus pyogenes (Spy) on contact. Here, we demonstrate that PlyC is a potent agent for controlling intracellular Spy that often underlies refractory infections. We show that the PlyC holoenzyme, mediated by its PlyCB subunit, crosses epithelial cell membranes and clears intracellular Spy in a dose-dependent manner. Quantitative studies using model membranes establish that PlyCB interacts strongly with phosphatidylserine (PS), whereas its interaction with other lipids is weak, suggesting specificity for PS as its cellular receptor. Neutron reflection further substantiates that PlyC penetrates bilayers above a PS threshold concentration. Crystallography and docking studies identify key residues that mediate PlyCB–PS interactions, which are validated by site-directed mutagenesis. This is the first report that a native endolysin can traverse epithelial membranes, thus substantiating the potential of PlyC as an antimicrobial for Spy in the extracellular and intracellular milieu and as a scaffold for engineering other functionalities. DOI: http://dx.doi.org/10.7554/eLife.13152.001 PMID:26978792

  8. Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

    Science.gov (United States)

    Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

    2016-11-01

    A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

  9. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos

    2014-11-01

    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  10. Incorporation of T4 bacteriophage in electrospun fibres.

    Science.gov (United States)

    Korehei, R; Kadla, J

    2013-05-01

    Antibacterial food packaging materials, such as bacteriophage-activated electrospun fibrous mats, may address concerns triggered by waves of bacterial food contamination. To address this, we investigated several efficient methods for incorporating T4 bacteriophage into electrospun fibrous mats. The incorporation of T4 bacteriophage using simple suspension electrospinning led to more than five orders of magnitude decrease in bacteriophage activity. To better maintain bacteriophage viability, emulsion electrospinning was developed where the T4 bacteriophage was pre-encapsulated in an alginate reservoir via an emulsification process and subsequently electrospun into fibres. This resulted in an increase in bacteriophage viability, but there was still two orders of magnitude drop in activity. Using a coaxial electrospinning process, full bacteriophage activity could be maintained. In this process, a core/shell fibre structure was formed with the T4 bacteriophage being directly incorporated into the fibre core. The core/shell fibre encapsulated bacteriophage exhibited full bacteriophage viability after storing for several weeks at +4°C. Coaxial electrospinning was shown to be capable of encapsulating bacteriophages with high loading capacity, high viability and long storage time. These results are significant in the context of controlling and preventing bacterial infections in perishable foods during storage. © 2013 The Society for Applied Microbiology.

  11. A quorum-sensing-induced bacteriophage defense mechanism

    DEFF Research Database (Denmark)

    Høyland-Kroghsbo, Nina Molin; Mærkedahl, Rasmus Baadsgaard; Svenningsen, Sine

    2013-01-01

    of uninfected survivor cells after a potent attack by virulent phages. Notably, this mechanism may apply to a broader range of phages, as AHLs also reduce the risk of ¿ phage infection through a different receptor. IMPORTANCE To enable the successful manipulation of bacterial populations, a comprehensive...... sensing plays an important role in determining the susceptibility of E. coli to infection by bacteriophages ¿ and ¿. On the basis of our findings in the classical Escherichia coli-¿ model system, we suggest that quorum sensing may serve as a general strategy to protect bacteria specifically under...

  12. Bacteriophages use hypermodified nucleosides to evade host's defence systems

    DEFF Research Database (Denmark)

    Kot, Witold; Olsen, Nikoline S.; Carstens, Alexander Byth

    developed several strategies to evade these defence mechanisms. Ultimately, this led to the oldest and still running arms race - microorganisms vs. their molecular parasites. We here describe a remarkable new strategy used by the recently isolated Escherichia coli phage CAjan belonging to...... to investigate this mechanism in detail we have used several methods including direct plaque sequencing, restriction endonuclease analysis and CRISPR-Cas genome editing. Through generation of specific mutants, we were able to introduce a restriction sensitive phenotype in the CAjan bacteriophage providing new...

  13. Neutron irradiation of bacteriophage λ

    International Nuclear Information System (INIS)

    Bozin, D.; Milosevic, M. . E-mail address of corresponding author: bozinde@vin.bg.ac.yu

    2005-01-01

    Double strand breaks (DSB) are the most dangerous lesions in DNA caused by irradiation, but many other lesions, usually called mutations, have not been clearly identified. These lesions, like DSB, can be the source of serious chromosomal damages and finally - cell death. Growing interest in heavy particles for radiotherapy and radioprotection encourages the search of the molecular basis of their action. In this respect, we chose bacteriophage λ1390 as the model system for the study of consequences of neutron irradiation. This derivative of λ phage possesses an unique ability to reversibly reorganize their genome in response to various selective pressures. The phages were irradiated with 13 Gy of mixed neutrons (7.5 Gy from fast and 5.6 Gy from thermal neutrons) and phages genomes were tested to DSB and mutations. Additionally, the stability of λ capsid proteins were tested. After all tests, we can conclude that, under our conditions, low flux of neutrons does not induce neither DNA strand break or DNA mutation nor the stability of λ capsid proteins. (author)

  14. Antibacterial Efficacy of Lytic Bacteriophages against Antibiotic-Resistant Klebsiella Species

    Directory of Open Access Journals (Sweden)

    M. Khajeh Karamoddini

    2011-01-01

    Full Text Available Bacterial resistance to antibiotics is a leading and highly prevalent problem in the treatment of infectious diseases. Bacteriophages (phages appear to be effective and safe alternatives for the treatment of resistant infections because of their specificity for bacterial species and lack of infectivity in eukaryotic cells. The present study aimed to isolate bacteriophages against Klebsiella spp. and evaluate their efficacy against antibiotic-resistant species. Seventy-two antibiotic-resistant Klebsiella spp. were isolated from samples of patients who referred to the Ghaem Hospital (Mashhad, Iran. Lytic bacteriophages against Klebsiella spp. were isolated from wastewater of the septic tank of the same hospital. Bactericidal activity of phages against resistant Klebsiella spp. was tested in both liquid (tube method; after 1 and 24 h of incubation and solid (double-layer agar plate method; after 24 h of incubation phases. In each method, three different concentrations of bacteriophages (low: 107 PFU/mL were used. Bacteriophages showed promising bactericidal activity at all assessed concentrations, regardless of the test method and duration of incubation. Overall, bactericidal effects were augmented at higher concentrations. In the tube method, higher activity was observed after 24 h of incubation compared to the 1-h incubation. The bactericidal effects were also higher in the tube method compared to the double-layer agar plate method after 24 h of incubation. The findings of the present study suggest that bacteriophages possess effective bactericidal activity against resistant Klebsiella spp. These bactericidal activities are influenced by phage concentration, duration of incubation, and test method.

  15. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  16. Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

    2001-01-01

    and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

  17. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

  18. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  19. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  20. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

    Science.gov (United States)

    Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

    2017-12-01

    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Photodynamic Inactivation of Mammalian Viruses and Bacteriophages

    Directory of Open Access Journals (Sweden)

    Liliana Costa

    2012-06-01

    Full Text Available Photodynamic inactivation (PDI has been used to inactivate microorganisms through the use of photosensitizers. The inactivation of mammalian viruses and bacteriophages by photosensitization has been applied with success since the first decades of the last century. Due to the fact that mammalian viruses are known to pose a threat to public health and that bacteriophages are frequently used as models of mammalian viruses, it is important to know and understand the mechanisms and photodynamic procedures involved in their photoinactivation. The aim of this review is to (i summarize the main approaches developed until now for the photodynamic inactivation of bacteriophages and mammalian viruses and, (ii discuss and compare the present state of the art of mammalian viruses PDI with phage photoinactivation, with special focus on the most relevant mechanisms, molecular targets and factors affecting the viral inactivation process.

  3. Isolation of lytic bacteriophage against Vibrio harveyi.

    Science.gov (United States)

    Crothers-Stomps, C; Høj, L; Bourne, D G; Hall, M R; Owens, L

    2010-05-01

    The isolation of lytic bacteriophage of Vibrio harveyi with potential for phage therapy of bacterial pathogens of phyllosoma larvae from the tropical rock lobster Panulirus ornatus. Water samples from discharge channels and grow-out ponds of a prawn farm in northeastern Australia were enriched for 24 h in a broth containing four V. harveyi strains. The bacteriophage-enriched filtrates were spotted onto bacterial lawns demonstrating that the bacteriophage host range for the samples included strains of V. harveyi, Vibrio campbellii, Vibrio rotiferianus, Vibrio parahaemolyticus and Vibrio proteolyticus. Bacteriophage were isolated from eight enriched samples through triple plaque purification. The host range of purified phage included V. harveyi, V. campbellii, V. rotiferianus and V. parahaemolyticus. Transmission electron microscope examination revealed that six purified phage belonged to the family Siphoviridae, whilst two belonged to the family Myoviridae. The Myoviridae appeared to induce bacteriocin production in a limited number of host bacterial strains, suggesting that they were lysogenic rather than lytic. A purified Siphoviridae phage could delay the entry of a broth culture of V. harveyi strain 12 into exponential growth, but could not prevent the overall growth of the bacterial strain. Bacteriophage with lytic activity against V. harveyi were isolated from prawn farm samples. Purified phage of the family Siphoviridae had a clear lytic ability and no apparent transducing properties, indicating they are appropriate for phage therapy. Phage resistance is potentially a major constraint to the use of phage therapy in aquaculture as bacteria are not completely eliminated. Phage therapy is emerging as a potential antibacterial agent that can be used to control pathogenic bacteria in aquaculture systems. The development of phage therapy for aquaculture requires initial isolation and determination of the bacteriophage host range, with subsequent creation of

  4. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  5. Bacteriophages in the control of pathogenic vibrios

    DEFF Research Database (Denmark)

    Plaza, Nicolás; Castillo Bermúdez, Daniel Elías; Perez-Reytor, Diliana

    2018-01-01

    constitute a continuing threat for aquaculture. Moreover, the continuous use of antibiotics has been accompanied by an emergence of antibiotic resistance in Vibrio species, implying a necessity for efficient treatments. One promising alternative that emerges is the use of lytic bacteriophages; however......, there are some drawbacks that should be overcome to make phage therapy a widely accepted method. In this work, we discuss about the major pathogenic Vibrio species and the progress, benefits and disadvantages that have been detected during the experimental use of bacteriophages to their control....

  6. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  7. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

  8. Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

    Science.gov (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

    2011-01-01

    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

  9. Toward modern inhalational bacteriophage therapy: nebulization of bacteriophages of Burkholderia cepacia complex.

    Science.gov (United States)

    Golshahi, Laleh; Seed, Kimberley D; Dennis, Jonathan J; Finlay, Warren H

    2008-12-01

    Antibiotic-resistant bacterial infections have renewed interest in finding substitute methods of treatment. The purpose of the present in vitro study was to investigate the possibility of respiratory delivery of a Burkholderia cepacia complex (BCC) bacteriophage by nebulized aerosol administration. Bacteriophages in isotonic saline were aerosolized with Pari LC star and eFlow nebulizers, at titers with mean value (standard deviation) of 2.15 x 10(8) (1.63 x 10(8)) plaque-forming unit (PFU)/mL in 2.5-mL nebulizer fills. The breathing pattern of an adult was simulated using a pulmonary waveform generator. During breath simulation, the size distributions of the nebulized aerosol were measured using phase doppler anemometry (PDA). Efficiency of nebulizer delivery was subsequently determined by collection of aerosol on low resistance filters and measurement of bacteriophage titers. These filter titers were used as input data to a mathematical lung deposition model to predict regional deposition of bacteriophages in the lung and initial bacteriophage titers in the liquid surface layer of each conducting airway generation. The results suggest that BCC bacteriophages can be nebulized successfully within a reasonable delivery time and predicted titers in the lung indicate that this method may hold potential for treatment of bacterial lung infections common among cystic fibrosis patients.

  10. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  11. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  12. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  13. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  14. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  15. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  16. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

  17. Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek

    2010-01-01

    -Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....

  18. What history tells us XLIII Bacteriophage

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 42; Issue 3. What history tells us XLIII Bacteriophage: The contexts in which it was discovered. MICHEL MORANGE. Series Volume 42 Issue 3 September 2017 pp 359-362. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  20. Aligning the unalignable: bacteriophage whole genome alignments.

    Science.gov (United States)

    Bérard, Sèverine; Chateau, Annie; Pompidor, Nicolas; Guertin, Paul; Bergeron, Anne; Swenson, Krister M

    2016-01-13

    In recent years, many studies focused on the description and comparison of large sets of related bacteriophage genomes. Due to the peculiar mosaic structure of these genomes, few informative approaches for comparing whole genomes exist: dot plots diagrams give a mostly qualitative assessment of the similarity/dissimilarity between two or more genomes, and clustering techniques are used to classify genomes. Multiple alignments are conspicuously absent from this scene. Indeed, whole genome aligners interpret lack of similarity between sequences as an indication of rearrangements, insertions, or losses. This behavior makes them ill-prepared to align bacteriophage genomes, where even closely related strains can accomplish the same biological function with highly dissimilar sequences. In this paper, we propose a multiple alignment strategy that exploits functional collinearity shared by related strains of bacteriophages, and uses partial orders to capture mosaicism of sets of genomes. As classical alignments do, the computed alignments can be used to predict that genes have the same biological function, even in the absence of detectable similarity. The Alpha aligner implements these ideas in visual interactive displays, and is used to compute several examples of alignments of Staphylococcus aureus and Mycobacterium bacteriophages, involving up to 29 genomes. Using these datasets, we prove that Alpha alignments are at least as good as those computed by standard aligners. Comparison with the progressive Mauve aligner - which implements a partial order strategy, but whose alignments are linearized - shows a greatly improved interactive graphic display, while avoiding misalignments. Multiple alignments of whole bacteriophage genomes work, and will become an important conceptual and visual tool in comparative genomics of sets of related strains. A python implementation of Alpha, along with installation instructions for Ubuntu and OSX, is available on bitbucket (https://bitbucket.org/thekswenson/alpha).

  1. Targeting Antibacterial Agents by Using Drug-Carrying Filamentous Bacteriophages

    Science.gov (United States)

    Yacoby, Iftach; Shamis, Marina; Bar, Hagit; Shabat, Doron; Benhar, Itai

    2006-01-01

    Bacteriophages have been used for more than a century for (unconventional) therapy of bacterial infections, for half a century as tools in genetic research, for 2 decades as tools for discovery of specific target-binding proteins, and for nearly a decade as tools for vaccination or as gene delivery vehicles. Here we present a novel application of filamentous bacteriophages (phages) as targeted drug carriers for the eradication of (pathogenic) bacteria. The phages are genetically modified to display a targeting moiety on their surface and are used to deliver a large payload of a cytotoxic drug to the target bacteria. The drug is linked to the phages by means of chemical conjugation through a labile linker subject to controlled release. In the conjugated state, the drug is in fact a prodrug devoid of cytotoxic activity and is activated following its dissociation from the phage at the target site in a temporally and spatially controlled manner. Our model target was Staphylococcus aureus, and the model drug was the antibiotic chloramphenicol. We demonstrated the potential of using filamentous phages as universal drug carriers for targetable cells involved in disease. Our approach replaces the selectivity of the drug itself with target selectivity borne by the targeting moiety, which may allow the reintroduction of nonspecific drugs that have thus far been excluded from antibacterial use (because of toxicity or low selectivity). Reintroduction of such drugs into the arsenal of useful tools may help to combat emerging bacterial antibiotic resistance. PMID:16723570

  2. Bacteriophage lambda: The path from biology to theranostic agent.

    Science.gov (United States)

    Catalano, Carlos E

    2018-03-13

    Viral particles provide an attractive platform for the engineering of semisynthetic therapeutic nanoparticles. They can be modified both genetically and chemically in a defined manner to alter their surface characteristics, for targeting specific cell types, to improve their pharmacokinetic features and to attenuate (or enhance) their antigenicity. These advantages derive from a detailed understanding of virus biology, gleaned from decades of fundamental genetic, biochemical, and structural studies that have provided mechanistic insight into virus assembly pathways. In particular, bacteriophages offer significant advantages as nanoparticle platforms and several have been adapted toward the design and engineering of "designer" nanoparticles for therapeutic and diagnostic (theranostic) applications. The present review focuses on one such virus, bacteriophage lambda; I discuss the biology of lambda, the tools developed to faithfully recapitulate the lambda assembly reactions in vitro and the observations that have led to cooptation of the lambda system for nanoparticle design. This discussion illustrates how a fundamental understanding of virus assembly has allowed the rational design and construction of semisynthetic nanoparticles as potential theranostic agents and illustrates the concept of benchtop to bedside translational research. This article is categorized under: Biology-Inspired Nanomaterials> Protein and Virus-Based Structures Biology-Inspired Nanomaterials> Nucleic Acid-Based Structures. © 2018 Wiley Periodicals, Inc.

  3. Evidence of translation efficiency adaptation of the coding regions of the bacteriophage lambda.

    Science.gov (United States)

    Goz, Eli; Mioduser, Oriah; Diament, Alon; Tuller, Tamir

    2017-08-01

    Deciphering the way gene expression regulatory aspects are encoded in viral genomes is a challenging mission with ramifications related to all biomedical disciplines. Here, we aimed to understand how the evolution shapes the bacteriophage lambda genes by performing a high resolution analysis of ribosomal profiling data and gene expression related synonymous/silent information encoded in bacteriophage coding regions.We demonstrated evidence of selection for distinct compositions of synonymous codons in early and late viral genes related to the adaptation of translation efficiency to different bacteriophage developmental stages. Specifically, we showed that evolution of viral coding regions is driven, among others, by selection for codons with higher decoding rates; during the initial/progressive stages of infection the decoding rates in early/late genes were found to be superior to those in late/early genes, respectively. Moreover, we argued that selection for translation efficiency could be partially explained by adaptation to Escherichia coli tRNA pool and the fact that it can change during the bacteriophage life cycle.An analysis of additional aspects related to the expression of viral genes, such as mRNA folding and more complex/longer regulatory signals in the coding regions, is also reported. The reported conclusions are likely to be relevant also to additional viruses. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

    Science.gov (United States)

    del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

    2007-02-01

    Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

  5. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  6. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

    OpenAIRE

    Fossmo, Sabine

    2013-01-01

    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  7. Evolution and the complexity of bacteriophages.

    Science.gov (United States)

    Serwer, Philip

    2007-03-13

    The genomes of both long-genome (> 200 Kb) bacteriophages and long-genome eukaryotic viruses have cellular gene homologs whose selective advantage is not explained. These homologs add genomic and possibly biochemical complexity. Understanding their significance requires a definition of complexity that is more biochemically oriented than past empirically based definitions. Initially, I propose two biochemistry-oriented definitions of complexity: either decreased randomness or increased encoded information that does not serve immediate needs. Then, I make the assumption that these two definitions are equivalent. This assumption and recent data lead to the following four-part hypothesis that explains the presence of cellular gene homologs in long bacteriophage genomes and also provides a pathway for complexity increases in prokaryotic cells: (1) Prokaryotes underwent evolutionary increases in biochemical complexity after the eukaryote/prokaryote splits. (2) Some of the complexity increases occurred via multi-step, weak selection that was both protected from strong selection and accelerated by embedding evolving cellular genes in the genomes of bacteriophages and, presumably, also archaeal viruses (first tier selection). (3) The mechanisms for retaining cellular genes in viral genomes evolved under additional, longer-term selection that was stronger (second tier selection). (4) The second tier selection was based on increased access by prokaryotic cells to improved biochemical systems. This access was achieved when DNA transfer moved to prokaryotic cells both the more evolved genes and their more competitive and complex biochemical systems. I propose testing this hypothesis by controlled evolution in microbial communities to (1) determine the effects of deleting individual cellular gene homologs on the growth and evolution of long genome bacteriophages and hosts, (2) find the environmental conditions that select for the presence of cellular gene homologs, (3) determine

  8. Evolution and the complexity of bacteriophages

    Directory of Open Access Journals (Sweden)

    Serwer Philip

    2007-03-01

    Full Text Available Abstract Background The genomes of both long-genome (> 200 Kb bacteriophages and long-genome eukaryotic viruses have cellular gene homologs whose selective advantage is not explained. These homologs add genomic and possibly biochemical complexity. Understanding their significance requires a definition of complexity that is more biochemically oriented than past empirically based definitions. Hypothesis Initially, I propose two biochemistry-oriented definitions of complexity: either decreased randomness or increased encoded information that does not serve immediate needs. Then, I make the assumption that these two definitions are equivalent. This assumption and recent data lead to the following four-part hypothesis that explains the presence of cellular gene homologs in long bacteriophage genomes and also provides a pathway for complexity increases in prokaryotic cells: (1 Prokaryotes underwent evolutionary increases in biochemical complexity after the eukaryote/prokaryote splits. (2 Some of the complexity increases occurred via multi-step, weak selection that was both protected from strong selection and accelerated by embedding evolving cellular genes in the genomes of bacteriophages and, presumably, also archaeal viruses (first tier selection. (3 The mechanisms for retaining cellular genes in viral genomes evolved under additional, longer-term selection that was stronger (second tier selection. (4 The second tier selection was based on increased access by prokaryotic cells to improved biochemical systems. This access was achieved when DNA transfer moved to prokaryotic cells both the more evolved genes and their more competitive and complex biochemical systems. Testing the hypothesis I propose testing this hypothesis by controlled evolution in microbial communities to (1 determine the effects of deleting individual cellular gene homologs on the growth and evolution of long genome bacteriophages and hosts, (2 find the environmental conditions that

  9. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

    Science.gov (United States)

    Tian, Jing; Liu, Xiu-mei

    2009-09-01

    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  10. In vitro evaluation of a novel bacteriophage cocktail as a preventative for bovine coliform mastitis.

    Science.gov (United States)

    Porter, J; Anderson, J; Carter, L; Donjacour, E; Paros, M

    2016-03-01

    The objective of this study was to investigate the potential use of bacteriophage in preventing Escherichia coli mastitis on dairies. A cocktail consisting of 4 distinct bacteriophages was generated by screening against 36 E. coli isolates from dairy cows in Washington State with clinical mastitis. The bacteriophage significantly inhibited growth of 58% of the Washington State isolates and 54% of E. coli mastitis isolates from New York State, suggesting that the cocktail of phages had a relatively broad spectrum of action against relevant strains from 2 distinct geographies. The ability to suppress bacterial growth of these isolates in a liquid growth medium was not affected by the ratio of bacteriophage particles to bacterial cells (multiplicity of infection, MOI). For those E. coli that were completely inhibited by the phage cocktail, an MOI as low as 10 had the same effect as 10 µg/mL of ceftiofur on the growth rate of E. coli over a 12-h period using optical density measurements. A 3.3- to 5.6-log reduction of growth was achieved when E. coli was co-incubated with our phage cocktail in raw milk over a 12-h period at physiologic temperature. A modified gentamicin protection assay using bovine mammary epithelial cells provided a model to test whether bacteriophage could prevent cell attachment and invasion by chronic coliform mastitis strains. Pretreatment of cell cultures with the phage cocktail significantly reduced adhesion and intracellular survival of E. coli compared with controls. When combined with a bismuth-based teat sealant, the phage cocktail was able to inhibit bacterial growth when challenged with 1.6 × 10(3) cfu/mL of a clinical mastitis E. coli strain. In vitro results show bactericidal activity by our phage in raw milk and mammary tissue culture systems. Before a bacteriophage-based dry-cow treatment becomes a potential option for dairies, in vivo studies must be able to demonstrate that a specific dose of bacteriophage can protect cows from

  11. Bacteriophage-resistant mutants in Yersinia pestis: identification of phage receptors and attenuation for mice.

    Directory of Open Access Journals (Sweden)

    Andrey A Filippov

    Full Text Available BACKGROUND: Bacteriophages specific for Yersinia pestis are routinely used for plague diagnostics and could be an alternative to antibiotics in case of drug-resistant plague. A major concern of bacteriophage therapy is the emergence of phage-resistant mutants. The use of phage cocktails can overcome this problem but only if the phages exploit different receptors. Some phage-resistant mutants lose virulence and therefore should not complicate bacteriophage therapy. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this work was to identify Y. pestis phage receptors using site-directed mutagenesis and trans-complementation and to determine potential attenuation of phage-resistant mutants for mice. Six receptors for eight phages were found in different parts of the lipopolysaccharide (LPS inner and outer core. The receptor for R phage was localized beyond the LPS core. Most spontaneous and defined phage-resistant mutants of Y. pestis were attenuated, showing increase in LD₅₀ and time to death. The loss of different LPS core biosynthesis enzymes resulted in the reduction of Y. pestis virulence and there was a correlation between the degree of core truncation and the impact on virulence. The yrbH and waaA mutants completely lost their virulence. CONCLUSIONS/SIGNIFICANCE: We identified Y. pestis receptors for eight bacteriophages. Nine phages together use at least seven different Y. pestis receptors that makes some of them promising for formulation of plague therapeutic cocktails. Most phage-resistant Y. pestis mutants become attenuated and thus should not pose a serious problem for bacteriophage therapy of plague. LPS is a critical virulence factor of Y. pestis.

  12. Bacteriophage interactions with marine pathogenic Vibrios

    DEFF Research Database (Denmark)

    Kalatzis, Panagiotis

    development and spreading of antibiotic resistant bacteria in the environment. Bacteriophage therapy, constitutes a potent alternative not only for treatment but also for prevention of vibriosis in aquaculture and the current thesis addresses the potential and challenges of using phages to control Vibrio...... pathogens. The combinatory administration of virulent bacteriophages φSt2 and φGrn1, isolated against Vibrio alginolyticus significantly reduced the Vibrio load in cultures of Artemia salina live prey, decreasing subsequently the risk of a vibriosis outbreak in the marine hatchery. During infection...... therapy applications. Lytic phage vB_VspP_pVa5 that has been isolated against the rapidly emerging pathogen V. splendidus is also a promising candidate for phage therapy application according to its gene content and in vitro performance against its host. The genetic features of vB_VspP_pVa5 provide also...

  13. Bacteriophage ecology in environmental biotechnology processes.

    Science.gov (United States)

    Shapiro, Orr H; Kushmaro, Ariel

    2011-06-01

    Heterotrophic bacteria are an integral part of any environmental biotechnology process (EBP). Therefore, factors controlling bacterial abundance, activity, and community composition are central to the understanding of such processes. Among these factors, top-down control by bacteriophage predation has so far received very limited attention. With over 10(8) particles per ml, phage appear to be the most numerous biological entities in EBP. Phage populations in EBP appear to be highly dynamic and to correlate with the population dynamics of their hosts and genomic evidence suggests bacteria evolve to avoid phage predation. Clearly, there is much to learn regarding bacteriophage in EBP before we can truly understand the microbial ecology of these globally important systems. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  15. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  16. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  17. T4-related bacteriophage LIMEstone isolates for the control of soft rot on potato caused by 'Dickeya solani'.

    Directory of Open Access Journals (Sweden)

    Evelien M Adriaenssens

    Full Text Available The bacterium 'Dickeya solani', an aggressive biovar 3 variant of Dickeya dianthicola, causes rotting and blackleg in potato. To control this pathogen using bacteriophage therapy, we isolated and characterized two closely related and specific bacteriophages, vB_DsoM_LIMEstone1 and vB_DsoM_LIMEstone2. The LIMEstone phages have a T4-related genome organization and share DNA similarity with Salmonella phage ViI. Microbiological and molecular characterization of the phages deemed them suitable and promising for use in phage therapy. The phages reduced disease incidence and severity on potato tubers in laboratory assays. In addition, in a field trial of potato tubers, when infected with 'Dickeya solani', the experimental phage treatment resulted in a higher yield. These results form the basis for the development of a bacteriophage-based biocontrol of potato plants and tubers as an alternative for the use of antibiotics.

  18. Genomic presence of gadD1 glutamate decarboxylase correlates with the organization of ascB-dapE internalin cluster in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan

    2012-02-01

    The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.

  19. Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

    Science.gov (United States)

    Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

    2018-06-20

    Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

  20. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  1. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  2. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel

    2012-09-01

    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  3. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  4. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

    Science.gov (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

    2016-01-01

    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Bacteriophages-potential for application in wastewater treatment processes

    International Nuclear Information System (INIS)

    Withey, S.; Cartmell, E.; Avery, L.M.; Stephenson, T.

    2005-01-01

    Bacteriophages are viruses that infect and lyse bacteria. Interest in the ability of phages to control bacterial populations has extended from medical applications into the fields of agriculture, aquaculture and the food industry. Here, the potential application of phage techniques in wastewater treatment systems to improve effluent and sludge emissions into the environment is discussed. Phage-mediated bacterial mortality has the potential to influence treatment performance by controlling the abundance of key functional groups. Phage treatments have the potential to control environmental wastewater process problems such as: foaming in activated sludge plants; sludge dewaterability and digestibility; pathogenic bacteria; and to reduce competition between nuisance bacteria and functionally important microbial populations. Successful application of phage therapy to wastewater treatment does though require a fuller understanding of wastewater microbial community dynamics and interactions. Strategies to counter host specificity and host cell resistance must also be developed, as should safety considerations regarding pathogen emergence through transduction

  6. RNA secondary structures of the bacteriophage phi6 packaging regions.

    Science.gov (United States)

    Pirttimaa, M J; Bamford, D H

    2000-06-01

    Bacteriophage phi6 genome consists of three segments of double-stranded RNA. During maturation, single-stranded copies of these segments are packaged into preformed polymerase complex particles. Only phi6 RNA is packaged, and each particle contains only one copy of each segment. An in vitro packaging and replication assay has been developed for phi6, and the packaging signals (pac sites) have been mapped to the 5' ends of the RNA segments. In this study, we propose secondary structure models for the pac sites of phi6 single-stranded RNA segments. Our models accommodate data from structure-specific chemical modifications, free energy minimizations, and phylogenetic comparisons. Previously reported pac site deletion studies are also discussed. Each pac site possesses a unique architecture, that, however, contains common structural elements.

  7. Bacteriophages: The viruses for all seasons of molecular biology

    Directory of Open Access Journals (Sweden)

    Karam Jim D

    2005-03-01

    Full Text Available Abstract Bacteriophage research continues to break new ground in our understanding of the basic molecular mechanisms of gene action and biological structure. The abundance of bacteriophages in nature and the diversity of their genomes are two reasons why phage research brims with excitement. The pages of Virology Journal will reflect the excitement of the "New Phage Biology."

  8. Bacteriophages as indicators of faecal pollution and enteric virus removal.

    Science.gov (United States)

    McMinn, B R; Ashbolt, N J; Korajkic, A

    2017-07-01

    Bacteriophages are an attractive alternative to faecal indicator bacteria (FIB), particularly as surrogates of enteric virus fate and transport, due to their closer morphological and biological properties. Based on a review of published data, we summarize densities of coliphages (F+ and somatic), Bacteroides spp. and enterococci bacteriophages (phages) in individual human waste, raw wastewater, ambient fresh and marine waters and removal through wastewater treatment processes utilizing traditional treatments. We also provide comparisons with FIB and enteric viruses whenever possible. Lastly, we examine fate and transport characteristics in the aquatic environment and provide an overview of the environmental factors affecting their survival. In summary, concentrations of bacteriophages in various sources were consistently lower than FIB, but more reflective of infectious enteric virus levels. Overall, our investigation indicates that bacteriophages may be adequate viral surrogates, especially in built systems, such as wastewater treatment plants. Bacteriophage are alternative fecal indicators that may be better surrogates for viral pathogens than fecal indicator bacteria (FIB). This report offers a summary of the existing literature concerning the utility of bacteriophage as indicators of viral presence (fecal sources and surface waters) and persistence (in built infrastructure and aquatic environments). Our findings indicate that bacteriophage levels in all matrices examined are consistently lower than FIB, but similar to viral pathogens. Furthermore, in built infrastructure (e.g. wastewater treatment systems) bacteriophage closely mimic viral pathogen persistence suggesting they may be adequate sentinels of enteric virus removal. © 2017 The Society for Applied Microbiology.

  9. Genome Sequences of 19 Novel Erwinia amylovora Bacteriophages.

    Science.gov (United States)

    Esplin, Ian N D; Berg, Jordan A; Sharma, Ruchira; Allen, Robert C; Arens, Daniel K; Ashcroft, Cody R; Bairett, Shannon R; Beatty, Nolan J; Bickmore, Madeline; Bloomfield, Travis J; Brady, T Scott; Bybee, Rachel N; Carter, John L; Choi, Minsey C; Duncan, Steven; Fajardo, Christopher P; Foy, Brayden B; Fuhriman, David A; Gibby, Paul D; Grossarth, Savannah E; Harbaugh, Kala; Harris, Natalie; Hilton, Jared A; Hurst, Emily; Hyde, Jonathan R; Ingersoll, Kayleigh; Jacobson, Caitlin M; James, Brady D; Jarvis, Todd M; Jaen-Anieves, Daniella; Jensen, Garrett L; Knabe, Bradley K; Kruger, Jared L; Merrill, Bryan D; Pape, Jenny A; Payne Anderson, Ashley M; Payne, David E; Peck, Malia D; Pollock, Samuel V; Putnam, Micah J; Ransom, Ethan K; Ririe, Devin B; Robinson, David M; Rogers, Spencer L; Russell, Kerri A; Schoenhals, Jonathan E; Shurtleff, Christopher A; Simister, Austin R; Smith, Hunter G; Stephenson, Michael B; Staley, Lyndsay A; Stettler, Jason M; Stratton, Mallorie L; Tateoka, Olivia B; Tatlow, P J; Taylor, Alexander S; Thompson, Suzanne E; Townsend, Michelle H; Thurgood, Trever L; Usher, Brittian K; Whitley, Kiara V; Ward, Andrew T; Ward, Megan E H; Webb, Charles J; Wienclaw, Trevor M; Williamson, Taryn L; Wells, Michael J; Wright, Cole K; Breakwell, Donald P; Hope, Sandra; Grose, Julianne H

    2017-11-16

    Erwinia amylovora is the causal agent of fire blight, a devastating disease affecting some plants of the Rosaceae family. We isolated bacteriophages from samples collected from infected apple and pear trees along the Wasatch Front in Utah. We announce 19 high-quality complete genome sequences of E. amylovora bacteriophages. Copyright © 2017 Esplin et al.

  10. Sequence and comparative analysis of Leuconostoc dairy bacteriophages

    DEFF Research Database (Denmark)

    Kot, Witold; Hansen, Lars Henrik; Neve, Horst

    2014-01-01

    Bacteriophages attacking Leuconostoc species may significantly influence the quality of the final product. There is however limited knowledge of this group of phages in the literature. We have determined the complete genome sequences of nine Leuconostoc bacteriophages virulent to either Leuconostoc...

  11. Biocontrol of Escherichia coli O157:H7 on fresh-cut spinach and lettuce using a bacteriophage cocktail

    Science.gov (United States)

    The effect of an E. coli O157:H7-specific bacteriophage cocktail (EcoShield™) was evaluated against nalidixic acid resistant (NalR) E. coli O157:H7 strains in either a) laboratory medium or b) on leafy greens. Laboratory medium cultures were inoculated with 5 log CFU/ml and treated with 7 log PFU/ml...

  12. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  13. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  14. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  15. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  16. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2010-08-01

    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  17. Interactions of the cell-wall glycopolymers of lactic acid bacteria with their bacteriophages

    Directory of Open Access Journals (Sweden)

    Marie-Pierre eChapot-Chartier

    2014-05-01

    Full Text Available Lactic acid bacteria (LAB are Gram positive bacteria widely used in the production of fermented food in particular cheese and yoghurts. Bacteriophage infections during fermentation processes have been for many years a major industrial concern and have stimulated numerous research efforts. Better understanding of the molecular mechanisms of bacteriophage interactions with their host bacteria is required for the development of efficient strategies to fight against infections. The bacterial cell wall plays key roles in these interactions. First, bacteriophages must adsorb at the bacterial surface through specific interactions with receptors that are cell wall components. At next step, phages must overcome the barrier constituted by cell wall peptidoglycan to inject DNA inside bacterial cell. Also at the end of the infection cycle, phages synthesize endolysins able to hydrolyze peptidoglycan and lyse bacterial cells to release phage progeny. In the last decade, concomitant development of genomics and structural analysis of cell wall components allowed considerable advances in the knowledge of their structure and function in several model LAB. Here, we describe the present knowledge on the structure of the cell wall glycopolymers of the best characterized LAB emphasizing their structural variations and we present the available data regarding their role in bacteria-phage specific interactions at the different steps of the infection cycle.

  18. M13 Bacteriophage Based Protein Sensors

    Science.gov (United States)

    Lee, Ju Hun

    Despite significant progress in biotechnology and biosensing, early detection and disease diagnosis remains a critical issue for improving patient survival rates and well-being. Many of the typical detection schemes currently used possess issues such as low sensitivity and accuracy and are also time consuming to run and expensive. In addition, multiplexed detection remains difficult to achieve. Therefore, developing advanced approaches for reliable, simple, quantitative analysis of multiple markers in solution that also are highly sensitive are still in demand. In recent years, much of the research has primarily focused on improving two key components of biosensors: the bio-recognition agent (bio-receptor) and the transducer. Particular bio-receptors that have been used include antibodies, aptamers, molecular imprinted polymers, and small affinity peptides. In terms of transducing agents, nanomaterials have been considered as attractive candidates due to their inherent nanoscale size, durability and unique chemical and physical properties. The key focus of this thesis is the design of a protein detection and identification system that is based on chemically engineered M13 bacteriophage coupled with nanomaterials. The first chapter provides an introduction of biosensors and M13 bacteriophage in general, where the advantages of each are provided. In chapter 2, an efficient and enzyme-free sensor is demonstrated from modified M13 bacteriophage to generate highly sensitive colorimetric signals from gold nanocrystals. In chapter 3, DNA conjugated M13 were used to enable facile and rapid detection of antigens in solution that also provides modalities for identification. Lastly, high DNA loadings per phage was achieved via hydrozone chemistry and these were applied in conjunction with Raman active DNA-gold/silver core/shell nanoparticles toward highly sensitive SERS sensing.

  19. [Neonatal meningitis due to Listeria monocytogenes after 3 weeks of maternal treatment during pregnancy].

    Science.gov (United States)

    Fayol, L; Beizig, S; Le Monnier, A; Lacroze, V; Simeoni, U

    2009-04-01

    We report the case of a pregnant woman with listeriosis at 26 gestational weeks followed by premature labor at 30 gestational weeks. Bacterial meningitis was suspected in the neonate with ventriculitis on sonography, a high level of protein in the cerebrospinal fluid (CSF), and an identified specific bacterial genome of Listeria monocytogenes (PCR 16S rDNA and sequencing and specific amplification of L. monocytogenes hly gene) in CSF. Neonatal meningitis was complicated with cerebral venous sinus thrombosis and ventriculomegaly. Listeriosis during pregnancy can lead to severe complications in the neonate. Thus, listeriosis should be a diagnostic concern in febrile pregnant women at any stage of pregnancy. First-line treatment is based on high-dose amoxicillin (> or =6g/day) and must be used for at least 3 weeks for treatment of listeriosis during pregnancy. If the fetus survives, longer therapy until delivery can be discussed.

  20. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  1. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  2. Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

    Science.gov (United States)

    Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

    2017-05-01

    Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  3. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  4. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  5. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  6. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  7. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  8. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  9. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  10. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  11. Effects of prebiotics on the infective potential of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Ebersbach, Tine

    % xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

  12. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  13. A bacteriophages journey through the human body.

    Science.gov (United States)

    Barr, Jeremy J

    2017-09-01

    The human body is colonized by a diverse collective of microorganisms, including bacteria, fungi, protozoa and viruses. The smallest entity of this microbial conglomerate are the bacterial viruses. Bacteriophages, or phages for short, exert significant selective pressure on their bacterial hosts, undoubtedly influencing the human microbiome and its impact on our health and well-being. Phages colonize all niches of the body, including the skin, oral cavity, lungs, gut, and urinary tract. As such our bodies are frequently and continuously exposed to diverse collections of phages. Despite the prevalence of phages throughout our bodies, the extent of their interactions with human cells, organs, and immune system is still largely unknown. Phages physically interact with our mucosal surfaces, are capable of bypassing epithelial cell layers, disseminate throughout the body and may manipulate our immune system. Here, I establish the novel concept of an "intra-body phageome," which encompasses the collection of phages residing within the classically "sterile" regions of the body. This review will take a phage-centric view of the microbiota, human body, and immune system with the ultimate goal of inspiring a greater appreciation for both the indirect and direct interactions between bacteriophages and their mammalian hosts. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  15. Bacteriophages: the possible solution to treat infections caused by pathogenic bacteria.

    Science.gov (United States)

    El-Shibiny, Ayman; El-Sahhar, Salma

    2017-11-01

    Since their discovery in 1915, bacteriophages have been used to treat bacterial infections in animals and humans because of their unique ability to infect their specific bacterial hosts without affecting other bacterial populations. The research carried out in this field throughout the 20th century, largely in Georgia, part of USSR and Poland, led to the establishment of phage therapy protocols. However, the discovery of penicillin and sulfonamide antibiotics in the Western World during the 1930s was a setback in the advancement of phage therapy. The misuse of antibiotics has reduced their efficacy in controlling pathogens and has led to an increase in the number of antibiotic-resistant bacteria. As an alternative to antibiotics, bacteriophages have become a topic of interest with the emergence of multidrug-resistant bacteria, which are a threat to public health. Recent studies have indicated that bacteriophages can be used indirectly to detect pathogenic bacteria or directly as biocontrol agents. Moreover, they can be used to develop new molecules for clinical applications, vaccine production, drug design, and in the nanomedicine field via phage display.

  16. The Baseplate of Lactobacillus delbrueckii Bacteriophage Ld17 Harbors a Glycerophosphodiesterase.

    Science.gov (United States)

    Cornelissen, Anneleen; Sadovskaya, Irina; Vinogradov, Evgeny; Blangy, Stéphanie; Spinelli, Silvia; Casey, Eoghan; Mahony, Jennifer; Noben, Jean-Paul; Dal Bello, Fabio; Cambillau, Christian; van Sinderen, Douwe

    2016-08-05

    Glycerophosphodiester phosphodiesterases (GDPDs; EC 3.1.4.46) typically hydrolyze glycerophosphodiesters to sn-glycerol 3-phosphate (Gro3P) and their corresponding alcohol during patho/physiological processes in bacteria and eukaryotes. GDPD(-like) domains were identified in the structural particle of bacterial viruses (bacteriophages) specifically infecting Gram-positive bacteria. The GDPD of phage 17 (Ld17; GDPDLd17), representative of the group b Lactobacillus delbrueckii subsp. bulgaricus (Ldb)-infecting bacteriophages, was shown to hydrolyze, besides the simple glycerophosphodiester, two complex surface-associated carbohydrates of the Ldb17 cell envelope: the Gro3P decoration of the major surface polysaccharide d-galactan and the oligo(glycerol phosphate) backbone of the partially glycosylated cell wall teichoic acid, a minor Ldb17 cell envelope component. Degradation of cell wall teichoic acid occurs according to an exolytic mechanism, and Gro3P substitution is presumed to be inhibitory for GDPDLd17 activity. The presence of the GDPDLd17 homotrimer in the viral baseplate structure involved in phage-host interaction together with the dependence of native GDPD activity, adsorption, and efficiency of plating of Ca(2+) ions supports a role for GDPDLd17 activity during phage adsorption and/or phage genome injection. In contrast to GDPDLd17, we could not identify any enzymatic activity for the GDPD-like domain in the neck passage structure of phage 340, a 936-type Lactococcus lactis subsp. lactis bacteriophage. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  18. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

  19. Study of the reactivation of X-ray inactivated lambda bacteriophages by irradiated Escherichia coli bacteria

    International Nuclear Information System (INIS)

    Kiessling, W.

    1980-01-01

    Bacteriophages lambda and E.coli cells were exposed to X-rays in LB medium. Host cells exposed to a dose of 85 to 765 Gy had a reactivation factor 1.3 to 3.0 for bacteriophages inactivated by X-rays. The capacity of the bacteria for bacteriophage mutliplication remained apparently unchanged in this dose range. After UV-irradiation of the host cells, only a reactivation factor of 1.3 was found for bacteriophages exposed to X-radiation. The comparatively low Weigle reactivation of bacteriophages exposed to X-radiation - as compared with bacteriophages exposed to UV radiation was analyzed by counting free, non-adsorbed bacteriophages determined by filtration of radioactively labelled bacteriophage-host complexes, it was found to be due to a reduced adsorptivity. Reactivation experiments with bacteriophages exposed to X-rays and host bacterias with different degrees of radiosensitivity proved this assumption to be correct. (orig.) [de

  20. Comparative analysis of the biological and physical properties of Enterococcus faecalis bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis bacteriophage vB_SmM_GEC-SmitisM_2.

    Science.gov (United States)

    Rigvava, Sophio; Tchgkonia, Irina; Jgenti, Darejan; Dvalidze, Teona; Carpino, James; Goderdzishvili, Marina

    2013-01-01

    Enterococcus faecalis and Streptococcus mitis are common commensal inhabitants of the human gastrointestinal and genitourinary tracts. However, both species can be opportunistic pathogens and cause disease in nosocomial settings. These infections can be difficult to treat because of the frequency of antibiotic resistance among these strains. Bacteriophages are often suggested as an alternative therapeutic agent against these infections. In this study, E. faecalis and S. mitis strains were isolated from female patients with urinary tract infections. Bacteriophages active against these strains were isolated from sewage water from the Mtkvari River. Two phages, designated vB_EfaS_GEC-EfS_3 (Syphoviridae) and vB_SmM_GEC-SmitisM_2 (Myoviridae), were specific for E. faecalis and S. mitis, respectively. Each phage's growth patterns and adsorption rates were quantified. Sensitivity to ultraviolet light and temperature was determined, as was host range and serology. The S. mitis bacteriophage was found to be more resistant to ultraviolet light and exposure to high temperatures than the E. faecalis bacteriophage, despite having a much greater rate of replication. While each phage was able to infect a broad range of strains of the same species as the host species from which they were isolated, they were unable to infect other host species tested.

  1. Direct Quantitative Detection and Identification of Lactococcal Bacteriophages from Milk and Whey by Real-Time PCR: Application for the Detection of Lactococcal Bacteriophages in Goat's Raw Milk Whey in France

    Directory of Open Access Journals (Sweden)

    Mai Huong Ly-Chatain

    2011-01-01

    Full Text Available The presence of Lactococcus bacteriophages in milk can partly or completely inhibit milk fermentation. To prevent the problems associated with the bacteriophages, the real-time PCR was developed in this study for direct detection from whey and milk of three main groups of Lactococcus bacteriophages, c2, 936, and P335. The optimization of DNA extraction protocol from complex matrices such as whey and milk was optimized allowed the amplification of PCR without any matrix and nontarget contaminant interference. The real-time PCR program was specific and with the detection limit of 102 PFU/mL. The curve slopes were −3.49, −3.69, and −3.45 with the amplification efficiency estimated at 94%, 94%, and 98% and the correlation coefficient (2 of 0.999, 0.999, and 0.998 for c2, 936 and P335 group, respectively. This method was then used to detect the bacteriophages in whey and goat's raw milk coming from three farms located in the Rhône-Alpes region (France.

  2. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  3. Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

    2016-01-01

    Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  4. STUDIES ON THE BACTERIOPHAGE OF D'HÉRELLE

    Science.gov (United States)

    Hetler, D. M.; Bronfenbrenner, J.

    1928-01-01

    1. During the process of lysis by bacteriophage, there is an appreciable increase in the amount of free amino acid present in the culture. 2. The increase of free amino acid is due to hydrolysis of bacterial protein. PMID:19869482

  5. Bacteria vs. bacteriophages: parallel evolution of immune arsenals

    Directory of Open Access Journals (Sweden)

    Muhammad Abu Bakr Shabbir

    2016-08-01

    Full Text Available Bacteriophages are the most common entities on earth and represent a constant challenge to bacterial populations. To fend off bacteriophage infection, bacteria evolved immune systems to avert phage adsorption and block invader DNA entry. They developed restriction-modification systems and mechanisms to abort infection and interfere with virion assembly, as well as newly recognized clustered regularly interspaced short palindromic repeats (CRISPR. In response to bacterial immune systems, bacteriophages synchronously evolved resistance mechanisms, such as the anti-CRISPR systems to counterattack bacterial CRISPR-cas systems, in a continuing evolutionary arms race between virus and host. In turn, it is fundamental to the survival of the bacterial cell to evolve a system to combat bacteriophage immune strategies.

  6. Reduction of Salmonella in ground chicken using a bacteriophage.

    Science.gov (United States)

    Grant, Ar'Quette; Parveen, Salina; Schwarz, Jurgen; Hashem, Fawzy; Vimini, Bob

    2017-08-01

    This study's goal was to ascertain the effectiveness of a commercially available Salmonella bacteriophage during ground chicken production focusing on: water source, different Salmonella serovars, and time. Salmonella-free boneless, skinless chicken meat was inoculated with 4.0 Log CFU/cm2 of either a cocktail of 3 Salmonella isolates derived from ground chicken (GC) or a cocktail of 3 Salmonella strains not isolated from ground chicken (non-GC). Bacteriophages were spread onto the chicken using sterile tap or filtered water for 30 min or 8 h. Salmonella was recovered using standard plating method. Greater Salmonella reduction was observed when the bacteriophage was diluted in sterile tap water than in sterile filtered water: 0.39 Log CFU/cm2 and 0.23 Log CFU/cm2 reduction after 30 min, respectively (P Salmonella's susceptibility to the bacteriophage, and treatment time. © 2017 Poultry Science Association Inc.

  7. Bacteriophages: update on application as models for viruses in water

    African Journals Online (AJOL)

    Bacteriophages: update on application as models for viruses in water. ... the resistance of human viruses to water treatment and disinfection processes. ... highly sensitive molecular techniques viruses have been detected in drinking water ...

  8. Bacteriophage-antibiotic synergism to control planktonic and biofilm ...

    African Journals Online (AJOL)

    Amina Amal Mahmoud Nouraldin

    2015-07-11

    Jul 11, 2015 ... mote resistance to antimicrobial agents, and its occurrence during the infectious ... Biofilm is a structured community of bacterial cells adher- ent to an inert or ..... biofilms with bacteriophages and chlorine. Biotechnol Bioeng.

  9. Bacteriophage-antibiotic synergism to control planktonic and biofilm ...

    African Journals Online (AJOL)

    Bacteriophage-antibiotic synergism to control planktonic and biofilm producing clinical isolates of Pseudomonas aeruginosa. Amina Amal Mahmoud Nouraldin, Manal Mohammad Baddour, Reem Abdel Hameed Harfoush, Sara AbdelAziz Mohamed Essa ...

  10. Methods for initial characterization of Campylobacter jejuni bacteriophages

    DEFF Research Database (Denmark)

    Sørensen, Martine Camilla Holst; Gencay, Yilmaz Emre; Brøndsted, Lone

    2017-01-01

    Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity.......Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity....

  11. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

    2010-03-31

    Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

  12. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Science.gov (United States)

    2010-01-01

    Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two

  13. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  14. [Studies on the repair of damaged DNA in bacteriophage, bacterial and mammalian systems]: Final report

    International Nuclear Information System (INIS)

    Friedberg, E.C.

    1987-08-01

    This study sought to exploit the use of uv radiation as a source of genomic damage. We explored the molecular mechanism of the repair of DNA damage at a number of different levels of biological organization, by investigating bacteriophage, bacterial, yeast and mammalian cells. Not only have observations obtained in one biological system suggested specific experimental approaches in others, but we have also learned that some biochemical pathways for DNA repair are unique to specific organisms. Our studies are summarized in terms of 4 major areas of research activity that span the past 16 years. 86 refs

  15. Extraction and Study of Bacteriophages, Used against Agents of Potato Soft Rot

    Directory of Open Access Journals (Sweden)

    Magda D. Davitashvili

    2012-12-01

    Full Text Available The use of specific bacteriophages and their complex mixtures against bacterial diseases is very effective. As for causative agent of potato soft rot Erwinia carotovora, specific phages (25 phages in total were extracted from diseased potato, soil and sewage. The study of their biological properties showed the diversity of phages in terms of lytic action, virion plaque and morphology, as well as in relation to different environmental factors. Phages showed explicit antibacterial activity in vitro in liquid and solid media, as well as during model tests of potato tubers artificial inoculation.

  16. Simulated hatchery system to assess bacteriophage efficacy against Vibrio harveyi.

    Science.gov (United States)

    Raghu Patil, J; Desai, Srividya Narayanamurthy; Roy, Panchali; Durgaiah, Murali; Saravanan, R Sanjeev; Vipra, Aradhana

    2014-12-02

    Vibriosis caused by luminous Vibrio harveyi commonly contributes to poor survival in shrimp hatcheries and aquaculture ponds. Lytic bacteriophages pathogenic for V. harveyi are currently being investigated as an alternative to antibiotics to prevent vibriosis. Here, 8 bacteriophages were isolated from oysters and clams using V. harveyi strains as baiting hosts. Among these bacteriophages, 1 strain (VHP6b) identified as broadly pathogenic for 27 V. harveyi strains examined was further characterized by electron microscopy and genome sequence analysis. Phage VHP6b possessed a tail and morphology consistent with it being a member of the family Siphoviridae, and its genome and proteome were most closely related to the Vibrio phages SSP02 and MAR10. An integrase gene essential for lysogeny was not evident. The ability of bacteriophage VHP6b to protect shrimp postlarvae against vibriosis caused by V. harveyi strain VH6 was demonstrated in a model system designed to simulate typical hatchery conditions. Bacteriophage treatment improved survival of postlarvae by 40 to 60% under these conditions, so therapies based on this or other bacteriophages may be useful in shrimp hatcheries.

  17. Detection and enumeration of F-specific bacteriophages

    NARCIS (Netherlands)

    Mooijman KA; Bahar M; Havelaar AH; MGB

    2000-01-01

    Tijdens het EU-project 'Bacteriofagen in zwemwater' (januari 1996 - juni 1999) werd onderzoek uitgevoerd ten behoeve van de optimalisatie van de methode voor de detectie en enumeratie van F-specifieke (RNA) fagen in water. Er werd gekeken of verdere optimalisatie van de procedure zoals

  18. Framing the Future with Bacteriophages in Agriculture.

    Science.gov (United States)

    Svircev, Antonet; Roach, Dwayne; Castle, Alan

    2018-04-25

    The ability of agriculture to continually provide food to a growing world population is of crucial importance. Bacterial diseases of plants and animals have continually reduced production since the advent of crop cultivation and animal husbandry practices. Antibiotics have been used extensively to mitigate these losses. The rise of antimicrobial resistant (AMR) bacteria, however, together with consumers’ calls for antibiotic-free products, presents problems that threaten sustainable agriculture. Bacteriophages (phages) are proposed as bacterial population control alternatives to antibiotics. Their unique properties make them highly promising but challenging antimicrobials. The use of phages in agriculture also presents a number of unique challenges. This mini-review summarizes recent development and perspectives of phages used as antimicrobial agents in plant and animal agriculture at the farm level. The main pathogens and their adjoining phage therapies are discussed.

  19. Bacteriophage lambda: early pioneer and still relevant

    Science.gov (United States)

    Casjens, Sherwood R.; Hendrix, Roger W.

    2015-01-01

    Molecular genetic research on bacteriophage lambda carried out during its golden age from the mid 1950's to mid 1980's was critically important in the attainment of our current understanding of the sophisticated and complex mechanisms by which the expression of genes is controlled, of DNA virus assembly and of the molecular nature of lysogeny. The development of molecular cloning techniques, ironically instigated largely by phage lambda researchers, allowed many phage workers to switch their efforts to other biological systems. Nonetheless, since that time the ongoing study of lambda and its relatives have continued to give important new insights. In this review we give some relevant early history and describe recent developments in understanding the molecular biology of lambda's life cycle. PMID:25742714

  20. Montmorillonite-induced Bacteriophage φ6 Disassembly

    Science.gov (United States)

    Trusiak, A.; Gottlieb, P.; Katz, A.; Alimova, A.; Steiner, J. C.; Block, K. A.

    2012-12-01

    It is estimated that there are 1031 virus particles on Earth making viruses an order of magnitude more prevalent in number than prokaryotes with the vast majority of viruses being bacteriophages. Clays are a major component of soils and aquatic sediments and can react with RNA, proteins and bacterial biofilms. The clays in soils serve as an important moderator between phage and their host bacteria, helping to preserve the evolutionary balance. Studies on the effects of clays on viral infectivity have given somewhat contradictory results; possibly a consequence of clay-virus interactions being dependent on the unique structure of particular viruses. In this work, the interaction between montmorillonite and the bacteriophage φ6 is investigated. φ6 is a member of the cystovirus family that infects Pseudomonas syringe, a common plant pathogen. As a member of the cystovirus family with an enveloped structure, φ6 serves as a model for reoviruses, a human pathogen. Experiments were conducted with φ6 suspended in dilute, purified homoionic commercial-grade montmorillonite over a range of virus:clay ratios. At a 1:100000 virus:clay ratio, the clay reduced viral infectivity by 99%. The minimum clay to virus ratio which results in a measurable reduction of P. syringae infection is 1:1. Electron microscopy demonstrates that mixed suspensions of smectite and virus co-aggregate to form flocs encompassing virions within the smectite. Both free viral particles as well as those imbedded in the flocs are seen in the micrographs to be missing the envelope- leaving only the nucleocapsid (NC) intact; indicating that smectite inactivates the virus by envelope disassembly. These results have strong implications in the evolution of both the φ6 virus and its P. syringae host cells. TEM of aggregate showing several disassembled NCs.

  1. Environmental Bacteriophages of the Emerging Enterobacterial Phytopathogen, Dickeya solani, Show Genomic Conservation and Capacity for Horizontal Gene Transfer between Their Bacterial Hosts

    Directory of Open Access Journals (Sweden)

    Andrew Day

    2017-08-01

    Full Text Available Dickeya solani is an economically important phytopathogen widespread in mainland Europe that can reduce potato crop yields by 25%. There are no effective environmentally-acceptable chemical systems available for diseases caused by Dickeya. Bacteriophages have been suggested for use in biocontrol of this pathogen in the field, and limited field trials have been conducted. To date only a small number of bacteriophages capable of infecting D. solani have been isolated and characterized, and so there is a need to expand the repertoire of phages that may have potential utility in phage therapy strategies. Here we describe 67 bacteriophages from environmental sources, the majority of which are members of the viral family Myoviridae. Full genomic sequencing of two isolates revealed a high degree of DNA identity with D. solani bacteriophages isolated in Europe in the past 5 years, suggesting a wide ecological distribution of this phage family. Transduction experiments showed that the majority of the new environmental bacteriophages are capable of facilitating efficient horizontal gene transfer. The possible risk of unintentional transfer of virulence or antibiotic resistance genes between hosts susceptible to transducing phages cautions against their environmental use for biocontrol, until specific phages are fully tested for transduction capabilities.

  2. Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2005-10-15

    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  3. Comparison of the virucidal efficacy of peracetic acid, potassium monopersulphate and sodium hypochlorite on bacteriophages P001 and MS2.

    Science.gov (United States)

    Morin, T; Martin, H; Soumet, C; Fresnel, R; Lamaudière, S; Le Sauvage, A L; Deleurme, K; Maris, P

    2015-09-01

    The phagicidal activity of peroxy products against the virulent bacteriophage P001 infecting lactic acid bacteria and bacteriophage MS2 used as a surrogate of enteric viruses (EVs) was evaluated and compared to sodium hypochlorite using the EN 13610 European suspension test and a surface test developed in our laboratories. Infectivity tests were adapted and/or developed to determine the activity of disinfectants against reference P001 phage of Lactoccocus lactis and F-specific RNA phage MS2 of Escherichia coli in conditions simulating practical use. Similar concentrations of sodium hypochlorite were phagicidal against both bacteriophages, either at 0·05-0·125% of active chlorine using the suspension test or at 0·12-0·5% using the surface test. For Potassium monopersulphate (MPS), phagicidal concentrations varied from 0·006 to 0·012% whatever the type of test and phages. However, for peracetic acid products (PAP) used in suspension, concentrations 55 times higher were necessary against MS2 (0·271%) than against P001 (0·005%). With the surface test, 0·089-0·178% concentrations of PAP were effective against MS2, but these concentrations were 16-32 times greater than needed against P001. Sodium hypochlorite and MPS had similar phagicidal activities against P001 and MS2, but PAP did not. This is the first comparative study to investigate through suspension and surface tests the difference in resistance to peroxy compounds between a reference bacteriophage (P001) used to evaluate phagicidal concentrations in European standards and a surrogate of EVs (MS2). Results underline the importance of validation tests on pertinent surrogates of viruses or bacteriophages to adjust the concentration of disinfectants for use in the food and water industries. © 2015 The Society for Applied Microbiology.

  4. Molecular characterization of podoviral bacteriophages virulent for Clostridium perfringens and their comparison with members of the Picovirinae.

    Directory of Open Access Journals (Sweden)

    Nikolay V Volozhantsev

    Full Text Available Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium responsible for human food-borne disease as well as non-food-borne human, animal and poultry diseases. Because bacteriophages or their gene products could be applied to control bacterial diseases in a species-specific manner, they are potential important alternatives to antibiotics. Consequently, poultry intestinal material, soil, sewage and poultry processing drainage water were screened for virulent bacteriophages that lysed C. perfringens. Two bacteriophages, designated ΦCPV4 and ΦZP2, were isolated in the Moscow Region of the Russian Federation while another closely related virus, named ΦCP7R, was isolated in the southeastern USA. The viruses were identified as members of the order Caudovirales in the family Podoviridae with short, non-contractile tails of the C1 morphotype. The genomes of the three bacteriophages were 17.972, 18.078 and 18.397 kbp respectively; encoding twenty-six to twenty-eight ORF's with inverted terminal repeats and an average GC content of 34.6%. Structural proteins identified by mass spectrometry in the purified ΦCP7R virion included a pre-neck/appendage with putative lyase activity, major head, tail, connector/upper collar, lower collar and a structural protein with putative lysozyme-peptidase activity. All three podoviral bacteriophage genomes encoded a predicted N-acetylmuramoyl-L-alanine amidase and a putative stage V sporulation protein. Each putative amidase contained a predicted bacterial SH3 domain at the C-terminal end of the protein, presumably involved with binding the C. perfringens cell wall. The predicted DNA polymerase type B protein sequences were closely related to other members of the Podoviridae including Bacillus phage Φ29. Whole-genome comparisons supported this relationship, but also indicated that the Russian and USA viruses may be unique members of the sub-family Picovirinae.

  5. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  6. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  7. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  8. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  9. Listeria monocytogenes in five Sardinian swine slaughterhouses: prevalence, serotype, and genotype characterization.

    Science.gov (United States)

    Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina

    2013-11-01

    In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.

  10. The high prevalence of Listeria monocytogenes peritonitis in cirrhotic patients of an Egyptian Medical Center.

    Science.gov (United States)

    El Sayed Zaki, Maysaa; El Shabrawy, Walaa Othman; El-Eshmawy, Mervat M; Aly Eletreby, Shahera

    2011-09-01

    Spontaneous bacterial peritonitis (SBP) is a potentially lethal complication of cirrhosis. It is probably the most characteristic infectious complication of cirrhosis. The aim of this study was to evaluate the bacterial and fungal causes of SBP in Egyptian population. Furthermore to predict the occurrence of rare pathogen like Listeria monocytogenes in those patients. The study included 100 patients with end stage liver disease associated with ascites. Patients were suspected to have SBP. The ascitic fluids were subjected to full cytological and microbiological study. The peritoneal fluid cytological study revealed that 50 samples had cell counts >250 cells/mm(3). 37 samples had growth and 13 samples had no growth (CNNA). The distribution of isolated pathogens was Gram positive cocci 48.8% followed by L. monocytogenes 24.4%, Gram negative bacilli 12.2% and Mycobacterium tuberculosis 7.3. The cells counts associated with listeria culture were 475 cells/mm(3) with sensitivity 70% and specificity 68%. The study highlights the prevalence of microorganisms in Egyptian patients with liver cirrhosis associated with ascites. It reflects the occurrence of L. monocytogenes as an important pathogen of such clinical situation. Other rare pathogens like M. tuberculosis are not uncommon in those patients. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  11. Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.

    Science.gov (United States)

    Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa

    2012-06-01

    Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.

  12. Prevalence of Listeria spp. and Molecular Characterization of Listeria monocytogenes Isolates from Broilers at the Abattoir.

    Science.gov (United States)

    Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc

    2015-07-01

    Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.

  13. Structure and assembly of bacteriophage T4 head

    Directory of Open Access Journals (Sweden)

    Black Lindsay W

    2010-12-01

    Full Text Available Abstract The bacteriophage T4 capsid is an elongated icosahedron, 120 nm long and 86 nm wide, and is built with three essential proteins; gp23*, which forms the hexagonal capsid lattice, gp24*, which forms pentamers at eleven of the twelve vertices, and gp20, which forms the unique dodecameric portal vertex through which DNA enters during packaging and exits during infection. The past twenty years of research has greatly elevated the understanding of phage T4 head assembly and DNA packaging. The atomic structure of gp24 has been determined. A structural model built for gp23 using its similarity to gp24 showed that the phage T4 major capsid protein has the same fold as that found in phage HK97 and several other icosahedral bacteriophages. Folding of gp23 requires the assistance of two chaperones, the E. coli chaperone GroEL and the phage coded gp23-specific chaperone, gp31. The capsid also contains two non-essential outer capsid proteins, Hoc and Soc, which decorate the capsid surface. The structure of Soc shows two capsid binding sites which, through binding to adjacent gp23 subunits, reinforce the capsid structure. Hoc and Soc have been extensively used in bipartite peptide display libraries and to display pathogen antigens including those from HIV, Neisseria meningitides, Bacillus anthracis, and FMDV. The structure of Ip1*, one of the components of the core, has been determined, which provided insights on how IPs protect T4 genome against the E. coli nucleases that degrade hydroxymethylated and glycosylated T4 DNA. Extensive mutagenesis combined with the atomic structures of the DNA packaging/terminase proteins gp16 and gp17 elucidated the ATPase and nuclease functional motifs involved in DNA translocation and headful DNA cutting. Cryo-EM structure of the T4 packaging machine showed a pentameric motor assembled with gp17 subunits on the portal vertex. Single molecule optical tweezers and fluorescence studies showed that the T4 motor packages

  14. Bacteriophage therapy to combat bacterial infections in poultry.

    Science.gov (United States)

    Wernicki, Andrzej; Nowaczek, Anna; Urban-Chmiel, Renata

    2017-09-16

    Infections in poultry are an economic and health problem in Europe and worldwide. The most common infections are associated with salmonellosis, colibacillosis, campylobacteriosis, and others. The prevalence of Campylobacter-positive poultry flocks in European countries varies from 18% to 90%. In the United States, the prevalence of infected flocks is nearly 90%. A similar percentage of infection has been noted for salmonellosis (about 75-90%) and E. coli (90-95%). The occurence of Clostridium perfringens is a major problem for the poultry industry, with some estimates suggesting colonization of as many as 95% of chickens, resulting in clinical or subclinical infections. In the US, annual economic losses due to Salmonella infections run from $1.188 billion to over $11.588 billion, based on an estimated 1.92 million cases. Similar costs are observed in the case of other types of infections. In 2005 economic losses in the the poultry industry due to mortalities reached 1,000,000 USD.Infections caused by these pathogens, often through poultry products, are also a serious public health issue.The progressive increase in the number of multi-drug resistant bacteria and the complete ban on the use of antibiotics in livestock feed in the EU, as well as the partial ban in the US, have led to the growth of research on the use of bacteriophages to combat bacterial infections in humans and animals.The high success rate and safety of phage therapy in comparison with antibiotics are partly due to their specificity for selected bacteria and the ability to infect only one species, serotype or strain. This mechanism does not cause the destruction of commensal bacterial flora. Phages are currently being used with success in humans and animals in targeted therapies for slow-healing infections. They have also found application in the US in eliminating pathogens from the surface of foods of animal and plant origin. At a time of growing antibiotic resistance in bacteria and the resulting

  15. Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

    Science.gov (United States)

    Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

    2013-12-01

    Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible

  16. Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

    Science.gov (United States)

    VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

    2016-10-01

    Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

  17. A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

    Science.gov (United States)

    Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

    2017-03-21

    Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role

  18. Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

    Directory of Open Access Journals (Sweden)

    Ninoska eCordero

    2016-03-01

    Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

  19. Hygienic Shortcomings of Frozen Dessert Freezing Equipment and Fate of Listeria monocytogenes on Ice Cream-Soiled Stainless Steel.

    Science.gov (United States)

    Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A

    2017-10-19

    Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.

  20. Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

    Science.gov (United States)

    Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

    2016-11-01

    Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

  1. TetR-dependent gene regulation in intracellular Listeria monocytogenes demonstrates the spatiotemporal surface distribution of ActA.

    Science.gov (United States)

    Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J

    2017-08-01

    To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.

  2. Targeted Drug-Carrying Bacteriophages as Antibacterial Nanomedicines▿

    Science.gov (United States)

    Yacoby, Iftach; Bar, Hagit; Benhar, Itai

    2007-01-01

    While the resistance of bacteria to traditional antibiotics is a major public health concern, the use of extremely potent antibacterial agents is limited by their lack of selectivity. As in cancer therapy, antibacterial targeted therapy could provide an opportunity to reintroduce toxic substances to the antibacterial arsenal. A desirable targeted antibacterial agent should combine binding specificity, a large drug payload per binding event, and a programmed drug release mechanism. Recently, we presented a novel application of filamentous bacteriophages as targeted drug carriers that could partially inhibit the growth of Staphylococcus aureus bacteria. This partial success was due to limitations of drug-loading capacity that resulted from the hydrophobicity of the drug. Here we present a novel drug conjugation chemistry which is based on connecting hydrophobic drugs to the phage via aminoglycoside antibiotics that serve as solubility-enhancing branched linkers. This new formulation allowed a significantly larger drug-carrying capacity of the phages, resulting in a drastic improvement in their performance as targeted drug-carrying nanoparticles. As an example for a potential systemic use for potent agents that are limited for topical use, we present antibody-targeted phage nanoparticles that carry a large payload of the hemolytic antibiotic chloramphenicol connected through the aminoglycoside neomycin. We demonstrate complete growth inhibition toward the pathogens Staphylococcus aureus, Streptococcus pyogenes, and Escherichia coli with an improvement in potency by a factor of ∼20,000 compared to the free drug. PMID:17404004

  3. BENEFICIAL FACE OF BACTERIOPHAGES: APPLICATIONS IN FOOD PROCESSING

    Directory of Open Access Journals (Sweden)

    H. V. Raghu

    2012-06-01

    Full Text Available Foods are processed to make them available at all places; consequently, our awareness regarding hygiene measures in food production has also increased dramatically over the last decades. In many countries cases associated with foodborne infectious are increased. However, available techniques are unable to effectively control the problem. Further, exploring novel methods and technologies for ensuring the safety of food with effective quality control approaches are under research. Phages are the natural enemies of bacteria, and are more specific to host renders them ideal candidates for applications designed to increase food safety during the production process. Scientific findings are available showing the possibility to use as biocontrol agents against various pathogens with out interfering with the natural microflora or the cultures in fermented products. Furthermore, phages or phage derived proteins can also be used to detect the presence of unwanted pathogens in food or the production environments, which allows quick and sp ecific identification of viable cells. Bacteriophages are natural, found in various environments including water; foods etc. and are not found significantly influence the human cells.

  4. Whole-genome sequence of the bacteriophage-sensitive strain Campylobacter jejuni NCTC12662

    DEFF Research Database (Denmark)

    Gencay, Yilmaz Emre; Sørensen, Martine C.H.; Brøndsted, Lone

    2017-01-01

    Campylobacter jejuni NCTC12662 has been the choice bacteriophage isolation strain due to its susceptibility to C. jejuni bacteriophages. This trait makes it a good candidate for studying bacteriophage-host interactions. We report here the whole-genome sequence of NCTC12662, allowing future...

  5. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  6. Analysis of Bacillus subtilis sporulation with spore-converting bacteriophage PMB12.

    OpenAIRE

    Kinney, D M; Bramucci, M G

    1981-01-01

    Previous observations concerning the ability of the spore-converting bacteriophage PMB12 to cause sporulation in certain sporulation-deficient mutants of Bacillus subtilis 168 were extended to include a spoOK mutant and a mutant temperature sensitive for sporulation due to a ribosomal mutation. Mutants of PMB12 that were unable to induce sporulation in the spoOK mutant were isolated to determine whether PMB12-encoded products had to affect the sporulation-specific functions of both the transc...

  7. Biology and genomics of an historic therapeutic Escherichia coli bacteriophage collection

    DEFF Research Database (Denmark)

    Baig, Abiyad; Colom, Joan; Barrow, Paul

    2017-01-01

    We have performed microbiological and genomic characterization of an historic collection of nine bacteriophages, specifically infecting a K1 E. coli O18:K1:H7 ColV+ strain. These phages were isolated from sewage and tested for their efficacy in vivo for the treatment of systemic E. coli infection...... in a mouse infection model by Smith and Huggins (1982). The aim of the study was to identify common microbiological and genomic characteristics, which co-relate to the performance of these phages in in vivo study. These features will allow an informed selection of phages for use as therapeutic agents...

  8. The use of lytic bacteriophages to reduce E. coli O157:H7 on fresh cut lettuce introduced through cross-contamination

    Science.gov (United States)

    The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield) at 108 PFU/ml or a control (phosphate buffered saline, PBS) was applied to lettuce by either 1) spraying on to lettuce piec...

  9. Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

    Science.gov (United States)

    A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

  10. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  11. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

    Science.gov (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

    2001-11-01

    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  12. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  13. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  14. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  16. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    , respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...

  17. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1990-01-01

    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  18. Use of results of microbiological analyses for risk-based control of Listeria monocytogenes in marinated broiler legs.

    Science.gov (United States)

    Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura

    2008-02-10

    Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk

  19. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  20. BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Lea

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  1. Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin.

    Science.gov (United States)

    Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale

    2004-04-20

    Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.

  2. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  3. Evaluation of a loop-mediated isothermal amplification method for the detection of Listeria monocytogenes in dairy food

    Directory of Open Access Journals (Sweden)

    Erica Tirloni

    2017-12-01

    Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.

  4. Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

    Directory of Open Access Journals (Sweden)

    Ivy Reid A

    2008-11-01

    Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

  5. Phenotypic, fermentation characterization, and resistance mechanism analysis of bacteriophage-resistant mutants of Lactobacillus delbrueckii ssp. bulgaricus isolated from traditional Chinese dairy products.

    Science.gov (United States)

    Deng, Kaibo; Fang, Wei; Zheng, Baodong; Miao, Song; Huo, Guicheng

    2018-03-01

    Bacteriophage infection is a large factor in dairy industrial production failure on the basis of pure inoculation fermentation, and developing good commercial starter cultures from wild dairy products and improving the environmental vigor of starter cultures by enhancing their phage resistance are still the most effective solutions. Here we used a spontaneous isolation method to obtain bacteriophage-resistant mutants of Lactobacillus delbrueckii ssp. bulgaricus strains that are used in traditional Chinese fermented dairy products. We analyzed their phenotypes, fermentation characteristics, and resistance mechanisms. The results showed that bacteriophage-insensitive mutants (BIM) BIM8 and BIM12 had high bacteriophage resistance while exhibiting fermentation and coagulation attributes that were as satisfying as those of their respective parent strains KLDS1.1016 and KLDS1.1028. According to the attachment receptor detection, mutants BIM8 and BIM12 exhibited reduced absorption to bacteriophage phiLdb compared with their respective bacteriophage-sensitive parent strains because of changes to the polysaccharides or teichoic acids connected to their peptidoglycan layer. Additionally, genes, including HSDR, HSDM, and HSDS, encoding 3 subunits of a type I restriction-modification system were identified in their respective parent strains. We also discovered that HSDR and HSDM were highly conserved but that HSDS was variable because it is responsible for the DNA specificity of the complex. The late lysis that occurred only in strain KLDS1.1016 and not in strain KLDS1.1028 suggests that the former and its mutant BIM8 also may have an activatable restriction-modification mechanism. We conclude that the L. bulgaricus BIM8 and BIM12 mutants have great potential in the dairy industry as starter cultures, and their phage-resistance mechanism was effective mainly due to the adsorption interference and restriction-modification system. Copyright © 2018 American Dairy Science

  6. Listeria monocytogenes - Danger for health safety vegetable production.

    Science.gov (United States)

    Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

    2018-04-22

    The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

  7. Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE.

    Science.gov (United States)

    Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne

    2013-08-16

    Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

  8. Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

    NARCIS (Netherlands)

    Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

    2009-01-01

    Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

  9. Comparison of the growth of Listeria monocytogenes in unirradiated and irradiated cook-chill roast beef and gravy at refrigeration temperatures

    International Nuclear Information System (INIS)

    Grant, I.R.; Nixon, C.R.; Patterson, M.F.

    1993-01-01

    Specific growth rates of two strains of Listeria monocytogenes in unirradiated and irradiated (2 kGy) roast beef and gravy stored at 5° and 10°C were found to be similar. However, exponential growth of L. monocytogenes after irradiation was preceded by an extended lag period of 6–9 d at 5°C and 3–4 d at 10°C, compared with lag periods of 1–2 d and <0.1 d in unirradiated beef and gravy stored similarly

  10. Bacteriophages of Soft Rot Enterobacteriaceae-a minireview.

    Science.gov (United States)

    Czajkowski, Robert

    2016-01-01

    Soft rot Enterobacteriaceae (Pectobacterium spp. and Dickeya spp., formerly pectinolytic Erwinia spp.) are ubiquitous necrotrophic bacterial pathogens that infect a large number of different plant species worldwide, including economically important crops. Despite the fact that these bacteria have been studied for more than 50 years, little is known of their corresponding predators: bacteriophages, both lytic and lysogenic. The aim of this minireview is to critically summarize recent ecological, biological and molecular research on bacteriophages infecting Pectobacterium spp. and Dickeya spp. with the main focus on current and future perspectives in that field. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Molecular and chemical engineering of bacteriophages for potential medical applications.

    Science.gov (United States)

    Hodyra, Katarzyna; Dąbrowska, Krystyna

    2015-04-01

    Recent progress in molecular engineering has contributed to the great progress of medicine. However, there are still difficult problems constituting a challenge for molecular biology and biotechnology, e.g. new generation of anticancer agents, alternative biosensors or vaccines. As a biotechnological tool, bacteriophages (phages) offer a promising alternative to traditional approaches. They can be applied as anticancer agents, novel platforms in vaccine design, or as target carriers in drug discovery. Phages also offer solutions for modern cell imaging, biosensor construction or food pathogen detection. Here we present a review of bacteriophage research as a dynamically developing field with promising prospects for further development of medicine and biotechnology.

  12. Comparative Genomics of Bacteriophage of the Genus Seuratvirus

    DEFF Research Database (Denmark)

    Sazinas, Pavelas; Redgwell, Tamsin; Rihtman, Branko

    2017-01-01

    polB and terL showed these bacteriophages to be closely related to members of the genus Seuratvirus. We performed a core-gene analysis using the 14 new and four closely related genomes. A total of 58 core genes were identified, the majority of which has no known function. These genes were used...... to construct a core-gene phylogeny, the results of which confirmed the new isolates to be part of the genus Seuratvirus and expanded the number of species within this genus to four. All bacteriophages within the genus contained the genes queCDE encoding enzymes involved in queuosine biosynthesis. We suggest...

  13. Engineered enzymatically active bacteriophages and methods of uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Collins, James J [Newton, MA; Kobayashi, Hideki [Yokohama, JP; Kearn, Mads [Ottawa, CA; Araki, Michihiro [Minatoku, JP; Friedland, Ari [Boston, MA; Lu, Timothy Kuan-Ta [Palo Alto, CA

    2012-05-22

    The present invention provides engineered bacteriophages that express at least one biofilm degrading enzyme on their surface and uses thereof for degrading bacterial biofilms. The invention also provides genetically engineered bacteriophages expressing the biofilm degrading enzymes and proteins necessary for the phage to replicate in different naturally occurring biofilm producing bacteria. The phages of the invention allow a method of biofilm degradation by the use of one or only a few administration of the phage because the system using these phages is self perpetuating, and capable of degrading biofilm even when the concentration of bacteria within the biofilm is low.

  14. Lysogeny with Shiga Toxin 2-Encoding Bacteriophages Represses Type III Secretion in Enterohemorrhagic Escherichia coli

    Science.gov (United States)

    Xu, Xuefang; McAteer, Sean P.; Tree, Jai J.; Shaw, Darren J.; Wolfson, Eliza B. K.; Beatson, Scott A.; Roe, Andrew J.; Allison, Lesley J.; Chase-Topping, Margo E.; Mahajan, Arvind; Tozzoli, Rosangela; Woolhouse, Mark E. J.; Morabito, Stefano; Gally, David L.

    2012-01-01

    Lytic or lysogenic infections by bacteriophages drive the evolution of enteric bacteria. Enterohemorrhagic Escherichia coli (EHEC) have recently emerged as a significant zoonotic infection of humans with the main serotypes carried by ruminants. Typical EHEC strains are defined by the expression of a type III secretion (T3S) system, the production of Shiga toxins (Stx) and association with specific clinical symptoms. The genes for Stx are present on lambdoid bacteriophages integrated into the E. coli genome. Phage type (PT) 21/28 is the most prevalent strain type linked with human EHEC infections in the United Kingdom and is more likely to be associated with cattle shedding high levels of the organism than PT32 strains. In this study we have demonstrated that the majority (90%) of PT 21/28 strains contain both Stx2 and Stx2c phages, irrespective of source. This is in contrast to PT 32 strains for which only a minority of strains contain both Stx2 and 2c phages (28%). PT21/28 strains had a lower median level of T3S compared to PT32 strains and so the relationship between Stx phage lysogeny and T3S was investigated. Deletion of Stx2 phages from EHEC strains increased the level of T3S whereas lysogeny decreased T3S. This regulation was confirmed in an E. coli K12 background transduced with a marked Stx2 phage followed by measurement of a T3S reporter controlled by induced levels of the LEE-encoded regulator (Ler). The presence of an integrated Stx2 phage was shown to repress Ler induction of LEE1 and this regulation involved the CII phage regulator. This repression could be relieved by ectopic expression of a cognate CI regulator. A model is proposed in which Stx2-encoding bacteriophages regulate T3S to co-ordinate epithelial cell colonisation that is promoted by Stx and secreted effector proteins. PMID:22615557

  15. Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Daniel R. Rissi

    2010-01-01

    Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

  16. The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

    Directory of Open Access Journals (Sweden)

    abazar pournajaf

    2013-09-01

    Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

  17. PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

    OpenAIRE

    SABIL, SYAHRIANA

    2015-01-01

    2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

  18. Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Gram, Lone

    2012-01-01

    or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

  19. Bactericidal Antibiotics Do Not Appear To Cause Oxidative Stress in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Feld, Louise; Knudsen, Gitte Maegaard; Gram, Lone

    2012-01-01

    Oxidative stress can be an important contributor to the lethal effect of bactericidal antibiotics in some bacteria, such as Escherichia coli and Staphylococcus aureus. Thus, despite the different target-specific actions of bactericidal antibiotics, they have a common mechanism leading to bacterial...... to cause oxidative stress in L. monocytogenes and propose that this is caused by its noncyclic tricarboxylic acid (TCA) pathway. Hence, in this noncyclic metabolism, there is a decoupling between the antibiotic-mediated cellular requirement for NADH and the induction of TCA enzyme activity, which...

  20. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Poyin Chen

    2017-12-01

    Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

  1. Low prevalence of Listeria monocytogenes in cull sows and pork.

    Science.gov (United States)

    Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

    2008-03-01

    The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

  2. Commensal microbes provide first line defense against Listeria monocytogenes infection

    Science.gov (United States)

    Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

  3. Deciphering the landscape of host barriers to Listeria monocytogenes infection.

    Science.gov (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

    2017-06-13

    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  4. Molecular characterization of bacteriophages for microbial source tracking in Korea.

    Science.gov (United States)

    Lee, Jung Eun; Lim, Mi Young; Kim, Sei Yoon; Lee, Sunghee; Lee, Heetae; Oh, Hyun-Myung; Hur, Hor-Gil; Ko, Gwangpyo

    2009-11-01

    We investigated coliphages from various fecal sources, including humans and animals, for microbial source tracking in South Korea. Both somatic and F+-specific coliphages were isolated from 43 fecal samples from farms, wild animal habitats, and human wastewater plants. Somatic coliphages were more prevalent and abundant than F+ coliphages in all of the tested fecal samples. We further characterized 311 F+ coliphage isolates using RNase sensitivity assays, PCR and reverse transcription-PCR, and nucleic acid sequencing. Phylogenetic analyses were performed based on the partial nucleic acid sequences of 311 F+ coliphages from various sources. F+ RNA coliphages were most prevalent among geese (95%) and were least prevalent in cows (5%). Among the genogroups of F+ RNA coliphages, most F+ coliphages isolated from animal fecal sources belonged to either group I or group IV, and most from human wastewater sources were in group II or III. Some of the group I coliphages were present in both human and animal source samples. F+ RNA coliphages isolated from various sources were divided into two main clusters. All F+ RNA coliphages isolated from human wastewater were grouped with Qbeta-like phages, while phages isolated from most animal sources were grouped with MS2-like phages. UniFrac significance statistical analyses revealed significant differences between human and animal bacteriophages. In the principal coordinate analysis (PCoA), F+ RNA coliphages isolated from human waste were distinctively separate from those isolated from other animal sources. However, F+ DNA coliphages were not significantly different or separate in the PCoA. These results demonstrate that proper analysis of F+ RNA coliphages can effectively distinguish fecal sources.

  5. Self-assembly of silver nanoparticles and bacteriophage

    Directory of Open Access Journals (Sweden)

    Santi Scibilia

    2016-03-01

    Full Text Available Biohybrid nanostructured materials, composed of both inorganic nanoparticles and biomolecules, offer prospects for many new applications in extremely diverse fields such as chemistry, physics, engineering, medicine and nanobiotechnology. In the recent years, Phage display technique has been extensively used to generate phage clones displaying surface peptides with functionality towards organic materials. Screening and selection of phage displayed material binding peptides has attracted great interest because of their use for development of hybrid materials with multiple functionalities. Here, we present a self-assembly approach for the construction of hybrid nanostructured networks consisting of M13 P9b phage clone, specific for Pseudomonas aeruginosa, selected by Phage display technology, directly assembled with silver nanoparticles (AgNPs, previously prepared by pulsed laser ablation. These networks are characterized by UV–vis optical spectroscopy, scanning/transmission electron microscopies and Raman spectroscopy. We investigated the influence of different ions and medium pH on self-assembly by evaluating different phage suspension buffers. The assembly of these networks is controlled by electrostatic interactions between the phage pVIII major capsid proteins and the AgNPs. The formation of the AgNPs-phage networks was obtained only in two types of tested buffers at a pH value near the isoelectric point of each pVIII proteins displayed on the surface of the clone. This systematic study allowed to optimize the synthesis procedure to assembly AgNPs and bacteriophage. Such networks find application in the biomedical field of advanced biosensing and targeted gene and drug delivery. Keywords: Phage display, Silver nanoparticles, Self-assembly, Hybrid architecture, Raman spectroscopy

  6. Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

    Science.gov (United States)

    Eskhan, Asma Omar

    Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

  7. Contractile injection systems of bacteriophages and related systems

    DEFF Research Database (Denmark)

    Taylor, Nicholas M I; van Raaij, Mark J; Leiman, Petr G

    2018-01-01

    Contractile tail bacteriophages, or myobacteriophages, use a sophisticated biomolecular structure to inject their genome into the bacterial host cell. This structure consists of a contractile sheath enveloping a rigid tube that is sharpened by a spike-shaped protein complex at its tip. The spike ...

  8. Bacteriophage Infectivity Against Pseudomonas aeruginosa in Saline Conditions

    KAUST Repository

    Scarascia, Giantommaso; Yap, Scott A.; Kaksonen, Anna H.; Hong, Pei-Ying

    2018-01-01

    at different temperature, pH, and salinity. Bacteriophages showed optimal infectivity at a multiplicity of infection of 10 in saline conditions, and demonstrated lytic abilities over all tested temperature (25, 30, 37, and 45°C) and pH 6–9. Planktonic P

  9. Non-Identity-Mediated CRISPR-Bacteriophage Interaction Mediated via the Csy and Cas3 Proteins ▿#

    Science.gov (United States)

    Cady, Kyle C.; O'Toole, George A.

    2011-01-01

    Studies of the Escherichia, Neisseria, Thermotoga, and Mycobacteria clustered regularly interspaced short palindromic repeat (CRISPR) subtypes have resulted in a model whereby CRISPRs function as a defense system against bacteriophage infection and conjugative plasmid transfer. In contrast, we previously showed that the Yersinia-subtype CRISPR region of Pseudomonas aeruginosa strain UCBPP-PA14 plays no detectable role in viral immunity but instead is required for bacteriophage DMS3-dependent inhibition of biofilm formation by P. aeruginosa. The goal of this study is to define the components of the Yersinia-subtype CRISPR region required to mediate this bacteriophage-host interaction. We show that the Yersinia-subtype-specific CRISPR-associated (Cas) proteins Csy4 and Csy2 are essential for small CRISPR RNA (crRNA) production in vivo, while the Csy1 and Csy3 proteins are not absolutely required for production of these small RNAs. Further, we present evidence that the core Cas protein Cas3 functions downstream of small crRNA production and that this protein requires functional HD (predicted phosphohydrolase) and DEXD/H (predicted helicase) domains to suppress biofilm formation in DMS3 lysogens. We also determined that only spacer 1, which is not identical to any region of the DMS3 genome, mediates the CRISPR-dependent loss of biofilm formation. Our evidence suggests that gene 42 of phage DMS3 (DMS3-42) is targeted by CRISPR2 spacer 1 and that this targeting tolerates multiple point mutations between the spacer and DMS3-42 target sequence. This work demonstrates how the interaction between P. aeruginosa strain UCBPP-PA14 and bacteriophage DMS3 can be used to further our understanding of the diverse roles of CRISPR system function in bacteria. PMID:21398535

  10. Sensitivity to acetic acid, ability to colonize abiotic surfaces and virulence potential of Listeria monocytogenes EGD-e after incubation on parsley leaves.

    Science.gov (United States)

    Rieu, A; Guzzo, J; Piveteau, P

    2010-02-01

    To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.

  11. A review of the incidence and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments.

    Science.gov (United States)

    Lianou, Alexandra; Sofos, John N

    2007-09-01

    Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail

  12. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Y

    2017-01-01

    Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect

  13. Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

    Science.gov (United States)

    Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

    2014-08-01

    This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

  14. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi

    2015-09-01

    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  15. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit

    2000-01-01

    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

  16. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

    2017-01-01

    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

  17. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

    2008-03-01

    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  18. Inactivation of Listeria monocytogenes in milk by pulsed electric field.

    Science.gov (United States)

    Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

    1998-09-01

    Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

  19. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  20. Review of Prosthetic Joint Infection from Listeria monocytogenes.

    Science.gov (United States)

    Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

    2016-12-01

    Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

  1. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  2. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  3. Direct interaction of the bacteriophage SPP1 packaging ATPase with the portal protein.

    Science.gov (United States)

    Oliveira, Leonor; Cuervo, Ana; Tavares, Paulo

    2010-03-05

    DNA packaging in tailed bacteriophages and other viruses requires assembly of a complex molecular machine at a specific vertex of the procapsid. This machine is composed of the portal protein that provides a tunnel for DNA entry, an ATPase that fuels DNA translocation (large terminase subunit), and most frequently, a small terminase subunit. Here we characterized the interaction between the terminase ATPase subunit of bacteriophage SPP1 (gp2) and the procapsid portal vertex. We found, by affinity pulldown assays with purified proteins, that gp2 interacts with the portal protein, gp6, independently of the terminase small subunit gp1, DNA, or ATP. The gp2-procapsid interaction via the portal protein depends on gp2 concentration and requires the presence of divalent cations. Competition experiments showed that isolated gp6 can only inhibit gp2-procapsid interactions and DNA packaging at gp6:procapsid molar ratios above 10-fold. Assays with gp6 carrying mutations in distinct regions of its structure that affect the portal-induced stimulation of ATPase and DNA packaging revealed that none of these mutations impedes gp2-gp6 binding. Our results demonstrate that the SPP1 packaging ATPase binds directly to the portal and that the interaction is stronger with the portal embedded in procapsids. Identification of mutations in gp6 that allow for assembly of the ATPase-portal complex but impair DNA packaging support an intricate cross-talk between the two proteins for activity of the DNA translocation motor.

  4. In vivo studies of genomic packaging in the dsRNA bacteriophage Φ8

    Directory of Open Access Journals (Sweden)

    Mindich Leonard

    2005-03-01

    Full Text Available Abstract Background Φ8 is a bacteriophage containing a genome of three segments of double-stranded RNA inside a polyhedral capsid enveloped in a lipid-containing membrane. Plus strand RNA binds and is packaged by empty procapsids. Whereas Φ6, another member of the Cystoviridae, shows high stringency, serial dependence and precision in its genomic packaging in vitro and in vivo, Φ8 packaging is more flexible. Unique sequences (pac near the 5' ends of plus strands are necessary and sufficient for Φ6 genomic packaging and the RNA binding sites are located on P1, the major structural protein of the procapsid. Results In this paper the boundaries of the Φ8 pac sequences have been explored by testing the in vivo packaging efficacy of transcripts containing deletions or changes in the RNA sequences. The pac sequences have been localized to the 5' untranslated regions of the viral transcripts. Major changes in the pac sequences are either tolerated or ameliorated by suppressor mutations in the RNA sequence. Changes in the genomic packaging program can be established as a result of mutations in P1, the major structural protein of the procapsid and the determinant of RNA binding specificity. Conclusion Although Φ8 is distantly related to bacteriophage Φ6, and does not show sequence similarity, it has a similar genomic packaging program. This program, however, is less stringent than that of Φ6.

  5. Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

    2013-04-01

    Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

  6. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  7. Aerosol studies with Listeria innocua and Listeria monocytogenes.

    Science.gov (United States)

    Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

    2007-08-01

    Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

  8. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

    Science.gov (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

    2017-11-01

    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  9. Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

    DEFF Research Database (Denmark)

    Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

    1996-01-01

    Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

  10. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  11. Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.

    Science.gov (United States)

    Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko

    2014-01-01

    The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.

  12. Release of silver and copper nanoparticles from polyethylene nanocomposites and their penetration into Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Tamayo, L.A., E-mail: laura.tamayo@usach.cl [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Zapata, P.A. [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Grupo de Polímeros, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Vejar, N.D.; Azócar, M.I.; Gulppi, M.A. [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Zhou, X.; Thompson, G.E. [Corrosion and Protection Centre, School of Materials, The University of Manchester, Manchester, M13 9PL England (United Kingdom); Rabagliati, F.M. [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Grupo de Polímeros, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); and others

    2014-07-01

    Since infection is a major cause of death in a patient whose immune responses have been compromised (immunocompromised patient), considerable attention has been focused on developing materials for the prevention of infections. This has been directed primarily at suppressing or eliminating the host's endogenous microbial burden and decreasing the acquisition of new organisms. In this study, the antibacterial properties of two nanocomposites, polyethylene modified with silver nanoparticles (PE-AgNps) or copper nanoparticles (PE-CuNps), against Listeria monocytogenes have been investigated. In order to elucidate the antibacterial mechanism, specifically whether this mechanism corresponds to bactericidal or bacteriolytic activities, we have determined the extent of release of metal ions (Ag{sup +} and Cu{sup 2+}) and, also, the morphology of the bacteria. The metal ion release from nanocomposites was followed by inductively coupled plasma spectrometry and the morphology of the bacteria was revealed through examination of ultramicrotomed sections of bacteria in a transmission electron microscope. The study of metal ion release from the nanocomposites shows that for both nanocomposites the amount of ions released varies with time, which initially displays a linear behavior until an asymptotic behavior is reached. Further, TEM images show that silver nanoparticles (AgNps) and copper nanoparticles (CuNps), which are released from the nanocomposites, can penetrate to the cell wall and the plasma membrane of bacteria. Resulting morphological changes involve separation of the cytoplasmic membrane from the cell wall, which is known to be an effect of plasmolysis. It was revealed that the antibacterial abilities of the two nanocomposites against L. monocytogenes are associated with both bactericidal and bacteriolytic effects. - Highlights: • Nanocomposites showed excellent antibacterial activity against L. monocytogenes. • The biocide abilities of nanocomposites

  13. Modeling the growth of Listeria monocytogenes in mold-ripened cheeses.

    Science.gov (United States)

    Lobacz, Adriana; Kowalik, Jaroslaw; Tarczynska, Anna

    2013-06-01

    This study presents possible applications of predictive microbiology to model the safety of mold-ripened cheeses with respect to bacteria of the species Listeria monocytogenes during (1) the ripening of Camembert cheese, (2) cold storage of Camembert cheese at temperatures ranging from 3 to 15°C, and (3) cold storage of blue cheese at temperatures ranging from 3 to 15°C. The primary models used in this study, such as the Baranyi model and modified Gompertz function, were fitted to growth curves. The Baranyi model yielded the most accurate goodness of fit and the growth rates generated by this model were used for secondary modeling (Ratkowsky simple square root and polynomial models). The polynomial model more accurately predicted the influence of temperature on the growth rate, reaching the adjusted coefficients of multiple determination 0.97 and 0.92 for Camembert and blue cheese, respectively. The observed growth rates of L. monocytogenes in mold-ripened cheeses were compared with simulations run with the Pathogen Modeling Program (PMP 7.0, USDA, Wyndmoor, PA) and ComBase Predictor (Institute of Food Research, Norwich, UK). However, the latter predictions proved to be consistently overestimated and contained a significant error level. In addition, a validation process using independent data generated in dairy products from the ComBase database (www.combase.cc) was performed. In conclusion, it was found that L. monocytogenes grows much faster in Camembert than in blue cheese. Both the Baranyi and Gompertz models described this phenomenon accurately, although the Baranyi model contained a smaller error. Secondary modeling and further validation of the generated models highlighted the issue of usability and applicability of predictive models in the food processing industry by elaborating models targeted at a specific product or a group of similar products. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. T4 bacteriophage conjugated magnetic particles for E. coli capturing: Influence of bacteriophage loading, temperature and tryptone.

    Science.gov (United States)

    Liana, Ayu Ekajayanthi; Marquis, Christopher P; Gunawan, Cindy; Gooding, J Justin; Amal, Rose

    2017-03-01

    This work demonstrates the use of bacteriophage conjugated magnetic particles (Fe 3 O 4 ) for the rapid capturing and isolation of Escherichia coli. The investigation of T4 bacteriophage adsorption to silane functionalised Fe 3 O 4 with amine (NH 2 ), carboxylic (COOH) and methyl (CH 3 ) surface functional groups reveals the domination of net electrostatic and hydrophobic interactions in governing bacteriophage adsorption. The bare Fe 3 O 4 and Fe 3 O 4 -NH 2 with high T4 loading captured 3-fold more E. coli (∼70% capturing efficiency) compared to the low loading T4 on Fe 3 O 4 -COOH, suggesting the significance of T4 loading in E. coli capturing efficiency. Importantly, it is further revealed that E. coli capture is highly dependent on the incubation temperature and the presence of tryptone in the media. Effective E. coli capturing only occurs at 37°C in tryptone-containing media with the absence of either conditions resulted in poor bacteria capture. The incubation temperature dictates the capturing ability of Fe 3 O 4 /T4, whereby T4 and E. coli need to establish an irreversible binding that occurred at 37°C. The presence of tryptophan-rich tryptone in the suspending media was also critical, as shown by a 3-fold increase in E. coli capture efficiency of Fe 3 O 4 /T4 in tryptone-containing media compared to that in tryptone-free media. This highlights for the first time that successful bacteria capturing requires not only an optimum tailoring of the particle's surface physicochemical properties for favourable bacteriophage loading, but also an in-depth understanding of how factors, such as temperature and solution chemistry influence the subsequent bacteriophage-bacteria interactions. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. A novel approach in acidic disinfection through inhibition of acid resistance mechanisms; Maleic acid-mediated inhibition of glutamate decarboxylase activity enhances acid sensitivity of Listeria monocytogenes.

    Science.gov (United States)

    Paudyal, Ranju; Barnes, Ruth H; Karatzas, Kimon Andreas G

    2018-02-01

    Here it is demonstrated a novel approach in disinfection regimes where specific molecular acid resistance systems are inhibited aiming to eliminate microorganisms under acidic conditions. Despite the importance of the Glutamate Decarboxylase (GAD) system for survival of Listeria monocytogenes and other pathogens under acidic conditions, its potential inhibition by specific compounds that could lead to its elimination from foods or food preparation premises has not been studied. The effects of maleic acid on the acid resistance of L. monocytogenes were investigated and found that it has a higher antimicrobial activity under acidic conditions than other organic acids, while this could not be explained by its pKa or Ka values. The effects were found to be more pronounced on strains with higher GAD activity. Maleic acid affected the extracellular GABA levels while it did not affect the intracellular ones. Maleic acid had a major impact mainly on GadD2 activity as also shown in cell lysates. Furthermore, it was demonstrated that maleic acid is able to partly remove biofilms of L. monocytogenes. Maleic acid is able to inhibit the GAD of L. monocytogenes significantly enhancing its sensitivity to acidic conditions and together with its ability to remove biofilms, make a good candidate for disinfection regimes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. The isolation and characterization of Campylobacter jejuni bacteriophages from free range and indoor poultry.

    Science.gov (United States)

    Owens, Jane; Barton, Mary D; Heuzenroeder, Michael W

    2013-02-22

    Six hundred and sixty one samples - primarily fresh chicken faeces - were processed to isolate wild type Campylobacter jejuni bacteriophages, via overlay agar methods using C. jejuni NCTC 12662. The aims of this study were to isolate and purify bacteriophages and then test for their ability to lyse field strains of C. jejuni in vitro. Of all samples processed, 130 were positive for bacteriophages. A distinct difference was observed between samples from different poultry enterprises. No bacteriophages could be isolated from indoor broilers. The majority of bacteriophages were isolated from free range poultry - both broilers and egg layers. Bacteriophages were purified and then selected for characterization based on their ability to produce clear lysis on plaque assay, as opposed to turbid plaques. Two hundred and forty one C. jejuni field isolates were tested for sensitivity to the bacteriophages. Lysis was graded subjectively and any minimal lysis was excluded. Using this system, 59.0% of the C. jejuni isolates showed significant sensitivity to at least one bacteriophage. The sensitivity to individual bacteriophages ranged from 10.0% to 32.5% of the C. jejuni isolates. Five bacteriophages were examined by electron microscopy and determined to belong to the Myoviridae family. The physical size, predicted genetic composition and genome size of the bacteriophages correlated well with other reported Campylobacter bacteriophages. The reasons for the observed difference between indoor broilers and free range poultry is unknown, but are postulated to be due to differences in the Campylobacter population in birds under different rearing conditions. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Bacteriophage-based synthetic biology for the study of infectious diseases

    Science.gov (United States)

    Lu, Timothy K.

    2014-01-01

    Since their discovery, bacteriophages have contributed enormously to our understanding of molecular biology as model systems. Furthermore, bacteriophages have provided many tools that have advanced the fields of genetic engineering and synthetic biology. Here, we discuss bacteriophage-based technologies and their application to the study of infectious diseases. New strategies for engineering genomes have the potential to accelerate the design of novel phages as therapies, diagnostics, and tools. Though almost a century has elapsed since their discovery, bacteriophages continue to have a major impact on modern biological sciences, especially with the growth of multidrug-resistant bacteria and interest in the microbiome. PMID:24997401

  18. Recombinant Antibodies for the Detection of Bacteriophage MS2 and Ovalbumin

    National Research Council Canada - National Science Library

    O'Connell, Kevin

    2002-01-01

    ...) genes are expressed on the surface of bacteriophage (bacterial virus) particles. We describe here the isolation of additional recombinant antibodies that bind two simulants of biothreat agents...

  19. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  20. Effect of Listeria monocytogenes inoculation, sodium acetate and ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.

  1. Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

    Science.gov (United States)

    Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2014-12-01

    The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

  2. Listeria monocytogenes repellence by enzymatically modified PES surfaces

    NARCIS (Netherlands)

    Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

    2015-01-01

    : The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

  3. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  4. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

  5. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  6. Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid

    NARCIS (Netherlands)

    Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.

    2008-01-01

    We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the

  7. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B. H.; Ingmer, H.

    2001-01-01

    of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  8. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  9. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  10. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  11. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  12. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  13. Recruitment of the major vault protein by InlK: a Listeria monocytogenes strategy to avoid autophagy.

    Directory of Open Access Journals (Sweden)

    Laurent Dortet

    2011-08-01

    Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.

  14. Processing-Dependent and Clonal Contamination Patterns of Listeria monocytogenes in the Cured Ham Food Chain Revealed by Genetic Analysis.

    Science.gov (United States)

    Morganti, Marina; Scaltriti, Erika; Cozzolino, Paolo; Bolzoni, Luca; Casadei, Gabriele; Pierantoni, Marco; Foni, Emanuela; Pongolini, Stefano

    2016-02-01

    The quantitative and qualitative patterns of environmental contamination by Listeria monocytogenes were investigated in the production chain of dry-cured Parma ham. Standard arrays of surfaces were sampled in processing facilities during a single visit per plant in the three compartments of the food chain, i.e., ham production (19 plants) and postproduction, which was divided into deboning (43 plants) and slicing (25 plants) steps. The numbers of sampled surfaces were 384 in ham production, with 25 positive for L. monocytogenes, and 1,084 in postproduction, with 83 positives. Statistical analysis of the prevalence of contaminated surfaces showed that in ham production, contamination was higher at the beginning of processing and declined significantly toward the end, while in postproduction, prevalence rose toward the end of processing. Prevalence was higher in the deboning facilities than in slicing facilities and was dependent on the type of surface (floor/drainage > clothing > equipment). The qualitative pattern of contamination was investigated through an analysis of the survey isolates and a set of isolates derived from routine monitoring, including longitudinal isolations. Pulsed-field gel electrophoresis (PFGE) and whole-genome single-nucleotide polymorphism (SNP) analysis revealed a remarkable clonality of L. monocytogenes within plants, with the detection of 16 plant-specific clones out of 17 establishments with multiple isolates. Repeated detections of clonal isolates >6 months apart were also observed. Six was the maximum number of between-isolate differences in core SNPs observed within these clones. Based on the same six-SNP threshold, three clusters of clonal isolates, shared by six establishments, were also identified. The spread of L. monocytogenes within and between plants, as indicated by its clonal behavior, is a matter of concern for the hygienic management of establishments. Copyright © 2016, American Society for Microbiology. All Rights

  15. Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

    Science.gov (United States)

    Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

    2014-05-01

    A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

  16. Bacteriophages encode factors required for protection in a symbiotic mutualism.

    Science.gov (United States)

    Oliver, Kerry M; Degnan, Patrick H; Hunter, Martha S; Moran, Nancy A

    2009-08-21

    Bacteriophages are known to carry key virulence factors for pathogenic bacteria, but their roles in symbiotic bacteria are less well understood. The heritable symbiont Hamiltonella defensa protects the aphid Acyrthosiphon pisum from attack by the parasitoid Aphidius ervi by killing developing wasp larvae. In a controlled genetic background, we show that a toxin-encoding bacteriophage is required to produce the protective phenotype. Phage loss occurs repeatedly in laboratory-held H. defensa-infected aphid clonal lines, resulting in increased susceptibility to parasitism in each instance. Our results show that these mobile genetic elements can endow a bacterial symbiont with benefits that extend to the animal host. Thus, phages vector ecologically important traits, such as defense against parasitoids, within and among symbiont and animal host lineages.

  17. MetaPhinder-Identifying Bacteriophage Sequences in Metagenomic Data Sets

    DEFF Research Database (Denmark)

    Jurtz, Vanessa Isabell; Villarroel, Julia; Lund, Ole

    2016-01-01

    genome structure of many bacteriophages. The method is demonstrated to outperform both BLAST methods based on single hits and methods based on k-mer comparisons. MetaPhinder is available as a web service at the Center for Genomic Epidemiology https://cge.cbs.dtu.dk/services/MetaPhinder/, while the source...... and understand them. Here we present MetaPhinder, a method to identify assembled genomic fragments (i.e. contigs) of phage origin in metage-nomic data sets. The method is based on a comparison to a database of whole genome bacteriophage sequences, integrating hits to multiple genomes to accomodate for the mosaic...... code can be downloaded from https://bitbucket.org/genomicepidemiology/metaphinder or https://github.com/vanessajurtz/MetaPhinder....

  18. Bacteriophages as Weapons Against Bacterial Biofilms in the Food Industry.

    Science.gov (United States)

    Gutiérrez, Diana; Rodríguez-Rubio, Lorena; Martínez, Beatriz; Rodríguez, Ana; García, Pilar

    2016-01-01

    Microbiological contamination in the food industry is often attributed to the presence of biofilms in processing plants. Bacterial biofilms are complex communities of bacteria attached to a surface and surrounded by an extracellular polymeric material. Their extreme resistance to cleaning and disinfecting processes is related to a unique organization, which implies a differential bacterial growth and gene expression inside the biofilm. The impact of biofilms on health, and the economic consequences, has promoted the development of different approaches to control or remove biofilm formation. Recently, successful results in phage therapy have boosted new research in bacteriophages and phage lytic proteins for biofilm eradication. In this regard, this review examines the environmental factors that determine biofilm development in food-processing equipment. In addition, future perspectives for the use of bacteriophage-derived tools as disinfectants are discussed.

  19. Insights into bacteriophage application in controlling Vibrio species

    Directory of Open Access Journals (Sweden)

    Vengadesh Letchumanan

    2016-07-01

    Full Text Available Bacterial infections from various organisms including Vibrio sp. pose a serious hazard to humans in many forms from clinical infection to affecting the yield of agriculture and aquaculture via infection of livestock. Vibrio sp. is one of the main foodborne pathogens causing human infection and is also a common cause of losses in the aquaculture industry. Prophylactic and therapeutic usage of antibiotics has become the mainstay of managing this problem, however this in turn led to the emergence of multidrug resistant strains of bacteria in the environment; which has raised awareness of the critical need for alternative non antibiotic based methods of preventing and treating bacterial infections. Bacteriophages - viruses that infect and result in the death of bacteria – are currently of great interest as a highly viable alternative to antibiotics. This article provides an insight into bacteriophage application in controlling Vibrio species as well underlining the advantages and drawbacks of phage therapy.

  20. Characterization of newly isolated lytic bacteriophages active against Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Maia Merabishvili

    Full Text Available Based on genotyping and host range, two newly isolated lytic bacteriophages, myovirus vB_AbaM_Acibel004 and podovirus vB_AbaP_Acibel007, active against Acinetobacter baumannii clinical strains, were selected from a new phage library for further characterization. The complete genomes of the two phages were analyzed. Both phages are characterized by broad host range and essential features of potential therapeutic phages, such as short latent period (27 and 21 min, respectively, high burst size (125 and 145, respectively, stability of activity in liquid culture and low frequency of occurrence of phage-resistant mutant bacterial cells. Genomic analysis showed that while Acibel004 represents a novel bacteriophage with resemblance to some unclassified Pseudomonas aeruginosa phages, Acibel007 belongs to the well-characterized genus of the Phikmvlikevirus. The newly isolated phages can serve as potential candidates for phage cocktails to control A. baumannii infections.

  1. RNA secondary structures of the bacteriophage phi6 packaging regions.

    OpenAIRE

    Pirttimaa, M J; Bamford, D H

    2000-01-01

    Bacteriophage phi6 genome consists of three segments of double-stranded RNA. During maturation, single-stranded copies of these segments are packaged into preformed polymerase complex particles. Only phi6 RNA is packaged, and each particle contains only one copy of each segment. An in vitro packaging and replication assay has been developed for phi6, and the packaging signals (pac sites) have been mapped to the 5' ends of the RNA segments. In this study, we propose secondary structure models ...

  2. Prevalence of Listeria monocytogenes in poultry production in France.

    Science.gov (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

    2008-10-01

    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  3. Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

    Science.gov (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

    2017-06-01

    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Masoumeh Hayati

    2017-11-01

    Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.

  5. Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

    Science.gov (United States)

    Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

    2014-08-01

    Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

  6. Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

    Science.gov (United States)

    Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

    2015-02-06

    Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

  7. Determination of fecal bacteriophages fecales from pre-potable waters using a simple membrane filtration technique; Determinacion de bacteriofagos fecales en aguas pre-potables por la tecnica de filtracion por membrana

    Energy Technology Data Exchange (ETDEWEB)

    Luque, A.; Basanta, A. [EMASESA. Sevilla (Spain); Fuentes, M. V.; Alonso, M. C.; Borrego, J. J. [Universidad de Malaga (Spain)

    2000-07-01

    A modification of the simple filtration technique used for the detection and enumeration of fecal bacteriophages from pre-treated and treated drinking water is described. The filters and equipments used are similar to those employed for the classical bacterial indicator analysis, and the titer of bacteriophages may be recorded in only 6 hours. The proposed modification is based on the elimination of the bacterial decontamination of the water sample by use the selective medium mFC agar; and, in addition, an optimal visualization of the lysis plaques is obtained in this medium, which avoid the use of specific stains like triphenyl tetrazolium chloride (TTC). On the other hand, the proposed modification of the technique presents a high accuracy, since bacteriophage titers of<10 pfu/100 ml of water are detected. (Author) 46 refs.

  8. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  9. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

    Science.gov (United States)

    Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

    2010-02-01

    Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.

  10. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-04-01

    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.

  11. Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria.

    Science.gov (United States)

    Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto

    2016-01-01

    The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

  12. Simultaneous Detection of Escherichia coli O157:H7, Salmonella enteritidis, and Listeria monocytogenes at a Very Low Level Using Simultaneous Enrichment Broth and Multichannel SPR Biosensor.

    Science.gov (United States)

    Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa

    2017-10-01

    Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.

  13. Two-Stage Dynamics of In Vivo Bacteriophage Genome Ejection

    Science.gov (United States)

    Chen, Yi-Ju; Wu, David; Gelbart, William; Knobler, Charles M.; Phillips, Rob; Kegel, Willem K.

    2018-04-01

    Biopolymer translocation is a key step in viral infection processes. The transfer of information-encoding genomes allows viruses to reprogram the cell fate of their hosts. Constituting 96% of all known bacterial viruses [A. Fokine and M. G. Rossmann, Molecular architecture of tailed double-stranded DNA phages, Bacteriophage 4, e28281 (2014)], the tailed bacteriophages deliver their DNA into host cells via an "ejection" process, leaving their protein shells outside of the bacteria; a similar scenario occurs for mammalian viruses like herpes, where the DNA genome is ejected into the nucleus of host cells, while the viral capsid remains bound outside to a nuclear-pore complex. In light of previous experimental measurements of in vivo bacteriophage λ ejection, we analyze here the physical processes that give rise to the observed dynamics. We propose that, after an initial phase driven by self-repulsion of DNA in the capsid, the ejection is driven by anomalous diffusion of phage DNA in the crowded bacterial cytoplasm. We expect that this two-step mechanism is general for phages that operate by pressure-driven ejection, and we discuss predictions of our theory to be tested in future experiments.

  14. Two-Stage Dynamics of In Vivo Bacteriophage Genome Ejection

    Directory of Open Access Journals (Sweden)

    Yi-Ju Chen

    2018-05-01

    Full Text Available Biopolymer translocation is a key step in viral infection processes. The transfer of information-encoding genomes allows viruses to reprogram the cell fate of their hosts. Constituting 96% of all known bacterial viruses [A. Fokine and M. G. Rossmann, Molecular architecture of tailed double-stranded DNA phages, Bacteriophage 4, e28281 (2014], the tailed bacteriophages deliver their DNA into host cells via an “ejection” process, leaving their protein shells outside of the bacteria; a similar scenario occurs for mammalian viruses like herpes, where the DNA genome is ejected into the nucleus of host cells, while the viral capsid remains bound outside to a nuclear-pore complex. In light of previous experimental measurements of in vivo bacteriophage λ ejection, we analyze here the physical processes that give rise to the observed dynamics. We propose that, after an initial phase driven by self-repulsion of DNA in the capsid, the ejection is driven by anomalous diffusion of phage DNA in the crowded bacterial cytoplasm. We expect that this two-step mechanism is general for phages that operate by pressure-driven ejection, and we discuss predictions of our theory to be tested in future experiments.

  15. A Bacteriophage-Related Chimeric Marine Virus Infecting Abalone

    Science.gov (United States)

    Zhuang, Jun; Cai, Guiqin; Lin, Qiying; Wu, Zujian; Xie, Lianhui

    2010-01-01

    Marine viruses shape microbial communities with the most genetic diversity in the sea by multiple genetic exchanges and infect multiple marine organisms. Here we provide proof from experimental infection that abalone shriveling syndrome-associated virus (AbSV) can cause abalone shriveling syndrome. This malady produces histological necrosis and abnormally modified macromolecules (hemocyanin and ferritin). The AbSV genome is a 34.952-kilobase circular double-stranded DNA, containing putative genes with similarity to bacteriophages, eukaryotic viruses, bacteria and endosymbionts. Of the 28 predicted open reading frames (ORFs), eight ORF-encoded proteins have identifiable functional homologues. The 4 ORF products correspond to a predicted terminase large subunit and an endonuclease in bacteriophage, and both an integrase and an exonuclease from bacteria. The other four proteins are homologous to an endosymbiont-derived helicase, primase, single-stranded binding (SSB) protein, and thymidylate kinase, individually. Additionally, AbSV exhibits a common gene arrangement similar to the majority of bacteriophages. Unique to AbSV, the viral genome also contains genes associated with bacterial outer membrane proteins and may lack the structural protein-encoding ORFs. Genomic characterization of AbSV indicates that it may represent a transitional form of microbial evolution from viruses to bacteria. PMID:21079776

  16. A bacteriophage-related chimeric marine virus infecting abalone.

    Directory of Open Access Journals (Sweden)

    Jun Zhuang

    Full Text Available Marine viruses shape microbial communities with the most genetic diversity in the sea by multiple genetic exchanges and infect multiple marine organisms. Here we provide proof from experimental infection that abalone shriveling syndrome-associated virus (AbSV can cause abalone shriveling syndrome. This malady produces histological necrosis and abnormally modified macromolecules (hemocyanin and ferritin. The AbSV genome is a 34.952-kilobase circular double-stranded DNA, containing putative genes with similarity to bacteriophages, eukaryotic viruses, bacteria and endosymbionts. Of the 28 predicted open reading frames (ORFs, eight ORF-encoded proteins have identifiable functional homologues. The 4 ORF products correspond to a predicted terminase large subunit and an endonuclease in bacteriophage, and both an integrase and an exonuclease from bacteria. The other four proteins are homologous to an endosymbiont-derived helicase, primase, single-stranded binding (SSB protein, and thymidylate kinase, individually. Additionally, AbSV exhibits a common gene arrangement similar to the majority of bacteriophages. Unique to AbSV, the viral genome also contains genes associated with bacterial outer membrane proteins and may lack the structural protein-encoding ORFs. Genomic characterization of AbSV indicates that it may represent a transitional form of microbial evolution from viruses to bacteria.

  17. Isolation and Characterization of a Virulent Bacteriophage AB1 of Acinetobacter baumannii

    Directory of Open Access Journals (Sweden)

    Jia Shiru

    2010-04-01

    Full Text Available Abstract Background Acinetobacter baumannii is an emerging nosocomial pathogen worldwide with increasing prevalence of multi-drug and pan-drug resistance. A. baumannii exists widely in natural environment, especially in health care settings, and has been shown difficult to be eradicated. Bacteriophages are often considered alternative agent for controlling bacterial infection and contamination. In this study, we described the isolation and characterization of one virulent bacteriophage AB1 capable of specifically infecting A. baumannii. Results A virulent bacteriophage AB1, specific for infecting a clinical strain A. baumannii KD311, was first isolated from marine sediment sample. Restriction analysis indicated that phage AB1 was a dsDNA virus with an approximate genome size of 45.2 kb to 46.9 kb. Transmission electron microscopy showed that phage AB1 had an icosahedral head with a non-contractile tail and collar or whisker structures, and might be tentatively classified as a member of the Siphoviridae family. Proteomic pattern of phage AB1, generated by SDS-PAGE using purified phage particles, revealed five major bands and six minor bands with molecular weight ranging from 14 to 80 kilo-dalton. Also determined was the adsorption rate of phage AB1 to the host bacterium, which was significantly enhanced by addition of 10 mM CaCl2. In a single step growth test, phage AB1 was shown having a latent period of 18 minutes and a burst size of 409. Moreover, pH and thermal stability of phage AB1 were also investigated. At the optimal pH 6.0, 73.2% of phages survived after 60 min incubation at 50°C. When phage AB1 was used to infect four additional clinical isolates of A. baumannii, one clinical isolate of Stenotrophomonas maltophilia, and Pseudomonas aeruginosa lab strains PAK and PAO1, none of the tested strains was found susceptible, indicating a relatively narrow host range for phage AB1. Conclusion Phage AB1 was capable of eliciting efficient lysis

  18. Genome Analysis of Listeria monocytogenes Sequence Type 8 Strains Persisting in Salmon and Poultry Processing Environments and Comparison with Related Strains

    Science.gov (United States)

    Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety

  19. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  20. Impact of increased mutagenesis on adaptation to high temperature in bacteriophage Qβ.

    Science.gov (United States)

    Arribas, María; Cabanillas, Laura; Kubota, Kirina; Lázaro, Ester

    2016-10-01

    RNA viruses replicate with very high error rates, which makes them more sensitive to additional increases in this parameter. This fact has inspired an antiviral strategy named lethal mutagenesis, which is based on the artificial increase of the error rate above a threshold incompatible with virus infectivity. A relevant issue concerning lethal mutagenesis is whether incomplete treatments might enhance the adaptive possibilities of viruses. We have addressed this question by subjecting an RNA virus, the bacteriophage Qβ, to different transmission regimes in the presence or the absence of sublethal concentrations of the mutagenic nucleoside analogue 5-azacytidine (AZC). Populations obtained were subsequently exposed to a non-optimal temperature and analyzed to determine their consensus sequences. Our results show that previously mutagenized populations rapidly fixed a specific set of mutations upon propagation at the new temperature, suggesting that the expansion of the mutant spectrum caused by AZC has an influence on later evolutionary behavior. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    Science.gov (United States)

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  2. Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

    Science.gov (United States)

    Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

    2017-07-01

    Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

  3. Pasteurella haemolytica bacteriophage: identification, partial characterization, and relationship of temperate bacteriophages from isolates of Pasteurella haemolytica (biotype A, serotype 1)

    International Nuclear Information System (INIS)

    Richards, A.B.; Renshaw, H.W.; Sneed, L.W.

    1985-01-01

    Pasteurella haemolytica (biotype A, serotype 1) isolates (n = 15) from the upper respiratory tract of clinically normal cattle, as well as from lung lesions from cases of fatal bovine pasteurellosis, were examined for the presence of bacteriophage after irradiation with UV light. Treatment of all P haemolytica isolates with UV irradiation resulted in lysis of bacteria due to the induction of vegetative development of bacteriophages. The extent of growth inhibition and bacterial lysis in irradiated cultures was UV dose-dependent. Bacterial cultures exposed to UV light for 20 s reached peak culture density between 60 and 70 minutes after irradiation; thereafter, culture density declined rapidly, so that by 120 minutes, it was approximately 60% of the original value. When examined ultrastructurally, lytic cultures from each isolate revealed bacteriophages with an overall length of approximately 200 nm and that appeared to have a head with icosahedral symmetry and a contractile tail. Cell-free filtrate from each noninduced bacterial isolate was inoculated onto the other bacterial isolates in a cross-culture sensitivity assay for the presence of phages lytic for the host bacterial isolates. Zones of lysis (plaques) did not develop when bacterial lawns grown from the different isolates were inoculated with filtrates from the heterologous isolates

  4. Evaluation of a cross contamination model describing transfer of salmonella spp. and listeria monocytogenes during grinding of pork and beef

    DEFF Research Database (Denmark)

    Møller, Cleide Oliveira de Almeida; Hansen, Tina Beck; Aabo, Søren

    2015-01-01

    Introduction: The cross contamination model (Møller et al. 2012) was evaluated to investigate its capability of describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef of varying sizes (50 – 324 g) and numbers of pieces to be ground (10 – 100), in two...... processing. QMRA risk estimates and TTP both revealed that risk attribution from grinding was mainly influenced by sharpness of grinder knife > specific grinder > grinding temperature whereas the specific pathogen was of minor importance....

  5. L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

    Science.gov (United States)

    Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

    2014-10-17

    The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

  6. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  7. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

    Science.gov (United States)

    Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

    2017-09-18

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

  8. Binding of the N-Terminal Domain of the Lactococcal Bacteriophage TP901-1 CI Repressor to Its Target DNA: A Crystallography, Small Angle Scattering, and Nuclear Magnetic Resonance Study

    DEFF Research Database (Denmark)

    Frandsen, Kristian Erik Høpfner; Rasmussen, Kim K.; Jensen, Malene Ringkjøbing

    2013-01-01

    In most temperate bacteriophages, regulation of the choice of lysogenic or lytic life cycle is controlled by a CI repressor protein. Inhibition of transcription is dependent on a helix–turn–helix motif, often located in the N-terminal domain (NTD), which binds to specific DNA sequences (operator ...

  9. Tracking Listeria monocytogenes contamination and virulence-associated characteristics in the ready-to-eat meat-based food products industry according to the hygiene level.

    Science.gov (United States)

    Henriques, A R; Gama, L T; Fraqueza, M J

    2017-02-02

    Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.

  10. Growth potential of Salmonella spp. and Listeria monocytogenes in nine types of ready-to-eat vegetables stored at variable temperature conditions during shelf-life.

    Science.gov (United States)

    Sant'Ana, Anderson S; Barbosa, Matheus S; Destro, Maria Teresa; Landgraf, Mariza; Franco, Bernadette D G M

    2012-06-15

    Growth potential (δ) is defined as the difference between the population of a microorganism at the end of shelf-life of specific food and its initial population. The determination of δ of Salmonella and Listeria monocytogenes in RTE vegetables can be very useful to determine likely threats to food safety. However, little is known on the behavior of these microorganisms in several RTE vegetables. Therefore, the aim of this study was to determine the δ of both pathogens in nine different types of RTE vegetables (escarole, collard green, spinach, watercress, arugula, grated carrot, green salad, and mix for yakisoba) stored at refrigeration (7°C) and abuse temperature (15°C). The population of aerobic microorganisms and lactic acid bacteria, including those showing antimicrobial activity has been also determined. Results indicated that L. monocytogenes was able to grow (δ≥0.5 log(10)) in more storage conditions and vegetables than Salmonella. Both microorganisms were inhibited in carrots, although a more pronounced effect has been observed against L. monocytogenes. The highest δ values were obtained when the RTE vegetables were stored 15°C/6days in collard greens (δ=3.3) and arugula (δ=3.2) (L. monocytogenes) and arugula (δ=4.1) and escarole (δ=2.8) (Salmonella). In most vegetables and storage conditions studied, the counts of total aerobic microorganisms raised significantly independent of the temperature of storage (pvegetables partially or fully stored at abuse temperature with recovery of isolates showing antimicrobial activity. In conclusion, the results of this study show that Salmonella and L. monocytogenes may grow and reach high populations in RTE vegetables depending on storage conditions and the definition of effective intervention strategies are needed to control their growth in these products. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Analysing and modelling the growth behaviour of Listeria monocytogenes on RTE cooked meat products after a high pressure treatment at 400 MPa.

    Science.gov (United States)

    Hereu, A; Dalgaard, P; Garriga, M; Aymerich, T; Bover-Cid, S

    2014-09-01

    Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes in sliced cooked meat products after a pressurization treatment. Two inoculum levels (10(7) or 10(4) CFU/g) and two physiological states before pressurization (freeze-stressed or cold-adapted) were evaluated. Samples of cooked ham and mortadella were inoculated, high pressure processed (400 MPa, 5 min) and subsequently stored at 4, 8 and 12 °C. The Logistic model with delay was used to estimate lag phase (λ) and maximum specific growth rate (μmax) values from the obtained growth curves. The effect of storage temperature on μmax and λ was modelled using the Ratkowsky square root model and the relative lag time (RLT) concept. Compared with cold-adapted cells the freeze-stressed cells were more pressure-resistant and showed a much longer lag phase during growth after the pressure treatment. Interestingly, for high-pressure inactivation and subsequent growth, the time to achieve a concentration of L. monocytogenes 100-fold (2-log) higher than the cell concentration prior to the pressure treatment was similar for the two studied physiological states of the inoculum. Two secondary models were necessary to describe the different growth behaviour of L. monocytogenes on ready-to-eat cooked ham (lean product) and mortadella (fatty product). This supported the need of a product-oriented approach to assess growth after high pressure processing. The performance of the developed predictive models for the growth of L. monocytogenes in high-pressure processed cooked ham and mortadella was evaluated by comparison with available data from the literature and by using the Acceptable Simulation Zone approach. Overall, 91% of the relative errors fell into the Acceptable Simulation Zone

  12. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2015-03-01

    Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  13. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

    Science.gov (United States)

    Meloni, Domenico

    2015-03-12

    The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  14. Potential of a lytic bacteriophage to disrupt Acinetobacter baumannii biofilms in vitro.

    Science.gov (United States)

    Liu, Yannan; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Wang, Yong; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Li, Puyuan; Tong, Yigang; Bai, Changqing

    2016-10-01

    The ability of Acinetobacter baumannii to form biofilms and develop antibiotic resistance makes it difficult to control infections caused by this bacterium. In this study, we explored the potential of a lytic bacteriophage to disrupt A. baumannii biofilms. The potential of the lytic bacteriophage to disrupt A. baumannii biofilms was assessed by performing electron microscopy, live/dead bacterial staining, crystal violet staining and by determining adenosine triphosphate release. The bacteriophage inhibited the formation of and disrupted preformed A. baumannii biofilms. Results of disinfection assay showed that the lytic bacteriophage lysed A. baumannii cells suspended in blood or grown on metal surfaces. These results suggest the potential of the lytic bacteriophage to disrupt A. baumannii biofilms.

  15. Inhibition of Listeria monocytogenes ATCC 19115 on ham steak by tea bioactive compounds incorporated into chitosan-coated plastic films

    Directory of Open Access Journals (Sweden)

    Vodnar Dan C

    2012-07-01

    Full Text Available Abstract Background The consumer demands for better quality and safety of food products have given rise to the development and implementation of edible films. The use of antimicrobial films can be a promising tool for controlling L. monocytogenes on ready to eat products. The aim of this study was to develop effective antimicrobial films incorporating bioactive compounds from green and black teas into chitosan, for controlling L. monocytogenes ATCC 19115 on vacuum-packaged ham steak. The effectiveness of these antimicrobial films was evaluated at room temperature (20°C for 10 days and at refrigerated temperature (4°C for 8 weeks. Results The HPLC results clearly show that relative concentrations of catechins and caffeine in green tea ranked EGCG>EGC>CAF>ECG>EC>C while in black tea extracts ranked CAF>EGCG>ECG>EGC>EC>C. The chitosan-coated plastic films incorporating green tea and black tea extracts shows specific markers identified by FTIR. Incorporating natural extracts into chitosan showed that the growth of L monocytogenes ATCC 19115 was inhibited. The efficacy of antimicrobial effect of tea extracts incorporated into chitosan-coated plastic film was dose dependent. However, chitosan-coated films without addition of tea extracts did not inhibit the growth of L. monocytogenes ATCC 19115. Chitosan-coated plastic films incorporating 4% Green tea extract was the most effective antimicrobial, reducing the initial counts from 3.2 to 2.65 log CFU/cm2 during room temperature storage and from 3.2 to 1–1.5 log CFU/cm2 during refrigerated storage. Conclusions Incorporation of tea extracts into the chitosan-coated films considerably enhanced their effectiveness against L. monocytogenes ATCC 19115. 4% Green tea incorporated into chitosan-coated plastic film had a better antilisterial effect than 2% green tea or 2% and 4% black tea. Data from this study would provide new formulation options for developing antimicrobial packaging films using tea

  16. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  17. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar

    2018-05-23

    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  18. Using lytic bacteriophages to eliminate or significantly reduce contamination of food by foodborne bacterial pathogens.

    Science.gov (United States)

    Sulakvelidze, Alexander

    2013-10-01

    Bacteriophages (also called 'phages') are viruses that kill bacteria. They are arguably the oldest (3 billion years old, by some estimates) and most ubiquitous (total number estimated to be 10(30) -10(32) ) known organisms on Earth. Phages play a key role in maintaining microbial balance in every ecosystem where bacteria exist, and they are part of the normal microflora of all fresh, unprocessed foods. Interest in various practical applications of bacteriophages has been gaining momentum recently, with perhaps the most attention focused on using them to improve food safety. That approach, called 'phage biocontrol', typically includes three main types of applications: (i) using phages to treat domesticated livestock in order to reduce their intestinal colonization with, and shedding of, specific bacterial pathogens; (ii) treatments for decontaminating inanimate surfaces in food-processing facilities and other food establishments, so that foods processed on those surfaces are not cross-contaminated with the targeted pathogens; and (iii) post-harvest treatments involving direct applications of phages onto the harvested foods. This mini-review primarily focuses on the last type of intervention, which has been gaining the most momentum recently. Indeed, the results of recent studies dealing with improving food safety, and several recent regulatory approvals of various commercial phage preparations developed for post-harvest food safety applications, strongly support the idea that lytic phages may provide a safe, environmentally-friendly, and effective approach for significantly reducing contamination of various foods with foodborne bacterial pathogens. However, some important technical and nontechnical problems may need to be addressed before phage biocontrol protocols can become an integral part of routine food safety intervention strategies implemented by food industries in the USA. © 2013 Society of Chemical Industry.

  19. Bacteriophages safely reduce Salmonella contamination in pet food and raw pet food ingredients.

    Science.gov (United States)

    Soffer, Nitzan; Abuladze, Tamar; Woolston, Joelle; Li, Manrong; Hanna, Leigh Farris; Heyse, Serena; Charbonneau, Duane; Sulakvelidze, Alexander

    2016-01-01

    Contamination of pet food with Salmonella is a serious public health concern, and several disease outbreaks have recently occurred due to human exposure to Salmonella tainted pet food. The problem is especially challenging for raw pet foods (which include raw meats, seafood, fruits, and vegetables). These foods are becoming increasingly popular because of their nutritional qualities, but they are also more difficult to maintain Salmonella -free because they lack heat-treatment. Among various methods examined to improve the safety of pet foods (including raw pet food), one intriguing approach is to use bacteriophages to specifically kill Salmonella serotypes. At least 2 phage preparations (SalmoFresh® and Salmonelex™) targeting Salmonella are already FDA cleared for commercial applications to improve the safety of human foods. However, similar preparations are not yet available for pet food applications. Here, we report the results of evaluating one such preparation (SalmoLyse®) in reducing Salmonella levels in various raw pet food ingredients (chicken, tuna, turkey, cantaloupe, and lettuce). Application of SalmoLyse® in low (ca. 2-4×10 6 PFU/g) and standard (ca. 9×10 6 PFU/g) concentrations significantly ( P contamination in all raw foods examined compared to control treatments. When SalmoLyse®-treated (ca. 2×10 7 PFU/g) dry pet food was fed to cats and dogs, it did not trigger any deleterious side effects in the pets. Our data suggest that the bacteriophage cocktail lytic for Salmonella can significantly and safely reduce Salmonella contamination in various raw pet food ingredients.

  20. Bacteriophage Distributions and Temporal Variability in the Ocean’s Interior

    Directory of Open Access Journals (Sweden)

    Elaine Luo

    2017-11-01

    Full Text Available Bacteriophages are numerically the most abundant DNA-containing entities in the oligotrophic ocean, yet how specific phage populations vary over time and space remains to be fully explored. Here, we conducted a metagenomic time-series survey of double-stranded DNA phages throughout the water column in the North Pacific Subtropical Gyre, encompassing 1.5 years from depths of 25 to 1,000 m. Viral gene sequences were identified in assembled metagenomic samples, yielding an estimated 172,385 different viral gene families. Viral marker gene distributions suggested that lysogeny was more prevalent at mesopelagic depths than in surface waters, consistent with prior prophage induction studies using mitomycin C. A total of 129 ALOHA viral genomes and genome fragments from 20 to 108 kbp were selected for further study, which represented the most abundant phages in the water column. Phage genotypes displayed discrete population structures. Most phages persisted throughout the time-series and displayed a strong depth structure that mirrored the stratified depth distributions of co-occurring bacterial taxa in the water column. Mesopelagic phages were distinct from surface water phages with respect to diversity, gene content, putative life histories, and temporal persistence, reflecting depth-dependent differences in host genomic architectures and phage reproductive strategies. The spatiotemporal distributions of the most abundant open-ocean bacteriophages that we report here provide new insight into viral temporal persistence, life history, and virus-host-environment interactions throughout the open-ocean water column.

  1. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

    Science.gov (United States)

    Soares, Charles A; Knuckley, Bryan

    2016-06-01

    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  2. Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aracelly Castro

    2013-09-01

    Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

  3. How Listeria monocytogenes organizes its surface for virulence

    Science.gov (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

    2014-01-01

    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  4. Genesis of a novel Shigella flexneri serotype by sequential infection of serotype-converting bacteriophages SfX and SfI

    Directory of Open Access Journals (Sweden)

    Sun Qiangzheng

    2011-12-01

    Full Text Available Abstract Background Shigella flexneri is the major pathogen causing bacillary dysentery. Fifteen serotypes have been recognized up to now. The genesis of new S. flexneri serotypes is commonly mediated by serotype-converting bacteriophages. Untypeable or novel serotypes from natural infections had been reported worldwide but have not been generated in laboratory. Results A new S. flexneri serotype-serotype 1 d was generated when a S. flexneri serotype Y strain (native LPS was sequentially infected with 2 serotype-converting bacteriophages, SfX first and then SfI. The new serotype 1 d strain agglutinated with both serotype X-specific anti-7;8 grouping serum and serotype 1a-specific anti- I typing serum, and differed from subserotypes 1a, 1b and 1c. Twenty four S. flexneri clinical isolates of serotype X were all converted to serotype 1 d by infection with phage SfI. PCR and sequencing revealed that SfI and SfX were integrated in tandem into the proA-yaiC region of the host chromosome. Conclusions These findings suggest a new S. flexneri serotype could be created in nature. Such a conversion may be constrained by susceptibility of a strain to infection by a given serotype-converting bacteriophage. This finding has significant implications in the emergence of new S. flexneri serotypes in nature.

  5. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  6. Lytic bacteriophages reduce Escherichia coli O157: H7 on fresh cut lettuce introduced through cross-contamination.

    Science.gov (United States)

    Ferguson, Sean; Roberts, Cheryl; Handy, Eric; Sharma, Manan

    2013-01-01

    The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield™) or a control (phosphate buffered saline, PBS) was applied to lettuce by either; (1) immersion of lettuce in 500 ml of EcoShield™ 8.3 log PFU/ml or 9.8 log PFU/ml for up to 2 min before inoculation with E. coli O157:H7; (2) spray-application of EcoShield™ (9.3 log PFU/ml) to lettuce after inoculation with E. coli O157:H7 (4.10 CFU/cm 2 ) following exposure to 50 μg/ml chlorine for 30 sec. After immersion studies, lettuce was spot-inoculated with E. coli O157:H7 (2.38 CFU/cm 2 ). Phage-treated, inoculated lettuce pieces were stored at 4°C for and analyzed for E. coli O157:H7 populations for up to 7 d. Immersion of lettuce in 9.8 log PFU/ml EcoShield™ for 2 min significantly (p PFU/ml) resulted in the deposition of high concentrations (7.8 log log PFU/cm 2 ) of bacteriophages on the surface of fresh cut lettuce, potentially contributing to the efficacy of the lytic phages on lettuce. Spraying phages on to inoculated fresh cut lettuce after being washed in hypochlorite solution was significantly more effective in reducing E. coli O157:H7 populations (2.22 log CFU/cm 2 ) on day 0 compared with control treatments (4.10 log CFU/cm 2 ). Both immersion and spray treatments provided protection from E. coli O157:H7 contamination on lettuce, but spray application of lytic bacteriophages to lettuce was more effective in immediately reducing E. coli O157:H7 populations fresh cut lettuce.

  7. Feasibility of using a bacteriophage-based structural color sensor for screening the geographical origins of agricultural products

    Science.gov (United States)

    Seol, Daun; Moon, Jong-Sik; Lee, Yujin; Han, Jiye; Jang, Daeil; Kang, Dong-Jin; Moon, Jiyoung; Jang, Eunjin; Oh, Jin-Woo; Chung, Hoeil

    2018-05-01

    An M13 bacteriophage-based color sensor, which can change its structural color upon interaction with a gaseous molecule, was evaluated as a screening tool for the discrimination of the geographical origins of three different agricultural products (garlic, onion, and perilla). Exposure of the color sensor to sample odors induced the self-assembled M13 bacteriophage bundles to swell by the interaction of amino acid residues (repeating units of four glutamates) on the bacteriophage with the odor components, resulting in a change in the structural color of the sensor. When the sensor was exposed to the odors of garlic and onion samples, the RGB color changes were considerable because of the strong interactions of the odor components such as disulfides with the glutamate residues on the sensor. Although the patterns of the color variations were generally similar between the domestic and imported samples, some degrees of dissimilarities in their intensities were also observed. Although the magnitude of color change decreased for perilla, the color change patterns between the two groups were somewhat different. With the acquired RGB data, a support vector machine was employed to distinguish the domestic and imported samples, and the resulting accuracies in the measurements of garlic, onion, and perilla samples were 94.1, 88.7, and 91.6%, respectively. The differences in the concentrations of the odor components between both groups and/or the presence of specific components exclusively in the odor of one group allowed the color sensor-based discrimination. The demonstrated color sensor was thus shown to be a potentially versatile and simple as an on-site screening tool. Strategies able to further improve the sensor performance were also discussed.

  8. Feasibility of using a bacteriophage-based structural color sensor for screening the geographical origins of agricultural products.

    Science.gov (United States)

    Seol, Daun; Moon, Jong-Sik; Lee, Yujin; Han, Jiye; Jang, Daeil; Kang, Dong-Jin; Moon, Jiyoung; Jang, Eunjin; Oh, Jin-Woo; Chung, Hoeil

    2018-05-15

    An M13 bacteriophage-based color sensor, which can change its structural color upon interaction with a gaseous molecule, was evaluated as a screening tool for the discrimination of the geographical origins of three different agricultural products (garlic, onion, and perilla). Exposure of the color sensor to sample odors induced the self-assembled M13 bacteriophage bundles to swell by the interaction of amino acid residues (repeating units of four glutamates) on the bacteriophage with the odor components, resulting in a change in the structural color of the sensor. When the sensor was exposed to the odors of garlic and onion samples, the RGB color changes were considerable because of the strong interactions of the odor components such as disulfides with the glutamate residues on the sensor. Although the patterns of the color variations were generally similar between the domestic and imported samples, some degrees of dissimilarities in their intensities were also observed. Although the magnitude of color change decreased for perilla, the color change patterns between the two groups were somewhat different. With the acquired RGB data, a support vector machine was employed to distinguish the domestic and imported samples, and the resulting accuracies in the measurements of garlic, onion, and perilla samples were 94.1, 88.7, and 91.6%, respectively. The differences in the concentrations of the odor components between both groups and/or the presence of specific components exclusively in the odor of one group allowed the color sensor-based discrimination. The demonstrated color sensor was thus shown to be a potentially versatile and simple as an on-site screening tool. Strategies able to further improve the sensor performance were also discussed. Copyright © 2018. Published by Elsevier B.V.

  9. Cholera dynamics with Bacteriophage infection: A mathematical study

    International Nuclear Information System (INIS)

    Misra, A.K.; Gupta, Alok; Venturino, Ezio

    2016-01-01

    Highlights: • A mathematical model for the biological control of cholera has been proposed. • The feasibility and stability of all the equilibria have been investigated. • The ODE model is found to exhibit Hopf-bifurcation. • Conditions of global asymptotic stability have been obtained. • The impact of important parameters on cholera spread has been shown. - Abstract: Mathematical modeling of waterborne diseases, such as cholera, including a biological control using Bacteriophage viruses in the aquatic reservoirs is of great relevance in epidemiology. In this paper, our aim is twofold: at first, to understand the cholera dynamics in the region around a water body; secondly, to understand how the spread of Bacteriophage infection in the cholera bacterium V. cholerae controls the disease in the human population. For this purpose, we modify the model proposed by Codeço, for the spread of cholera infection in human population and the one proposed by Beretta and Kuang, for the spread of Bacteriophage infection in the bacteria population [1, 2]. We first discuss the feasibility and local asymptotic stability of all the possible equilibria of the proposed model. Further, in the numerical investigation, we have found that the parameter ϕ, called the phage adsorption rate, plays an important role. There is a critical value, ϕ c , at which the model possess Hopf-bifurcation. For lower values than ϕ c , the equilibrium E * is unstable and periodic solutions are observed, while above ϕ c , the equilibrium E * is locally asymptotically stable, and further shown to be also globally asymptotically stable. We investigate the effect of the various parameters on the dynamics of the infected humans by means of numerical simulations.

  10. Bacteriophages : an underestimated role in human and animal health ?

    Directory of Open Access Journals (Sweden)

    Marianne eDe Paepe

    2014-03-01

    Full Text Available Metagenomic approaches applied to viruses have highlighted their prevalence in almost all microbial ecosystems investigated. In all ecosystems, notably those associated with humans or animals, the viral fraction is dominated by bacteriophages. Whether they contribute to dysbiosis, i.e. the departure from microbiota composition in symbiosis at equilibrium and entry into a state favoring human or animal disease is unknown at present. This review summarizes what has been learnt on phages associated with human and animal microbiota, and focuses on examples illustrating the several ways by which phages may contribute to a shift to pathogenesis, either by modifying population equilibrium, by horizontal transfer, or by modulating immunity.

  11. Mechanisms for the initiation of bacteriophage T7 DNA replication

    International Nuclear Information System (INIS)

    Fuller, C.W.; Beauchamp, B.B.; Engler, M.J.; Lechner, R.L.; Matson, S.W.; Tabor, S.; White, J.H.; Richardson, C.C.

    1983-01-01

    Genetic analysis of bacteriophage T7 has shown that the products of phage genes 1, 2, 3, 4, 5, and 6 are required for phage DNA synthesis in vivo. T7 RNA polymerase is the translation product of gene 1. This RNA polymerase is required for transcription of most of the phage genome, including genes 2 through 6. T7 RNA polymerase promoters consist of a highly conserved 23-bp DNA sequence. There are 17 such promoters in the T7 DNA molecule, all of which direct transcription from the same strand of the DNA. 70 references, 11 figures

  12. Re-initiation repair in bacteriophage T4

    International Nuclear Information System (INIS)

    Cupido, M.

    1981-01-01

    Irradiation of bacteriophage T4 with ultraviolet light induces the formation of pyrimidine dimers in its DNA. These dimers hamper replication of DNA and, to a lesser extent, transcription of DNA after its infection of bacteria. A number of pathways enable phage T4 to multiply dimer-containing DNA. One of these pathways has been named replication repair and is described in this thesis. The properties of two phage strains, unable to perform replication repair, have been studied to obtain a picture of the repair process. The mutations in these strains that affect replication repair have been located on the genomic map of T4. (Auth.)

  13. One group of genetically similar Listeria monocytogenes strains frequently dominates and persists in several fish slaughter- and smokehouses

    DEFF Research Database (Denmark)

    Wulff, Gitte; Gram, Lone; Ahrens, Peter

    2006-01-01

    Contamination of foods with the human pathogen Listeria monocytogenes may occur during processing, and the purpose of this study was to determine whether genetically similar strains colonize different processing plants or whether specific persistent strains are unique to each processing plant. We...... smokehouses and two slaughterhouses and was predominant in three of these plants. A subset of 35 strains was also analyzed by amplified fragment length polymorphism typing, which confirmed the genetic similarity of the groups. Moreover, strains of the dominant RAPD type were indistinguishable from strains...

  14. Rapid Identification of Intact Staphylococcal Bacteriophages Using Matrix-Assisted Laser Desorption Ionization-Time-of-Flight Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Dana Štveráková

    2018-04-01

    Full Text Available Staphylococcus aureus is a major causative agent of infections associated with hospital environments, where antibiotic-resistant strains have emerged as a significant threat. Phage therapy could offer a safe and effective alternative to antibiotics. Phage preparations should comply with quality and safety requirements; therefore, it is important to develop efficient production control technologies. This study was conducted to develop and evaluate a rapid and reliable method for identifying staphylococcal bacteriophages, based on detecting their specific proteins using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS profiling that is among the suggested methods for meeting the regulations of pharmaceutical authorities. Five different phage purification techniques were tested in combination with two MALDI-TOF MS matrices. Phages, either purified by CsCl density gradient centrifugation or as resuspended phage pellets, yielded mass spectra with the highest information value if ferulic acid was used as the MALDI matrix. Phage tail and capsid proteins yielded the strongest signals whereas the culture conditions had no effect on mass spectral quality. Thirty-seven phages from Myoviridae, Siphoviridae or Podoviridae families were analysed, including 23 siphophages belonging to the International Typing Set for human strains of S. aureus, as well as phages in preparations produced by Microgen, Bohemia Pharmaceuticals and MB Pharma. The data obtained demonstrate that MALDI-TOF MS can be used to effectively distinguish between Staphylococcus-specific bacteriophages.

  15. Growth potential of Salmonella spp. and Listeria monocytogenes in nine types of ready-to-eat vegetables stored at variable temperature conditions during shelf-life

    OpenAIRE

    Sant'Ana, Anderson S.; Barbosa, Matheus S.; Destro, Maria Teresa; Landgraf, Mariza; Franco, Bernadette D. G. M.

    2012-01-01

    Growth potential (delta) is defined as the difference between the population of a microorganism at the end of shelf-life of specific food and its initial population. The determination of 6 of Salmonella and Listeria monocytogenes in RTE vegetables can be very useful to determine likely threats to food safety. However, little is known on the behavior of these microorganisms in several RTE vegetables. Therefore, the aim of this study was to determine the delta of both pathogens in nine differen...

  16. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  17. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  18. A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

    Science.gov (United States)

    Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

  19. Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants

    Science.gov (United States)

    The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

  20. Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

    Science.gov (United States)

    Lu, Chunye; Marjanovic, Olivera; Kiang, David

    2017-01-01

    ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

  1. The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

    Science.gov (United States)

    Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

    2018-06-13

    The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

  2. A dynamical systems approach to actin-based motility in Listeria monocytogenes

    Science.gov (United States)

    Hotton, S.

    2010-11-01

    A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

  3. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

    Science.gov (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  5. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  6. Stress Survival Islet 2, Predominantly Present in Listeria monocytogenes Strains of Sequence Type 121, Is Involved in the Alkaline and Oxidative Stress Responses.

    Science.gov (United States)

    Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin

    2017-08-15

    The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation

  7. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  8. Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

    2013-01-01

    Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

  9. Isolation and Characterization of a Bacteriophage Preying an Antifungal Bacterium

    Directory of Open Access Journals (Sweden)

    Aryan Rahimi-Midani

    2016-12-01

    Full Text Available Several Bacillus species were isolated from rice field soils, and 16S rRNA gene sequence analysis showed that Bacillus cereus was the most abundant. A strain named BC1 showed antifungal activity against Rhizoctonia solani. Bacteriophages infecting strain BC1 were isolated from the same soil sample. The isolated phage PK16 had an icosahedral head of 100 ± 5 nm and tail of 200 ± 5 nm, indicating that it belonged to the family Myoviridae. Analysis of the complete linear dsDNA genome revealed a 158,127-bp genome with G + C content of 39.9% comprising 235 open reading frames as well as 19 tRNA genes (including 1 pseudogene. Blastp analysis showed that the proteins encoded by the PK16 genome had the closest hits to proteins of seven different bacteriophages. A neighbor-joining phylogenetic tree based on the major capsid protein showed a robust clustering of phage PK16 with phage JBP901 and BCP8-2 isolated from Korean fermented food.

  10. Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

    DEFF Research Database (Denmark)

    Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter

    2006-01-01

    The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

  11. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  12. Novel Method To Identify Source-Associated Phylogenetic Clustering Shows that Listeria monocytogenes Includes Niche-Adapted Clonal Groups with Distinct Ecological Preferences

    DEFF Research Database (Denmark)

    Nightingale, K. K.; Lyles, K.; Ayodele, M.

    2006-01-01

    population are identified (TreeStats test). Analysis of sequence data for 120 L. monocytogenes isolates revealed evidence of clustering between isolates from the same source, based on the phylogenies inferred from actA and inlA (P = 0.02 and P = 0.07, respectively; SourceCluster test). Overall, the Tree...... are biologically valid. Overall, our data show that (i) the SourceCluster and TreeStats tests can identify biologically meaningful source-associated phylogenetic clusters and (ii) L. monocytogenes includes clonal groups that have adapted to infect specific host species or colonize nonhost environments......., including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source...

  13. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

    2013-01-01

    Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

  14. Beyond the chromosome: the prevalence of unique extra-chromosomal bacteriophages with integrated virulence genes in pathogenic Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Bryan Utter

    Full Text Available In Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExPΦs throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExPΦ (designated ФBU01 from a vancomycin-intermediate S. aureus (VISA strain. Assembly and annotation of ФBU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC. Our identification of several potential ExPΦs and mobile genetic elements (MGEs also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT.

  15. Studies on the pathogenesis and survival of different culture forms of Listeria monocytogenes to pulsed UV-light irradiation after exposure to mild-food processing stresses.

    Science.gov (United States)

    Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J

    2012-06-01

    The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Estimation of Listeria monocytogenes and Escherichia coli O157:H7 prevalence and levels in naturally contaminated rocket and cucumber samples by deterministic and stochastic approaches.

    Science.gov (United States)

    Hadjilouka, Agni; Mantzourani, Kyriaki-Sofia; Katsarou, Anastasia; Cavaiuolo, Marina; Ferrante, Antonio; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2015-02-01

    The aims of the present study were to determine the prevalence and levels of Listeria monocytogenes and Escherichia coli O157:H7 in rocket and cucumber samples by deterministic (estimation of a single value) and stochastic (estimation of a range of values) approaches. In parallel, the chromogenic media commonly used for the recovery of these microorganisms were evaluated and compared, and the efficiency of an enzyme-linked immunosorbent assay (ELISA)-based protocol was validated. L. monocytogenes and E. coli O157:H7 were detected and enumerated using agar Listeria according to Ottaviani and Agosti plus RAPID' L. mono medium and Fluorocult plus sorbitol MacConkey medium with cefixime and tellurite in parallel, respectively. Identity was confirmed with biochemical and molecular tests and the ELISA. Performance indices of the media and the prevalence of both pathogens were estimated using Bayesian inference. In rocket, prevalence of both L. monocytogenes and E. coli O157:H7 was estimated at 7% (7 of 100 samples). In cucumber, prevalence was 6% (6 of 100 samples) and 3% (3 of 100 samples) for L. monocytogenes and E. coli O157:H7, respectively. The levels derived from the presence-absence data using Bayesian modeling were estimated at 0.12 CFU/25 g (0.06 to 0.20) and 0.09 CFU/25 g (0.04 to 0.170) for L. monocytogenes in rocket and cucumber samples, respectively. The corresponding values for E. coli O157:H7 were 0.59 CFU/25 g (0.43 to 0.78) and 1.78 CFU/25 g (1.38 to 2.24), respectively. The sensitivity and specificity of the culture media differed for rocket and cucumber samples. The ELISA technique had a high level of cross-reactivity. Parallel testing with at least two culture media was required to achieve a reliable result for L. monocytogenes or E. coli O157:H7 prevalence in rocket and cucumber samples.

  17. The metabolic regulator CodY links L. monocytogenes metabolism to virulence by directly activating the virulence regulatory gene, prfA

    Science.gov (United States)

    Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.

    2015-01-01

    Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920

  18. MS2 bacteriophage as a delivery vessel of porphyrins for photodynamic therapy

    Science.gov (United States)

    Cohen, Brian A.; Kaloyeros, Alain E.; Bergkvist, Magnus

    2011-02-01

    Challenges associated with photodynamic therapy (PDT) include the packaging and site-specific delivery of therapeutic agents to the tissue of interest. Nanoscale encapsulation of PDT agents inside targeted virus capsids is a novel concept for packaging and site-specific targeting. The icosahedral MS2 bacteriophage is one potential candidate for such a packaging-system. MS2 has a porous capsid with an exterior diameter of ~28 nm where the pores allow small molecules access to the capsid interior. Furthermore, MS2 presents suitable residues on the exterior capsid for conjugation of targeting ligands. Initial work by the present investigators has successfully demonstrated RNA-based self-packaging of a heterocyclic PDT agent (meso-tetrakis(para-N-trimethylanilinium)porphine, TMAP) into the MS2 capsid. Packaging photoactive compounds in confined spaces could result in energy transfer between the molecules upon photoactivation, which could in turn reduce the production of radical oxygen species (ROS). ROS are key components in photodynamic therapy, and a reduced production could negatively impact the efficacy of PDT treatment. Here, findings are presented from an investigation of ROS generation of TMAP encapsulated within the MS2 capsid compared to free TMAP in solution. Monitoring of ROS production upon photoactivation via a specific singlet oxygen assay revealed the impact on ROS generation between packaged porphyrins as compared to free porphyrin in an aqueous solution. Follow on work will study the ability of MS2-packaged porphyrins to generate ROS in vitro and subsequent cytotoxic effects on cells in culture.

  19. Analysis of Transcriptional Signatures in Response to Listeria monocytogenes Infection Reveals Temporal Changes That Result from Type I Interferon Signaling

    Science.gov (United States)

    Potempa, Krzysztof; Graham, Christine M.; Moreira-Teixeira, Lucia; McNab, Finlay W.; Howes, Ashleigh; Stavropoulos, Evangelos; Pascual, Virginia; Banchereau, Jacques; Chaussabel, Damien; O’Garra, Anne

    2016-01-01

    Analysis of the mouse transcriptional response to Listeria monocytogenes infection reveals that a large set of genes are perturbed in both blood and tissue and that these transcriptional responses are enriched for pathways of the immune response. Further we identified enrichment for both type I and type II interferon (IFN) signaling molecules in the blood and tissues upon infection. Since type I IFN signaling has been reported widely to impair bacterial clearance we examined gene expression from blood and tissues of wild type (WT) and type I IFNαβ receptor-deficient (Ifnar1-/-) mice at the basal level and upon infection with L. monocytogenes. Measurement of the fold change response upon infection in the absence of type I IFN signaling demonstrated an upregulation of specific genes at day 1 post infection. A less marked reduction of the global gene expression signature in blood or tissues from infected Ifnar1-/- as compared to WT mice was observed at days 2 and 3 after infection, with marked reduction in key genes such as Oasg1 and Stat2. Moreover, on in depth analysis, changes in gene expression in uninfected mice of key IFN regulatory genes including Irf9, Irf7, Stat1 and others were identified, and although induced by an equivalent degree upon infection this resulted in significantly lower final gene expression levels upon infection of Ifnar1-/- mice. These data highlight how dysregulation of this network in the steady state and temporally upon infection may determine the outcome of this bacterial infection and how basal levels of type I IFN-inducible genes may perturb an optimal host immune response to control intracellular bacterial infections such as L. monocytogenes. PMID:26918359

  20. Bacteriophage and lytic enzymes - can they help us in the war with antibiotic resistant bacteria

    International Nuclear Information System (INIS)

    Trudil, D.; Rainina, E.

    2009-01-01

    Drug-resistant pathogens are a growing menace to all people, regardless of age, or socioeconomic background. They endanger people industrial societies like the United States, as well as in less developed nations and are even causing problems in military field hospitals. From Streptococcus pneumoniae to Staphylococcus, C. difficile, and multidrug-resistant TB, the list is growing. The threat of engineered microorganisms further complicates the interaction between man and Mother Nature. Additionally, although antibiotics were specifically designed for treating human health emergencies, their use for raising livestock animals has expanded. In the US, large amounts of antibiotics are routinely mixed into feed in order to promote growth rather than combat disease and as prophylactic treatment to offset unnatural diets and unhealthy living conditions. U.S.-raised animals in the 1950s received 2 million pounds per year of antibiotics in their feed compared to 50 million pounds today-a 2,500-percent increase. A large percentage of these drugs pass into the environment. In fact, prior to 1995, when fluoroquinolones were first approved to treat poultry, very few fluoroquinolone-resistant Campylobacter were found in people with foodborne diseases in the United States. After the approval, however, many more fluoroquinolone-resistant bacteria were found in humans and in poultry from slaughter plants and retail stores. The threat to our food supply becomes a threat to security. What can be done? One approach is to treat bacterial diseases by the use of bacteriophages. Phages are very small viruses that destroy by lysing select bacteria. The idea of using phage as a therapy for infectious bacterial diseases was first proposed by d'Herelle around World War I and over 80 years bacteriophage has been a key tool of healthcare professionals within Eastern Europe. More recently professionals in the USA and Western Europe have isolated and developed specific lytic components which have

  1. Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente

    Directory of Open Access Journals (Sweden)

    Kirvis Torres

    2005-05-01

    Full Text Available Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los marcadores devirulencia de este microorganismo, la biología celular de las interacciones de los marcadores de virulenciacon los receptores de la célula hospedero, el citoesqueleto, las vías de transducción de señales y losmecanismos de inmunidad mediada por células del hospedero. El propósito de esta revisión es describiralgunas características taxonómicas y filogenéticas de Listeria monocytogenes , la incidencia humana yanimal de varios serotipos, la fisiopatología de la infección , modelos animales y de cultivo celular utilizadospara estudios de virulencia, las poblaciones de riesgo, manifestaciones clínicas de listeriosis humana yanimal, el tratamiento, la organización genética y evolución de los determinantes de virulencia, losmecanismos empleados para interactuar con la célula hospedera, y los mecanismos para escapar de losprocesos de muerte celular y pasar de una célula infectada a otra. La información recopilada resulta degran importancia para el personal de salud, industria, consumidores y población de riesgo; razón por lacual Listeria monocytogenes es un patógeno que representa una amenaza para la salud pública mundial.

  2. Control of Listeria monocytogenes in food production plants

    Directory of Open Access Journals (Sweden)

    Dimitrijević Mirjana

    2008-01-01

    Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

  3. Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

    Science.gov (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

    2017-12-01

    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Complete genome sequence of the Pectobacterium carotovorum subsp. carotovorum virulent bacteriophage PM1.

    Science.gov (United States)

    Lim, Jeong-A; Shin, Hakdong; Lee, Dong Hwan; Han, Sang-Wook; Lee, Ju-Hoon; Ryu, Sangryeol; Heu, Sunggi

    2014-08-01

    PM1, a novel virulent bacteriophage that infects Pectobacterium carotovorum subsp. carotovorum, was isolated. Its morphological features were examined by electron microscopy, which indicated that this phage belongs to the family Myoviridae. It has a 55,098-bp genome, including a 2,665-bp terminal repeat. A total of 63 open reading frames (ORFs) were predicted, but only 20 ORFs possessed homology with functional proteins. There is one tRNA coding region, and the GC-content of the genome is 44.9 %. Most ORFs in bacteriophage PM1 showed high homology to enterobacteria phage ΦEcoM-GJ1 and Erwinia phage νB EamM-Y2. Like these bacteriophages, PM1 encodes an RNA polymerase, which is a hallmark of T7-like phages. There is no integrase or repressor, suggesting that PM1 is a virulent bacteriophage.

  5. 76 FR 66187 - Bacteriophage of Clavibacter Michiganensis Subspecies Michiganensis; Exemption From the...

    Science.gov (United States)

    2011-10-26

    ... history of bacteriophage laboratory and pesticidal usage, adverse reports in the literature have not been... cheese factory in Argentina. Journal of Dairy Science 89:3791-3799. 19. Guillaumes J, Houdeau G, Germain...

  6. Activity of Bacteriophages in Removing Biofilms of Pseudomonas aeruginosa Isolates from Chronic Rhinosinusitis Patients

    NARCIS (Netherlands)

    Fong, Stephanie A.; Drilling, Amanda; Morales, Sandra; Cornet, Marjolein E.; Woodworth, Bradford A.; Fokkens, Wytske J.; Psaltis, Alkis J.; Vreugde, Sarah; Wormald, Peter-John

    2017-01-01

    Introduction:Pseudomonas aeruginosa infections are prevalent amongst chronic rhinosinusitis (CRS) sufferers. Many P. aeruginosa strains form biofilms, leading to treatment failure. Lytic bacteriophages (phages) are viruses that infect, replicate within, and lyse bacteria, causing bacterial death.

  7. Pecularities of mutagenesis of T4Br bacteriophage under the direct and indirect radiation effects

    International Nuclear Information System (INIS)

    Yurov, S.S.

    1975-01-01

    Different lethal and mutagenic effects were shown when bacteriophage T4Br + (470 r/min) was irradiated in broth (direct effect) and a buffer solution (direct and indirect action). The survival rate of the bacteriophage in the buffer solution was 0.1 percent for a dose rate of 60 kr; in the broth it was 10 percent. The frequency of mutation of the bacteriophage also showed the greater effect of the irradiation in the buffer solution than in the broth (25 and 5 r-mutants respectively at a dose rate of 10 kr). An analysis of the ratio of the r-groups when the bacteriophage was treated in various ways revealed differences between mutagenesis produced in the broth and the buffer, and spontaneous mutagenesis. (V.A.P.)

  8. Improved bacteriophage genome data is necessary for integrating viral and bacterial ecology.

    Science.gov (United States)

    Bibby, Kyle

    2014-02-01

    The recent rise in "omics"-enabled approaches has lead to improved understanding in many areas of microbial ecology. However, despite the importance that viruses play in a broad microbial ecology context, viral ecology remains largely not integrated into high-throughput microbial ecology studies. A fundamental hindrance to the integration of viral ecology into omics-enabled microbial ecology studies is the lack of suitable reference bacteriophage genomes in reference databases-currently, only 0.001% of bacteriophage diversity is represented in genome sequence databases. This commentary serves to highlight this issue and to promote bacteriophage genome sequencing as a valuable scientific undertaking to both better understand bacteriophage diversity and move towards a more holistic view of microbial ecology.

  9. BRED: a simple and powerful tool for constructing mutant and recombinant bacteriophage genomes.

    Directory of Open Access Journals (Sweden)

    Laura J Marinelli

    Full Text Available Advances in DNA sequencing technology have facilitated the determination of hundreds of complete genome sequences both for bacteria and their bacteriophages. Some of these bacteria have well-developed and facile genetic systems for constructing mutants to determine gene function, and recombineering is a particularly effective tool. However, generally applicable methods for constructing defined mutants of bacteriophages are poorly developed, in part because of the inability to use selectable markers such as drug resistance genes during viral lytic growth. Here we describe a method for simple and effective directed mutagenesis of bacteriophage genomes using Bacteriophage Recombineering of Electroporated DNA (BRED, in which a highly efficient recombineering system is utilized directly on electroporated phage DNA; no selection is required and mutants can be readily detected by PCR. We describe the use of BRED to construct unmarked gene deletions, in-frame internal deletions, base substitutions, precise gene replacements, and the addition of gene tags.

  10. Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

    International Nuclear Information System (INIS)

    Chu, F.K.; Maley, F.; Martinez, J.; Maley, G.F.

    1987-01-01

    Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α- 32 P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns

  11. Listeria monocytogenes HAZARD MANAGEMENT IN A TYPICAL PRODUCT: THE CIAUSCOLO

    Directory of Open Access Journals (Sweden)

    S Fisichella

    2013-02-01

    Full Text Available The aim of the present study is to investigate operative procedures that allow to minimize Listeria monocytogenes (L. m. hazard in the main traditional sausage of the internal areas of Marche (Italy: the Ciauscolo, that has received the quality trademark PGI. It is made from lean cuts of well mature pork that is finely minced, adding fat which give the salami his characteristic softness and flavour. It is characterized by having a very little maturing period that determine high aw levels and, for this peculiarity, it allows L. m development.

  12. Thermal resistance of Listeria monocytogenes in sausage meat.

    Science.gov (United States)

    Farber, J M; Hughes, A; Holley, R; Brown, B

    1989-01-01

    The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.

  13. [Listeria monocytogenes nosocomial infection in the maternity ward].

    Science.gov (United States)

    Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P

    1991-01-01

    Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.

  14. Genetic diversity among five T4-like bacteriophages

    Directory of Open Access Journals (Sweden)

    Bertrand Claire

    2006-05-01

    Full Text Available Abstract Background Bacteriophages are an important repository of genetic diversity. As one of the major constituents of terrestrial biomass, they exert profound effects on the earth's ecology and microbial evolution by mediating horizontal gene transfer between bacteria and controlling their growth. Only limited genomic sequence data are currently available for phages but even this reveals an overwhelming diversity in their gene sequences and genomes. The contribution of the T4-like phages to this overall phage diversity is difficult to assess, since only a few examples of complete genome sequence exist for these phages. Our analysis of five T4-like genomes represents half of the known T4-like genomes in GenBank. Results Here, we have examined in detail the genetic diversity of the genomes of five relatives of bacteriophage T4: the Escherichia coli phages RB43, RB49 and RB69, the Aeromonas salmonicida phage 44RR2.8t (or 44RR and the Aeromonas hydrophila phage Aeh1. Our data define a core set of conserved genes common to these genomes as well as hundreds of additional open reading frames (ORFs that are nonconserved. Although some of these ORFs resemble known genes from bacterial hosts or other phages, most show no significant similarity to any known sequence in the databases. The five genomes analyzed here all have similarities in gene regulation to T4. Sequence motifs resembling T4 early and late consensus promoters were observed in all five genomes. In contrast, only two of these genomes, RB69 and 44RR, showed similarities to T4 middle-mode promoter sequences and to the T4 motA gene product required for their recognition. In addition, we observed that each phage differed in the number and assortment of putative genes encoding host-like metabolic enzymes, tRNA species, and homing endonucleases. Conclusion Our observations suggest that evolution of the T4-like phages has drawn on a highly diverged pool of genes in the microbial world. The T4

  15. Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Propage in B. pseudomallei 1026b

    National Research Council Canada - National Science Library

    DeShazer, David

    2004-01-01

    .... pseudomallei, 1026b and K96243. Numerous mobile genetic elements, including a temperate bacteriophage designated phi1026b, were identified among the 1026b-specific suppression subtractive hybridization products...

  16. Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

    Science.gov (United States)

    Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

    2015-11-09

    Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

  17. Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

    Science.gov (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

    2017-11-01

    Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

  18. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

    Science.gov (United States)

    Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

    2011-06-01

    This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

  19. Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

    Science.gov (United States)

    Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

    2013-02-01

    This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

  20. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

    Science.gov (United States)

    Alali, Walid Q; Schaffner, Donald W

    2013-07-01

    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  1. Isolation of Dickeya dadantii strains from potato disease and biocontrol by their bacteriophages

    Directory of Open Access Journals (Sweden)

    Abbas Soleimani-Delfan

    2015-09-01

    Full Text Available One of the most economically important bacterial pathogens of plants and plant products is Dickeya dadantii. This bacterium causes soft rot disease in tubers and other parts of the potato and other plants of the Solanaceae family. The application of restricted host range bacteriophages as biocontrol agents has recently gained widespread interest. This study purposed to isolate the infectious agent of the potato and evaluate its biocontrol by bacteriophages. Two phytopathogenic strains were isolated from infected potatoes, identified based on biochemical and 16S rRNA gene sequencing, and submitted to GenBank as D. dadantii strain pis3 (accession no. HQ423668 and D. dadantii strain sip4 (accession no. HQ423669. Their bacteriophages were isolated from Caspian Sea water by enriching the water filtrate with D. dadantii strains as hosts using spot or overlay methods. On the basis of morphotypes, the isolated bacteriophages were identified as members of the Myoviridae and Siphoviridae families and could inhibit the growth of antibiotic resistant D. dadantii strains in culture medium. Moreover, in Dickeya infected plants treated with bacteriophage, no disease progression was detected. No significant difference was seen between phage-treated and control plants. Thus, isolated bacteriophages can be suggested for the biocontrol of plant disease caused by Dickeya strains.

  2. Identification and Characterization of T5-Like Bacteriophages Representing Two Novel Subgroups from Food Products

    Directory of Open Access Journals (Sweden)

    Domonkos Sváb

    2018-02-01

    Full Text Available During recent years, interest in the use of bacteriophages as biocontrol agents against foodborne pathogens has increased, particularly for members of the family Enterobacteriaceae, with pathogenic Escherichia coli, Shigella, and Salmonella strains among them. Here, we report the isolation and characterisation of 12 novel T5-like bacteriophages from confiscated food samples. All bacterophages effectively lysed E. coli K-12 strains and were able to infect pathogenic E. coli strains representing enterohaemorrhagic (EHEC, enteropathogenic (EPEC, enterotoxigenic (ETEC, and enteroinvasive (EIEC pathotypes, Shigella dysenteriae, S. sonnei strains, as well as multidrug-resistant (MDR E. coli and multiple strains representing different Salmonella enterica serovars. All the bacteriophages exhibited Siphoviridae morphology. Whole genome sequencing of the novel T5-like bacteriophages showed that they represent two distinct groups, with the genome-based grouping correlating to the different host spectra. As these bacteriophages are of food origin, their stability and lack of any virulence genes, as well as their broad and mutually complementary host spectrum makes these new T5-like bacteriophages valuable candidates for use as biocontrol agents against foodborne pathogenic enterobacteria.

  3. [Determination of Azospirillum Brasilense Cells With Bacteriophages via Electrooptical Analysis of Microbial Suspensions].

    Science.gov (United States)

    Gulii, O I; Karavayeva, O A; Pavlii, S A; Sokolov, O I; Bunin, V D; Ignatov, O V

    2015-01-01

    The dependence-of changes in the electrooptical properties of Azospirillum brasilense cell suspension Sp7 during interaction with bacteriophage ΦAb-Sp7 on the number and time of interactions was studied. Incubation of cells with bacteriophage significantly changed the electrooptical signal within one minute. The selective effect of bacteriophage ΦAb on 18 strains of bacteria of the genus Azospirillum was studied: A. amazonense Ami4, A. brasilense Sp7, Cd, Sp107, Sp245, Jm6B2, Brl4, KR77, S17, S27, SR55, SR75, A. halopraeferans Au4, A. irakense KBC1, K A3, A. lipoferum Sp59b, SR65 and RG20a. We determined the limit of reliable determination of microbial cells infected with bacteriophage: - 10(4) cells/mL. The presence of foreign cell cultures of E. coli B-878 and E. coli XL-1 did not complicate the detection of A brasilense Sp7 cells with the use of bacteriophage ΦAb-Sp7. The results demonstrated that bacteriophage (ΦAb-Sp7 can be used for the detection of Azospirillum microbial cells via t electrooptical analysis of cell suspensions.

  4. Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions

    Directory of Open Access Journals (Sweden)

    Changyong Cheng

    2017-06-01

    Full Text Available Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the ΔtrxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA, and plcB. Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a

  5. Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions.

    Science.gov (United States)

    Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui

    2017-01-01

    Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for

  6. Lethal and Mutagenic Effects of Tritium Decay Produced by Tritiated Compounds Incorporated into Bacteria and Bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Person, S. [Pennsylvania State University, University Park, PA (United States)

    1968-06-15

    The work discussed below is predominantly from the author's laboratory. Some effects of tritium decay on bacteria and bacteriophages, using labelled compounds that are incorporated preferentially into DNA, RNA or protein, have been studied. A relatively high killing efficiency, the probability that a single decay produces loss of colony-forming ability in bacteria or loss of plaque-forming ability in bacteriophages, is observed for thymidine- methyl-{sup 3}H decay, but this is thought to be due to S-particle ionization damage. The most definitive experiments involved a comparison of killing efficiencies for decays originating as thymidine-methyl-{sup 3}H in phage DNA and as amino acid-{sup 3}H in phage protein with the calculated {beta}-particle path length through, the DNA in the two cases. Experimental and calculated values are essentially the same. Radiation-dose calculations to many different bacterial sub-volumes were determined for several different distributions of radioactivity. The high killing efficiency for thymidine-methyl- {sup 3}H decay can be explained by {beta}-particle ionizations, providing DNA is the sensitive target molecule and it is organized in a central volume of the cell (see also Ref.[24]). Although both the lethal and mutagenic effect of thymidine-methyl-{sup 3}H and amino acid-{sup 3}H decays can readily be explained on the basis of {beta}-particle ionizations, the observed large mutation frequency produced by uracil-5{sup 3}H decay cannot. The majority of mutations produced by uracil-5{sup 3}H decays are due to a specific chemical rearrangement of the parent molecule, since decays from uracil-6{sup 3}H are 6 to 7-fold less mutagenic. It is clear that the decays leading to mutations for cells labelled with uracil-5{sup 3}H originate as cytosine-5{sup 3}H in bacterial DNA. Recent work shows that the specific chemical rearrangement causes a C --> T(u) genetic coding change. (author)

  7. Double resonance long period fiber grating for detection of E. coli in trace concentration by choosing a proper bacteriophage

    Science.gov (United States)

    Chiniforooshan, Y.; Celebanska, A.; Janik, M.; Mikulic, P.; Haddad, F.; Perreault, J.; Bock, W. J.

    2017-04-01

    There is a critical need of a fast, specific and reliable assay for biological species. To address this need, long period fiber gratings (LPFG) among other fiber optic sensors can be used because of their high sensitivity to changes in surrounding medium. In this work we fabricated and used two over-etched LPFGs. One of them was covered with T4 Phage and the other was covered with MS2 phage that both specifically bind with Escherichia coli (E. coli) bacteria. This bacterium is a major cause of the food contaminations and outbreaks. We showed achieving a highest sensitivity region of the LPFG and the way to fine tune to that region by over-etching the grating. Finally, using the highly sensitive LPFG platform we could detect E. coli at concentrations as low as 100 colony forming units (CFU), by covering the LPFG with an optimized bio-functionalization of the fiber surface with MS2 bacteriophage.

  8. Biodiversity of Lactobacillus helveticus bacteriophages isolated from cheese whey starters.

    Science.gov (United States)

    Zago, Miriam; Bonvini, Barbara; Rossetti, Lia; Meucci, Aurora; Giraffa, Giorgio; Carminati, Domenico

    2015-05-01

    Twenty-one Lactobacillus helveticus bacteriophages, 18 isolated from different cheese whey starters and three from CNRZ collection, were phenotypically and genetically characterised. A biodiversity between phages was evidenced both by host range and molecular (RAPD-PCR) typing. A more detailed characterisation of six phages showed similar structural protein profiles and a relevant genetic biodiversity, as shown by restriction enzyme analysis of total DNA. Latent period, burst time and burst size data evidenced that phages were active and virulent. Overall, data highlighted the biodiversity of Lb. helveticus phages isolated from cheese whey starters, which were confirmed to be one of the most common phage contamination source in dairy factories. More research is required to further unravel the ecological role of Lb. helveticus phages and to evaluate their impact on the dairy fermentation processes where whey starter cultures are used.

  9. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  10. The oxygen effect in bacteriophages irradiated in different media. 1

    International Nuclear Information System (INIS)

    Korystov, Yu.N.; Veksler, F.B.

    1983-01-01

    The oxygen effect (OE) on bacteriophage T4 in a salt solution was studied. It is shown that the sign and magnitude of OE depend on the conditions of the postirradiation incubation of the phage in irradiated medium. The direct OE is due to postirradiation lesion of the phage by hydrogen peroxide which is formed in greater amounts after irradiation in oxygen than in anoxia. The addition of catalase is shown to eliminate the postirradiation inactivation of the phage. In this case an opposite OE is observed. The mechanism of this effect is a scavenge of hydrogen atoms which damage the phage by oxygen. In the presence of catalase the OE depends also on pH of the solution. It is suggested that the hydroxyl radical arising from the reaction of H 2 O 2 with Fe 2+ is responsible for the damaging effect of H 2 O 2 . (author)

  11. Bacteriophage-Derived Peptidase CHAPK Eliminates and Prevents Staphylococcal Biofilms

    Directory of Open Access Journals (Sweden)

    Mark Fenton

    2013-01-01

    Full Text Available New antibacterial agents are urgently needed for the elimination of biofilm-forming bacteria that are highly resistant to traditional antimicrobial agents. Proliferation of such bacteria can lead to significant economic losses in the agri-food sector. This study demonstrates the potential of the bacteriophage-derived peptidase, CHAPK, as a biocidal agent for the rapid disruption of biofilm-forming staphylococci, commonly associated with bovine mastitis. Purified CHAPK applied to biofilms of Staphylococcus aureus DPC5246 completely eliminated the staphylococcal biofilms within 4 h. In addition, CHAPK was able to prevent biofilm formation by this strain. The CHAPK lysin also reduced S. aureus in a skin decolonization model. Our data demonstrates the potential of CHAPK as a biocidal agent for prevention and treatment of biofilm-associated staphylococcal infections or as a decontaminating agent in the food and healthcare sectors.

  12. Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

    Science.gov (United States)

    Lee, Yuejia; Wang, Chinling

    2017-03-01

    Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

  13. Impacts of Antibiotic and Bacteriophage Treatments on the Gut-Symbiont-Associated Blissus insularis (Hemiptera: Blissidae

    Directory of Open Access Journals (Sweden)

    Yao Xu

    2016-11-01

    Full Text Available The Southern chinch bug, Blissus insularis, possesses specialized midgut crypts that harbor dense populations of the exocellular symbiont Burkholderia. Oral administration of antibiotics suppressed the gut symbionts in B. insularis and negatively impacted insect host fitness, as reflected by retarded development, smaller body size, and higher susceptibility to an insecticide, bifenthrin. Considering that the antibiotics probably had non-lethal but toxic effects on host fitness, attempts were conducted to reduce gut symbionts using bacteriophage treatment. Soil-lytic phages active against the cultures of specific Burkholderia ribotypes were successfully isolated using a soil enrichment protocol. Characterization of the BiBurk16MC_R phage determined its specificity to the Bi16MC_R_vitro ribotype and placed it within the family Podoviridae. Oral administration of phages to fifth-instar B. insularis, inoculated with Bi16MC_R_vitro as neonates had no deleterious effects on host fitness. However, the ingested phages failed to impact the crypt-associated Burkholderia. The observed inactivity of the phage was likely due to the blockage of the connection between the anterior and posterior midgut regions. These findings suggest that the initial colonization by Burkholderia programs the ontogeny of the midgut, providing a sheltered residence protected from microbial antagonists.

  14. Use of a bacteriophage lysin to identify a novel target for antimicrobial development.

    Directory of Open Access Journals (Sweden)

    Raymond Schuch

    Full Text Available We identified an essential cell wall biosynthetic enzyme in Bacillus anthracis and an inhibitor thereof to which the organism did not spontaneously evolve measurable resistance. This work is based on the exquisite binding specificity of bacteriophage-encoded cell wall-hydrolytic lysins, which have evolved to recognize critical receptors within the bacterial cell wall. Focusing on the B. anthracis-specific PlyG lysin, we first identified its unique cell wall receptor and cognate biosynthetic pathway. Within this pathway, one biosynthetic enzyme, 2-epimerase, was required for both PlyG receptor expression and bacterial growth. The 2-epimerase was used to design a small-molecule inhibitor, epimerox. Epimerox prevented growth of several Gram-positive pathogens and rescued mice challenged with lethal doses of B. anthracis. Importantly, resistance to epimerox was not detected (<10(-11 frequency in B. anthracis and S. aureus. These results describe the use of phage lysins to identify promising lead molecules with reduced resistance potential for antimicrobial development.

  15. Review: elimination of bacteriophages in whey and whey products

    Directory of Open Access Journals (Sweden)

    Zeynep eAtamer

    2013-07-01

    Full Text Available As the cheese market faces strong international competition, the optimization of production processes becomes more important for the economic success of dairy companies. In dairy productions, whey from former cheese batches is frequently re-used to increase the yield, to improve the texture and to increase the nutrient value of the final product. Recycling of whey cream and particulated whey proteins is also routinely performed. Most bacteriophages, however, survive pasteurization and may re-enter the cheese manufacturing process. There is a risk that phages multiply to high numbers during the production. Contamination of whey samples with bacteriophages may cause problems in cheese factories because whey separation often leads to aerosol-borne phages and thus contamination of the factory environment. Furthermore, whey cream or whey proteins used for recycling into cheese matrices may contain thermo-resistant phages. Drained cheese whey can be contaminated with phages as high as 109 phages per mL. When whey batches are concentrated, phage titers can increase significantly by a factor of 10 hindering a complete elimination of phages. To eliminate the risk of fermentation failure during recycling of whey, whey treatments assuring an efficient reduction of phages are indispensable. This review focuses on inactivation of phages in whey by thermal treatment, ultraviolet (UV light irradiation and membrane filtration. Inactivation by heat is the most common procedure. However, application of heat for inactivation of thermo-resistant phages in whey is restricted due to negative effects on the functional properties of native whey proteins. Therefore an alternative strategy applying combined treatments should be favoured - rather than heating the dairy product at extreme temperature/time combinations. By using membrane filtration or UV treatment in combination with thermal treatment, phage numbers in whey can be reduced sufficiently to prevent subsequent

  16. Review: elimination of bacteriophages in whey and whey products

    Science.gov (United States)

    Atamer, Zeynep; Samtlebe, Meike; Neve, Horst; J. Heller, Knut; Hinrichs, Joerg

    2013-01-01

    As the cheese market faces strong international competition, the optimization of production processes becomes more important for the economic success of dairy companies. In dairy productions, whey from former cheese batches is frequently re-used to increase the yield, to improve the texture and to increase the nutrient value of the final product. Recycling of whey cream and particulated whey proteins is also routinely performed. Most bacteriophages, however, survive pasteurization and may re-enter the cheese manufacturing process. There is a risk that phages multiply to high numbers during the production. Contamination of whey samples with bacteriophages may cause problems in cheese factories because whey separation often leads to aerosol-borne phages and thus contamination of the factory environment. Furthermore, whey cream or whey proteins used for recycling into cheese matrices may contain thermo-resistant phages. Drained cheese whey can be contaminated with phages as high as 109 phages mL-1. When whey batches are concentrated, phage titers can increase significantly by a factor of 10 hindering a complete elimination of phages. To eliminate the risk of fermentation failure during recycling of whey, whey treatments assuring an efficient reduction of phages are indispensable. This review focuses on inactivation of phages in whey by thermal treatment, ultraviolet (UV) light irradiation, and membrane filtration. Inactivation by heat is the most common procedure. However, application of heat for inactivation of thermo-resistant phages in whey is restricted due to negative effects on the functional properties of native whey proteins. Therefore an alternative strategy applying combined treatments should be favored – rather than heating the dairy product at extreme temperature/time combinations. By using membrane filtration or UV treatment in combination with thermal treatment, phage numbers in whey can be reduced sufficiently to prevent subsequent phage accumulations

  17. Bacteriophage and their potential roles in the human oral cavity

    Directory of Open Access Journals (Sweden)

    Anna Edlund

    2015-04-01

    Full Text Available The human oral cavity provides the perfect portal of entry for viruses and bacteria in the environment to access new hosts. Hence, the oral cavity is one of the most densely populated habitats of the human body containing some 6 billion bacteria and potentially 35 times that many viruses. The role of these viral communities remains unclear; however, many are bacteriophage that may have active roles in shaping the ecology of oral bacterial communities. Other implications for the presence of such vast oral phage communities include accelerating the molecular diversity of their bacterial hosts as both host and phage mutate to gain evolutionary advantages. Additional roles include the acquisitions of new gene functions through lysogenic conversions that may provide selective advantages to host bacteria in response to antibiotics or other types of disturbances, and protection of the human host from invading pathogens by binding to and preventing pathogens from crossing oral mucosal barriers. Recent evidence suggests that phage may be more involved in periodontal diseases than were previously thought, as their compositions in the subgingival crevice in moderate to severe periodontitis are known to be significantly altered. However, it is unclear to what extent they contribute to dysbiosis or the transition of the microbial community into a state promoting oral disease. Bacteriophage communities are distinct in saliva compared to sub- and supragingival areas, suggesting that different oral biogeographic niches have unique phage ecology shaping their bacterial biota. In this review, we summarize what is known about phage communities in the oral cavity, the possible contributions of phage in shaping oral bacterial ecology, and the risks to public health oral phage may pose through their potential to spread antibiotic resistance gene functions to close contacts.

  18. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  19. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba

    2013-09-01

    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  20. Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia.

    Science.gov (United States)

    Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S

    2013-06-01

    A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

  1. Flagellar motility is critical for Listeria monocytogenes biofilm formation.

    Science.gov (United States)

    Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

    2007-06-01

    The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

  2. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

    Science.gov (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

    2012-01-01

    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

  3. ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS

    Directory of Open Access Journals (Sweden)

    T. K. CABEÇA

    2008-12-01

    Full Text Available

    The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

  4. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  5. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes Isolates

    Directory of Open Access Journals (Sweden)

    Ozbey Gokben

    2006-06-01

    Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.

  6. Detección de Listeria spp. y Listeria monocytogenes en muestras de leche cruda y quesos artesanales respectivamente, mediante PCR en Tiempo Real

    Directory of Open Access Journals (Sweden)

    Viviana Pamela Chiluisa-Utreras

    2017-07-01

    Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples

  7. Comparison of public health impact of Listeria monocytogenes product-to-product and environment-to-product contamination of deli meats at retail.

    Science.gov (United States)

    Pradhan, Abani K; Ivanek, Renata; Gröhn, Yrjö T; Bukowski, Robert; Wiedmann, Martin

    2011-11-01

    This study compared the relative public health impact in deli meats at retail contaminated with Listeria monocytogenes by either (i) other products or (ii) the retail environment. Modeling was performed using the risk of listeriosis-associated deaths as a public health outcome of interest and using two deli meat products (i.e., ham and turkey, both formulated without growth inhibitors) as model systems. Based on reported data, deli meats coming to retail were assumed to be contaminated at a frequency of 0.4%. Three contamination scenarios were investigated: (i) a baseline scenario, in which no additional cross-contamination occurred at retail, (ii) a scenario in which an additional 2.3% of products were cross-contaminated at retail due to transfer of L. monocytogenes cells from already contaminated ready-to-eat deli meats, and (iii) a scenario in which an additional 2.3% of products were contaminated as a result of cross-contamination from a contaminated retail environment. By using a previously reported L. monocytogenes risk assessment model that uses product-specific growth kinetic parameters, cross-contamination of deli ham and turkey was estimated to increase the relative risk of listeriosis-associated deaths by 5.9- and 6.1-fold, respectively, for contamination from other products and by 4.9- and 5.8-fold, respectively, for contamination from the retail environment. Sensitivity and scenario analyses indicated that the frequency of cross-contamination at retail from any source (other food products or environment) was the most important factor affecting the relative risk of listeriosis-associated deaths. Overall, our data indicate that retail-level cross-contamination of ready-to-eat deli meats with L. monocytogenes has the potential to considerably increase the risk of human listeriosis cases and deaths, and thus precise estimates of cross-contamination frequency are critical for accurate risk assessments.

  8. Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

    Science.gov (United States)

    Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

    2007-10-01

    To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

  9. Evaluation of Anti- Bacteriophage as Feed Additives to Prevent (SE in Broiler

    Directory of Open Access Journals (Sweden)

    K. H. Kim

    2013-03-01

    Full Text Available This experiment was conducted to evaluate anti-Salmonella enteritidis (anti-SE bacteriophage as feed additives to prevent Salmonella enteritidis in broilers. The experimental diets were formulated for 2 phases feeding trial, and 3 different levels (0.05, 0.1 and 0.2% of anti-SE bacteriophage were supplemented in basal diet. The basal diet was regarded as the control treatment. A total of 320 1-d-old male broilers (Ross 308 were allotted by randomized complete block (RCB design in 8 replicates with 10 chicks per pen. All birds were raised on rice hull bedding in ambient controlled environment and free access to feed and water. There were no significant differences in body weight gain, feed intake and feed conversion ratio (FCR at terminal period among treatments (p>0.05. Relative weights of liver, spleen, abdominal fat and tissue muscle of breast obtained from each anti-SE bacteriophage treatment were similar to control, with a slightly higher value in anti-SE bacteriophage 0.2%. In addition, a numerical difference of glutamic-oxaloacetic transaminase (GOT, glutamic-pyruvic transaminase (GPT and LDL cholesterol level was observed in the 0.2% anti-SE bacteriophage application even though blood profiles were not significantly affected by supplemented levels of anti-SE bacteriophage (p>0.05. In the result of a 14 d record after Salmonella enteritidis challenge of 160 birds from 4 previous treatments, mortality was linearly decreased with increasing anti-SE bacteriophage level (p<0.05, and Salmonella enteritidis concentration in the cecum was decreased with increasing levels of anti-SE bacteriophage (p<0.05. Based on the results of this study, it is considered that supplementation of 0.2% anti-SE bacteriophage may not cause any negative effect on growth, meat production, and it reduces mortality after Salmonella enteritidis challenge. These results imply to a possible use of anti-SE bacteriophage as an alternative feed additive instead of antibiotics

  10. Lactococcus bacteriophages isolated from whey and their effects on commercial lactic starters

    Directory of Open Access Journals (Sweden)

    Maria Raquel de Godoy Oriani

    2004-08-01

    Full Text Available The incidence of phages of lactic acid bacteria in milk industry and their effects on acidification ability of commercial lactic acid starters were studied. Cheese whey samples (33 samples were collected from 17 factories. A total of 16 bacteriophages were isolated (12 specific for Lactococcus lactis, 3 for L. diacetylactis and one capable of lysing both species. The results showed that 10% reduction in acidification tests was not good indication of phage in the sample. The majority of samples showed reduction higher than 10%, although only 65% were phage positive. The isolated phages were quite stable and showed no reduction in infectivity even after 20 daily replications. A pool of bacteriophages was prepared from isolates and inoculated in 12 commercial lactic starters. After 8 hours of incubation, only 2 showed reduced acidification. Bacterial strains isolated from commercial starters were tested regarding the phage resistance. Considerable difference in phage sensitivity was observed among different starters (BD, D, O and L. diacetylactis. Five bacteriophages showed no infectivity on any isolates but one was infective for most of isolates.Para ampliar conhecimentos sobre a incidência de bacteriófagos de bactérias lácticas na indústria de leite do Estado de São Paulo e a sua influência sobre a capacidade acidificante de fermentos lácticos disponíveis em nosso mercado, o presente trabalho foi conduzido com o intuito de esclarecer a real situação dos laticínios no Estado. Foram coletadas 33 amostras de soro de queijo em 17 laticínios. Foram isolados 16 bacteriófagos, 12 específicos para Lactococcus lactis, 3 para L. diacetylactis e um capaz de lisar ambos os microrganismos. Os experimentos mostraram que, uma diminuição de 10% na acidez em presença de soro suspeito, ao contrário do estabelecido na literatura, não reflete a veracidade da presença de bacteriófagos na amostra, uma vez que a maioria apresentou redução acima

  11. On the mutagenicity of homologous recombination and double-strand break repair in bacteriophage.

    Science.gov (United States)

    Shcherbakov, Victor P; Plugina, Lidiya; Shcherbakova, Tamara; Sizova, Svetlana; Kudryashova, Elena

    2011-01-02

    The double-strand break (DSB) repair via homologous recombination is generally construed as a high-fidelity process. However, some molecular genetic observations show that the recombination and the recombinational DSB repair may be mutagenic and even highly mutagenic. Here we developed an effective and precise method for studying the fidelity of DSB repair in vivo by combining DSBs produced site-specifically by the SegC endonuclease with the famous advantages of the recombination analysis of bacteriophage T4 rII mutants. The method is based on the comparison of the rate of reversion of rII mutation in the presence and in the absence of a DSB repair event initiated in the proximity of the mutation. We observed that DSB repair may moderately (up to 6-fold) increase the apparent reversion frequency, the effect of being dependent on the mutation structure. We also studied the effect of the T4 recombinase deficiency (amber mutation in the uvsX gene) on the fidelity of DSB repair. We observed that DSBs are still repaired via homologous recombination in the uvsX mutants, and the apparent fidelity of this repair is higher than that seen in the wild-type background. The mutator effect of the DSB repair may look unexpected given that most of the normal DNA synthesis in bacteriophage T4 is performed via a recombination-dependent replication (RDR) pathway, which is thought to be indistinguishable from DSB repair. There are three possible explanations for the observed mutagenicity of DSB repair: (1) the origin-dependent (early) DNA replication may be more accurate than the RDR; (2) the step of replication initiation may be more mutagenic than the process of elongation; and (3) the apparent mutagenicity may just reflect some non-randomness in the pool of replicating DNA, i.e., preferential replication of the sequences already involved in replication. We discuss the DSB repair pathway in the absence of UvsX recombinase. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Crystal structure of the bacteriophage Qβ coat protein in complex with the RNA operator of the replicase gene.

    Science.gov (United States)

    Rumnieks, Janis; Tars, Kaspars

    2014-03-06

    The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein-RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-