Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters
Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...
Directory of Open Access Journals (Sweden)
Daryl J. V. David
2017-07-01
Full Text Available The bacterial pathogen Listeria monocytogenes (Lm is the causative agent of listeriosis, a rare but fatal foodborne disease. During infection, Lm can traverse several host barriers and enter the cytosol of a variety of cell types. Thus, consideration of the extracellular and intracellular niches of Lm is critical for understanding the infection process. Here, we review advances in our understanding of Lm infection and highlight how the interactions between the host and the pathogen are context dependent. We discuss discoveries of how Lm senses entry into the host cell cytosol. We present findings concerning how the nature of the various cytoskeleton components subverted by Lm changes depending on both the stage of infection and the subcellular context. We present discoveries of critical components required for Lm traversal of physiological barriers. Interactions between the host gut microbiota and Lm will be briefly discussed. Finally, the importance of Lm biodiversity and post-genomics approaches as a promising way to discover novel virulence factors will be highlighted.
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50
Directory of Open Access Journals (Sweden)
Wufeng Fan
2017-01-01
Full Text Available In our study, we aimed to extract dysregulated pathways in human monocytes infected by Listeria monocytogenes (LM based on pathway interaction network (PIN which presented the functional dependency between pathways. After genes were aligned to the pathways, principal component analysis (PCA was used to calculate the pathway activity for each pathway, followed by detecting seed pathway. A PIN was constructed based on gene expression profile, protein-protein interactions (PPIs, and cellular pathways. Identifying dysregulated pathways from the PIN was performed relying on seed pathway and classification accuracy. To evaluate whether the PIN method was feasible or not, we compared the introduced method with standard network centrality measures. The pathway of RNA polymerase II pretranscription events was selected as the seed pathway. Taking this seed pathway as start, one pathway set (9 dysregulated pathways with AUC score of 1.00 was identified. Among the 5 hub pathways obtained using standard network centrality measures, 4 pathways were the common ones between the two methods. RNA polymerase II transcription and DNA replication owned a higher number of pathway genes and DEGs. These dysregulated pathways work together to influence the progression of LM infection, and they will be available as biomarkers to diagnose LM infection.
Review of Prosthetic Joint Infection from Listeria monocytogenes.
Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James
2016-12-01
Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection
Directory of Open Access Journals (Sweden)
Poyin Chen
2017-12-01
Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Deciphering the landscape of host barriers to Listeria monocytogenes infection.
Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K
2017-06-13
Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review
Directory of Open Access Journals (Sweden)
James C. Barton
2018-01-01
Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.
Immunohematopoietic modulation by oral β-1,3-glucan in mice infected with Listeria monocytogenes.
Torello, Cristiane O; de Souza Queiroz, Julia; Oliveira, Sueli C; Queiroz, Mary L S
2010-12-01
In this study we demonstrated that the oral administration of β-1,3-glucan (Imunoglucan®) protects mice from a lethal dose of Listeria monocytogenes (LM) when administered prophylactically for 10 days at the doses of 150 and 300 mg/kg, with survival rates up to 40%. These doses also prevented the myelosuppression and the splenomegaly caused by a sublethal infection with LM, due to increased numbers of granulocyte-macrophage progenitors (CFU-GM) in the bone marrow. Investigation of the production of colony-stimulating factors revealed an increased colony-stimulating activity (CSA) in the serum of infected mice pre-treated with Imunoglucan®. The treatment also restored the reduced ability of stromal cells to display myeloid progenitors in long-term bone marrow cultures (LTBMC) and up-regulated IL-6 and IL-1α production by these cells in the infected mice, which was consistent with higher number of non-adherent cells. Additional studies to investigate the levels of interferon-gamma (INF-γ) in the supernatant of splenocyte cultures demonstrated a further increase in the level of this cytokine in infected-treated mice, compared to infected controls. In all cases, no differences were observed between the responses of the two optimal biologically effective doses. In contrast, no significant changes were produced by the treatment with the 50mg/kg dose. In addition, no changes were observed in normal mice treated with the three doses used. All together our results suggest that orally given Imunoglucan® indirectly modulates immune activity and probably disengages Listeria induced suppression of these responses by inducing a higher reserve of myeloid progenitors in the bone marrow in consequence of biologically active cytokine release (CSFs, IL-1α, IL-6, and INF-γ). Copyright © 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin
2016-01-01
Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.
Shen, Hao; Slifka, Mark K.; Matloubian, Mehrdad; Jensen, Eric R.; Ahmed, Rafi; Miller, Jeff F.
1995-04-01
Listeria monocytogenes (LM) is a Gram-positive bacterium that is able to enter host cells, escape from the endocytic vesicle, multiply within the cytoplasm, and spread directly from cell to cell without encountering the extracellular milieu. The ability of LM to gain access to the host cell cytosol allows proteins secreted by the bacterium to efficiently enter the pathway for major histocompatibility complex class I antigen processing and presentation. We have established a genetic system for expression and secretion of foreign antigens by recombinant strains, based on stable site-specific integration of expression cassettes into the LM genome. The ability of LM recombinants to induce protective immunity against a heterologous pathogen was demonstrated with lymphocytic choriomeningitis virus (LCMV). LM strains expressing the entire LCMV nucleoprotein or an H-2L^d-restricted nucleoprotein epitope (aa 118-126) were constructed. Immunization of mice with LM vaccine strains conferred protection against challenge with virulent strains of LCMV that otherwise establish chronic infection in naive adult mice. In vivo depletion of CD8^+ T cells from vaccinated mice abrogated their ability to clear viral infection, showing that protective anti-viral immunity was due to CD8^+ T cells.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland
Directory of Open Access Journals (Sweden)
Emmanuel Okpo
2015-11-01
Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis
Energy Technology Data Exchange (ETDEWEB)
Schlech, W.F. III
1984-01-01
The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.
Sensitivity of Listeria monocytogenes to irradiation
International Nuclear Information System (INIS)
Tarjan, Veronika
1990-01-01
Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
DEFF Research Database (Denmark)
Zhu, Xinna; Long, Fei; Chen, Yonghui
2008-01-01
Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...
Directory of Open Access Journals (Sweden)
Caroline Neu
Full Text Available Macrophages are an important line of defence against invading pathogens. Human macrophages derived by different methods were tested for their suitability as models to investigate Listeria monocytogenes (Lm infection and compared to macrophage-like THP-1 cells. Human primary monocytes were isolated by either positive or negative immunomagnetic selection and differentiated in the presence of granulocyte macrophage colony-stimulating factor (GM-CSF or macrophage colony-stimulating factor (M-CSF into pro- or anti-inflammatory macrophages, respectively. Regardless of the isolation method, GM-CSF-derived macrophages (GM-Mφ stained positive for CD206 and M-CSF-derived macrophages (M-Mφ for CD163. THP-1 cells did not express CD206 or CD163 following incubation with PMA, M- or GM-CSF alone or in combination. Upon infection with Lm, all primary macrophages showed good survival at high multiplicities of infection whereas viability of THP-1 was severely reduced even at lower bacterial numbers. M-Mφ generally showed high phagocytosis of Lm. Strikingly, phagocytosis of Lm by GM-Mφ was markedly influenced by the method used for isolation of monocytes. GM-Mφ derived from negatively isolated monocytes showed low phagocytosis of Lm whereas GM-Mφ generated from positively selected monocytes displayed high phagocytosis of Lm. Moreover, incubation with CD14 antibody was sufficient to enhance phagocytosis of Lm by GM-Mφ generated from negatively isolated monocytes. By contrast, non-specific phagocytosis of latex beads by GM-Mφ was not influenced by treatment with CD14 antibody. Furthermore, phagocytosis of Lactococcus lactis, Escherichia coli, human cytomegalovirus and the protozoan parasite Leishmania major by GM-Mφ was not enhanced upon treatment with CD14 antibody indicating that this effect is specific for Lm. Based on these observations, we propose macrophages derived by ex vivo differentiation of negatively selected human primary monocytes as the most
Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...
Directory of Open Access Journals (Sweden)
Ana Camejo
2009-05-01
Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.
Quadros, M R; Souza Brito, A R; Queiroz, M L
1999-02-01
In this study we have investigated the effects of Petiveria alliacea on the hematopoietic response of mice infected with Listeria monocytogenes. Our results demonstrate a protective effect of the crude extract of P. alliacea since the survival of the treated/infected was higher than that in the infected group. Moreover, the number of granulocyte/macrophage colonies (CFU-GM) and the serum colony stimulating activity levels were increased in the treated/infected mice in relation to the infected group. These results suggest an immunomodulation of Petiveria alliacea extract on hematopoiesis, which may be responsible, at least in part, for the increased resistance of mice to Listeria monocytogenes infection.
LENUS (Irish Health Repository)
Monk, Ian R
2010-12-13
Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human
Directory of Open Access Journals (Sweden)
Hill Colin
2010-12-01
Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced
LENUS (Irish Health Repository)
Monk, Ian R
2010-01-01
Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells.
Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier
2017-05-01
Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Directory of Open Access Journals (Sweden)
Lisandra Aguilar-Bultet
2018-02-01
Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent
2018-01-01
Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.
Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom
2015-01-01
Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild
2010-12-01
Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
[Listeria monocytogenes nosocomial infection in the maternity ward].
Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P
1991-01-01
Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.
Miller, E. S.; Bates, R. A.; Koebel, D. A.; Fuchs, B. B.; Sonnenfeld, G.
1998-01-01
Exposure to different forms of psychological and physiological stress can elicit a host stress response, which alters normal parameters of neuroendocrine homeostasis. The present study evaluated the influence of the metabolic stressor 2-deoxy-D-glucose (2-DG; a glucose analog, which when administered to rodents, induces acute periods of metabolic stress) on the capacity of mice to resist infection with the facultative intracellular bacterial pathogen Listeria monocytogenes. Female BDF1 mice were injected with 2-DG (500 mg/kg b. wt.) once every 48 h prior to, concurrent with, or after the onset of a sublethal dose of virulent L. monocytogenes. Kinetics of bacterial growth in mice were not altered if 2-DG was applied concurrently or after the start of the infection. In contrast, mice exposed to 2-DG prior to infection demonstrated an enhanced resistance to the listeria challenge. The enhanced bacterial clearance in vivo could not be explained by 2-DG exerting a toxic effect on the listeria, based on the results of two experiments. First, 2-DG did not inhibit listeria replication in trypticase soy broth. Second, replication of L. monocytogenes was not inhibited in bone marrow-derived macrophage cultures exposed to 2-DG. Production of neopterin and lysozyme, indicators of macrophage activation, were enhanced following exposure to 2-DG, which correlated with the increased resistance to L. monocytogenes. These results support the contention that the host response to 2-DG-induced metabolic stress can influence the capacity of the immune system to resist infection by certain classes of microbial pathogens.
microRNA Response to Listeria monocytogenes Infection in Epithelial Cells
Izar, Benjamin; Mannala, Gopala Krishna; Mraheil, Mobarak Abu; Chakraborty, Trinad; Hain, Torsten
2012-01-01
microRNAs represent a family of very small non-coding RNAs that control several physiologic and pathologic processes, including host immune response and cancer by antagonizing a number of target mRNAs. There is limited knowledge about cell expression and the regulatory role of microRNAs following bacterial infections. We investigated whether infection with a Gram-positive bacterium leads to altered expression of microRNAs involved in the host cell response in epithelial cells. Caco-2 cells were infected with Listeria monocytogenes EGD-e, a mutant strain (ΔinlAB or Δhly) or incubated with purified listeriolysin (LLO). Total RNA was isolated and microRNA and target gene expression was compared to the expression in non-infected cells using microRNA microarrays and qRT-PCR. We identified and validated five microRNAs (miR- 146b, miR-16, let-7a1, miR-145 and miR-155) that were significantly deregulated following listerial infection. We show that expression patterns of particular microRNAs strongly depend on pathogen localization and the presence of bacterial effector proteins. Strikingly, miR-155 which was shown to have an important role in inflammatory responses during infection was induced by wild-type bacteria, by LLO-deficient bacteria and following incubation with purified LLO. It was downregulated following ΔinlAB infection indicating a new potent role for internalins in listerial pathogenicity and miRNA regulation. Concurrently, we observed differences in target transcript expression of the investigated miRNAs. We provide first evidence that L. monocytogenes infection leads to deregulation of a set of microRNAs with important roles in host response. Distinct microRNA expression depends on both LLO and pathogen localization. PMID:22312311
Introduction: Investigation of the 2011 U.S. listeriosis outbreak associated withcontaminated cantaloupes revealed that transfer of L. monocytogenes(Lm) from equipment surfaces to melons in the packing facility was a potential route of contamination. Purpose:This study examined the persistence of Lm...
Longhi, C; Conte, M P; Ranaldi, S; Penta, M; Valenti, P; Tinari, A; Superti, F; Seganti, L
2005-01-01
Listeria monocytogenes, an intracellular facultative food-borne pathogen, was reported to induce apoptosis in vitro and in vivo in a variety of cell types with the exception of murine macrophages. These cells represent the predominant compartment of bacterial multiplication and die as a result of necrosis. In this study we showed that human non-activated and IFN-gamma-activated macrophagic-like (THP-1) cells infected with L. monocytogenes, mainly die by necrosis rather than by an apoptotic process. Two natural products derived from bovine milk, lactoferrin and its derivative peptide lactoferricin B, are capable of regulating the fate of infected human macrophages. Bovine lactoferrin treatment of macrophages protects them from L. monocytogenes-induced death whereas lactoferricin B, its derivative peptide, determines a shifting of the equilibrium from necrosis to apoptosis.
Wolfe, Bryce; Wiepz, Gregory J.; Schotzko, Michele; Bondarenko, Gennadiy I.; Durning, Maureen; Simmons, Heather A.; Mejia, Andres; Faith, Nancy G.; Sampene, Emmanuel; Suresh, Marulasiddappa; Kathariou, Sophia; Czuprynski, Charles J.
2017-01-01
ABSTRACT Infection with Listeria monocytogenes during pregnancy is associated with miscarriage, preterm birth, and neonatal complications, including sepsis and meningitis. While the risk of these conditions is thought to be greatest during the third trimester of pregnancy, the determinants of fetoplacental susceptibility to infection, the contribution of gestational age, and the in vivo progression of disease at the maternal-fetal interface are poorly understood. We developed a nonhuman primate model of listeriosis to better understand antecedents of adverse pregnancy outcomes in early pregnancy. Four pregnant cynomolgus macaques (Macaca fascicularis) received a single intragastric inoculation between days 36 and 46 of gestation with 107 CFU of an L. monocytogenes strain isolated from a previous cluster of human listeriosis cases that resulted in adverse pregnancy outcomes. Fecal shedding, maternal bacteremia, and fetal demise were consistently noted within 7 to 13 days. Biopsy specimens of maternal liver, spleen, and lymph node displayed variable inflammation and relatively low bacterial burden. In comparison, we observed greater bacterial burden in the decidua and placenta and the highest burden in fetal tissues. Histopathology indicated vasculitis, fibrinoid necrosis, and thrombosis of the decidual spiral arteries, acute chorioamnionitis and villitis in the placenta, and hematogenous infection of the fetus. Vascular pathology suggests early impact of L. monocytogenes infection on spiral arteries in the decidua, which we hypothesize precipitates subsequent placentitis and fetal demise. These results demonstrate that L. monocytogenes tropism for the maternal reproductive tract results in infection of the decidua, placenta, and the fetus itself during the first trimester of pregnancy. PMID:28223455
Shan, Ying; Zhang, Yikai; Zhuo, Xunhui; Li, Xiaoliang; Peng, Jinrong; Fang, Weihuan
2016-07-01
Zebrafish could serve as an alternative animal model for pathogenic bacteria in multiple infectious routes. Our previous study showed that immersion infection in zebrafish with Listeria monocytogenes did not cause lethality but induced transient expression of several immune response genes. We used an Affymetrix gene chip to examine the expression profiles of genes of zebrafish immersion-infected with L. monocytogenes. A total of 239 genes were up-regulated and 56 genes down-regulated compared with uninfected fish. Highest expression (>20-fold) was seen with the mmp-9 gene encoding the matrix metalloproteinase-9 (Mmp-9) known to degrade the extracellular matrix proteins. By morpholino knockdown of mmp-9, we found that the morphants showed rapid death with much higher bacterial load after intravenous or intraventricular (brain ventricle) infection with L. monocytogenes. Macrophages in mmp-9-knockdown morphants had significant defect in migrating to the brain cavity upon intraventricular infection. Decreased migration of murine macrophages with knockdown of mmp-9 and cd44 was also seen in transwell inserts with 8-μm pore polycarbonate membrane, as compared with the scrambled RNA. These findings suggest that Mmp-9 is a protective molecule against infection by L. monocytogenes by engaging in migration of zebrafish macrophages to the site of infection via a non-proteolytic role. Further work is required on the molecular mechanisms governing Mmp-9-driven macrophage migration in zebrafish. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Boyacioglu O.
2016-06-01
Full Text Available A Listeria monocytogenes-specific bacteriophage cocktail was evaluated for its activity against a nalidixic acid-resistant L. monocytogenes (Lm-NalR isolate on fresh-cut spinach stored under modified atmosphere packaging at various temperatures. Pieces (~2 × 2 cm2 of fresh spinach inoculated with 4.5 log CFU/cm2 Lm-NalR were sprayed with the phage cocktail (6.5 log plaque-forming units [PFU]/cm2 or a control. The samples were stored at 4°C or 10°C for up to 14 d in sealed packages filled with either atmospheric air (AA or modified atmosphere (MA. At 4°C under AA, the phages significantly (P ≤ 0.05 lowered the Lm-NalR populations on spinach, compared to control-treated inoculated samples, by 1.12 and 1.51 log CFU/cm2 after 1 and 14 d, respectively. At 4°C under MA, Lm-NalR was significantly reduced by 1.95 log CFU/cm2 compared to control leaves after both 1 and 14 d. At 10°C under AA, the phages significantly reduced Lm-NalR by 1.50 and 2.51 log CFU/cm2 after 1 and 14 d compared to the control. Again at 10°C under MA, the phages significantly reduced Lm-NalR by 1.71 and 3.24 log CFU/cm2 compared to control after 1 and 14 d, respectively. The results support the potential of lytic bacteriophages in effectively reducing populations of L. monocytogenes on freshcut leafy produce, under both AA and MA conditions.
Tindwa, Hamisi; Patnaik, Bharat Bhusan; Kim, Dong Hyun; Mun, Seulgi; Jo, Yong Hun; Lee, Bok Luel; Lee, Yong Seok; Kim, Nam Jung; Han, Yeon Soo
2013-11-14
Peptidoglycan recognition proteins (PGRPs) are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP)-type peptidoglycan to activate both the immune deficiency (Imd) and proPhenoloxidase (proPO) pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF) of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.
Directory of Open Access Journals (Sweden)
Yeon Soo Han
2013-11-01
Full Text Available Peptidoglycan recognition proteins (PGRPs are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP-type peptidoglycan to activate both the immune deficiency (Imd and proPhenoloxidase (proPO pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.
Directory of Open Access Journals (Sweden)
Analía L. Laciar
2000-03-01
Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.
Directory of Open Access Journals (Sweden)
Oleg Garifulin
2007-09-01
Full Text Available Genetic makeup of the host plays a significant role in the course and outcome of infection. Inbred strains of mice display a wide range of sensitivities to Listeria monocytogenes infection and thus serve as a good model for analysis of the effect of genetic polymorphism. The outcome of L. monocytogenes infection in mice is influenced by the ability of this bacterium to induce expression of interferon beta mRNA, encoded in mouse by the Ifnb1 (interferon beta 1, fibroblast gene. Mouse strains that lack components of the IFN beta signaling pathway are substantially more resistant to infection. We found that macrophages from the ByJ substrain of the common C57BL/6 inbred strain of mice are impaired in their ability to induce Ifnb1 expression in response to bacterial and viral infections. We mapped the locus that controls differential expression of Ifnb1 to a region on Chromosome 7 that includes interferon regulatory factor 3 (Irf3, which encodes a transcription factor responsible for early induction of Ifnb1 expression. In C57BL/6ByJ mice, Irf3 mRNA was inefficiently spliced, with a significant proportion of the transcripts retaining intron 5. Analysis of the Irf3 locus identified a single base-pair polymorphism and revealed that intron 5 of Irf3 is spliced by the atypical U12-type spliceosome. We found that the polymorphism disrupts a U12-type branchpoint and has a profound effect on the efficiency of splicing of Irf3. We demonstrate that a naturally occurring change in the splicing control element has a dramatic effect on the resistance to L. monocytogenes infection. Thus, the C57BL/6ByJ mouse strain serves as an example of how a mammalian host can counter bacterial virulence strategies by introducing subtle alteration of noncoding sequences.
Brenner, Moran; Lobel, Lior; Borovok, Ilya; Sigal, Nadejda; Herskovits, Anat A
2018-03-01
Listeria monocytogenes (Lm) is a saprophyte and intracellular pathogen. Transition to the pathogenic state relies on sensing of host-derived metabolites, yet it remains unclear how these are recognized and how they mediate virulence gene regulation. We previously found that low availability of isoleucine signals Lm to activate the virulent state. This response is dependent on CodY, a global regulator and isoleucine sensor. Isoleucine-bound CodY represses metabolic pathways including branched-chain amino acids (BCAA) biosynthesis, however under BCAA depletion, as occurs during infection, BCAA biosynthesis is upregulated and isoleucine-unbound CodY activates virulence genes. While isoleucine was revealed as an important input signal, it was not identified how internal levels are controlled during infection. Here we show that Lm regulates BCAA biosynthesis via CodY and via a riboregulator located upstream to the BCAA biosynthesis genes, named Rli60. rli60 is transcribed when BCAA levels drop, forming a ribosome-mediated attenuator that cis-regulates the downstream genes according to BCAA supply. Notably, we found that Rli60 restricts BCAA production, essentially starving Lm, a mechanism that is directly linked to virulence, as it controls the internal isoleucine pool and thereby CodY activity. This controlled BCAA auxotrophy likely evolved to enable isoleucine to serve as a host signal and virulence effector.
Directory of Open Access Journals (Sweden)
Moran Brenner
2018-03-01
Full Text Available Listeria monocytogenes (Lm is a saprophyte and intracellular pathogen. Transition to the pathogenic state relies on sensing of host-derived metabolites, yet it remains unclear how these are recognized and how they mediate virulence gene regulation. We previously found that low availability of isoleucine signals Lm to activate the virulent state. This response is dependent on CodY, a global regulator and isoleucine sensor. Isoleucine-bound CodY represses metabolic pathways including branched-chain amino acids (BCAA biosynthesis, however under BCAA depletion, as occurs during infection, BCAA biosynthesis is upregulated and isoleucine-unbound CodY activates virulence genes. While isoleucine was revealed as an important input signal, it was not identified how internal levels are controlled during infection. Here we show that Lm regulates BCAA biosynthesis via CodY and via a riboregulator located upstream to the BCAA biosynthesis genes, named Rli60. rli60 is transcribed when BCAA levels drop, forming a ribosome-mediated attenuator that cis-regulates the downstream genes according to BCAA supply. Notably, we found that Rli60 restricts BCAA production, essentially starving Lm, a mechanism that is directly linked to virulence, as it controls the internal isoleucine pool and thereby CodY activity. This controlled BCAA auxotrophy likely evolved to enable isoleucine to serve as a host signal and virulence effector.
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
DEFF Research Database (Denmark)
Paspaliari, Dafni Katerina; Loose, Jennifer S. M.; Larsen, Marianne Halberg
2015-01-01
Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and ChiB) and a ......Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and Chi...... but different product profiles depending on the substrate. In LPMO-chitinase synergy experiments, CBP21 is able to boost the activity of both ChiA and ChiB more than LmLPMO10. Product analysis of the synergy assays revealed that the chitinases were unable to efficiently hydrolyse the LPMO products...... (chitooligosaccharide aldonic acids) with a degree of polymerization below four (ChiA and SmChiC) or three (ChiB). Gene transcription and protein expression analysis showed that LmLPMO10 is neither highly transcribed, nor abundantly secreted during the growth of L. monocytogenes in a chitin-containing medium...
dos Santos, Liliane Martins; Santos, Mônica Morais; de Souza Silva, Humberto Pereira; Arantes, Rosa Maria Esteves; Nicoli, Jacques Robert; Vieira, Leda Quercia
2011-02-01
In the present study, we investigated the protective effects of Lactobacillus delbrueckii UFV-H2b20 on the resistance to Listeria monocytogenes infection in gnotobiotic mice. Germfree mice or monoassociated mice were infected with L. monocytogenes, and the microbiological and immunological responses were evaluated after 1, 3, and 5 days of infection. Monoassociation with L. delbrueckii was capable of protecting mice against death caused by L. monocytogenes and induced a faster clearance of the bacteria in the liver, spleen, and peritoneal cavity at days 1, 3, and 5 post-infection. Also, monoassociated mice displayed less liver injury than germfree mice. The production of TNF-α in the serum, peritoneal cavity, and gut was augmented in monoassociated mice. Likewise, the levels of IFN-γ found on supernatants of spleen cells cultures were higher after the monoassociation. In addition, increased production of nitric oxide in peritoneal cell cultures supernatants and in serum was observed in mice that received L. delbrueckii. The monoassociation with L. delbrueckii induced higher production of IL-10 in the mucosal immune system. We conclude that monoassociation with L. delbrueckii UFV-H2b20 protects mice from death caused by L. monocytogenes infection by favoring effector responses while preventing their immunopathological consequences.
Kubicová Z.; Filipová M.; Jurovčíková J.; Cabanová L
2017-01-01
The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB)” in 2012 led by the European Union Reference Laboratory (EURL) for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Foo...
Exendin-4 improves resistance to Listeria monocytogenes infection in diabetic db/db mice
Liu, Hsien Yueh; Chung, Chih-Yao; Yang, Wen-Chin; Liang, Chih-Lung; Wang, Chi-Young; Chang, Chih-Yu; Chang, Cicero Lee-Tian
2012-01-01
The incidence of diabetes mellitus is increasing among companion animals. This disease has similar characteristics in both humans and animals. Diabetes is frequently identified as an independent risk factor for infections associated with increased mortality. In the present study, homozygous diabetic (db/db) mice were infected with Listeria (L.) monocytogenes and then treated with the anti-diabetic drug exendin-4, a glucagon-like peptide 1 analogue. In aged db/db mice, decreased CD11b+ macroph...
Directory of Open Access Journals (Sweden)
Ying eShan
2015-04-01
Full Text Available Zebrafish, Denio rerio, could be an alternative to other classic animal models for human infectious diseases to examine the processes of microbial infections and host-pathogen interactions in vivo because of their small body dimension but large clutch size. We established germ-free zebrafish infection models of Listeria monocytogenes through different routes of infection: oral immersion and injection via yolk sac, brain ventricle and blood island. Immersion of zebrafish larva even with 1010CFU/mL L. monocytogenes EGDe strain in egg water was unable to cause mortality, but GFP-expressing bacteria in the gut lumen could be observed in frozen sections. Several selected maker genes of the innate immune system, including cyp1a, irg1l, il1b and mmp9, were significantly induced by oral immersion not only with strain EGDe, but also with strain M7 and L. innocua, though to a lesser degree (P < 0.01. Such induction appears to be transient with peak at 48 h post-infection, but returned to basal level at 72 h post-infection. Of the three injection routes, mortality after infection by yolk sac was 80% in early stage of infection. Few eggs could survive and hatch. Injection into zebrafish embryos via brain ventricle or blood island led to progressive lethal infection. L. mocytogenes EGDe showed steady replication in the fish embryos and was far more pathogenic than strain M7, which is consistent with findings in the murine model. We conclude that zebrafish could serve as susceptible and microscopically visible infection models for L. monocytogenes via different routes and could be applied to further studies on the interactions between bacterial virulence factors and host immune responses.
Qian, Yue; Zhang, Na; Jiang, Ping; Chen, Siyuan; Chu, Shujuan; Hamze, Firas; Wu, Yan; Luo, Qin; Feng, Aiping
2012-08-01
Listeria monocytogenes (LM), a Gram-positive facultative intracellular bacterium, can be used as an effective exogenous antigen expression vector in tumor-target therapy. But for successful clinical application, it is necessary to construct attenuated LM stain that is safe yet retains the potency of LM based on the full virulent pathogen. In this study, attenuated LM and recombinants of LM expressing melanoma inhibitory activity (MIA) were constructed successfully. The median lethal dose (LD(50)) and invasion efficiency of attenuated LM strains were detected. The recombinants were utilized for immunotherapy of animal model of B16F10 melanoma. The level of MIA mRNA expression in tumor tissue was detected by using real-time polymerase chain reaction (PCR) with specific sequence, meanwhile the anti-tumor immune response was assayed by flow cytometric analysis and enzyme-linked immunosorbent spot (ELISPOT) assay. The results showed the toxicity and invasiveness of attenuated LM were decreased as compared with LM, and attenuated LM expressing MIA, especially the double-genes attenuated LM recombinant, could significantly induce anti-tumor immune response and inhibit tumor growth. This study implicates attenuated LM may be a safer and more effective vector for immunotherapy of melanoma.
Animal models for oral transmission of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Sarah E F D'Orazio
2014-02-01
Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C
2007-10-01
To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.
Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man
2017-07-01
Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.
Potempa, Krzysztof; Graham, Christine M.; Moreira-Teixeira, Lucia; McNab, Finlay W.; Howes, Ashleigh; Stavropoulos, Evangelos; Pascual, Virginia; Banchereau, Jacques; Chaussabel, Damien; O’Garra, Anne
2016-01-01
Analysis of the mouse transcriptional response to Listeria monocytogenes infection reveals that a large set of genes are perturbed in both blood and tissue and that these transcriptional responses are enriched for pathways of the immune response. Further we identified enrichment for both type I and type II interferon (IFN) signaling molecules in the blood and tissues upon infection. Since type I IFN signaling has been reported widely to impair bacterial clearance we examined gene expression from blood and tissues of wild type (WT) and type I IFNαβ receptor-deficient (Ifnar1-/-) mice at the basal level and upon infection with L. monocytogenes. Measurement of the fold change response upon infection in the absence of type I IFN signaling demonstrated an upregulation of specific genes at day 1 post infection. A less marked reduction of the global gene expression signature in blood or tissues from infected Ifnar1-/- as compared to WT mice was observed at days 2 and 3 after infection, with marked reduction in key genes such as Oasg1 and Stat2. Moreover, on in depth analysis, changes in gene expression in uninfected mice of key IFN regulatory genes including Irf9, Irf7, Stat1 and others were identified, and although induced by an equivalent degree upon infection this resulted in significantly lower final gene expression levels upon infection of Ifnar1-/- mice. These data highlight how dysregulation of this network in the steady state and temporally upon infection may determine the outcome of this bacterial infection and how basal levels of type I IFN-inducible genes may perturb an optimal host immune response to control intracellular bacterial infections such as L. monocytogenes. PMID:26918359
Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes
Directory of Open Access Journals (Sweden)
Ashley M. Sherrid
2013-01-01
Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.
Directory of Open Access Journals (Sweden)
Marina Ceruso
2014-02-01
Full Text Available Listeria monocytogenes (Lm is a food-borne pathogen responsible for human listeriosis, an invasive infection with high mortality rates. Lm has developed efficient strategies for survival under stress conditions such as starvation and wide variations in temperature, pH, and osmolarity. Therefore, Lm can survive in food under multiple stress conditions. Detailed studies to determine the mode of action of this pathogen for survival under stress conditions are important to control Lm in food. It has been shown that genes encoding for ATP-binding cassette (ABC transporters are induced in Lm in food, in particular under stress conditions. Previous studies showed that these genes are involved in sensitivity to nisin, acids, and salt. The aim of this study was to determine the involvement of some ABC transporters in biofilm formation. Therefore, deletion mutants of ABC transporter genes (LMOf2365_1875 and LMOf2365_1877 were created in Lm F2365, and then were compared to the wild type for their capacity to form biofilms. Lm strain F2365 was chosen as reference since the genome is fully sequenced and furthermore this strain is particularly involved in food-borne outbreaks of listeriosis. Our results showed that DLMOf2365_1875 had an increased capacity to form biofilms compared to the wild type, indicating that LMOf2365_1875 negatively regulates biofilm formation. A deeper knowledge on the ability to form biofilms in these mutants may help in the development of intervention strategies to control Lm in food and in the environment.
Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.
Directory of Open Access Journals (Sweden)
Nadine Gillmaier
Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.
Effects of prebiotics on the infective potential of Listeria monocytogenes
DEFF Research Database (Denmark)
Ebersbach, Tine
% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Directory of Open Access Journals (Sweden)
Licht Tine
2007-06-01
Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.
Rios-Covian, David; Nogacka, Alicja; Salazar, Nuria; Hernández-Barranco, A M; Cuesta, Isabel; Gueimonde, Miguel; de Los Reyes Gavilán, Clara G
2018-03-01
Mechanistic features that characterize the interaction and inhibition of the food-borne pathogen Listeria monocytogenes by members of the genus Bifidobacterium still remain unclear. In the present work, we tried to shed light on the influence that co-cultivation of L. monocytogenes with Bifidobacterium breve may exert on both microorganisms and on virulence of the pathogen. Production of acetate and lactate was measured by gas chromatography and high-performance liquid chromatography, respectively; bacterial counts were obtained by plate count; gene expression was determined by RT-qPCR; and haemolytic activity was analyzed against goat erythrocytes. We found slightly but significantly lower final counts of Listeria and Bifidobacterium (p monocytogenes cells from cocultures than in those from monocultures. In contrast, the hly and luxS genes, which code for the cytolysin listeriolysin O and participate in biofilm formation, respectively, were overexpressed when L. monocytogenes was grown in coculture. This indicates that the presence of Bifidobacterium is able to modify the gene expression and haemolytic activity of L. monocytogenes when both microorganisms grow together.
REALIS: Postgenomic Analysis of Listeria Monocytogenes
Directory of Open Access Journals (Sweden)
The REALIS Consortium
2006-04-01
Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.
Omori, Yasuo; Miake, Kiyotaka; Nakamura, Hiromi; Kage-Nakadai, Eriko; Nishikawa, Yoshikazu
2017-09-18
The aim of this study was to evaluate the effect of lactic acid (LA) with and without organic material at various post-treatment recovery times on the heat resistance of Listeria monocytogenes (Lm). LA decreased Lm numbers; however, the effect was remarkably attenuated by the presence of organic matter. Five strains of Lm were treated with LA and the listericidal effects were compared. The effect of LA varied depending on the strain, with ≥3.0% (w/w) LA required to kill the Lm strains in a short time. The heat resistance of Lm treated with LA was examined with respect to the time interval between the acid treatment and the subsequent manufacturing step. The heat resistance of Lm was shown to significantly increase during the post-treatment period. Heat tolerance (D value) increased up to 3.4-fold compared with the non-treated control bacteria. RNA sequencing and RT-PCR analyses suggested that several stress chaperones, proteins controlled by RecA and associated with high-temperature survival, were involved in the mechanism of enhanced heat resistance. These results are applicable to manufacturers when LA and heat treatment methods are utilized for the effective control of Lm in foods. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Lee, Mi-Hwa; Lee, Jiyeon; Nam, Young-Do; Lee, Jong Suk; Seo, Myung-Ji; Yi, Sung-Hun
2016-03-16
A wild-type microorganism exhibiting antimicrobial activities was isolated from the Korean traditional fermented soybean food Chungkookjang and identified as Bacillus sp. LM7. During its stationary growth phase, the microorganism secreted an antimicrobial substance, which we partially purified using a simple two-step procedure involving ammonium sulfate precipitation and heat treatment. The partially purified antimicrobial substance, Anti-LM7, was stable over a broad pH range (4.0-9.0) and at temperatures up to 80 °C for 30 min, and was resistant to most proteolytic enzymes and maintained its activity in 30% (v/v) organic solvents. Anti-LM7 inhibited the growth of a broad range of Gram-positive bacteria, including Bacillus cereus and Listeria monocytogenes, but it did not inhibit lactic acid bacteria such as Lactobacillus plantarum and Lactococcus lactis subsp. Lactis. Moreover, unlike commercially available nisin and polymyxin B, Anti-LM7 inhibited certain fungal strains. Lastly, liquid chromatography-mass spectrometry analysis of Anti-LM7 revealed that it contained eight lipopeptides belonging to two families: four bacillomycin D and four surfactin analogs. These Bacillus sp. LM7-produced heterogeneous lipopeptides exhibiting extremely high stability and a broad antimicrobial spectrum are likely to be closely related to the antimicrobial activity of Chungkookjang, and their identification presents an opportunity for application of the peptides in environmental bioremediation, pharmaceutical, cosmetic, and food industries. Copyright © 2015 Elsevier B.V. All rights reserved.
Zilelidou, Evangelia; Karmiri, Christina-Vasiliki; Zoumpopoulou, Georgia; Mavrogonatou, Eleni; Kletsas, Dimitris; Tsakalidou, Effie; Papadimitriou, Konstantinos; Drosinos, Eleftherios
2016-01-01
ABSTRACT Various Listeria monocytogenes strains may contaminate a single food product, potentially resulting in simultaneous exposure of consumers to multiple strains. However, due to bias in strain recovery, L. monocytogenes strains isolated from foods by selective enrichment (SE) might not always represent those that can better survive the immune system of a patient. We investigated the effect of cocultivation in tryptic soy broth with 0.6% yeast extract (TSB-Y) at 10°C for 8 days on (i) the detection of L. monocytogenes strains during SE with the ISO 11290-1:1996/Amd 1:2004 protocol and (ii) the in vitro virulence of strains toward the Caco-2 human colon epithelial cancer cell line following exposure to simulated gastric fluid (SGF; pH 2.0)-HCl (37°C). We determined whether the strains which were favored by SE would be effective competitors under the conditions of challenges related to gastrointestinal passage of the pathogen. Interstrain competition of L. monocytogenes in TSB-Y determined the relative population of each strain at the beginning of SE. This in turn impacted the outcome of SE (i.e., favoring survival of competitors with better fitness) and the levels exposed subsequently to SGF. However, strong growth competitors could be outcompeted after SGF exposure and infection of Caco-2 cells by strains outgrown in TSB-Y and underdetected (or even missed) during enrichment. Our data demonstrate a preferential selection of certain L. monocytogenes strains during enrichments, often not reflecting a selective advantage of strains during infection. These findings highlight a noteworthy scenario associated with the difficulty of matching the source of infection (food) with the L. monocytogenes isolate appearing to be the causative agent during listeriosis outbreak investigations. IMPORTANCE This report is relevant to understanding the processes involved in selection and prevalence of certain L. monocytogenes strains in different environments (i.e., foods or
Directory of Open Access Journals (Sweden)
Changyong Cheng
2017-06-01
Full Text Available Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the ΔtrxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA, and plcB. Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a
Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui
2017-01-01
Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for
Ishola, O O; Mosugu, J I; Adesokan, H K
2016-09-01
Food contamination with Listeria monocytogenes is on the increase posing threats to public health with growing trends in food products recalls due to suspected Listeria contamination. We conducted a cross-sectional study to determine the prevalence and antibiotic susceptibility profiles of Listeria monocytogenes (Lm) among 71 randomly selected poultry farms in Oyo State, Nigeria. A total of 450 samples comprising cloacal swabs (426) and randomly selected dressed chicken meat (24) were cultured for Lm isolation using BrillianceTM Selective Listeria Agar with antibiotics and microbial load count with Nutrient Agar. Further identification was done using microscopic, biochemical characterization and antibiotic sensitivity tests. Data were analysed using bivariate analysis and student t-test. An overall prevalence of 91.8% Lm contamination was obtained comprising 91.5% (390/426) in cloacal swabs and 95.8% (23/24) in meat. The prevalence of Lm in cloacal samples was significantly associated with poultry type (p = 0.008) and breed (p = 0.000. In addition, all the flocks had at least one positive sample yielding 100% flock prevalence. Antibiotic sensitivity test revealed that most of the isolates were resistant to common antibiotics like Ampicillin-cloxacillin and cefuroxime. The results revealed a high level of contamination with Lm in the poultry flock and meat and the observed resistance to most common antibiotics has implications for future disease control as well as public health. There is need to step up routine screening of food animal products for Listeria contamination as well as measures towards reducing such contaminations.
Dhama, Kuldeep; Verma, Amit Kumar; Rajagunalan, S; Kumar, Amit; Tiwari, Ruchi; Chakraborty, Sandip; Kumar, Rajesh
2013-04-01
Listeriosis is a disease that causes septicemia or encephalitis in humans, animals and birds. Although, the disease is rare and sporadic in poultry but if occurs then causes septicemia or sometimes localized encephalitis. Occasionally, the disease is seen in young chicks and the causative agent, like in humans and animals, is Listeria monocytogenes. The organism is capable to infect almost all animals and poultry; however, outbreaks of listeriosis are infrequent in birds. It is widely distributed among avian species and chickens, turkeys, waterfowl (geese, ducks), game birds, pigeons, parrots, wood grouse, snowy owl, eagle, canaries, which appear to be the most commonly affected. Chickens are thought to be the carriers of Listeria and also the prime reservoirs for the infection and thus contaminate the litter and environment of the poultry production units. Listeriosis is often noticed along with other poultry diseases such as coccidiosis, infectious coryza, salmonellosis, campylobacteriosis and parasitic infections, signifying the opportunistic nature of the organism. Intestinal colonization of poultry and the presence of L. monocytogenes in feces represent a potential source of the organism for listeriosis in ruminants. Man gets infection from raw broiler meat due to Listeria contamination and unhygienic conditions of the processing area, rather than acquiring direct infection from birds. With the changing food habits of the people, the health consciousness is also increasing and since listeriosis has now been recognized as an emerging food borne zoonoses. Therefore, this review has been compiled to make aware the poultry producers and the consumers of poultry meat/products regarding the importance of the disease and its public health significance.
Listeria monocytogenes endophthalmitis following keratoconjunctivitis.
Shoughy, Samir S; Tabbara, Khalid F
2014-01-01
Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.
Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming
2017-01-01
The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.
Biofilm Formation of Listeria monocytogenes on Various Surfaces
Directory of Open Access Journals (Sweden)
M Mahdavi
2007-10-01
Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.
Directory of Open Access Journals (Sweden)
Catherine E Jobbings
Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.
Anti-bacterial immunity to Listeria monocytogenes in allogeneic bone marrow chimera in mice
International Nuclear Information System (INIS)
Onoe, K.; Good, R.A.; Yamamoto, K.
1986-01-01
Protection and delayed-type hypersensitivity (DTH) to the facultative intracellular bacterium Listeria monocytogenes (L.m.) were studied in allogeneic and syngeneic bone marrow chimeras. Lethally irradiated AKR (H-2k) mice were successfully reconstituted with marrow cells from C57BL/10 (B10) (H-2b), B10 H-2-recombinant strains or syngeneic mice. Irradiated AKR mice reconstituted with marrow cells from H-2-compatible B10.BR mice, [BR----AKR], as well as syngeneic marrow cells, [AKR----AKR], showed a normal level of responsiveness to the challenge stimulation with the listeria antigens when DTH was evaluated by footpad reactions. These mice also showed vigorous activities in acquired resistance to the L.m. By contrast, chimeric mice that had total or partial histoincompatibility at the H-2 determinants between donor and recipient, [B10----AKR], [B10.AQR----AKR], [B10.A(4R)----AKR], or [B10.A(5R)----AKR], were almost completely unresponsive in DTH and antibacterial immunity. However, when [B10----AKR] H-2-incompatible chimeras had been immunized with killed L.m. before challenge with live L.m., these mice manifested considerable DTH and resistance to L.m. These observations suggest that compatibility at the entire MHC between donor and recipient is required for bone marrow chimeras to be able to manifest DTH and protection against L.m. after a short-term immunization schedule. However, this requirement is overcome by a preceding or more prolonged period of immunization with L.m. antigens. These antigens, together with marrow-derived antigen-presenting cells, can then stimulate and expand cell populations that are restricted to the MHC (H-2) products of the donor type
Listeria monocytogenes endophthalmitis following keratoconjunctivitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2014-01-01
Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages
Directory of Open Access Journals (Sweden)
Domenico Meloni
2015-03-01
Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.
Meloni, Domenico
2015-03-12
The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes
DEFF Research Database (Denmark)
Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone
2013-01-01
Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
Down regulation of macrophage IFNGR1 exacerbates systemic L. monocytogenes infection.
Directory of Open Access Journals (Sweden)
Emily M Eshleman
2017-05-01
Full Text Available Interferons (IFNs target macrophages to regulate inflammation and resistance to microbial infections. The type II IFN (IFNγ acts on a cell surface receptor (IFNGR to promote gene expression that enhance macrophage inflammatory and anti-microbial activity. Type I IFNs can dampen macrophage responsiveness to IFNγ and are associated with increased susceptibility to numerous bacterial infections. The precise mechanisms responsible for these effects remain unclear. Type I IFNs silence macrophage ifngr1 transcription and thus reduce cell surface expression of IFNGR1. To test how these events might impact macrophage activation and host resistance during bacterial infection, we developed transgenic mice that express a functional FLAG-tagged IFNGR1 (fGR1 driven by a macrophage-specific promoter. Macrophages from fGR1 mice expressed physiologic levels of cell surface IFNGR1 at steady state and responded equivalently to WT C57Bl/6 macrophages when treated with IFNγ alone. However, fGR1 macrophages retained cell surface IFNGR1 and showed enhanced responsiveness to IFNγ in the presence of type I IFNs. When fGR1 mice were infected with the bacterium Listeria monocytogenes their resistance was significantly increased, despite normal type I and II IFN production. Enhanced resistance was dependent on IFNγ and associated with increased macrophage activation and antimicrobial function. These results argue that down regulation of myeloid cell IFNGR1 is an important mechanism by which type I IFNs suppress inflammatory and anti-bacterial functions of macrophages.
A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.
Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan
2016-04-01
A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.
Developments in the LM2500 and LM5000 aircraft derivatives
Energy Technology Data Exchange (ETDEWEB)
Honebrink, R W; Nichols, T B; Spector, R B; Sailer, E D
1983-03-01
When first introduced into industrial service in 1970, the General Electric LM2500 (the first of the second generation aircraft derivative units to enter industrial service) represented a significant advance in gas turbine technology in the areas of improved simple cycle efficiency--now up to 37 per cent on natural gas fuel--on site maintenance capability and high levels of reliability/availability. During the 11 years since initial introduction numerous product improvements have been introduced to expand the power range, extend the scheduled maintenance levels, further improve reliability/availability and increase the application flexibility of the LM2500. The higher power LM5000 gas turbine, which is derived from the CF6-50 aircraft turbofan engine, is also described in this article.
Directory of Open Access Journals (Sweden)
Asael E. de la Rosa-Zariñana
2018-01-01
Full Text Available The aim of this study was to standardize the PCR technique for detecting Listeria monocytogenes (Lm in chicken, beef and pork. The sensitivity and speci city of PCR and the level of concordance with the microbiological method were evaluated. PCR was standardized using a total of 60 samples of chicken, beef and pork (20 samples per meat type. Sensitivity and speci city were calculated using the 2 x 2 table and the level of accordance by the Kappa index. The minimum detectable DNA concentration was 3.0 ng μL−1. The PCR showed 100% sensitivity and speci city, and 80, 91 and 100% concordance between the methods was obtained for detecting Lm in chicken, beef and pork samples respectively, with 89.4% similarity between the methods for the three types of meat.
Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa
2015-01-01
Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.
Directory of Open Access Journals (Sweden)
Schwab Jussara Pires
2003-01-01
Full Text Available OBJETIVOS: identificar Listeria monocytogenes (Lm em placentas humanas pela técnica de imuno-histoquímica (IHQ e relacionar sua presença com as alterações histológicas encontradas com as alterações histológicas encontradas no exame convencional, com o trimestre gestacional, a idade das gestantes, casos de aborto e parto prematuro e a ocorrência de aborto habitual. MÉTODOS: um estudo retrospectivo foi realizado no setor de patologia de um hospital-escola de Porto Alegre no ano 2000. O material dos blocos de parafina de 254 placentas (exames anatomopatológicos, provenientes de aborto, de parto prematuro e de nascimento a termo, foi analisado pela técnica histológica convencional com a coloração de hematoxilina e eosina (HE. A técnica de IHQ foi realizada no material de 148 exames anatomopatológicos, que apresentaram alterações inflamatórias, hemorragia, necrose e trombose, utilizando anticorpo policlonal Rabbit A "Listeria monocytogenes" B65420R (Biodesign® na diluição 1:1000 e complexo avidina-biotina-estreptavidina. O teste c² foi aplicado para a análise estatística. RESULTADOS: a presença de Lm foi identificada em 33,7% das placentas analisadas pela técnica IHQ. Corioamnionite e vilite foram as alterações inflamatórias que estiverem associadas a diferença significativa nas placentas positivas. Lm esteve presente nas placentas de 1º, 2º e 3º trimestre gestacional. Não houve associação entre idade das gestantes, casos de aborto e/ou parto prematuro e a presença ou ausência de Lm nas placentas. Abortos habituais ocorreram em pacientes com ou sem Lm no tecido placentário. CONCLUSÃO: a técnica de IHQ pode ser utilizada para confirmar o diagnóstico histopatológico de listeriose em todos os trimestres gestacionais.
Carrier status for Listeria monocytogenes and other Listeria species ...
African Journals Online (AJOL)
Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...
Michelon, Damien; Félix, Benjamin; Vingadassalon, Noemie; Mariet, Jean-François; Larsson, Jonas T; Møller-Nielsen, Eva; Roussel, Sophie
2015-03-01
Listeria monocytogenes is a foodborne pathogen responsible for a severe disease known as listeriosis. The European Centre for Disease Prevention and Control (ECDC) coordinates a network of national public health laboratories (NPHLs) in charge of typing clinical strains. In food, it is the European Union Reference Laboratory for L. monocytogenes (EURL Lm), which manages a network of National Reference Laboratories (NRLs). A pulsed-field gel electrophoresis (PFGE) standard operating procedure (EURL SOP) has been used routinely at the EURL Lm since 2007. The EURL Lm has recommended that NRLs use the EURL SOP, whereas the Statens Serum Institut (SSI), under contract for ECDC, requested that NPHLs use Halpins' SOP (HSOP) published in 2010 for the PulseNet USA network. An update of Halpins' SOP (uHSOP) was published in 2013. To facilitate the exchange of profiles among human and food European reference laboratories, it is crucial to ensure that the PFGE profiles obtained with these different SOPs are comparable. The aim here was to compare the EURL SOP with HSOP and uHSOP. The panel comprised 114 well-characterized SSI/EURL strains. All were characterized at the EURL using both the EURL SOP and uHSOP. Seventy of the 114 strains were also characterized at the SSI using HSOP. The EURL SOP and uHSOP produced indistinguishable combined (ApaI/AscI) profiles for the 114 strains tested. The EURL SOP and HSOP produced indistinguishable combined profiles for 69 of the 70 strains tested. One strain displayed for the AscI profile an additional low-intensity band at 184 kbp with HSOP. For this strain, SSI and EUR Lm had already observed the same profile from NPHLs and NRLs. However, this deviation is minor as it accounted for about 1% of all the 114 combined profiles. This study should facilitate the exchange of reproducible PFGE profiles among human and food reference laboratories.
A multi-year Interagency Listeria monocytogenes Market Basket Survey (Lm MBS) was undertaken for selected categories of refrigerated ready-to eat (RTE) foods purchased at retail in four FoodNet sites in the U.S. Eighteen product types were sampled, including RTE seafood, produce, dairy, meat, eggs,...
Energy Technology Data Exchange (ETDEWEB)
Fujihara, Kazuo; Shida, Norihiko; Ohta, Michiya [Hiroshima Atomic Bomb Hospital (Japan)
1995-12-01
We report a case of successfully treated Listeria monocytogenes (Lm) meningitis in a atomic bomb survivor receiving steroid therapy for aplastic anemia. The patient was a 62-year-old woman and the past medical history included hypothyroidism due to radioiodide therapy for Basedow disease, breast cancer, aplastic anemia, steroid-induced diabetes mellitus, and pulmonary tuberculosis. At the time of onset, she was receiving corticosteroid, anabolic steroid, an H{sub 2}-blocker (famotidine), and other medication. Since she developed symptoms of meningitis when she visited our hospital for regular medical check-up for aplastic anemia, she was hospitalized and given antibiotic therapy, including ABPC, without delay. With this effective antibiotic therapy and successful management of the co-existing medical conditions, she was cured except for being a little euphoric. Lm meningitis is known to occur in aged and immunocompromised patients. Since most of the atomic bomb survivors are now aged and the prevalence of malignancy, diabetes mellitus, and other diseases which cause immunodeficiency have been rising year by year, Lm meningitis is one of the emergency neurologic conditions whose diagnosis should not be delayed in this population. (author).
International Nuclear Information System (INIS)
Fujihara, Kazuo; Shida, Norihiko; Ohta, Michiya
1995-01-01
We report a case of successfully treated Listeria monocytogenes (Lm) meningitis in a atomic bomb survivor receiving steroid therapy for aplastic anemia. The patient was a 62-year-old woman and the past medical history included hypothyroidism due to radioiodide therapy for Basedow disease, breast cancer, aplastic anemia, steroid-induced diabetes mellitus, and pulmonary tuberculosis. At the time of onset, she was receiving corticosteroid, anabolic steroid, an H 2 -blocker (famotidine), and other medication. Since she developed symptoms of meningitis when she visited our hospital for regular medical check-up for aplastic anemia, she was hospitalized and given antibiotic therapy, including ABPC, without delay. With this effective antibiotic therapy and successful management of the co-existing medical conditions, she was cured except for being a little euphoric. Lm meningitis is known to occur in aged and immunocompromised patients. Since most of the atomic bomb survivors are now aged and the prevalence of malignancy, diabetes mellitus, and other diseases which cause immunodeficiency have been rising year by year, Lm meningitis is one of the emergency neurologic conditions whose diagnosis should not be delayed in this population. (author)
The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.
Grounta, Athena; Harizanis, Paschalis; Mylonakis, Eleftherios; Nychas, George-John E; Panagou, Efstathios Z
2016-01-01
The use of Galleria mellonella as a model host to elucidate microbial pathogenesis and search for novel drugs and therapies has been well appreciated over the past years. However, the effect of microorganisms with functional appeal in the specific host remains scarce. The present study investigates the effect of treatment with selected lactic acid bacteria (LAB) with probiotic potential, as potential protective agents by using live or heat-killed cells at 6 and 24 h prior to infection with Listeria monocytogenes and Staphylococcus aureus or as potential therapeutic agents by using cell-free supernatants (CFS) after infection with the same pathogens. The employed LAB strains were Lactobacillus pentosus B281 and Lactobacillus plantarum B282 (isolated from table olive fermentations) along with Lactobacillus rhamnosus GG (inhabitant of human intestinal tract). Kaplan-Meier survival curves were plotted while the pathogen's persistence in the larval hemolymph was determined by microbiological analysis. It was observed that the time (6 or 24 h) and type (live or heat-killed cells) of challenge period with LAB prior to infection greatly affected the survival of infected larvae. The highest decrease of L. monocytogenes population in the hemolymph was observed in groups challenged for 6 h with heat-killed cells by an average of 1.8 log units compared to non challenged larvae for strains B281 (p 0.0322), B282 (p 0.0325), and LGG (p 0.0356). In the case of S. aureus infection, the population of the pathogen decreased in the hemolymph by 1 log units at 8 h post infection in the groups challenged for 6 h with heat-killed cells of strains B281 (p 0.0161) and B282 (p 0.0096) and by 1.8 log units in groups challenged with heat-killed cells of LGG strain (p 0.0175). Further use of CFS of each LAB strain did not result in any significant prolonged survival but interestingly it resulted in pronounced decrease of L. monocytogenes in the hemolymph at 24 h and 48 h after infection by
[Virulent gene prevalence of foodborne Listeria monocytogenes in China in 2005].
Yang, Yang; Fu, Ping; Guo, Yun-Chang; Pei, Xiao-Yan; Liu, Xiu-Mei
2010-12-01
To study the virulent gene prevalence of foodborne Listeria monocytogenes (LM) isolated from China. 78 LM isolates derived from raw meat, cooked food, aquatic products and vegetables of 13 provinces and cities.LM isolates were investigated for prevalence of virulence genes (LIPI-1 (prfA, plcA, hly, mpl, actA, plcB); LIPI-2 (inlA, inlB), and iap) by PCR method. 87.2% (68/78) of the isolates were prfA positive, 98.7% (77/78) of the isolates were plcA, actA and plcB positive, 97.4% (76/78) of the isolates were hly positive, 87.2% (68/78) of the isolates were mpl positive, 92.3% (72/78) of the isolates were inlA positive, 100% (78/78) of the isolates were inlB positive, 98.7% (77/78) of the isolates were iap positive. Among 21 virulent gene negative isolates, there was 7 isolates lack of two or more virulence genes. The rate of virulence genes deletion isolates from cooked meat was 31.3% (10/32), the rate of virulence genes deletion isolates from raw meat was 16.1% (5/31), the rate of virulence genes deletion isolates from vegetables was 36.4% (4/11) and rate of virulence genes deletion isolates from seafood was 50% (2/4). No significant difference was found (χ(2) = 3.721, P > 0.05). The virulence gene array-1 strains were dominant among these isolates. Among 78 LM isolates, prevalent of virulent genes were different except inlB, virulence genes of LIP-1 were deleted prevalently among isolates, virulence gene deletion patterns were diverse.
How the study of Listeria monocytogenes has led to new concepts in biology.
Rolhion, Nathalie; Cossart, Pascale
2017-06-01
The opportunistic intracellular bacterial pathogen Listeria monocytogenes has in 30 years emerged as an exceptional bacterial model system in infection biology. Research on this bacterium has provided considerable insight into how pathogenic bacteria adapt to mammalian hosts, invade eukaryotic cells, move intracellularly, interfere with host cell functions and disseminate within tissues. It also contributed to unveil features of normal host cell pathways and unsuspected functions of previously known cellular proteins. This review provides an updated overview of our knowledge on this pathogen. In many examples, findings on L. monocytogenes provided the basis for new concepts in bacterial regulation, cell biology and infection processes.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B H; Ingmer, H
2001-01-01
Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur
Wemekamp-Kamphuis, H.H.; Abee, T.
2004-01-01
Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat
Variations in virulence between different electrophoretic types of Listeria monocytogenes
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk
2000-01-01
A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....
Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig
2016-07-16
The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic
The objective of this study was to determine the effect of strain and temperature on growth and biofilm formation by Listeria monocytogenes (Lm) in high and low concentrations of catfish mucus extract on different food-contact surfaces at 10°C and 22°C. The second objective of this study was to eval...
Queiroz, M L; Quadros, M R; Santos, L M
2000-08-01
In this work, we investigated the effects of Petiveria alliacea extract on the production of Th1-type and Th2-type cytokines and on NK cells activity in normal and Listeria monocytogenes infected mice. Our results demonstrated that in normal/non-infected mice P. alliacea administration led to increased levels of Interleukin-2 (IL-2). The infection alone enhanced INF-gamma levels and NK cell activity at 48 and 72 hours of infection. The treatment with five consecutive doses of 1000 mg/kg/day of P. alliacea extract, given previously to infection, led to further increases in IL-2 levels, in relation to normal/non-infected/P. alliacea treated controls, and in INF-gamma levels at 72 h of infection, compared to infected mice. On the other hand, the production of IL-4 and IL-10 were not altered either by the infection or by the treatment with P. alliacea extract. NK cells activity increased at 48 h and 72 h following the inoculation of the bacteria. When mice were treated with P. alliacea previously to infection, NK activity was higher than that observed at 48 h, 72 h and 120 h of infection in the infected animal. Based on these findings we suggest that P. alliacea up-regulates anti-bacterial immune response by enhancing both Th1 function and the activity of NK cells.
Vadia, Stephen; Seveau, Stephanie
2014-03-01
Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.
Directory of Open Access Journals (Sweden)
Athena Grounta
Full Text Available The use of Galleria mellonella as a model host to elucidate microbial pathogenesis and search for novel drugs and therapies has been well appreciated over the past years. However, the effect of microorganisms with functional appeal in the specific host remains scarce. The present study investigates the effect of treatment with selected lactic acid bacteria (LAB with probiotic potential, as potential protective agents by using live or heat-killed cells at 6 and 24 h prior to infection with Listeria monocytogenes and Staphylococcus aureus or as potential therapeutic agents by using cell-free supernatants (CFS after infection with the same pathogens. The employed LAB strains were Lactobacillus pentosus B281 and Lactobacillus plantarum B282 (isolated from table olive fermentations along with Lactobacillus rhamnosus GG (inhabitant of human intestinal tract. Kaplan-Meier survival curves were plotted while the pathogen's persistence in the larval hemolymph was determined by microbiological analysis. It was observed that the time (6 or 24 h and type (live or heat-killed cells of challenge period with LAB prior to infection greatly affected the survival of infected larvae. The highest decrease of L. monocytogenes population in the hemolymph was observed in groups challenged for 6 h with heat-killed cells by an average of 1.8 log units compared to non challenged larvae for strains B281 (p 0.0322, B282 (p 0.0325, and LGG (p 0.0356. In the case of S. aureus infection, the population of the pathogen decreased in the hemolymph by 1 log units at 8 h post infection in the groups challenged for 6 h with heat-killed cells of strains B281 (p 0.0161 and B282 (p 0.0096 and by 1.8 log units in groups challenged with heat-killed cells of LGG strain (p 0.0175. Further use of CFS of each LAB strain did not result in any significant prolonged survival but interestingly it resulted in pronounced decrease of L. monocytogenes in the hemolymph at 24 h and 48 h after
Expression of Leishmania major LmSTI1 in Yeast Pichia Pastoris
Directory of Open Access Journals (Sweden)
Mehdi Shokri
2017-01-01
Full Text Available Background: Leishmania major LmSTI1 is a conserved protein among different species of leishmania, and expressed in both amastigote and promastigote forms of L. major life cycle. It has previously been expressed in bacterial systems.Materials and Methods: To express LmSTI1 in the methylotrophic yeast Pichia pastoris (P. pastoris, the shuttle vector pPICZA containing gene lmsti1 was constructed under the control of the AOX1 promoter. The recombinant vector was electro-transformed into P. pastoris, and induced by 0.5% methanol in the buffered medium. The expression of the LmSTI1 protein was visualized in the total soluble protein of P. pastoris by 12% SDS-PAGE, and further confirmed by Western blotting with L.major-infected mouse sera and HRP-conjugated goat anti-mouse IgG as the first and secondary antibodies, respectively.Results: The expression level was 0.2% of total soluble proteins.Conclusion: It might be possible to use this formulation as a whole yeast candidate vaccine against cutaneous leishmanization.
Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier
2017-07-04
Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.
PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD
Directory of Open Access Journals (Sweden)
Imad al Kassaa
2016-06-01
Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.
Hildebrandt, P; Greinert, R; Stier, A; Taniguchi, H
1989-12-08
The isozymes 2 and 4 of rabbit microsomal cytochrome P-450 (LM2, LM4) have been studied by resonance Raman spectroscopy. Based on high quality spectra, a vibrational assignment of the porphyrin modes in the frequency range between 100-1700 cm-1 is presented for different ferric states of cytochrome P-450 LM2 and LM4. The resonance Raman spectra are interpreted in terms of the spin and ligation state of the heme iron and of heme-protein interactions. While in cytochrome P-450 LM2 the six-coordinated low-spin configuration is predominantly occupied, in the isozyme LM4 the five-coordinated high-spin form is the most stable state. The different stability of these two spin configurations in LM2 and LM4 can be attributed to the structures of the active sites. In the low-spin form of the isozymes LM4 the protein matrix forces the heme into a more rigid conformation than in LM2. These steric constraints are removed upon dissociation of the sixth ligand leading to a more flexible structure of the active site in the high-spin form of the isozyme LM4. The vibrational modes of the vinyl groups were found to be characteristic markers for the specific structures of the heme pockets in both isozymes. They also respond sensitively to type-I substrate binding. While in cytochrome P-450 LM4 the occupation of the substrate-binding pocket induces conformational changes of the vinyl groups, as reflected by frequency shifts of the vinyl modes, in the LM2 isozyme the ground-state conformation of these substituents remain unaffected, suggesting that the more flexible heme pocket can accommodate substrates without imposing steric constraints on the porphyrin. The resonance Raman technique makes structural changes visible which are induced by substrate binding in addition and independent of the changes associated with the shift of the spin state equilibrium: the high-spin states in the substrate-bound and substrate-free enzyme are structurally different. The formation of the inactive form
Directory of Open Access Journals (Sweden)
Cronin Michael
2008-06-01
Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.
Directory of Open Access Journals (Sweden)
Hurtado Ana
2009-01-01
Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone
2014-01-01
Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....
Directory of Open Access Journals (Sweden)
Kubicová Z.
2017-03-01
Full Text Available The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB” in 2012 led by the European Union Reference Laboratory (EURL for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Food Safety, France in close collaboration with Applied Maths. This database includes the typing results and epidemiological information on strains isolated from food, environmental or animal samples and it is in connection with human strains database TESSy (The European Surveillance System led by the ECDC (European Centre for Disease Prevention and Control. In total 147 L. monocytogenes isolates were examined by PFGE (pulsed field gel electrophoresis in 2014—2015 in VFI Dolny Kubin from different sources. Nearly half (68 of the 147 isolates in the national Slovak database came from milk or dairy products samples and the related manufacturing environment. In this work, 68 isolates associated with milk were selected and divided into 27 clusters (95 % similarity level after combined comparison analysis (AscI and ApaI by BioNumerics 6.6 software. Eight clusters included three or more similar PFGE profiles.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B. H.; Ingmer, H.
2001-01-01
of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
Schrama, D; Helliwell, N; Neto, L; Faleiro, M L
2013-06-01
The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.
Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.
Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger
2017-04-01
In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.
Directory of Open Access Journals (Sweden)
Lior Lobel
2012-09-01
Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.
Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto
2017-11-01
Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.
Cui, H Y; Wu, J; Lin, L
2016-08-01
Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C
2017-02-01
Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease
Casco, Gerardo; Johnson, Jennifer L; Taylor, T Matthew; Gaytán, Carlos N; Brashears, Mindy M; Alvarado, Christine Z
2015-01-01
This study evaluated the efficacy of organic acids applied singly or in combination as postlethality dips to sliced uncured turkey deli loaves to inhibit the growth of Listeria monocytogenes (Lm) Scott A. Treatments consisted of sodium lactate (SL; 3.6%), potassium lactate (PL; 3.6%), sodium citrate (SC; 0.75%), a combination of SL and sodium diacetate (SDA; 0.25%), and a combination of SL/PL/SDA, alongside appropriate negative and positive controls. Products were inoculated with 10(4)-10(5) CFU/mL streptomycin-resistant (1500 μg/mL) Lm Scott A prior to treatment. Products were then stored at ~4°C and sampled at 0, 7, 14, 21, 28, 42, and 56 d. The SL/SDA combination applied to turkey slices extended the lag phase through 21 days of refrigerated storage. Numbers of Lm Scott A rose by 0.7 log10 CFU/g through the 56 d storage period. The application of the SL/PL/SDA treatment to turkey product surfaces extended the lag phase through 42 d, with pathogen numbers declining after 21 d. Combination organic acid dips prolonged the lag phase for 2 to 6 wk on turkey product surfaces and can be useful as antimicrobial agents for Lm control on postlethality exposed sliced deli products.
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-10-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena
2017-09-05
Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.
Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.
Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando
2012-01-01
Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L
Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano
2016-06-01
Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset
Directory of Open Access Journals (Sweden)
Jin-Qiang Chen
2017-09-01
Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.
Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
Lin, Chen-Si; Wang, Chinling; Tsai, Hsiang-Jung; Chou, Chung-Hsi
2010-11-15
It remains unclear whether the growth of Listeria monocytogenes on a ready-to-eat (RTE) meat matrix has an impact on the bacterium's pathogenic abilities. In this study, we investigated the impact of environments on virulence by growing L. monocytogenes (F2365 strain) on brain heart infusion agar (BHI), tryptic soy agar (TSA), and RTE turkey meat matrices. Bacteria cultured from these media were harvested and used to infect mouse macrophage cell line J774A.1 with different MOIs to examine their invasion ability. At MOI=10 and 50, the numbers of bacteria recovered from cells infected with turkey-meat-grown Listeria were significantly higher than those from the two nutrient-rich growth media. Additionally, MOI played a role in determining L. monocytogenes recovery rates, since significant differences were found amongst all three groups at low MOI, while no significant differences were found between BHI and TSA groups at high MOI. These results indicate that environmental changes affect the ability of L. monocytogenes to invade and survive intracellularly while grown on RTE-meat matrix. Copyright © 2010 Elsevier B.V. All rights reserved.
Cirkovic, Ivana; Bozic, Dragana D; Draganic, Veselin; Lozo, Jelena; Beric, Tanja; Kojic, Milan; Arsic, Biljana; Garalejic, Eliana; Djukic, Slobodanka; Stankovic, Slavisa
2016-01-01
Coagulase negative staphylococci (CoNS) and Listeria monocytogenes have important roles in pathogenesis of various genital tract infections and fatal foetomaternal infections, respectively. The aim of our study was to investigate the inhibitory effects of two novel bacteriocins on biofilms of CoNS and L. monocytogenes genital isolates. The effects of licheniocin 50.2 from Bacillus licheniformis VPS50.2 and crude extract of bacteriocins produced by Lactococcus lactis subsp. lactis biovar. diacetylactis BGBU1-4 (BGBU1-4 crude extract) were evaluated on biofilm formation and formed biofilms of eight CoNS (four S. epidermidis, two S. hominis, one S. lugdunensis and one S. haemolyticus) and 12 L. monocytogenes genital isolates. Licheniocin 50.2 and BGBU1-4 crude extract inhibited the growth of both CoNS and L. monocytogenes isolates, with MIC values in the range between 200-400 AU/ml for licheniocin 50.2 and 400-3200 AU/ml for BGBU1-4 crude extract. Subinhibitory concentrations (1/2 × and 1/4 × MIC) of licheniocin 50.2 inhibited biofilm formation by all CoNS isolates (p < 0.05, respectively), while BGBU1-4 crude extract inhibited biofilm formation by all L. monocytogenes isolates (p < 0.01 and p < 0.05, respectively). Both bacteriocins in concentrations of 100 AU/mL and 200 AU/mL reduced the amount of 24 h old CoNS and L. monocytogenes biofilms (p < 0.05, p < 0.01, p < 0.001). This study suggests that novel bacteriocins have potential to be used for genital application, to prevent biofilm formation and/or to eradicate formed biofilms, and consequently reduce genital and neonatal infections by CoNS and L. monocytogenes.
Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.
2017-01-01
The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987
Learning LM Specificity for Ganglion Cells
Ahumada, Albert J.
2015-01-01
Unsupervised learning models have been proposed based on experience (Ahumada and Mulligan, 1990;Wachtler, Doi, Lee and Sejnowski, 2007) that allow the cortex to develop units with LM specific color opponent receptive fields like the blob cells reported by Hubel and Wiesel on the basis of visual experience. These models used ganglion cells with LM indiscriminate wiring as inputs to the learning mechanism, which was presumed to occur at the cortical level.
Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.
NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P
2018-03-01
Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8 CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4 CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.
Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J
2017-08-01
To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.
How Listeria monocytogenes organizes its surface for virulence
Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier
2014-01-01
Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022
2014-01-01
The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012
Haaser, Fred G.
2006-01-01
The LM2500+ industrial aeroderivative gas turbine, a 25% enhanced power derivative of the LM2500 gas turbine, recently completed its development test program during the period 5/96 - 10/96. Early in the engine program a Quality Function Deployment (QFD) process was used to determine customer needs for this project.The feedback obtained from the QFD process showed without doubt that gas turbine customers now emphasize product reliability and availability at the top of their needs. One area of development on the LM2500+ was to investigate the use of a brush seal as a means to reduce undesirable turbine cooling leakages within the turbine mid frame in order to enhance part life. This presentation presents a case study on the factors that went into evaluating a brush seal during engine test, test results, and the ultimate decision not to implement the brush seal for cost and other reasons.
Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.
Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M
2016-12-01
The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Directory of Open Access Journals (Sweden)
Jessica A. Gray
2018-04-01
Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
Directory of Open Access Journals (Sweden)
Hain Torsten
2012-04-01
Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G
1997-09-01
Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.
Thønnings, S; Knudsen, J D; Schønheyder, H C; Søgaard, M; Arpi, M; Gradel, K O; Østergaard, C
2016-08-01
Invasive Listeria monocytogenes infections carry a high mortality despite antibiotic treatment. The rareness of the infection makes it difficult to improve antibiotic treatment through randomized clinical trials. This observational study investigated clinical features and outcome of invasive L. monocytogenes infections including the efficacy of empiric and definitive antibiotic therapies. Demographic, clinical and biochemical findings, antibiotic treatment and 30-day mortality for all episodes of L. monocytogenes bacteraemia and/or meningitis were collected by retrospective medical record review in the North Denmark Region and the Capital Region of Denmark (17 hospitals) from 1997 to 2012. Risk factors for 30-day all-cause mortality were assessed by logistic regression. The study comprised 229 patients (median age: 71 years), 172 patients had bacteraemia, 24 patients had meningitis and 33 patients had both. Significant risk factors for 30-day mortality were septic shock (OR 3.0, 95% CI 1.4-6.4), altered mental state (OR 3.6, 95% CI 1.7-7.6) and inadequate empiric antibiotic therapy (OR 3.8, 95% CI 1.8-8.1). Cephalosporins accounted for 90% of inadequately treated cases. Adequate definitive antibiotic treatment was administered to 195 patients who survived the early period (benzylpenicillin 72, aminopenicillin 84, meropenem 28, sulfamethoxazole/trimethoprim 6, and piperacillin/tazobactam 5). Definitive antibiotic treatment with benzylpenicillin or aminopenicillin resulted in a lower 30-day mortality in an adjusted analysis compared with meropenem (OR 0.3; 95% CI 0.1-0.8). In conclusion, inadequate empiric antibiotic therapy and definitive therapy with meropenem were both associated with significantly higher 30-day mortality. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Meeker, Rick B; Poulton, Winona; Feng, Wen-hai; Hudson, Lola; Longo, Frank M
2012-06-01
Feline immunodeficiency virus (FIV) infection like human immunodeficiency virus (HIV), produces systemic and central nervous system disease in its natural host, the domestic cat, that parallels the pathogenesis seen in HIV-infected humans. The ability to culture feline nervous system tissue affords the unique opportunity to directly examine interactions of infectious virus with CNS cells for the development of models and treatments that can then be translated to a natural infectious model. To explore the therapeutic potential of a new p75 neurotrophin receptor ligand, LM11A-31, we evaluated neuronal survival, neuronal damage and calcium homeostasis in cultured feline neurons following inoculation with FIV. FIV resulted in the gradual appearance of dendritic beading, pruning of processes and shrinkage of neuronal perikarya in the neurons. Astrocytes developed a more activated appearance and there was an enhanced accumulation of microglia, particularly at longer times post-inoculation. Addition of 10 nM LM11A-31, to the cultures greatly reduced or eliminated the neuronal pathology as well as the FIV effects on astrocytes and microglia. LM11A-31 also, prevented the development of delayed calcium deregulation in feline neurons exposed to conditioned medium from FIV treated macrophages. The suppression of calcium accumulation prevented the development of foci of calcium accumulation and beading in the dendrites. FIV replication was unaffected by LM11A-31. The strong neuroprotection afforded by LM11A-31 in an infectious in vitro model indicates that LM11A-31 may have excellent potential for the treatment of HIV-associated neurodegeneration.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale
2004-04-20
Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.
Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.
Redfern, J; Verran, J
2017-04-01
Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.
DEFF Research Database (Denmark)
Andersen, Jens Bo; Roldgaard, Bent; Lindner, A. B.
2006-01-01
strains at the single cell level by use of fluorescence microscopy. More than 90% of the L. monocytogenes host cells maintained the fluorescence tags for 40 generations. The fluorescence tags did not alter the invasive capacity of the L. monocytogenes cells in a traditional Caco-2 cell invasion assay......, and visual discrimination between invaded bacteria carrying different fluorescent labels inside the cells was possible. Conclusion The constructed fluorescent marker system is stable, easy to use, does not affect the virulence of L. monocytogenes in Caco-2 cell assays, and allows discrimination between...... deviations in the observed capacity for infection when animal models are used. One way to circumvent this problem is to carry out virulence studies as competition assays between 2 or more strains. This, however, requires invasion-neutral markers that enable easy discrimination between the different strains...
NicAogáin, Kerrie; O'Byrne, Conor P
2016-01-01
The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.
NicAogáin, Kerrie; O’Byrne, Conor P.
2016-01-01
The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042
Listeria monocytogenes: Overview and Targeting Advances
Directory of Open Access Journals (Sweden)
Mostafa F.N. Abushahba
2016-04-01
Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.
Shrimali, Rajeev; Ahmad, Shamim; Berrong, Zuzana; Okoev, Grigori; Matevosyan, Adelaida; Razavi, Ghazaleh Shoja E; Petit, Robert; Gupta, Seema; Mkrtichyan, Mikayel; Khleif, Samir N
2017-08-15
We previously demonstrated that in addition to generating an antigen-specific immune response, Listeria monocytogenes (Lm)-based immunotherapy significantly reduces the ratio of regulatory T cells (Tregs)/CD4 + and myeloid-derived suppressor cells (MDSCs) in the tumor microenvironment. Since Lm-based immunotherapy is able to inhibit the immune suppressive environment, we hypothesized that combining this treatment with agonist antibody to a co-stimulatory receptor that would further boost the effector arm of immunity will result in significant improvement of anti-tumor efficacy of treatment. Here we tested the immune and therapeutic efficacy of Listeria-based immunotherapy combination with agonist antibody to glucocorticoid-induced tumor necrosis factor receptor-related protein (GITR) in TC-1 mouse tumor model. We evaluated the potency of combination on tumor growth and survival of treated animals and profiled tumor microenvironment for effector and suppressor cell populations. We demonstrate that combination of Listeria-based immunotherapy with agonist antibody to GITR synergizes to improve immune and therapeutic efficacy of treatment in a mouse tumor model. We show that this combinational treatment leads to significant inhibition of tumor-growth, prolongs survival and leads to complete regression of established tumors in 60% of treated animals. We determined that this therapeutic benefit of combinational treatment is due to a significant increase in tumor infiltrating effector CD4 + and CD8 + T cells along with a decrease of inhibitory cells. To our knowledge, this is the first study that exploits Lm-based immunotherapy combined with agonist anti-GITR antibody as a potent treatment strategy that simultaneously targets both the effector and suppressor arms of the immune system, leading to significantly improved anti-tumor efficacy. We believe that our findings depicted in this manuscript provide a promising and translatable strategy that can enhance the overall
Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo
2015-07-02
Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
Colás-Medà, Pilar; Viñas, Inmaculada; Oliveira, Márcia; Anguera, Marina; Serrano, Jose C E; Abadias, Maribel
2017-04-01
Survival and virulence of foodborne pathogens can be influenced by environmental factors such as the intrinsic properties of food as well as the extrinsic properties that contribute to food shelf life (e.g., temperature and gas atmosphere). The direct contribution of food matrix characteristics on the survival of L. monocytogenes during fresh-cut fruit shelf life is not very well understood. In addition, the gastrointestinal tract is the primary route of listeriosis infection and penetration of the intestinal epithelial cell barrier is the first step in the infection process. Hence, the pathogenic potential of L. monocytogenes, measured as the capability for the organism to survive a simulated gastrointestinal tract and the proportion of cells able to subsequently adhere to and invade differentiated Caco-2 cells, subjected to fresh-cut pear and melon shelf life, was investigated. Samples were inoculated, stored at 10 °C for 7 days and evaluated after inoculation and again after 2 and 7 days of storage. A decrease in L. monocytogenes' capacity to survive a simulated gastrointestinal tract was observed with increasing storage time, regardless of the fruit matrix evaluated. Furthermore, L. monocytogenes placed on fresh-cut pear and melon was subjected to an attachment and invasion assay after crossing the simulated gastrointestinal tract. After inoculation, pathogen on fresh-cut pear showed 5-fold more capacity to adhere to Caco-2 cells than pathogen on fresh-cut melon. After 2 days of storage, L. monocytogenes grown on fresh-cut melon showed similar adhesive capacity (1.11%) than cells grown on pear (1.83%), but cells grown on melon had the higher invasive capacity (0.0093%). We can conclude that minimally processed melon could represent a more important hazard than pear under the studied shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.
CloudLM: a Cloud-based Language Model for Machine Translation
Directory of Open Access Journals (Sweden)
Ferrández-Tordera Jorge
2016-04-01
Full Text Available Language models (LMs are an essential element in statistical approaches to natural language processing for tasks such as speech recognition and machine translation (MT. The advent of big data leads to the availability of massive amounts of data to build LMs, and in fact, for the most prominent languages, using current techniques and hardware, it is not feasible to train LMs with all the data available nowadays. At the same time, it has been shown that the more data is used for a LM the better the performance, e.g. for MT, without any indication yet of reaching a plateau. This paper presents CloudLM, an open-source cloud-based LM intended for MT, which allows to query distributed LMs. CloudLM relies on Apache Solr and provides the functionality of state-of-the-art language modelling (it builds upon KenLM, while allowing to query massive LMs (as the use of local memory is drastically reduced, at the expense of slower decoding speed.
Energy Technology Data Exchange (ETDEWEB)
Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)
2015-03-15
Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.
Xu, Benhong; Gao, Yanpan; Zhan, Shaohua; Ge, Wei
2017-07-01
Lysosomes play vital roles in both innate and adaptive immunity. It is widely accepted that lysosomes do not function exclusively as a digestive organelle. It is also involved in the process of immune cells against pathogens. However, the changes in the lysosomal proteome caused by infection with various microbes are still largely unknown, and our understanding of the proteome of the purified lysosome is another obstacle that needs to be resolved. Here, we performed a proteomic study on lysosomes enriched from THP1 cells after infection with Listeria monocytogenes (L.m), Herpes Simplex Virus 1 (HSV-1) and Vesicular Stomatitis Virus (VSV). In combination with the gene ontology (GO) analysis, we identified 284 lysosomal-related proteins from a total of 4560 proteins. We also constructed the protein-protein interaction networks for the differentially expressed proteins and revealed the core lysosomal proteins, including SRC in the L. m treated group, SRC, GLB1, HEXA and HEXB in the HSV-1 treated group and GLB1, CTSA, CTSB, HEXA and HEXB in the VSV treated group, which are involved in responding to diverse microbial infections. This study not only reveals variable lysosome responses depending on the bacterial or virus infection, but also provides the evidence based on which we propose a novel approach to proteome research for investigation of the function of the enriched organelles. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ryan Chong
Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin
Directory of Open Access Journals (Sweden)
Gopala K. Mannala
2017-12-01
Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
Directory of Open Access Journals (Sweden)
Federico Lari
2012-10-01
Full Text Available Introduction The appearance of neurological disorders in a patient with liver cirrhosis initially suggests hepatic encephalopathy, but other causes should be considered, including bacterial infections.Materials and methods An 80-year-old woman suffering from HCV-related cirrhosis was admitted for fever, confusion, and stupor. No improvement was seen after treatment with cephalosporins, lactulose, and fluids.Results Listeria monocytogenes was isolated from blood cultures and subsequently from a cerebrospinal fluid specimen as well. On the basis of the antibiogram, the antibiotic therapy was modified to include ampicillin, but shock and multiorgan failure developed and the patient died one week later.Discussion Bacterial infections are more common and more aggressive in patients with liver cirrhosis, probably because of the immune dysfunction associated with this disorder. The presence of neurological disorders in a patient with liver cirrhosis may be a sign of hepatic encephalopathy, but it is important to recall that there are other potential causes as well, including bacterial infections. In this case, it is possible that the patient's symptoms were the result of the CNS infection with L. monocytogenes, which was particularly aggressive as a result of her cirrhosis.
Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.
Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal
2015-08-01
In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan
2009-03-01
The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.
Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Michael Vincent F. Tablang
2008-11-01
Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.
ISG15 counteracts Listeria monocytogenes infection
Radoshevich, Lilliana; Impens, Francis; Ribet, David; Quereda, Juan J; Nam Tham, To; Nahori, Marie-Anne; Bierne, Hélène; Dussurget, Olivier; Pizarro-Cerdá, Javier; Knobeloch, Klaus-Peter; Cossart, Pascale
2015-01-01
ISG15 is an interferon-stimulated, linear di-ubiquitin-like protein, with anti-viral activity. The role of ISG15 during bacterial infection remains elusive. We show that ISG15 expression in nonphagocytic cells is dramatically induced upon Listeria infection. Surprisingly this induction can be type I interferon independent and depends on the cytosolic surveillance pathway, which senses bacterial DNA and signals through STING, TBK1, IRF3 and IRF7. Most importantly, we observed that ISG15 expression restricts Listeria infection in vitro and in vivo. We made use of stable isotope labeling in tissue culture (SILAC) to identify ISGylated proteins that could be responsible for the protective effect. Strikingly, infection or overexpression of ISG15 leads to ISGylation of ER and Golgi proteins, which correlates with increased secretion of cytokines known to counteract infection. Together, our data reveal a previously uncharacterized ISG15-dependent restriction of Listeria infection, reinforcing the view that ISG15 is a key component of the innate immune response. DOI: http://dx.doi.org/10.7554/eLife.06848.001 PMID:26259872
Szymczak, Barbara; Dąbrowski, Waldemar
2015-05-01
The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Listeria monocytogenes as a vector for anti-cancer therapies.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.
Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood
DEFF Research Database (Denmark)
Jørgensen, Lasse Vigel; Huss, Hans Henrik
1998-01-01
Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...
Multiple cortical brain abscesses due to Listeria monocytogenes in an immunocompetent patient.
Khan, Sadia; Kumar, Anil; Kale, Satyajit; Kurkure, Nitin; Nair, Gulsiv; Dinesh, Kavitha
2018-04-01
Listeria monocytogenes is an intracellular organism which is well recognised for its ability to cause meningeal infections in neonates, immunosuppressed, debilitated and elderly individuals. 1 Other less common central nervous system (CNS) infections caused by Listeria spp. include rhomboencephalitis, cerebritis and abscesses in the brain, brain stem and spinal cord. The neuroradiological appearance of Listeria brain abscesses is similar to other types and may also mimic primary or metastatic brain tumours. 2 , 3 We report a case of Listeria brain abscesses in a patient who was being treated for atypical parkinsonism. A good clinical outcome was achieved after appropriate antimicrobial therapy.
Mitchell, Gabriel
2017-01-01
Listeria monocytogenes causes listeriosis, a foodborne disease that poses serious risks to fetuses, newborns and immunocompromised adults. This intracellular bacterial pathogen proliferates in the host cytosol and exploits the host actin polymerization machinery to spread from cell-to-cell and disseminate in the host. Here, we report that during several days of infection in human hepatocytes or trophoblast cells, L. monocytogenes switches from this active motile lifestyle to a stage of persistence in vacuoles. Upon intercellular spread, bacteria gradually stopped producing the actin-nucleating protein ActA and became trapped in lysosome-like vacuoles termed Listeria-Containing Vacuoles (LisCVs). Subpopulations of bacteria resisted degradation in LisCVs and entered a slow/non-replicative state. During the subculture of host cells harboring LisCVs, bacteria showed a capacity to cycle between the vacuolar and the actin-based motility stages. When ActA was absent, such as in ΔactA mutants, vacuolar bacteria parasitized host cells in the so-called “viable but non-culturable” state (VBNC), preventing their detection by conventional colony counting methods. The exposure of infected cells to high doses of gentamicin did not trigger the formation of LisCVs, but selected for vacuolar and VBNC bacteria. Together, these results reveal the ability of L. monocytogenes to enter a persistent state in a subset of epithelial cells, which may favor the asymptomatic carriage of this pathogen, lengthen the incubation period of listeriosis, and promote bacterial survival during antibiotic therapy. PMID:29190284
Liu, Z; Meng, R; Zhao, X; Shi, C; Zhang, X; Zhang, Y; Guo, N
2016-12-01
Listeria monocytogenes (L. monocytogenes) is a Gram-positive bacterium that causes infections in humans. In this study, the effects of tea tree oil (TTO) at subinhibitory concentrations on L. monocytogenes growth and two important exotoxin proteins secreted by L. monocytogenes were researched. Treatment with half of minimal inhibitory concentration of TTO demonstrated very little or no reduction in numbers of viable ATCC 19115 cells. Listeriolysin O (LLO) and p60, were investigated. A listeriolysin assay was used to investigate the hemolytic activities of L. monocytogenes exposed to TTO, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, real-time RT-PCR was used to analyse the influence of TTO on the transcription of LLO and p60 encoded genes hly and iap respectively. According to our experimental results, we propose that TTO could be used as a promising natural compound against L. monocytogenes and its virulence factors. This is the first report on the influence of subinhibitory concentrations of tea tree oil (TTO) on the secretion of listeriolysin O (LLO) and p60, the critical virulence factors involved in Listeria pathogenesis. The results showed that TTO at 0·25 mg ml -1 reduced the secretion of LLO and p60 to 10 and 34·9% respectively, in addtion, the transcription of hly and iap was reduced to 10 and 4·3% at 0·5 mg ml -1 respectively. We propose that TTO could be used as a promising antimicrobial compound and virulence inhibitor against L. monocytogenes. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Stephanie M. Meek
2018-02-01
Full Text Available While CD8+ memory T cells can promote long-lived protection from secondary exposure to intracellular pathogens, less is known regarding the direct protective mechanisms of CD4+ T cells. We utilized a prime/boost model in which mice are initially exposed to an acutely infecting strain of lymphocytic choriomeningitis virus (LCMV, followed by a heterologous rechallenge with Listeria monocytogenes recombinantly expressing the MHC Class II-restricted LCMV epitope, GP61–80 (Lm-gp61. We found that heterologous Lm-gp61 rechallenge resulted in robust activation of CD4+ memory T cells and that they were required for rapid bacterial clearance. We further assessed the relative roles of TNF and IFNγ in the direct anti-bacterial function of CD4+ memory T cells. We found that disruption of TNF resulted in a complete loss of protection mediated by CD4+ memory T cells, whereas disruption of IFNγ signaling to macrophages results in only a partial loss of protection. The protective effect mediated by CD4+ T cells corresponded to the rapid accumulation of pro-inflammatory macrophages in the spleen and an altered inflammatory environment in vivo. Overall, we conclude that protection mediated by CD4+ memory T cells from heterologous Listeria challenge is most directly dependent on TNF, whereas IFNγ only plays a minor role.
Directory of Open Access Journals (Sweden)
Michela Ibba
2013-09-01
Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.
Zwaferink, Heather; Stockinger, Silvia; Reipert, Siegfried; Decker, Thomas
2008-01-01
Murine macrophage death upon infection with Listeria monocytogenes was previously shown to be increased by beta interferon, produced by the infected cells. We saw that interferon-upregulated caspase activation or other interferon-inducible, death-associated proteins, including TRAIL, protein kinase R, and p53, were not necessary for cell death. Macrophage death was reduced when inducible nitric oxide synthase (iNOS) was inhibited during infection, and iNOS-deficient macrophages were less susc...
Energy Technology Data Exchange (ETDEWEB)
Bisacchi, Davide [Bioinformatics and Structural Proteomics, IST-National Cancer Research Institute, Genova (Italy); Zhou, Yao; Rosen, Barry P.; Mukhopadhyay, Rita [Department of Biochemistry and Molecular Biology, Wayne State University School of Medicine, Detroit, Michigan (United States); Bordo, Domenico, E-mail: domenico.bordo@istge.it [Bioinformatics and Structural Proteomics, IST-National Cancer Research Institute, Genova (Italy)
2006-10-01
LmACR2 from L. major is the first rhodanese-like enzyme directly involved in the reduction of arsenate and antimonate to be crystallized. Diffraction data have been collected to 1.99 Å resolution using synchrotron X-rays. Arsenic is present in the biosphere owing either to the presence of pesticides and herbicides used in agricultural and industrial activities or to leaching from geological formations. The health effects of prolonged exposure to arsenic can be devastating and may lead to various forms of cancer. Antimony(V), which is chemically very similar to arsenic, is used instead in the treatment of leishmaniasis, an infection caused by the protozoan parasite Leishmania sp.; the reduction of pentavalent antimony contained in the drug Pentostam to the active trivalent form arises from the presence in the Leishmania genome of a gene, LmACR2, coding for the protein LmACR2 (14.5 kDa, 127 amino acids) that displays weak but significant sequence similarity to the catalytic domain of Cdc25 phosphatase and to rhodanese enzymes. For structural characterization, LmACR2 was overexpressed, purified to homogeneity and crystallized in a trigonal space group (P321 or P3{sub 1}21/P3{sub 2}21). The protein crystallized in two distinct trigonal crystal forms, with unit-cell parameters a = b = 111.0, c = 86.1 Å and a = b = 111.0, c = 175.6 Å, respectively. At a synchrotron beamline, the diffraction pattern extended to a resolution limit of 1.99 Å.
International Nuclear Information System (INIS)
Bisacchi, Davide; Zhou, Yao; Rosen, Barry P.; Mukhopadhyay, Rita; Bordo, Domenico
2006-01-01
LmACR2 from L. major is the first rhodanese-like enzyme directly involved in the reduction of arsenate and antimonate to be crystallized. Diffraction data have been collected to 1.99 Å resolution using synchrotron X-rays. Arsenic is present in the biosphere owing either to the presence of pesticides and herbicides used in agricultural and industrial activities or to leaching from geological formations. The health effects of prolonged exposure to arsenic can be devastating and may lead to various forms of cancer. Antimony(V), which is chemically very similar to arsenic, is used instead in the treatment of leishmaniasis, an infection caused by the protozoan parasite Leishmania sp.; the reduction of pentavalent antimony contained in the drug Pentostam to the active trivalent form arises from the presence in the Leishmania genome of a gene, LmACR2, coding for the protein LmACR2 (14.5 kDa, 127 amino acids) that displays weak but significant sequence similarity to the catalytic domain of Cdc25 phosphatase and to rhodanese enzymes. For structural characterization, LmACR2 was overexpressed, purified to homogeneity and crystallized in a trigonal space group (P321 or P3 1 21/P3 2 21). The protein crystallized in two distinct trigonal crystal forms, with unit-cell parameters a = b = 111.0, c = 86.1 Å and a = b = 111.0, c = 175.6 Å, respectively. At a synchrotron beamline, the diffraction pattern extended to a resolution limit of 1.99 Å
Vinodhini, K.; Divya Bharathi, R.; Srinivasan, K.
2018-02-01
Lactose is an optically active substance. As it is one of the reducing sugars, exhibits mutarotation in solution when it dissolves in any solvent. In solution, lactose exists in two isomeric forms, alpha-Lactose (α-L) and beta-lactose (β-L) through the mutarotation reaction. Mutarotation produces a dynamic equilibrium between two isomers in a solution and kinetics of this process determines the growth rate of alpha lactose monohydrate (α-LM) crystals. Since no data were available on the specific rotation of aqueous α-LM solutions at different concentrations at 33 °C, the initial experiments were carried out on the specific rotation of aqueous α-LM solutions at different concentrations at 33 °C. The specific rotations of the solutions were decreased with increasing time through the mutarotation reaction. The initial and final (equilibrium) specific rotations of the solutions were determined by using automatic digital polarimeter. The compositions of α and β-L in all prepared solutions were calculated from initial and final optical rotations by the method of Sharp and Doob. The composition of α-L decreased whereas, the composition of β-L increased in solutions with increasing concentration of α-LM at 33 °C. Experimental results revealed that this method could be easily and safely employed to study the dependence of specific rotation of solutions on their concentration. The effect of β-lactose on the morphology of nucleated α-LM single crystals has been studied at different experimental conditions.
Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan
2012-02-01
The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.
Directory of Open Access Journals (Sweden)
Nilma Cintra Lea
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
Listeria monocytogenes Monographic Study
Directory of Open Access Journals (Sweden)
Emil Tirziu
2010-05-01
Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.
Meek, Stephanie M; Williams, Matthew A
2018-02-13
While CD8⁺ memory T cells can promote long-lived protection from secondary exposure to intracellular pathogens, less is known regarding the direct protective mechanisms of CD4⁺ T cells. We utilized a prime/boost model in which mice are initially exposed to an acutely infecting strain of lymphocytic choriomeningitis virus (LCMV), followed by a heterologous rechallenge with Listeria monocytogenes recombinantly expressing the MHC Class II-restricted LCMV epitope, GP 61-80 (Lm-gp61). We found that heterologous Lm-gp61 rechallenge resulted in robust activation of CD4⁺ memory T cells and that they were required for rapid bacterial clearance. We further assessed the relative roles of TNF and IFNγ in the direct anti-bacterial function of CD4⁺ memory T cells. We found that disruption of TNF resulted in a complete loss of protection mediated by CD4⁺ memory T cells, whereas disruption of IFNγ signaling to macrophages results in only a partial loss of protection. The protective effect mediated by CD4⁺ T cells corresponded to the rapid accumulation of pro-inflammatory macrophages in the spleen and an altered inflammatory environment in vivo. Overall, we conclude that protection mediated by CD4⁺ memory T cells from heterologous Listeria challenge is most directly dependent on TNF, whereas IFNγ only plays a minor role.
Directory of Open Access Journals (Sweden)
Behrooz Sadeghi kalani
2014-12-01
Full Text Available Background and Aim:Listeria monocytogenes cause listeriosis and fatal infections in humans. The aim of this study was typing and evaluation of the genetic relatedness of L. monocytogenes strains from food samples using MLVA technique. Materials and Methods: 317 food samples were collected from 2009 to 2013 in Tehran,Iran. After final diagnosis of L. monocytogenes DNA was extracted to perform of MLVA technique, and also PCR products were analyzed by Gene Tools software. The number of tandem repeats was determined by using special equation for each selected locus. Also typing of strains was done. Results: 24 samples of 317 food samples were positive for L. monocytogenes using standard laboratory techniques. A total 13 different types were determined by MLVA technique that type 2 and type 3 were the most abundant types by 6 and 4 strains, respectively. Conclusions: The results of this study showed the presence of L. monocytogenes in dairy products and meat samples, therefore all people, especially pregnant women should observe health tips when using these products. The results of typing showed that L. monocytogenes strains from different sources can have the same origin. MLVA technique is easy with high accuracy and this method can be used in typing and evaluation of the genetic relatedness of L. monocytogenes for determination the source of contamination.
DEFF Research Database (Denmark)
Severin, Gregory; Kristensen, Lotte K.; Nielsen, Carsten H.
2017-01-01
analogue, DOTA-LM3 (1,4,7,10- tetraazacyclododecane, 1,4,7- tri acetic acid, 10- acetamide N - p-Cl-Phecyclo(D-Cys-Tyr-d-4-amino-Phe(carbamoyl)-Lys-Thr-Cys)D-Tyr-NH2) and injected into H727 xenograft bearing mice. Comparative pre- and post-mortem PET imaging at 16 h postinjection was used to quantify......140Nd (t1/2 = 3.4 days), owing to its short-lived positron emitting daughter 140Pr (t1/2 = 3.4 min), has promise as an in vivo generator for positron emission tomography (PET). However, the electron capture decay of 140Nd is chemically disruptive to macrocycle-based radiolabeling, meaning...... the in vivo redistribution of 140Pr following 140Nd decay. The somatostatin receptor-positive pancreas exhibited the highest tissue accumulation of 140Nd-DOTA-LM3 (13% ID/g at 16 h) coupled with the largest observed redistribution rate, where 56 ± 7% (n = 4, mean ± SD) of the in situ produced 140Pr washed out...
exploration the extrudability of aluminum matrix composite (lm6/tic)
African Journals Online (AJOL)
lanez
2017-11-24
Nov 24, 2017 ... Aluminum matrix composites (LM6/TiC) is a mix of excellent properties of aluminum casting alloy (LM6), and particles of (TiC) which make it the first choice in many applications like airplane and marine industries. During this research the extrudability and mechanical specifications of this composite ...
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
Directory of Open Access Journals (Sweden)
Nilma Cintra Leal
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.
2018-01-01
Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736
Directory of Open Access Journals (Sweden)
Hélène Bierne
Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.
Day, J B; Basavanna, U
2015-04-01
Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.
Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P
2016-01-01
Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission
LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS
Directory of Open Access Journals (Sweden)
T Civera
2013-02-01
Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.
Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi
2017-09-18
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle
Technology Improvement for the High Reliability LM-2F Launch Vehicle
Institute of Scientific and Technical Information of China (English)
QIN Tong; RONG Yi; ZHENG Liwei; ZHANG Zhi
2017-01-01
The Long March 2F (LM-2F) launch vehicle,the only launch vehicle designed for manned space flight in China,successfully launched the Tiangong 2 space laboratory and the Shenzhou ll manned spaceship into orbits in 2016 respectively.In this study,it introduces the technological improvements for enhancing the reliability of the LM-2F launch vehicle in the aspects of general technology,control system,manufacture and ground support system.The LM2F launch vehicle will continue to provide more contributions to the Chinese Space Station Project with its high reliability and 100% success rate.
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
Electric utility system benefits of factory packaged GE LM Modular Generator sets
Energy Technology Data Exchange (ETDEWEB)
West, G.
1994-12-31
Electric utility system benefits of factory packaged GE LM modular generator sets are outlined. The following topics are discussed: GE LM gas turbine history, operating experience, maintenance, gas turbine spare engines, modular gas turbine generator sets, typical LM2500 cogeneration plant and STIG cycle plant, factory packaging concept, gas turbine/generator package, performance, comparison, competitive capital cost, phased construction, comparison of revenue requirements, capacity evaluation, heat rate evaluation, fuel evaluation, startup, and dispatch flexibility without maintenance penalty.
OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence
Directory of Open Access Journals (Sweden)
Andrzej Prokop
2017-10-01
Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.
Bento, Roberta A.; Stamford, Tânia L.M.; de Campos-Takaki, Galba M.; Stamford, Thayza C.M.; de Souza, Evandro L.
2009-01-01
Listeria monocytogenes is widely distributed in nature and the infection listeriosis is recognized as a potential threat for human health because of its mortality rate. The objective of this study was to evaluate the growth profile and chitosan production by Mucor rouxxi UCP 064 grown in yam bean (Pachyrhizus erosus L. Urban) medium. It was also to assess the anti-L. monocytogenes efficacy of the obtained chitosan. Higher values of biomass of M. rouxxi (16.9 g.L-1) and best yield of chitosan (62 mg.g-1) were found after 48 h of cultivation. Residual glucose and nitrogen in the growth media were 4.1 and 0.02 g.L-1 after 96 h, respectively. Obtained chitosan presented 85 % of degree of deacetylation and 2.60 x 104 g.mol-1 of viscosimetric molecular weight. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) values of chitosan against L. monocytogenes ATCC 7644 were, respectively, 2.5 and 5.0 mg.mL-1. At 2.5 and 5.0 mg.mL-1 chitosan caused cidal effect in a maximum time of 4 h. Bacterial count below 2 log cfu.mL-1 were found from 2 h onwards and no recovery in bacterial growth was noted in the remainder period. These results show the biotechnological potential of yam bean medium for chitosan production by Mucor rouxxi and support the possible rational use of chitosan from fungi as natural antimicrobial to control L. monocytogenes. PMID:24031403
Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi
2017-03-01
Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.
Antibiotic treatment and mortality in patients with Listeria monocytogenes meningitis or bacteraemia
DEFF Research Database (Denmark)
Thønnings, S; Knudsen, J D; Schønheyder, H C
2016-01-01
. monocytogenes infections including the efficacy of empiric and definitive antibiotic therapies. Demographic, clinical and biochemical findings, antibiotic treatment and 30-day mortality for all episodes of L. monocytogenes bacteraemia and/or meningitis were collected by retrospective medical record review...... in the North Denmark Region and the Capital Region of Denmark (17 hospitals) from 1997 to 2012. Risk factors for 30-day all-cause mortality were assessed by logistic regression. The study comprised 229 patients (median age: 71 years), 172 patients had bacteraemia, 24 patients had meningitis and 33 patients had...... both. Significant risk factors for 30-day mortality were septic shock (OR 3.0, 95% CI 1.4-6.4), altered mental state (OR 3.6, 95% CI 1.7-7.6) and inadequate empiric antibiotic therapy (OR 3.8, 95% CI 1.8-8.1). Cephalosporins accounted for 90% of inadequately treated cases. Adequate definitive...
Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula
2014-08-01
Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.
Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform
Energy Technology Data Exchange (ETDEWEB)
Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL
2014-01-01
Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan
2010-01-01
Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.
Low prevalence of Listeria monocytogenes in cull sows and pork.
Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary
2008-03-01
The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Krawczyk-Balska, A; Markiewicz, Z
2016-02-01
Intrinsic resistance to antibiotics is a serious therapeutic problem in the case of many bacterial species. The Gram-positive human pathogen Listeria monocytogenes is intrinsically resistant to broad spectrum cephalosporin antibiotics, which are commonly used in therapy of bacterial infections. Besides three penicillin-binding proteins the intrinsic cephalosporin resistome of L. monocytogenes includes multidrug resistance transporter transporters, proteins involved in peptidoglycan biosynthesis and modification, cell envelope proteins with structural or general detoxification function, cytoplasmic proteins with unknown function and regulatory proteins. Analysis of the regulation of the expression of genes involved in the intrinsic resistance of L. monocytogenes to cephalosporins highlights the high complexity of control of the intrinsic resistance phenotype. The regulation of the transcription of the intrinsic resistome determinants involves the activity of eight regulators, namely LisR, CesR, LiaR, VirR, σ(B) , σ(H) , σ(L) and PrfA, of which the most prominent role play LisR, CesR and σ(B) . Furthermore, the vast majority of the intrinsic resistome determinants contribute to the tolerance of different stress conditions and virulence. A study indicates that O-acetyltransferase OatA is the most promising candidate for co-drug development since an agent targeting OatA should sensitize L. monocytogenes to certain antibiotics, therefore improving the efficacy of listeriosis treatment as well as food preservation measures. © 2015 The Society for Applied Microbiology.
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
Nonlinear anisotropic parabolic equations in Lm
Directory of Open Access Journals (Sweden)
Fares Mokhtari
2014-01-01
Full Text Available In this paper, we give a result of regularity of weak solutions for a class of nonlinear anisotropic parabolic equations with lower-order term when the right-hand side is an Lm function, with m being ”small”. This work generalizes some results given in [2] and [3].
Infection Reveals a Modification of SIRT2 Critical for Chromatin Association
Directory of Open Access Journals (Sweden)
Jorge M. Pereira
2018-04-01
Full Text Available Summary: Sirtuin 2 is a nicotinamide-adenine-dinucleotide-dependent deacetylase that regulates cell processes such as carcinogenesis, cell cycle, DNA damage, and infection. Subcellular localization of SIRT2 is crucial for its function but is poorly understood. Infection with the bacterial pathogen Listeria monocytogenes, which relocalizes SIRT2 from the cytoplasm to the chromatin, provides an ideal stimulus for the molecular study of this process. In this report, we provide a map of SIRT2 post-translational modification sites and focus on serine 25 phosphorylation. We show that infection specifically induces dephosphorylation of S25, an event essential for SIRT2 chromatin association. Furthermore, we identify a nuclear complex formed by the phosphatases PPM1A and PPM1B, with SIRT2 essential for controlling H3K18 deacetylation and SIRT2-mediated gene repression during infection and necessary for a productive Listeria infection. This study reveals a molecular mechanism regulating SIRT2 function and localization, paving the way for understanding other SIRT2-regulated cellular processes. : Sirtuins are enzymes critical for various processes, including genomic stability, metabolism, and aging. Through study of Listeria monocytogenes, a bacterial pathogen that exploits SIRT2 for productive infection, Pereira et al. uncover a SIRT2 modification necessary for chromatin association and function. Keywords: chromatin, sirtuin, Listeria monocytogenes, phosphorylation, PPM1, histone acetylation, H3K18, infection, subcellular localization
Directory of Open Access Journals (Sweden)
Beom Ryong Kang
2017-06-01
Full Text Available Bacillus amyloliquefaciens LM11 was isolated from the feces of larvae of the rhino beetle and showed strong antifungal activities against various phytopathogenic fungi by producing biosurfactants. In this study, our overall goal was to determine relationship between biosurfactants produced from the LM11 strain and its role in growth inhibition of phytopathogenic fungi. Production and expression levels of B. amyloliquefaciens LM11 biosurfactants were significantly differed depending on growth phases. Transcriptional and biochemical analysis indicated that the biosurfactants of the LM11 strain were greatly enhanced in late log-phase to stationary phase. Inhibitions of phytopathogenic mycelial growth and spore germination were directly correlated (P<0.001, R=0.761 with concentrations of the LM11 cell-free culture filtrates. The minimum inhibitory surface tension of the culture filtrate of the B. amyloliquefaciens LM11 grown in stationary phase to inhibit mycelial growth of the phytopathogenic fungi was 38.5 mN/m (P<0.001, R=0.951–0.977. Our results indicated that the biosurfactants of B. amyloliquefaciens LM11 act as key antifungal metabolites in biocontrol of plant diseases, and measuring surface tension of the cell-free culture fluids can be used as an easy indicator for optimal usage of the biocontrol agents.
Directory of Open Access Journals (Sweden)
Smith Thomas A
2009-03-01
Full Text Available Abstract Background When diagnosed by standard light microscopy (LM, malaria prevalence can vary significantly between sites, even at local scale, and mixed species infections are consistently less common than expect in areas co-endemic for Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae. The development of a high-throughput molecular species diagnostic assay now enables routine PCR-based surveillance of malaria infections in large field and intervention studies, and improves resolution of species distribution within and between communities. Methods This study reports differences in the prevalence of infections with all four human malarial species and of mixed infections as diagnosed by LM and post-PCR ligase detection reaction – fluorescent microsphere (LDR-FMA assay in 15 villages in the central Sepik area of Papua New Guinea. Results Significantly higher rates of infection by P. falciparum, P. vivax, P. malariae and Plasmodium ovale were observed in LDR-FMA compared to LM diagnosis (p P. malariae (3.9% vs 13.4% and P. ovale (0.0% vs 4.8%. In contrast to LM diagnosis, which suggested a significant deficit of mixed species infections, a significant excess of mixed infections over expectation was detected by LDR-FMA (p P. falciparum (LM: 7–9 yrs 47.5%, LDR-FMA: 10–19 yrs 74.2% and P. vivax (LM: 4–6 yrs 24.2%, LDR-FMA: 7–9 yrs 50.9% but not P. malariae infections (10–19 yrs, LM: 7.7% LDR-FMA: 21.6%. Significant geographical variation in prevalence was found for all species (except for LM-diagnosed P. falciparum, with the extent of this variation greater in LDR-FMA than LM diagnosed infections (overall, 84.4% vs. 37.6%. Insecticide-treated bednet (ITN coverage was also the dominant factor linked to geographical differences in Plasmodium species infection prevalence explaining between 60.6% – 74.5% of this variation for LDR-FMA and 81.8% – 90.0% for LM (except P. falciparum, respectively. Conclusion The present study
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A previously healthy 74-year-old Caucasian man with penicillin allergy was admitted with evolving headache, confusion, fever, and neck stiffness. Treatment for bacterial meningitis with dexamethasone and monotherapy ceftriaxone was started. The cerebrospinal fluid showed negative microscopy for bacteria, no bacterial growth, and negative polymerase chain reaction for bacterial DNA. The patient developed hydrocephalus on a second CT scan of the brain on the 5th day of admission. An external ventricular catheter was inserted and Listeria monocytogenes grew in the cerebrospinal fluid from the catheter. The patient had severe neurological sequelae. This case report emphasises the importance of covering empirically for Listeria monocytogenes in all patients with penicillin allergy with suspected bacterial meningitis. The case also shows that it is possible to have significant infection and inflammation even with negative microscopy, negative cultures, and negative broad range polymerase chain reaction in cases of Listeria meningitis. Follow-up spinal taps can be necessary to detect the presence of Listeria monocytogenes.
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Directory of Open Access Journals (Sweden)
Wanessa Altimiras Costa
2009-12-01
Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
Olaimat, Amin N; Holley, Richard A
2016-08-01
Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
abazar pournajaf
2013-09-01
Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.
130 LPW 1000 Lm Warm White LED for Illumination
Energy Technology Data Exchange (ETDEWEB)
Soer, Wouter [Philips Lumileds Lighting Company LLC, San Jose, CA (United States)
2012-12-21
An illumination-grade warm-white LED, having correlated color temperature (CCT) between 2700 and 3500 K and capable of producing 1000 lm output at over 130 lm/W at room temperature, has been developed in this program. The high-power warm-white LED is an ideal source for use in indoor and outdoor lighting applications. Over the two year period, we have made the following accomplishments: • Developed a low-cost high-power white LED package and commercialized a series of products with CCT ranging from 2700 to 5700 K under the product name LUXEON M; • Demonstrated a record efficacy of 124.8 lm/W at a flux of 1023 lm, CCT of 3435 K and color rendering index (CRI) over 80 at room temperature in the productized package; • Demonstrated a record efficacy of 133.1 lm/W at a flux of 1015 lm, CCT of 3475 K and CRI over 80 at room temperature in an R&D package. The new high-power LED package is a die-on-ceramic surface mountable LED package. It has four 2 mm2 InGaN pump dice, flip-chip attached to a ceramic submount in a 2x2 array configuration. The submount design utilizes a design approach that combines a high-thermal- conductivity ceramic core for die attach and a low-cost and low-thermal-conductivity ceramic frame for mechanical support and as optical lens carrier. The LED package has a thermal resistance of less than 1.25 K/W. The white LED fabrication also adopts a new batch level (instead of die-by-die) phosphor deposition process with precision layer thickness and composition control, which provides not only tight color control, but also low cost. The efficacy performance goal was achieved through the progress in following key areas: (1) high-efficiency royal blue pump LED development through active region design and epitaxial growth quality improvement (funded by internal programs); (2) improvement in extraction efficiency from the LED package through improvement of InGaN-die-level and package-level optical extraction efficiency; and (3) improvement in phosphor
Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne
2013-08-16
Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well
Energy Technology Data Exchange (ETDEWEB)
Tamayo, L.A., E-mail: laura.tamayo@usach.cl [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Zapata, P.A. [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Grupo de Polímeros, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Vejar, N.D.; Azócar, M.I.; Gulppi, M.A. [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Zhou, X.; Thompson, G.E. [Corrosion and Protection Centre, School of Materials, The University of Manchester, Manchester, M13 9PL England (United Kingdom); Rabagliati, F.M. [Departamento de Química de los Materiales, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); Grupo de Polímeros, Facultad de Química y Biología, Universidad de Santiago de Chile, Av. L. B. O' Higgins 3363, Casilla 40, Correo 33, Santiago (Chile); and others
2014-07-01
Since infection is a major cause of death in a patient whose immune responses have been compromised (immunocompromised patient), considerable attention has been focused on developing materials for the prevention of infections. This has been directed primarily at suppressing or eliminating the host's endogenous microbial burden and decreasing the acquisition of new organisms. In this study, the antibacterial properties of two nanocomposites, polyethylene modified with silver nanoparticles (PE-AgNps) or copper nanoparticles (PE-CuNps), against Listeria monocytogenes have been investigated. In order to elucidate the antibacterial mechanism, specifically whether this mechanism corresponds to bactericidal or bacteriolytic activities, we have determined the extent of release of metal ions (Ag{sup +} and Cu{sup 2+}) and, also, the morphology of the bacteria. The metal ion release from nanocomposites was followed by inductively coupled plasma spectrometry and the morphology of the bacteria was revealed through examination of ultramicrotomed sections of bacteria in a transmission electron microscope. The study of metal ion release from the nanocomposites shows that for both nanocomposites the amount of ions released varies with time, which initially displays a linear behavior until an asymptotic behavior is reached. Further, TEM images show that silver nanoparticles (AgNps) and copper nanoparticles (CuNps), which are released from the nanocomposites, can penetrate to the cell wall and the plasma membrane of bacteria. Resulting morphological changes involve separation of the cytoplasmic membrane from the cell wall, which is known to be an effect of plasmolysis. It was revealed that the antibacterial abilities of the two nanocomposites against L. monocytogenes are associated with both bactericidal and bacteriolytic effects. - Highlights: • Nanocomposites showed excellent antibacterial activity against L. monocytogenes. • The biocide abilities of nanocomposites
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Illuminating the landscape of host–pathogen interactions with the bacterium Listeria monocytogenes
Cossart, Pascale
2011-01-01
Listeria monocytogenes has, in 25 y, become a model in infection biology. Through the analysis of both its saprophytic life and infectious process, new concepts in microbiology, cell biology, and pathogenesis have been discovered. This review will update our knowledge on this intracellular pathogen and highlight the most recent breakthroughs. Promising areas of investigation such as the increasingly recognized relevance for the infectious process, of RNA-mediated regulations in the bacterium, and the role of bacterially controlled posttranslational and epigenetic modifications in the host will also be discussed. PMID:22114192
An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes.
Aureli, P; Fiorucci, G C; Caroli, D; Marchiaro, G; Novara, O; Leone, L; Salmaso, S
2000-04-27
On May 21, 1997, numerous cases of febrile gastrointestinal illness were reported among the students and staff of two primary schools in northern Italy, all of whom had eaten at cafeterias served by the same caterer. We interviewed people who ate at the cafeterias about symptoms and foods consumed on May 20. There were no samples of foods left at the cafeterias, but we tested routine samples taken on May 20 by the caterer and environmental specimens at the catering plant. The hospitalized patients were tested for common enteropathogens and toxins. Of the 2189 persons interviewed (82 percent of those exposed), 1566 (72 percent) reported symptoms; of these, 292 (19 percent) were hospitalized. Among samples obtained from hospitalized patients, all but two of the stool specimens and all blood specimens were negative for common enteropathogens. Listeria monocytogenes was isolated from one blood specimen and from 123 of the 141 stool specimens. Consumption of a cold salad of corn and tuna was associated with the development of symptoms (relative risk, 6.19; 95 percent confidence interval, 4.81 to 7.98; Pcaterer's sample of the salad and from environmental specimens collected from the catering plant. All listeria isolates were serotype 4b and were found to be identical on DNA analysis. Experimental contamination of sterile samples of the implicated foods showed that L. monocytogenes grew on corn when kept for at least 10 hours at 25 degrees C. Food-borne infection with L. monocytogenes can cause febrile illness with gastroenteritis in immunocompetent persons.
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas
2014-08-01
This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.
Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.
Lee, Yuejia; Wang, Chinling
2017-03-01
Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.
Modeling the growth of Listeria monocytogenes in soft blue-white cheese
DEFF Research Database (Denmark)
Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne
2012-01-01
The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Host resistance of CD18 knockout mice against systemic infection with Listeria monocytogenes
Wu, Huaizhu; Prince, Joseph E.; Brayton, Cory F.; Shah, Chirayu; Zeve, Daniel; Gregory, Stephen H.; Smith, C. Wayne; Ballantyne, Christie M.
2003-01-01
Mice with targeted mutations of CD18, the common beta2 subunit of CD11/CD18 integrins, have leukocytosis, impaired transendothelial neutrophil emigration, and reduced host defense to Streptococcus pneumoniae, a gram-positive extracellular bacterium. Previous studies using blocking monoclonal antibodies suggested roles for CD18 and CD11b in hepatic neutrophil recruitment and host innate response to Listeria monocytogenes, a gram-positive intracellular bacterium. We induced systemic listeriosis in CD18 knockout (CD18-ko) and wild-type (WT) mice by tail vein injection with Listeria. By 14 days postinjection (dpi), 8 of 10 WT mice died, compared with 2 of 10 CD18-ko mice (P Listeria organisms in livers and spleens were similar in both groups at 20 min postinfection. By 3, 5, and 7 dpi, however, numbers of Listeria organisms were significantly lower in livers and spleens of CD18-ko mice than in WT mice. Histopathology showed that following Listeria infection, CD18-ko mice had milder inflammatory and necrotizing lesions in both spleens and livers than did WT mice. Cytokine assays indicated that baseline interleukin-1beta and granulocyte colony-stimulating factor (G-CSF) levels were higher in CD18-ko mice than in WT mice and that CD18-ko splenocytes produced higher levels of interleukin-1beta and G-CSF than WT splenocytes under the same amount of Listeria stimulation. These findings show that CD18 is not an absolute requirement for antilisterial innate immunity or hepatic neutrophil recruitment. We propose that the absence of CD18 in the mice results in the priming of innate immunity, as evidenced by elevated cytokine expression, and neutrophilic leukocytosis, which augments antilisterial defense.
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Brama, Elisabeth; Peddie, Christopher J; Wilkes, Gary; Gu, Yan; Collinson, Lucy M; Jones, Martin L
2016-12-13
In-resin fluorescence (IRF) protocols preserve fluorescent proteins in resin-embedded cells and tissues for correlative light and electron microscopy, aiding interpretation of macromolecular function within the complex cellular landscape. Dual-contrast IRF samples can be imaged in separate fluorescence and electron microscopes, or in dual-modality integrated microscopes for high resolution correlation of fluorophore to organelle. IRF samples also offer a unique opportunity to automate correlative imaging workflows. Here we present two new locator tools for finding and following fluorescent cells in IRF blocks, enabling future automation of correlative imaging. The ultraLM is a fluorescence microscope that integrates with an ultramicrotome, which enables 'smart collection' of ultrathin sections containing fluorescent cells or tissues for subsequent transmission electron microscopy or array tomography. The miniLM is a fluorescence microscope that integrates with serial block face scanning electron microscopes, which enables 'smart tracking' of fluorescent structures during automated serial electron image acquisition from large cell and tissue volumes.
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
DEFF Research Database (Denmark)
Nørrung, Birgit
2000-01-01
This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....
Sample dependent correlation between TL and LM-OSL in Al2O3:C
International Nuclear Information System (INIS)
Dallas, G.I.; Polymeris, G.S.; Stefanaki, E.C.; Afouxenidis, D.; Tsirliganis, N.C.; Kitis, G.
2008-01-01
Al 2 O 3 :C single crystals are known to exhibit different, sample dependent, glow-curve shapes. The relation between the Thermoluminescence (TL) traps and the linear modulated optically stimulation luminescence (LM-OSL) traps is of high importance. In the present work a correlation study is attempted using 23 single crystals with dimensions between 400 and 500μm. The correlation study involved two steps. In the first step, both TL glow curves and LM-OSL decay curves are deconvoluted and a one-to-one correlation between TL peaks and LM-OSL components is attempted. In the second step the TL glow-curves are corrected for thermal quenching, the corrected curves are deconvoluted and a new correlation between TL and LM-OSL individual components is performed
Radioactivity nuclide identification based on BP and LM algorithm neural network
International Nuclear Information System (INIS)
Wang Jihong; Sun Jian; Wang Lianghou
2012-01-01
The paper provides the method which can identify radioactive nuclide based on the BP and LM algorithm neural network. Then, this paper compares the above-mentioned method with FR algorithm. Through the result of the Matlab simulation, the method of radioactivity nuclide identification based on the BP and LM algorithm neural network is superior to the FR algorithm. With the better effect and the higher accuracy, it will be the best choice. (authors)
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Directory of Open Access Journals (Sweden)
Roberta A. Bento
2009-09-01
Full Text Available Listeria monocytogenes is widely distributed in nature and the infection listeriosis is recognized as a potential threat for human health because of its mortality rate. The objective of this study was to evaluate the growth profile and chitosan production by Mucor rouxxi UCP 064 grown in yam bean (Pachyrhizus erosus L. Urban medium. It was also to assess the anti-L. monocytogenes efficacy of the obtained chitosan. Higher values of biomass of M. rouxxi (16.9 g.L¹ and best yield of chitosan (62 mg.g-1 were found after 48 h of cultivation. Residual glucose and nitrogen in the growth media were 4.1 and 0.02 g.L¹ after 96 h, respectively. Obtained chitosan presented 85 % of degree of deacetylation and 2.60 x 10(4 g.mol-1of viscosimetric molecular weight. Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MBC values of chitosan against L. monocytogenes ATCC 7644 were, respectively, 2.5 and 5.0 mg.mL-1. At 2.5 and 5.0 mg.mL-1 chitosan caused cidal effect in a maximum time of 4 h. Bacterial count below 2 log cfu.mL-1were found from 2 h onwards and no recovery in bacterial growth was noted in the remainder period. These results show the biotechnological potential of yam bean medium for chitosan production by Mucor rouxxi and support the possible rational use of chitosan from fungi as natural antimicrobial to control L. monocytogenes.Listeria monocytogenes apresentase como um microrganismo amplamente distribuído na natureza, sendo que a infecção listeriose é reconhecida como uma potencial ameaça a saúde humana devido a sua taxa de mortalidade. O objetivo deste estudo foi avaliar o perfil de crescimento e de produção de quitosana por Mucor rouxxi UCP 064 cultivado em meio jacatupé (Pachyrhizus erosus L. Urban, bem como avaliar a eficácia anti-L. monocytogenes da quitosana produzida com vistas a uma possível aplicação em alimentos. Os mais elevados valores de biomassa de M. rouxxi (16,9 g.L¹ e o maior rendimento na
Franz, E.; Tromp, S.O.; Rijgersberg, H.; Fels-Klerx, van der H.J.
2010-01-01
Fresh vegetables are increasingly recognized as a source of foodborne outbreaks in many parts of the world. The purpose of this study was to conduct a quantitative microbial risk assessment for Escherichia coli O157:H7, Salmonella, and Listeria monocytogenes infection from consumption of leafy green
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Directory of Open Access Journals (Sweden)
Jung Hwa Lee
Full Text Available Gram-negative bacteria produce extracellular outer membrane vesicles (OMVs that interact with host cells. Unlike Gram-negative bacteria, less is known about the production and role of extracellular membrane vesicles (MVs in Gram-positive bacteria. The food-borne pathogen Listeria monocytogenes can survive under extreme environmental and energy stress conditions and the transcription factor σ(B is involved in this survival ability. Here, we first determined the production of MVs from L. monocytogenes and evaluated whether general stress transcription factor σ(B affected production of MVs in L. monocytogenes. L. monocytogenes secreted MVs during in vitro broth culture. The wild-type strain actively produced MVs approximately nine times more and also produced more intact shapes of MVs than those of the isogenic ΔsigB mutant. A proteomic analysis showed that 130 and 89 MV proteins were identified in the wild-type and ΔsigB mutant strains, respectively. Wild-type strain-derived MVs contained proteins regulated by σ(B such as transporters (OpuCA and OpuCC, stress response (Kat, metabolism (LacD, translation (InfC, and cell division protein (FtsZ. Gene Ontology (GO enrichment analysis showed that wild-type-derived MV proteins corresponded to several GO terms, including response to stress (heat, acid, and bile resistance and extracellular polysaccharide biosynthetic process, but not the ΔsigB mutant. Internalin B (InlB was almost three times more contained in MVs derived from the wild-type strain than in MVs derived from the ΔsigB mutant. Taken together, these results suggest that σ(B plays a pivotal role in the production of MVs and protein profiles contained in MVs. L. monocytogenes MVs may contribute to host infection and survival ability under various stressful conditions.
MORPHOLOGICAL ASPECTS OF HUMAN LENS CAPSULES - A COMPARATIVE LM, SEM AND TEM EXAMINATION
JONGEBLOED, WL; KALICHARAN, D; LOS, LI; VANDERVEEN, G; WORST, JGF
1991-01-01
Lens capsules of patients of advanced age, obtained after extracapsular cataract surgery, were carefully prepared for a combined LM, TEM and SEM investigation, after preliminary washing and mounting onto a holder in a buffer solution. After pre-fixation with GA, samples were postfixed for LM/TEM and
Directory of Open Access Journals (Sweden)
Laurent Dortet
2011-08-01
Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia
2018-06-13
The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.
Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.
Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc
2017-11-01
The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.
Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.
Valderrama, W B; Mills, E W; Cutter, C N
2009-11-01
Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.
Directory of Open Access Journals (Sweden)
Roberta Ortenzi
2015-09-01
Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.
Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis
2014-01-02
An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .
Jahan, M; Holley, R A
2016-04-01
Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.
Sternkopf Lillebæk, Eva Maria; Lambert Nielsen, Stine; Scheel Thomasen, Rikke; Færgeman, Nils J; Kallipolitis, Birgitte H
The foodborne pathogen Listeria monocytogenes is the causative agent of the invasive disease listeriosis. Infection by L. monocytogenes involves bacterial crossing of the intestinal barrier and intracellular replication in a variety of host cells. The PrfA protein is the master regulator of virulence factors required for bacterial entry, intracellular replication and cell-to-cell spread. PrfA-dependent activation of virulence genes occurs primarily in the blood and during intracellular infection. In contrast, PrfA does not play a significant role in regulation of virulence gene expression in the intestinal environment. In the gastrointestinal phase of infection, the bacterium encounters a variety of antimicrobial agents, including medium- and long-chain free fatty acids that are commonly found in our diet and as active components of bile. Here we show that subinhibitory concentrations of specific antimicrobial free fatty acids act to downregulate transcription of PrfA-activated virulence genes. Interestingly, the inhibitory effect is also evident in cells encoding a constitutively active variant of PrfA. Collectively, our data suggest that antimicrobial medium- and long-chain free fatty acids may act as signals to prevent PrfA-mediated activation of virulence genes in environments where PrfA activation is not required, such as in food and the gastrointestinal tract. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Prevalence of Listeria monocytogenes in poultry production in France.
Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe
2008-10-01
This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).
Characterization and mapping of complementary lesion-mimic genes lm1 and lm2 in common wheat.
Yao, Qin; Zhou, Ronghua; Fu, Tihua; Wu, Weiren; Zhu, Zhendong; Li, Aili; Jia, Jizeng
2009-10-01
A lesion-mimic phenotype appeared in a segregating population of common wheat cross Yanzhan 1/Zaosui 30. The parents had non-lesion normal phenotypes. Shading treatment and histochemical analyses showed that the lesions were caused by light-dependent cell death and were not associated with pathogens. Studies over two cropping seasons showed that some lines with more highly expressed lesion-mimic phenotypes exhibited significantly lower grain yields than those with the normal phenotype, but there were no significant effects in the lines with weakly expressed lesion-mimic phenotypes. Among yield traits, one-thousand grain weight was the most affected by lesion-mimic phenotypes. Genetic analysis indicated that this was a novel type of lesion mimic, which was caused by interaction of recessive genes derived from each parent. The lm1 (lesion mimic 1) locus from Zaosui 30 was flanked by microsatellite markers Xwmc674 and Xbarc133/Xbarc147 on chromosome 3BS, at genetic distances of 1.2 and 3.8 cM, respectively, whereas lm2 from Yanzhan 1 was mapped between microsatellite markers Xgwm513 and Xksum154 on chromosome 4BL, at genetic distances of 1.5 and 3 cM, respectively. The linked microsatellite makers identified in this study might be useful for evaluating whether potential parents with normal phenotype are carriers of lesion-mimic alleles.
SABIL, SYAHRIANA
2015-01-01
2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.
de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa
2018-04-12
Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.
Novel Cadmium Resistance Determinant in Listeria monocytogenes.
Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia
2017-03-01
Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and
Possibilities and testing of CPRNG in block cipher mode of operation PM-DC-LM
Energy Technology Data Exchange (ETDEWEB)
Zacek, Petr; Jasek, Roman; Malanik, David [Faculty of applied Informatics, Tomas Bata University in Zlin, Zlin, Czech Republic zacek@fai.utb.cz, jasek@fai.utb.cz, dmalanik@fai.utb.cz (Czech Republic)
2016-06-08
This paper discusses the chaotic pseudo-random number generator (CPRNG), which is used in block cipher mode of operation called PM-DC-LM. PM-DC-LM is one of possible subversions of general PM mode. In this paper is not discussed the design of PM-DC-LM, but only CPRNG as a part of it because designing is written in other papers. Possibilities, how to change or to improve CPRNG are mentioned. The final part is devoted for a little testing of CPRNG and some testing data are shown.
Possibilities and testing of CPRNG in block cipher mode of operation PM-DC-LM
Zacek, Petr; Jasek, Roman; Malanik, David
2016-06-01
This paper discusses the chaotic pseudo-random number generator (CPRNG), which is used in block cipher mode of operation called PM-DC-LM. PM-DC-LM is one of possible subversions of general PM mode. In this paper is not discussed the design of PM-DC-LM, but only CPRNG as a part of it because designing is written in other papers. Possibilities, how to change or to improve CPRNG are mentioned. The final part is devoted for a little testing of CPRNG and some testing data are shown.
Possibilities and testing of CPRNG in block cipher mode of operation PM-DC-LM
International Nuclear Information System (INIS)
Zacek, Petr; Jasek, Roman; Malanik, David
2016-01-01
This paper discusses the chaotic pseudo-random number generator (CPRNG), which is used in block cipher mode of operation called PM-DC-LM. PM-DC-LM is one of possible subversions of general PM mode. In this paper is not discussed the design of PM-DC-LM, but only CPRNG as a part of it because designing is written in other papers. Possibilities, how to change or to improve CPRNG are mentioned. The final part is devoted for a little testing of CPRNG and some testing data are shown.
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes
Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...
Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup
2018-05-11
Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
DEFF Research Database (Denmark)
Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter
2006-01-01
The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...
Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Cristina Tostes Filgueiras
2006-05-01
Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.
2009-01-01
Ill.: situatsiooniplaan, 3 vaadet; fotod: Reio Avaste; autorid: M. Kask, R. Lõoke (Salto), N. Külm, kuraator: I. Ruudi, komissar: L. Põdra. Eesti Kultuurkapitali peapreemia ja arhitektuuri sihtkapitali aastapreemia 2008 pälvisid M. Kask, R. Lõoke, N. Külm ja I. Ruudi
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
Patel, P J
1981-01-01
Age-related changes in resistance of mice to infection with Listeria monocytogenes were investigated. One-month-old mice exhibited the least resistance, and the resistance level increased over the first few months to reach a maximum by 8 months. Increase in age thereafter was accompanied by a slow but progressive decrease in resistance. Thus, 50% lethal doses for 1-, 8-, and 24-month-old mice were 10(4.2), 10(6.6), and 10(5.2), respectively. In spite of differences in resistance, the growth o...
Casco, G; Taylor, T M; Alvarado, C
2015-04-01
Essential oils and their constituents are reported to possess potent antimicrobial activity, but their use in food processing is limited because of low solubility in aqueous systems and volatilization during processing. Two proprietary noncommercial essential oil-containing phosphate blends were evaluated for antimicrobial activity against Salmonella enterica cocktail (SC)-and Listeria monocytogenes (Lm)-inoculated deli meat products made from pork, poultry, or beef. Four treatments were tested on restructured cured pork ham, emulsified chicken bologna, and restructured beef loaf: nonencapsulated essential oil with phosphate version 1 at 0.45% of final batch (EOV145; chicken and pork, or EEOV245 beef), micronized encapsulated essential oil with phosphate version 2 at 0.60% of final batch (EEOV260), a 2.0% potassium lactate (PL) control, and a negative control (CN) with no applied antimicrobial agent. Compared with the CN, none of the antimicrobial agents (EEOV260, EOV145, PL) successfully limited Lm or SC growth to deli loaves, the EEOV260 inhibited growth of SC at days 21 and 28 to the same level of efficacy as PL (0.5 log cycle). In roast beef samples, on day 35, the SC growth was inhibited ca. 0.5 log CFU/g by EEOV260 when compared with the CN. In conclusion the EEOV260 can function to replace PL to limit Salmonella and Lm growth in ready-to-eat deli products. Further testing is needed to ensure consumer acceptability.
Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.
Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet
2010-06-01
Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Gram, Lone
2012-01-01
or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....
Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M
2009-10-01
The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.
Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B
2014-10-17
The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
Listeria monocytogenes and Shigella flexneri Activate the NLRP1B Inflammasome.
Neiman-Zenevich, Jana; Stuart, Sarah; Abdel-Nour, Mena; Girardin, Stephen E; Mogridge, Jeremy
2017-11-01
Activation of the innate immune receptor NLRP1B leads to the formation of an inflammasome, which induces autoproteolytic processing of pro-caspase-1, and ultimately to the release of inflammatory cytokines and to the execution of pyroptosis. One of the signals to which NLRP1B responds is metabolic stress that occurs in cells deprived of glucose or treated with metabolic inhibitors. NLRP1B might therefore sense microbial infection, as intracellular pathogens such as Listeria monocytogenes and Shigella flexneri cause metabolic stress as a result of nutrient scavenging and host cell damage. Here we addressed whether these pathogens activate the NLRP1B inflammasome. We found that Listeria infection activated the NLRP1B inflammasome in a reconstituted fibroblast model. Activation of NLRP1B by Listeria was diminished in an NLRP1B mutant shown previously to be defective at detecting energy stress and was dependent on the expression of listeriolysin O (LLO), a protein required for vacuolar escape. Infections of either Listeria or Shigella activated NLRP1B in the RAW264.7 murine macrophage line, which expresses endogenous NLRP1B. We conclude that NLRP1B senses cellular infection by distinct invasive pathogens. Copyright © 2017 American Society for Microbiology.
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Directory of Open Access Journals (Sweden)
Annaleise Wilson
2018-02-01
Full Text Available The current global crisis of antimicrobial resistance (AMR among important human bacterial pathogens has been amplified by an increased resistance prevalence. In recent years, a number of studies have reported higher resistance levels among Listeria monocytogenes isolates, which may have implications for treatment of listeriosis infection where resistance to key treatment antimicrobials is noted. This study examined the genotypic and phenotypic AMR patterns of 100 L. monocytogenes isolates originating from food production supplies in Australia and examined this in the context of global population trends. Low levels of resistance were noted to ciprofloxacin (2% and erythromycin (1%; however, no resistance was observed to penicillin G or tetracycline. Resistance to ciprofloxacin was associated with a mutation in the fepR gene in one isolate; however, no genetic basis for resistance in the other isolate was identified. Resistance to erythromycin was correlated with the presence of the ermB resistance gene. Both resistant isolates belonged to clonal complex 1 (CC1, and analysis of these in the context of global CC1 isolates suggested that they were more similar to isolates from India rather than the other CC1 isolates included in this study. This study provides baseline AMR data for L. monocytogenes isolated in Australia, identifies key genetic markers underlying this resistance, and highlights the need for global molecular surveillance of resistance patterns to maintain control over the potential dissemination of AMR isolates.
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.
Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline
2013-10-21
Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Jia, Qingmei; Dillon, Barbara Jane; Masleša-Galić, Saša; Horwitz, Marcus A
2017-06-19
A potent vaccine against tuberculosis, one of the world's deadliest diseases, is needed to enhance the immunity of people worldwide, most of whom have been vaccinated with the partially effective BCG vaccine. Here we investigate novel live attenuated recombinant Listeria monocytogenes (rLm) vaccines expressing the Mycobacterium tuberculosis (Mtb) 30 kDa major secretory protein (r30/Ag85B) (rLm30) as heterologous booster vaccines in animals primed with BCG. Using three attenuated Lm vectors, rLm Δ actA (LmI), rLm Δ actA Δ inlB (LmII), and rLm Δ actA Δ inlB prfA * (LmIII), we constructed five rLm30 vaccine candidates expressing the r30 linked in-frame to the Lm Listeriolycin O signal sequence and driven by the hly promoter (h30) or linked in-frame to the ActA N-terminus and driven by the actA promoter (a30). All five rLm30 vaccines secreted r30 in broth and macrophages; while rLm expressing r30 via a constitutively active prfA * regulon (rLmIII/a30) expressed the greatest amount of r30 in broth culture, all five rLm vaccines expressed equivalent amounts of r30 in infected macrophages. In comparative studies, boosting BCG-immunized mice with rLmIII/a30 induced the strongest antigen-specific T-cell responses, including splenic and lung polyfunctional CD4+ T-cells expressing the three cytokines of interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and interleukin-2 (IL-2) ( P vaccines were generally more potent booster vaccines than r30 in adjuvant and a recombinant adenovirus vaccine expressing r30. In a setting in which BCG alone was highly immunoprotective, boosting mice with rLmIII/a30, the most potent of the vaccines, significantly enhanced protection against aerosolized Mtb ( P <0.01). Copyright © 2017 American Society for Microbiology.
Loepfe, Chantal; Raimann, Eveline; Stephan, Roger; Tasara, Taurai
2010-07-01
The cold shock protein (Csp) family comprises small, highly conserved proteins that bind nucleic acids to modulate various bacterial gene expressions. In addition to cold adaptation functions, this group of proteins is thought to facilitate various cellular processes to promote normal growth and stress adaptation responses. Three proteins making up the Listeria monocytogenes Csp family (CspA, CspB, and CspD) promote both cold and osmotic stress adaptation functions in this bacterium. The contribution of these three Csps in the host cell invasion processes of L. monocytogenes was investigated based on human Caco-2 and murine macrophage in vitro cell infection models. The DeltacspB, DeltacspD, DeltacspAB, DeltacspAD, DeltacspBD, and DeltacspABD strains were all significantly impaired in Caco-2 cell invasion compared with the wild-type strain, whereas in the murine macrophage infection assay only, the double (DeltacspBD) and triple (DeltacspABD) csp mutants were also significantly impaired in cell invasion compared with the wild-type strain. The DeltacspBD and DeltacspABD mutants displayed the most severely impaired invasion phenotypes. The invasion ability of these two mutant strains was also further analyzed using cold-stress-exposed organisms. In both cell infection models a significant reduction in invasiveness was observed after cold stress exposure of Listeria organisms. The negative impact of cold stress on subsequent cell invasion ability was, however, more severe in cold-sensitive csp mutants (DeltacspBD and DeltacspABD) compared with the wild type. The impaired macrophage invasion and intracellular growth of DeltacspBD and DeltacspABD also led us to examine oxidative stress resistance capacity in these two mutant strains. Both strains also displayed higher oxidative stress sensitivity relative to the wild-type strain. Our data indicate that besides cold and osmotic stress adaptation roles, Csp family proteins also promote efficient host cell invasion and
A physical/psychological and biological stress combine to enhance endoplasmic reticulum stress
Energy Technology Data Exchange (ETDEWEB)
Mondal, Tapan Kumar; Emeny, Rebecca T.; Gao, Donghong; Ault, Jeffrey G.; Kasten-Jolly, Jane; Lawrence, David A., E-mail: david.lawrence@health.ny.gov
2015-12-01
The generation of an immune response against infectious and other foreign agents is substantially modified by allostatic load, which is increased with chemical, physical and/or psychological stressors. The physical/psychological stress from cold-restraint (CR) inhibits host defense against Listeria monocytogenes (LM), due to early effects of the catecholamine norepinephrine (NE) from sympathetic nerves on β1-adrenoceptors (β1AR) of immune cells. Although CR activates innate immunity within 2 h, host defenses against bacterial growth are suppressed 2–3 days after infection (Cao and Lawrence 2002). CR enhances inducible nitric oxide synthase (iNOS) expression and NO production. The early innate activation leads to cellular reduction-oxidation (redox) changes of immune cells. Lymphocytes from CR-treated mice express fewer surface thiols. Splenic and hepatic immune cells also have fewer proteins with free thiols after CR and/or LM, and macrophages have less glutathione after the in vivo CR exposure or exposure to NE in vitro. The early induction of CR-induced oxidative stress elevates endoplasmic reticulum (ER) stress, which could interfere with keeping phagocytized LM within the phagosome or re-encapsuling LM by autophagy once they escape from the phagosome. ER stress-related proteins, such as glucose-regulated protein 78 (GRP78), have elevated expression with CR and LM. The results indicate that CR enhances the unfolded protein response (UPR), which interferes with host defenses against LM. Thus, it is postulated that increased stress, as exists with living conditions at low socioeconomic conditions, can lower host defenses against pathogens because of oxidative and ER stress processes. - Highlights: • Cold-restraint (physical/psychological stress) induces early oxidative stress. • The oxidative stress relates to catecholamine signaling beta-adrenoceptors. • Physical/psychological stress combines infection enhancing inflammation. • Endoplasmic reticulum
A Learning Model for L/M Specificity in Ganglion Cells
Ahumada, Albert J.
2016-01-01
An unsupervised learning model for developing LM specific wiring at the ganglion cell level would support the research indicating LM specific wiring at the ganglion cell level (Reid and Shapley, 2002). Removing the contributions to the surround from cells of the same cone type improves the signal-to-noise ratio of the chromatic signals. The unsupervised learning model used is Hebbian associative learning, which strengthens the surround input connections according to the correlation of the output with the input. Since the surround units of the same cone type as the center are redundant with the center, their weights end up disappearing. This process can be thought of as a general mechanism for eliminating unnecessary cells in the nervous system.
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.
Valderrama, Wladir B; Cutter, Catherine N
2013-01-01
Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.
DEFF Research Database (Denmark)
Ebersbach, Tine; Jørgensen, Julie Boeck; Heegaard, Peter M. H.
2010-01-01
of five non-digestible carbohydrates on the resistance of guinea pigs to Listeria monocytogenes infections. Animals were fed a diet supplemented with 10% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral infection with a mixture...
Directory of Open Access Journals (Sweden)
N Choobkar
2012-02-01
Full Text Available Salting of fish is a traditional method for fish preservation which reduces corruption, increase shelf life and is used in order to have an access to the new markets. In some countries, consuming semi-cooked or raw salted and smoked fish is well-liked. Due to the presence of halophilic microorganisms in salted fish, occurrence of food-borne infections is probable. The aim of this study was to investigate the antimicrobial activity of NaCl on Staphlococcus aureus and Listeria monocytogenes in salted silver carp. Effect of different concentrations of NaCl (4, 8, 12 % on behavior of Staphlococcus aureus and Listeria monocytogenes in 10˚C during 3 weeks (0, 1, 2, 3, 6, 9, 12, 15, 18, 21 days was determined by evaluation of the bacterial growth in salted fish fillets. Statistical analysis showed that application of different concentrations of NaCl had significant inhibitory effect on the growth of S. aureus and L.monocytogenes in salted fish fillets compared to control group (p
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone
2010-01-01
Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants use......, such as antibiotic resistance....... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...
Antimicrobial treatments to control Listeria monocytogenes in queso fresco.
Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco
2017-06-01
Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4 CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
Directory of Open Access Journals (Sweden)
Maria da Graça F. Nascimento
1994-12-01
Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.
Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi
2016-11-01
A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.
Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P
2011-06-01
This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.
Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.
Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun
2012-03-01
Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
A dynamical systems approach to actin-based motility in Listeria monocytogenes
Hotton, S.
2010-11-01
A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage
Directory of Open Access Journals (Sweden)
Michline Brice
2013-10-01
Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
DEFF Research Database (Denmark)
Nightingale, K. K.; Lyles, K.; Ayodele, M.
2006-01-01
population are identified (TreeStats test). Analysis of sequence data for 120 L. monocytogenes isolates revealed evidence of clustering between isolates from the same source, based on the phylogenies inferred from actA and inlA (P = 0.02 and P = 0.07, respectively; SourceCluster test). Overall, the Tree...... are biologically valid. Overall, our data show that (i) the SourceCluster and TreeStats tests can identify biologically meaningful source-associated phylogenetic clusters and (ii) L. monocytogenes includes clonal groups that have adapted to infect specific host species or colonize nonhost environments......., including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source...
Dalzini, Elena
2017-01-01
Among food-borne pathogens, L. monocytogenes represents one of the most serious food safety concerns. In particular, dairy products are often a source of this infection. During 2007 and 2009 in Italy there was an increase of notifications of listeriosis with the most cases reported in the Centre-North of Italy. This is probably attributable both to a real increase of listeriosis in Italy and to surveillance implementation. However, statistically significant increasing trends in listeriosis no...
Ma, Feng; Xu, Sheng; Liu, Xingguang; Zhang, Qian; Xu, Xiongfei; Liu, Mofang; Hua, Minmin; Li, Nan; Yao, Hangping; Cao, Xuetao
2011-07-24
Interferon-γ (IFN-γ) has a critical role in immune responses to intracellular bacterial infection. MicroRNAs (miRNAs) are important in the regulation of innate and adaptive immunity. However, whether miRNAs can directly target IFN-γ and regulate IFN-γ production post-transcriptionally remains unknown. Here we show that infection of mice with Listeria monocytogenes or Mycobacterium bovis bacillus Calmette-Guérin (BCG) downregulated miR-29 expression in IFN-γ-producing natural killer cells, CD4(+) T cells and CD8(+) T cells. Moreover, miR-29 suppressed IFN-γ production by directly targeting IFN-γ mRNA. We developed mice with transgenic expression of a 'sponge' target to compete with endogenous miR-29 targets (GS29 mice). We found higher serum concentrations of IFN-γ and lower L. monocytogenes burdens in L. monocytogenes-infected GS29 mice than in their littermates. GS29 mice had enhanced T helper type 1 (T(H)1) responses and greater resistance to infection with BCG or Mycobacterium tuberculosis. Therefore, miR-29 suppresses immune responses to intracellular pathogens by targeting IFN-γ.
Moreno-Enriquez, R I; Garcia-Galaz, A; Acedo-Felix, E; Gonzalez-Rios, I H; Call, J E; Luchansky, J B; Diaz-Cinco, M E
2007-11-01
In the first part of this study, samples were collected from farms, cheese processing plants (CPPs), and retail markets located in various geographical areas of Sonora, Mexico, over a 12-month period during the summer of 2004 and winter of 2005. Four (all Queso Fresco [QF] from retail markets) of 349 total samples tested positive for Listeria monocytogenes (Lm). Of these four positive samples, three were collected in the northern region and one in the southern region of Sonora. Additionally, two were collected during the winter months, and two were collected during the summer months. For the second part of the study, a total of 39 samples from a farm, a CPP, and retail markets were collected and processed according to a combination of the Norma Oficial Mexicana NOM-143-SSA1-1995.10 method (NOM) and the U.S. Food and Drug Administration (FDA) Bacteriological Analytical Manual method, and 27 samples from these same locations were collected and processed according to the U.S. Department of Agriculture Food Safety and Inspection Service method (USDA-FSIS). The NOM-FDA method recovered the pathogen from 6 (15%) of 39 samples (one cheese and five product contact surfaces), while the USDA-FSIS method recovered the pathogen from 5 (18.5%) of 27 samples (all product contact surfaces). In addition, the 40 isolates recovered from the 15 total samples that tested positive for Lm grouped into five distinct pulsotypes that were ca. 60% related, as determined by pulsed-field gel electrophoresis analysis. The results of this study confirmed a 3.4% prevalence of Lm in QF collected from retail markets located in Sonora and no appreciable difference in the effectiveness of either the NOM-FDA or USDA-FSIS method to recover the pathogen from cheese or environmental samples.
DEFF Research Database (Denmark)
Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck
2009-01-01
Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES
Directory of Open Access Journals (Sweden)
G. Tantillo
2013-02-01
Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.
Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes
DEFF Research Database (Denmark)
Harmsen, Morten; Lappann, Martin; Knøchel, S
2010-01-01
(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...
Directory of Open Access Journals (Sweden)
Bahador
2015-08-01
Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.
Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.
Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P
2012-01-01
Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P
2016-01-01
The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Lineage specific recombination rates and microevolution in Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Nightingale Kendra K
2008-10-01
Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that
Montero, David; Bodero Baeza, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M.; Vidal, Maricel
2015-01-01
Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low
Design and Simulation of a PIC16F877A and LM35 Based ...
African Journals Online (AJOL)
This paper describes the design and simulation of a temperature virtual monitoring system using proteus (Labcenter electronics). The device makes use of the PIC16F877A, LM35, 2x16 LCD and other discrete components. The lm35 serve as the temperature sensor, whose output is fed into the PIC16F877A for further ...
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.
Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N
2017-01-01
Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.
A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death
Directory of Open Access Journals (Sweden)
Svitlana Vdovikova
2017-05-01
Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.
LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION
Directory of Open Access Journals (Sweden)
S. Colombo
2012-08-01
Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.
Inactivation of Listeria monocytogenes in milk by pulsed electric field.
Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E
1998-09-01
Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.
Listeria monocytogenes inhibition by defatted mustard meal-based edible films.
Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C
2012-02-01
An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.
Exploration the extrudability of aluminum matrix composite (LM6/TIC ...
African Journals Online (AJOL)
Aluminum matrix composites (LM6/TiC) is a mix of excellent properties of aluminum ... ABAQUS/CAE software has been successfully employed for Modeling and ... Experimental results show that, many mechanical properties are improved and ...
Directory of Open Access Journals (Sweden)
Anouk C.M. Platteel
2017-08-01
Full Text Available Proteasome-catalyzed peptide splicing (PCPS generates peptides that are presented by MHC class I molecules, but because their identification is challenging, the immunological relevance of spliced peptides remains unclear. Here, we developed a reverse immunology-based multi-level approach to identify proteasome-generated spliced epitopes. Applying this strategy to a murine Listeria monocytogenes infection model, we identified two spliced epitopes within the secreted bacterial phospholipase PlcB that primed antigen-specific CD8+ T cells in L. monocytogenes-infected mice. While reacting to the spliced epitopes, these CD8+ T cells failed to recognize the non-spliced peptide parts in the context of their natural flanking sequences. Thus, we here show that PCPS expands the CD8+ T cell response against L. monocytogenes by exposing spliced epitopes on the cell surface. Moreover, our multi-level strategy opens up opportunities to systematically investigate proteins for spliced epitope candidates and thus strategies for immunotherapies or vaccine design.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Listeria monocytogenes : nog steeds een probleem?
Beumer, R.R.
2011-01-01
Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,
Hwang, Cheng-An; Sheen, Shiowshuh
2011-05-01
This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.
Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat
International Nuclear Information System (INIS)
Kamat, A.S.; Nair, M.P.
1995-01-01
Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)
Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Aracelly Castro
2013-09-01
Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal. doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482
Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J
1997-03-01
The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro
2016-01-01
Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.
Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko
2018-05-20
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.
Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M
2017-09-01
Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.
Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA
Directory of Open Access Journals (Sweden)
Yolanda Albarracín C
2008-08-01
Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
Silver as antibacterial towards Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Simone eBelluco
2016-03-01
Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.
The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.
DEFF Research Database (Denmark)
Gaini, Shahin
2015-01-01
A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....
Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.
Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio
2008-12-01
The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.
Fabrikasi Sistem Alat Ukur Temperatur Lapisan Buah Mangga dengan Menggunakan Sensor Waterproof LM35
Directory of Open Access Journals (Sweden)
Muhammad Sarif
2017-03-01
Full Text Available Telah dibuat sistem alat ukur untuk memonitoring secara real time pada temperatur lapisan buah mangga dan temperatur lingkungan lemari pendingin. Ada tiga lapisan buah mangga yang dimonitoring dengan menggunakan sensor waterproof LM35. ketiga lapisan buah mangga yang dimaksud adalah lapisan 1 lapisan dekat dengan biji buah, lapisan 2 merupakan lapisan daging buah, dan lapisan 3 adalah lapisan di sekitar kulit buah mangga. Sinyal tegangan keluaran probe sensor LM35 dikondisikan dengan penguat tak mebalik yang mengaplikasikan IC OP07. Keluaran dari penguat tak membalik yang berupa data analog selanjutnya diolah menjadi data digital dengan modul mikrokontroler ATMega8535. Data digital hasil pengolahan mikrokontroler ATMega8535 di tampilkan ke unit penampil berupa liquid crystal display (LCD 20x4 karakter. Persamaan karakteristik yang diperoleh dari kalibrasi probe sensor LM35 menunjukkan performa yang sangat baik terlihat dari hasil karakterisasi yang memiliki linieritas tinggi. Persamaan karakteristik yang diperoleh dari masing masing probe sensor LM35 adalah probe sensor 1 dengan V = (9,663T – 6,054 milivolt, probe sensor 2 dengan V = (9,656 T – 2,517 milivolt, probe sensor 3 dengan V = (9,771T – 9,826 milivolt, dan probe sensor 4 dengan V = (9,782T – 8,092 milivolt.
EBaLM-THP - A neural network thermohydraulic prediction model of advanced nuclear system components
International Nuclear Information System (INIS)
Ridluan, Artit; Manic, Milos; Tokuhiro, Akira
2009-01-01
In lieu of the worldwide energy demand, economics and consensus concern regarding climate change, nuclear power - specifically near-term nuclear power plant designs are receiving increased engineering attention. However, as the nuclear industry is emerging from a lull in component modeling and analyses, optimization for example using ANN has received little research attention. This paper presents a neural network approach, EBaLM, based on a specific combination of two training algorithms, error-back propagation (EBP), and Levenberg-Marquardt (LM), applied to a problem of thermohydraulics predictions (THPs) of advanced nuclear heat exchangers (HXs). The suitability of the EBaLM-THP algorithm was tested on two different reference problems in thermohydraulic design analysis; that is, convective heat transfer of supercritical CO 2 through a single tube, and convective heat transfer through a printed circuit heat exchanger (PCHE) using CO 2 . Further, comparison of EBaLM-THP and a polynomial fitting approach was considered. Within the defined reference problems, the neural network approach generated good results in both cases, in spite of highly fluctuating trends in the dataset used. In fact, the neural network approach demonstrated cumulative measure of the error one to three orders of magnitude smaller than that produce via polynomial fitting of 10th order
Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.
Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D
2017-06-05
The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.
The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.
Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto
2010-08-01
Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.
DEFF Research Database (Denmark)
Holch, Anne; Webb, Kristen; Lukjancenko, Oksana
2013-01-01
Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...
Directory of Open Access Journals (Sweden)
Valeria Braga
Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
Directory of Open Access Journals (Sweden)
Élen Silveira Nalério
2009-09-01
Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-12-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
International Nuclear Information System (INIS)
2016-01-01
This report on evaporite mineralization was completed as an Ancillary Work Plan for the Applied Studies and Technology program under the U.S. Department of Energy (DOE) Office of Legacy Management (LM). This study reviews all LM sites under Title I and Title II of the Uranium Mill Tailings Radiation Control Act (UMTRCA) and one Decontamination and Decommissioning site to provide (1) a summary of which sites have evaporite deposits, (2) any available quantitative geochemical and mineralogical analyses, and (3) references to relevant reports. In this study, 'evaporite' refers to any secondary mineral precipitate that occurs due to a loss of water through evaporative processes. This includes efflorescent salt crusts, where this term refers to a migration of dissolved constituents to the surface with a resulting salt crust, where 'salt' can refer to any secondary precipitate, regardless of constituents. The potential for the formation of evaporites at LM sites has been identified, and may have relevance to plume persistence issues. Evaporite deposits have the potential to concentrate and store contaminants at LM sites that could later be re-released. These deposits can also provide a temporary storage mechanism for carbonate, chloride, and sulfate salts along with uranium and other contaminants of concern (COCs). Identification of sites with evaporites will be used in a new technical task plan (TTP), Persistent Secondary Contaminant Sources (PeSCS), for any proposed additional sampling and analyses. This additional study is currently under development and will focus on determining if the dissolution of evaporites has the potential to hinder natural flushing strategies and impact plume persistence. This report provides an initial literature review on evaporites followed by details for each site with identified evaporites. The final summary includes a table listing of all relevant LM sites regardless of evaporite identification.
Energy Technology Data Exchange (ETDEWEB)
None, None
2016-05-01
This report on evaporite mineralization was completed as an Ancillary Work Plan for the Applied Studies and Technology program under the U.S. Department of Energy (DOE) Office of Legacy Management (LM). This study reviews all LM sites under Title I and Title II of the Uranium Mill Tailings Radiation Control Act (UMTRCA) and one Decontamination and Decommissioning site to provide (1) a summary of which sites have evaporite deposits, (2) any available quantitative geochemical and mineralogical analyses, and (3) references to relevant reports. In this study, “evaporite” refers to any secondary mineral precipitate that occurs due to a loss of water through evaporative processes. This includes efflorescent salt crusts, where this term refers to a migration of dissolved constituents to the surface with a resulting salt crust, where “salt” can refer to any secondary precipitate, regardless of constituents. The potential for the formation of evaporites at LM sites has been identified, and may have relevance to plume persistence issues. Evaporite deposits have the potential to concentrate and store contaminants at LM sites that could later be re-released. These deposits can also provide a temporary storage mechanism for carbonate, chloride, and sulfate salts along with uranium and other contaminants of concern (COCs). Identification of sites with evaporites will be used in a new technical task plan (TTP), Persistent Secondary Contaminant Sources (PeSCS), for any proposed additional sampling and analyses. This additional study is currently under development and will focus on determining if the dissolution of evaporites has the potential to hinder natural flushing strategies and impact plume persistence. This report provides an initial literature review on evaporites followed by details for each site with identified evaporites. The final summary includes a table listing of all relevant LM sites regardless of evaporite identification.
Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.
Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina
2014-01-21
Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.
Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants
Directory of Open Access Journals (Sweden)
Anna Mureddu
2014-02-01
Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.
Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere
Directory of Open Access Journals (Sweden)
Elena Dalzini
2014-02-01
Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.
Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin
2016-02-02
The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the
Wang, Hong; Luo, Lijuan; Zhang, Zhengdong; Deng, Jianping; Wang, Yan; Miao, Yimao; Zhang, Ling; Chen, Xi; Liu, Xiang; Sun, Songsong; Xiao, Bo; Li, Qun; Ye, Changyun
2018-02-01
This study aimed to investigate the prevalence and molecular characteristics of Listeria monocytogenes in cooked products in Zigong City, China. The overall occurrence of the L. monocytogenes in the ready-to-eat (RTE) shops and mutton restaurants surveyed was 16.2% (141/873). An occurrence of 13.5% was observed in RTE pork, 6.5% in RTE vegetables, and more than 24.0% in either cooked mutton or cooked haggis. Serotype 1/2b (45.4%), 1/2a (33.3%), and 1/2c (14.2%) were the predominant types. By comparing the clonal complexes (CCs) based on multilocus sequence typing (MLST) of the L. monocytogenes from cooked foods in Zigong City and 33 listeriosis cases from different districts of China, CC87, CC9, CC8, and CC3 were showed to be prevalent in cooked products and CC87 and CC3 were the first two frequent types in the 33 clinic-source strains. All CC87 stains harbored the newly reported Listeria pathogenicity island 4 (LIPI-4) gene fragment ptsA, and all CC3 strains possessed the Listeria pathogenicity island 3 (LIPI-3) gene fragment llsX. These may increase the occurrence of the strains belonging to CC87 and CC3 in listeriosis cases in China and also underline the risk of infection owing to the consumption of the cooked products from Zigong. ST619 (serotype 1/2b) harbored both llsX and ptsA, indicating a potential hypervirulent sequence type in Zigong.
International Nuclear Information System (INIS)
Roesler, J.; Groettrup, E.B.; Baccarini, M.; Lohmann-Mattes, M.L.
1989-01-01
Radiation chimeras in the early phase after bone marrow transplantation are a good model to study the efficiency of the body's nonspecific defense system represented by macrophages (M phi), polymorphonuclear cells (PMN), and NK cells. These cell types are present in large numbers in spleen and liver at that time, whereas the specific immune system represented by T and B cells is functionally deficient. We previously reported enhanced activities in vitro of M phi (and PMN) from recipient animals in an early phase after allogeneic bone marrow transfer. We here demonstrate that these activities result in enhanced spontaneous resistance against Listeria monocytogenes in vivo: CFU of L. monocytogenes in spleen and liver 48 h after infection were about 1 or 2 to 4 log steps less than in untreated control mice of donor or host haplotype. This enhanced resistance decreased over the 4-mo period after marrow transfer. Preactivated M phi were identified as the most important effector cells. Isolated from spleen and peritoneal cavity, they performed enhanced killing of phagocytosed Listeria. Such preactivated M phi occurred in recipient animals after transfer of allogeneic but not of syngeneic bone marrow. The precise mechanism of M phi activation in the allogeneic radiation chimera in the complete absence of any detectable T cell function is not clear at present. However, these preactivated M phi display an important protective effect against L. monocytogenes: chimeras could eliminate Listeria without acquisition of positive delayed-type sensitivity when infected with 10(3) bacteria. An inoculum of 5 . 10(3) L. monocytogenes resulted either in prolonged survival compared with normal mice of the recipient haplotype or in definitive survival accompanied by a positive delayed-type sensitivity
An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes
DEFF Research Database (Denmark)
Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.
2017-01-01
Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...
Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco
2016-01-01
ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is
LM-OSL from single grains of quartz: A preliminary study
DEFF Research Database (Denmark)
Bulur, E.; Duller, G.A.T.; Solongo, S.
2002-01-01
the easy-to-bleach component, those with only the hard-to-bleach component, and those exhibiting all components. The results of this preliminary study show that LM-OSL experiments carried out at the single grain level may give important insights into the luminescence properties observed when viewing...
Wear and microstructural characteristics of spray atomized zircon sand reinforced LM13 alloy
Energy Technology Data Exchange (ETDEWEB)
Kaur, K.; Pandey, O.P. [School of Physics and Materials Science, Thapar University Patiala, Punjab (India)
2010-07-15
The requirement of the high performance light weight materials demands the development of varieties of materials within the economical range to get it commercialized. Light weight aluminium alloys are used in several structural applications like automotive, aerospace, defense industry and other fields of engineering. The ceramic particle reinforced aluminium metal matrix composites (AMCs) have emerged as a suitable candidate for commercial applications. A variety of processing routes have been adopted to manufacture AMCs. In the present work LM13 alloy reinforced with zircon sand is formed via spray forming. During experimentation a self prepared convergent-divergent nozzle is used for inert gas atomization of the melt which is subsequently deposited on copper substrate placed vertically below the atomizer. The zircon sand particles are injected in the atomization zone by external injectors aligned perpendicular to the gas atomization axis. Zircon sand has been found to have new promising economical commercial candidate due to its easy availability and good mechanical properties like high hardness, high modulus of elasticity and good thermal stability. The microhardness of cast alloy and spray formed composite shows that the spray formed zircon sand reinforced composite has higher hardness. Also the lower wear rate has been observed in case of the zircon sand reinforced AMC as compared to LM13 alloy. This behaviour is further analyzed in light of microstructural features of the spray deposited composite using optical and scanning electron microscope (SEM). A comparative study of this material (LM13/Zircon sand) with the parent alloy (LM13) is presented in this work. (Abstract Copyright [2010], Wiley Periodicals, Inc.)
Control options for Listeria monocytogenes in seafoods
DEFF Research Database (Denmark)
Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech
2000-01-01
At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...
Directory of Open Access Journals (Sweden)
N. Soultos
2014-11-01
Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.
Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.
Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji
2016-08-01
We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-01-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507
Directory of Open Access Journals (Sweden)
Chee Hao Kuan
2013-12-01
Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces
Directory of Open Access Journals (Sweden)
Fernanda Barbosa dos Reis-Teixeira
Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.
Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira
The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.
Directory of Open Access Journals (Sweden)
Jozi Fagundes de Mello
2008-03-01
Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.
Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.
2009-01-01
Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated
[Survey of the presence of Listeria monocytogenes in meat products sold in retail].
Langiano, E; Lanni, L; Atrei, P; De Vito, E
2007-01-01
The present study evaluates the presence of Listeria spp and particularly of L. monocytogenes in bovine, pork and poultry meats sold by retail in supermarkets and butchers in the city of Cassino. The sensibility to the antibiotics mostly used in the veterinary practice has been tested on the isolated strains. The different species of Listeria have shown a considerable variation of isolation based on the meat's typology and on the different store's provenance. Moreover our results show greater degree of contamination than the data currently available the Italian literature. In our study poultry meat is the most contaminated one. We can assert that omissions and poor caring errors in the manipulation and conservation of meat expose the customer to an even higher risk of infection.
Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike
2017-09-01
Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Directory of Open Access Journals (Sweden)
Vanessa de Vasconcelos Byrne
2016-06-01
Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.
Franz, E; Tromp, S O; Rijgersberg, H; van der Fels-Klerx, H J
2010-02-01
Fresh vegetables are increasingly recognized as a source of foodborne outbreaks in many parts of the world. The purpose of this study was to conduct a quantitative microbial risk assessment for Escherichia coli O157:H7, Salmonella, and Listeria monocytogenes infection from consumption of leafy green vegetables in salad from salad bars in The Netherlands. Pathogen growth was modeled in Aladin (Agro Logistics Analysis and Design Instrument) using time-temperature profiles in the chilled supply chain and one particular restaurant with a salad bar. A second-order Monte Carlo risk assessment model was constructed (using @Risk) to estimate the public health effects. The temperature in the studied cold chain was well controlled below 5 degrees C. Growth of E. coli O157:H7 and Salmonella was minimal (17 and 15%, respectively). Growth of L. monocytogenes was considerably greater (194%). Based on first-order Monte Carlo simulations, the average number of cases per year in The Netherlands associated the consumption leafy greens in salads from salad bars was 166, 187, and 0.3 for E. coli O157:H7, Salmonella, and L. monocytogenes, respectively. The ranges of the average number of annual cases as estimated by second-order Monte Carlo simulation (with prevalence and number of visitors as uncertain variables) were 42 to 551 for E. coli O157:H7, 81 to 281 for Salmonella, and 0.1 to 0.9 for L. monocytogenes. This study included an integration of modeling pathogen growth in the supply chain of fresh leafy vegetables destined for restaurant salad bars using software designed to model and design logistics and modeling the public health effects using probabilistic risk assessment software.
Both TLR2 and TRIF contribute to interferon-β production during Listeria infection.
Directory of Open Access Journals (Sweden)
Camille Aubry
Full Text Available Synthesis of interferon-β (IFN-β is an innate response to cytoplasmic infection with bacterial pathogens. Our recent studies showed that Listeria monocytogenes limits immune detection and IFN-β synthesis via deacetylation of its peptidoglycan, which renders the bacterium resistant to lysozyme degradation. Here, we examined signaling requirements for the massive IFN-β production resulting from the infection of murine macrophages with a mutant strain of L. monocytogenes, ΔpgdA, which is unable to modify its peptidoglycan. We report the identification of unconventional signaling pathways to the IFN-β gene, requiring TLR2 and bacterial internalization. Induction of IFN-β was independent of the Mal/TIRAP adaptor protein but required TRIF and the transcription factors IRF3 and IRF7. These pathways were stimulated to a lesser degree by wild-type L. monocytogenes. They operated in both resident and inflammatory macrophages derived from the peritoneal cavity, but not in bone marrow-derived macrophages. The novelty of our findings thus lies in the first description of TLR2 and TRIF as two critical components leading to the induction of the IFN-β gene and in uncovering that individual macrophage populations adopt different strategies to link pathogen recognition signals to IFN-β gene expression.
Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.
Soares, Charles A; Knuckley, Bryan
2016-06-01
Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Directory of Open Access Journals (Sweden)
Matthias J. E. Arlt
2013-01-01
Full Text Available Metastasis is the major cause of death of osteosarcoma patients and its diagnosis remains difficult. In preclinical studies, however, forced expression of reporter genes in osteosarcoma cells has remarkably improved the detection of micrometastases and, consequently, the quality of the studies. We recently showed that Dunn cells equipped with a lacZ reporter gene disseminated from subcutaneous primary tumors as frequently as their highly metastatic subline LM8, but only LM8 cells grew to macrometastases. In the present time-course study, tail-vein-injected Dunn and LM8 cells settled within 24 h at the same frequency in the lung, liver, and kidney of mice. Furthermore, Dunn cells also grew to macrometastases, but, compared to LM8, with a delay of two weeks in lung and one week in liver and kidney tissue, consistent with prolonged survival of the mice. Dunn- and LM8-cell-derived ovary and spine metastases occurred less frequently. In vitro, Dunn cells showed less invasiveness and stronger contact inhibition and intercellular adhesion than LM8 cells and several cancer- and dormancy-related genes were differentially expressed. In conclusion, Dunn cells, compared to LM8, have a similar capability but a longer latency to form macrometastases and provide an interesting new experimental system to study tumor cell dormancy.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2010-03-01
Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.
de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage
Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.
2017-09-01
The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.
Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H
2007-01-01
A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...
Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.
2015-01-01
Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753
Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira
2017-12-01
Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni
2012-10-15
The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
The challenge of setting risk-based microbiological criteria for Listeria monocytogenes
DEFF Research Database (Denmark)
Andersen, Jens Kirk; Nørrung, Birgit
2011-01-01
After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...
Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage
Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.
2017-09-01
The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.
Weller, Daniel; Wiedmann, Martin
2015-01-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668
Wind Tunnel Measurements at LM Wind Power
DEFF Research Database (Denmark)
Bertagnolio, Franck
2012-01-01
This section presents the results obtained during the experimental campaign that was conducted in the wind tunnel at LM Wind Power in Lunderskov from August 16th to 26th, 2010. The goal of this study is to validate the so-called TNO trailing edge noise model through measurements of the boundary...... layer turbulence characteristics and the far-field noise generated by the acoustic scattering of the turbulent boundary layer vorticies as they convect past the trailing edge. This campaign was conducted with a NACA0015 airfoil section that was placed in the wind tunnel section. It is equipped with high...
DEFF Research Database (Denmark)
Gaini, Shahin; Karlsen, Gunn Hege; Nandy, Anirban
2015-01-01
A previously healthy 74-year-old Caucasian man with penicillin allergy was admitted with evolving headache, confusion, fever, and neck stiffness. Treatment for bacterial meningitis with dexamethasone and monotherapy ceftriaxone was started. The cerebrospinal fluid showed negative microscopy...... the catheter. The patient had severe neurological sequelae. This case report emphasises the importance of covering empirically for Listeria monocytogenes in all patients with penicillin allergy with suspected bacterial meningitis. The case also shows that it is possible to have significant infection...
Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.
2013-01-01
The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that
Directory of Open Access Journals (Sweden)
Negar Hamidian
2017-07-01
Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of Listeria species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov
Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S
2013-06-01
A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.
Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.
Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani
2013-12-01
Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.
Lu, Chunye; Marjanovic, Olivera; Kiang, David
2017-01-01
ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255
Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi
2015-01-01
Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...
Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce
2012-01-01
The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Laila Katriani
2017-11-01
INTEGRATED WITH AIR THERMOMETER USING LM35 SENSOR AND PT100 SENSOR This research aimed to design a thermal type anemometer integrated with air thermometer using Lm35 sensor and PT100 sensor. The study began in Mei until Oktober 2016. The study was conducted at the Laboratory of Electronics and Instrumentation, Department of Physics Education, State University of Yogyakarta. The design of the thermal type anemometer consists of two stages, namely, the design of the hardware and software design. Hardware design consists of a sensor system design (LM35 and PT100, LM317 design, system design for data processing and display. Software design using C language. Based on the results of tests that had been done, shows that the sensor output LM35, whic is voltage is proportional to temperature changes, which had a sensitivity of 0.009 volts / ºC and initial output voltage of the sensor when the temperature reach 0 °C is 0,041 volts. PT100 sensor output, which is resistance is proportional to temperature changes, which had sensitivity of 0.391 Ω/oC and initial output resistance of the sensor when temperature reach 28 °C is 100,8 Ω. Error percent of thermal-type air speed measuring instrument testing is 4%.
Directory of Open Access Journals (Sweden)
Joelle K. Salazar
2018-01-01
Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Ericson, Megan E.; Frank, Matthew W.
2016-01-01
Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774
Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei
2017-11-01
Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.
Directory of Open Access Journals (Sweden)
Yushi Yao
2017-11-01
Full Text Available Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM, which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.
de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri
2016-01-01
Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Recombination Narratives to Accompany "A-LM French One," First Edition.
Coughlin, Dorothy
Supplementary recombination narratives intended for use with the 1961 edition of the text "A-LM French One" are designed to help students learn to manipulate basic textual materials. The sample narratives correlate with Units 4-14 of the text. The teacher is urged to make use of the overhead projector when using the narratives for the…
DEFF Research Database (Denmark)
Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik
2006-01-01
A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...
Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina
2013-11-01
In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.
Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.
Sauders, B D; D'Amico, D J
2016-10-01
Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.
Directory of Open Access Journals (Sweden)
Karla Sequeira Mendonça
2016-01-01
Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.
Directory of Open Access Journals (Sweden)
Voltaire Sant'Anna
2013-12-01
Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.
HUMAN CAPSULE EPITHELIAL-CELL DEGENERATION A LM, SEM AND TEM INVESTIGATION
JONGEBLOED, WL; KALICHARAN, D; WORST, JGF
1993-01-01
The degeneration of the capsule epithelium of cataractous lenses has been studied with LM, SEM on TEM with emphases on TEM. The observed degeneration of the epithelial cells can be described as follows: The cell nucleus becomes picnotic and desintegrates as result of change of the chromatin.
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
Annual Surveillance Summary: Klebsiella Species Infections in the Military Health System (MHS), 2016
2017-06-01
Shortliffe LM, McCue JD. Urinary tract infection at the age extremes: pediatrics and geriatrics. Am J Med. 2002;113(1a)55S-66S. 7. U.S. Centers for...options are still present for Klebsiella species. However, for mild to moderate community- acquired infections (uncomplicated urinary tract infection ...Corps, which saw a percent decrease of 1.3%. Assessment of clinical and demographic characteristics found that urinary tract infections (UTIs
Weller, Daniel; Wiedmann, Martin; Strawn, Laura K
2015-09-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A
2014-05-01
The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
David eMontero
2015-04-01
Full Text Available Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE such as sausage, cheese, fresh salads and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR identified that strains belonging to serotype 4b, and containing one or more genes encoded by LIPI-1, were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE, it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1 pathogenicity island, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent
Montero, David; Bodero, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M; Vidal, Maricel
2015-01-01
Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance.
Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou
2015-06-01
For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.
Fluctuations in a mixed IS-LM business cycle model
Directory of Open Access Journals (Sweden)
Hamad Talibi Alaoui
2008-09-01
Full Text Available In the present paper, we extend a delayed IS-LM business cycle model by introducing an additional advance (anticipated capital stock in the investment function. The resulting model is represented in terms of mixed differential equations. For the deviating argument $au$ (advance and delay being a bifurcation parameter we investigate the local stability and the local Hopf bifurcation. Also some numerical simulations are given to support the theoretical analysis.
Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg
2017-11-15
The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore
Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.
Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y
2009-09-01
The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.
DEFF Research Database (Denmark)
Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet
2013-01-01
Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites......-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L.?monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating...
Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M
2017-08-16
The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further
Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth
2015-06-01
Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina
2009-02-15
The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.
Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh
2015-07-25
The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.
Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M
2017-05-01
This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike
2015-04-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.
Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike
2016-01-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325
DEFF Research Database (Denmark)
Gimenez, B.; Dalgaard, Paw
2004-01-01
Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...
Listeria monocytogenes repellence by enzymatically modified PES surfaces
Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.
2015-01-01
: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces
LM1-64: a Newly Reported Lmc-Pn with WR Nucleus
Pena, M.; Olguin, L.; Ruiz, M. T.; Torres-Peimbert, S.
1993-05-01
The object LM1-64 was reported by Lindsay & Mullan (1963, Irish Astron. J., 5, 51) as a probable PN in the LMC. Optical and UV spectra taken by us confirm that suggestion. LM1-64 is a high excitation planetary nebulae which shows evidence of having a WC central star. Broad stellar emission at lambda 4650 is detected in the optical spectrum obtained with the CTIO 4m telescope, in 1989. A UV spectrum in the range from 1200 Angstroms to 2000 Angstroms was obtained with IUE in 1990. We have measured all the emission line fluxes available and determined values for the physical conditions and chemical abundances of the nebular ionized gas. The derived values are T(OIII) = 14000K, log He/H = 11.05, log C/H = 9.48, log O/H = 8.55 and log Ne/H = 7.94. LM1-64 shows a large C enhancement in the envelope as result of the central star activity, while He, O and Ne are comparable to the average values reported for the LMC-PNe (Monk, Barlow & Clegg, 1988, MNRAS, 234, 583). We have estimated the He II Zanstra temperature of the central star to be ~ 80,000 K. This temperature is much higher than the values reported for the known LMC-PNe with WR nucleus that Monk et al. have classified as W4 to W8. The only other high temperature WR nucleus in a LMC-PN is N66 which recently showed evidence of undergoing a WR episode (Torres-Peimbert, Ruiz, Peimbert & Pe\\ na, 1993, IAU Symp. 155, eds. A. Acker & R. Weinberger, in press).
9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.
2010-01-01
... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...
Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...
Directory of Open Access Journals (Sweden)
Roberto Degenhardt
2007-06-01
Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil
Directory of Open Access Journals (Sweden)
Rafael C.R. Martinez
2005-03-01
Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr
Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood
DEFF Research Database (Denmark)
Mejlholm, Ole; Dalgaard, Paw
2007-01-01
The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....
Prevalence of Listeria monocytogenes in retailed meat in the Tokyo metropolitan area.
Ochiai, Yoshitsugu; Yamada, Fumiya; Batmunkh, Otgonchimeg; Mochizuki, Mariko; Takano, Takashi; Hondo, Ryo; Ueda, Fukiko
2010-09-01
This study was conducted to determine the prevalence of Listeria monocytogenes in retailed meats, comprising beef, chicken, and pork, in the Tokyo metropolitan area. A total of 379 samples of retailed meat were collected from 1998 to 2003, most of which were obtained by simultaneously purchasing the three classes of meat from a shop and then making another simultaneous purchase of meat from the same shop a few weeks later. The prevalence of L. monocytogenes was 28.0%, and the serotypes isolated were mainly 1/2a, 1/2b, 1/2c, and 4b. Comparison of the prevalence of each serotype among the classes of meat showed a predominant distribution of serotypes 1/2a, 1/2b, and 4b in chicken, while serotype 1/2c was dominant in pork. A total of nine cases considered to be due to persistence and/or cross-contamination were found. Most of the strains involved in persistence and/or cross-contamination were of serotypes 1/2c or 4b. These results suggest that contamination in retailed meat in Japan is at almost the same level as in other countries and that chicken has the highest potential as a source of contamination and infection. In addition, we suggest that the ecological niche of serotype 1/2c is distinct from those of 1/2a, 1/2b, and 4b, which may explain why human hosts have less opportunity to be exposed to serotype 1/2c and why there is a lower rate of isolation of this serotype from cases of human listeriosis.
Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.
Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain
2011-01-01
Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.
Directory of Open Access Journals (Sweden)
Ewa Sawosz
2010-08-01
Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
Directory of Open Access Journals (Sweden)
Gusman Vera
2014-01-01
Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.
Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig
2017-01-16
The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hayat Ennaji
2008-09-01
Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR
International Nuclear Information System (INIS)
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-01-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-07-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Energy Technology Data Exchange (ETDEWEB)
Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)
2009-07-15
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
Prof. Ogunji
Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...
Energy Technology Data Exchange (ETDEWEB)
Cao, Cuiwen; Zhang, Yakun; Gu, Xingsheng [Ministry of Education, East China Univ. of Science and Technology, Shanghai (China). Key Lab. of Advanced Control and Optimization for Chemical Processes
2013-07-01
Optimizing operation parameters for Texaco coal-water slurry gasifier with the consideration of multiple objectives is a complicated nonlinear constrained problem concerning 3 BP neural networks. In this paper, multi-objective 3-layer mixed cultural differential evolution (MO-3LM-CDE) algorithms which comprise of 4 multi-objective strategies and a 3LM-CDE algorithm are firstly presented. Then they are tested in 6 benchmark functions. Finally, the MO-3LM-CDE algorithms are applied to optimize 3 control parameters of the Texaco coal-water slurry gasifier in methanol production of a real-world chemical plant. The simulation results show that multi-objective optimal results are better than the respective single-objective optimal operations.
MOSUGU, J.I.; ADESOKAN, H.K.
2016-01-01
Summary Introduction. Food contamination with Listeria monocytogenes is on the increase posing threats to public health with growing trends in food products recalls due to suspected Listeria contamination. Methods. We conducted a cross-sectional study to determine the prevalence and antibiotic susceptibility profiles of Listeria monocytogenes (Lm) among 71 randomly selected poultry farms in Oyo State, Nigeria. A total of 450 samples comprising cloacal swabs (426) and randomly selected dressed chicken meat (24) were cultured for Lm isolation using BrillianceTM Selective Listeria Agar with antibiotics and microbial load count with Nutrient Agar. Further identification was done using microscopic, biochemical characterization and antibiotic sensitivity tests. Data were analysed using bivariate analysis and student t-test. Results. An overall prevalence of 91.8% Lm contamination was obtained comprising 91.5% (390/426) in cloacal swabs and 95.8% (23/24) in meat. The prevalence of Lm in cloacal samples was significantly associated with poultry type (p = 0.008) and breed (p = 0.000. In addition, all the flocks had at least one positive sample yielding 100% flock prevalence. Antibiotic sensitivity test revealed that most of the isolates were resistant to common antibiotics like Ampicillin-cloxacillin and cefuroxime. Conclusions. The results revealed a high level of contamination with Lm in the poultry flock and meat and the observed resistance to most common antibiotics has implications for future disease control as well as public health. There is need to step up routine screening of food animal products for Listeria contamination as well as measures towards reducing such contaminations. PMID:27980380
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased
Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric
2007-01-01
A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID
Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity
Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc
2016-01-01
Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754
Depletion of proton motive force by nisin in Listeria monocytogenes cells.
Bruno, M E; Kaiser, A; Montville, T J
1992-07-01
The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH values of 5.5 and 7.0. With 1 microgram of nisin per ml, delta pH was completely dissipated but delta psi decreased only slightly. The action of nisin on PMF in L. monocytogenes Scott A was both time and concentration dependent. Valinomycin depleted only delta pH, whereas nigericin and carbonyl cyanide m-chlorophenylhydrazone depleted only delta psi, under conditions in which nisin depleted both. Four other L. monocytogenes strains had basal PMF parameters similar to those of strain Scott A. Nisin (2.5 micrograms/ml) also completely dissipated PMF in these strains.
Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun
2016-01-18
In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.
Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.
Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A
2016-01-01
The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.
DEFF Research Database (Denmark)
Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K
2017-01-01
elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...
Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...
Multi-Scale Parameter Identification of Lithium-Ion Battery Electric Models Using a PSO-LM Algorithm
Directory of Open Access Journals (Sweden)
Wen-Jing Shen
2017-03-01
Full Text Available This paper proposes a multi-scale parameter identification algorithm for the lithium-ion battery (LIB electric model by using a combination of particle swarm optimization (PSO and Levenberg-Marquardt (LM algorithms. Two-dimensional Poisson equations with unknown parameters are used to describe the potential and current density distribution (PDD of the positive and negative electrodes in the LIB electric model. The model parameters are difficult to determine in the simulation due to the nonlinear complexity of the model. In the proposed identification algorithm, PSO is used for the coarse-scale parameter identification and the LM algorithm is applied for the fine-scale parameter identification. The experiment results show that the multi-scale identification not only improves the convergence rate and effectively escapes from the stagnation of PSO, but also overcomes the local minimum entrapment drawback of the LM algorithm. The terminal voltage curves from the PDD model with the identified parameter values are in good agreement with those from the experiments at different discharge/charge rates.
Verginin Ağırlıklandırılmış Fiyat Elastikiyetinin Hesaplanması: Türkiye (1998-2013
Directory of Open Access Journals (Sweden)
Engin YILMAZ
2015-04-01
Full Text Available Bu çalışma içerisinde, enflasyonun vergi gelirleri üzerindeki etkilerini inceleyen ilk çalışmalarda ortaya konulan, “gelişmekte olan ülkelerde verginin ağırlıklandırılmış fiyat elastikiyetinin birim olduğu” varsayımı Türkiye için 1998 -2013 periyodu için yeniden değerlendirilecektir. Ağırlıklandırılmış fiyat elastikiyetinin hesaplanmasında Türk vergi gelirleri ve fiyat endeksleri verileri kullanılmıştır. Dinamik En Küçük Kareler (DOLS yöntemiyle, vergi sisteminin uzun dönem ağırlıklandırılmış fiyat elastikiyeti tahmin edilmiştir. Çalışmanın önemi Türkiye için verginin ağırlıklandırılmış fiyat elastikiyetini hesaplamaya yönelik ilk çalışma olmasıdır. Bu anlamda “gelişmekte olan ülkelerde verginin ağırlıklandırılmış fiyat elastikiyetinin birim olduğu” varsayımının yeniden gözden geçirilmesi için yol gösterici bir çalışma olacaktır.
Piercey, Marta J; Ells, Timothy C; Macintosh, Andrew J; Truelstrup Hansen, Lisbeth
2017-09-18
Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure. The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence of the SSI-1 (Stress Survival Islet) and LGI1/CC8 (Listeria Genomic Island 1 in a clonal complex 8 background) genetic markers. Genetic sequences from four strains representing different phenotypes were also probed for predicted amino acid differences in biofilm, desiccation, and membrane related genes. The water isolates were among the most desiccation susceptible strains, while strains exhibiting desiccation resistance harboured SSI-1 or both the SSI-1 and LGI1/CC8 markers. BAC resistance was greatest in planktonic LGI1/CC8 cells (relative to non-LGI1/CC8 cells), and higher BAC concentrations were also needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48h and 6days compared to other strains. Formation of biofilm on stainless steel was not significantly (p>0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5-1, CP5 2-3, both from water), intermediate (Lm568, food) and desiccation and BAC resistant (08 5578, blood, human outbreak) strains led to the finding of amino acid differences in predicted functional protein domains in several biofilm, desiccation and peptidoglycan related genes (e.g., lmo0263, lmo0433, lmo0434, lmo0771, lmo0973, lmo1080, lmo1224, lmo1370, lmo1744, and lmo2558). Notably, the LGI1/CC8 strain 08-5578 had a frameshift mutation in lmo1370, a gene previously
Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig
2018-06-20
Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L
Directory of Open Access Journals (Sweden)
Callum J. Highmore
2018-04-01
Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.
Pathogenic potential of Listeria monocytogenes isolated from cattle ...
African Journals Online (AJOL)
Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...
Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...
African Journals Online (AJOL)
One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...
Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.
Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie
2017-07-01
Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG
Directory of Open Access Journals (Sweden)
ALESSANDRA PARO RODRIGUES CESAR
2011-06-01
Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product
Directory of Open Access Journals (Sweden)
Elisabeth Brama
2016-12-01
Full Text Available In-resin fluorescence (IRF protocols preserve fluorescent proteins in resin-embedded cells and tissues for correlative light and electron microscopy, aiding interpretation of macromolecular function within the complex cellular landscape. Dual-contrast IRF samples can be imaged in separate fluorescence and electron microscopes, or in dual-modality integrated microscopes for high resolution correlation of fluorophore to organelle. IRF samples also offer a unique opportunity to automate correlative imaging workflows. Here we present two new locator tools for finding and following fluorescent cells in IRF blocks, enabling future automation of correlative imaging. The ultraLM is a fluorescence microscope that integrates with an ultramicrotome, which enables ‘smart collection’ of ultrathin sections containing fluorescent cells or tissues for subsequent transmission electron microscopy or array tomography. The miniLM is a fluorescence microscope that integrates with serial block face scanning electron microscopes, which enables ‘smart tracking’ of fluorescent structures during automated serial electron image acquisition from large cell and tissue volumes.
Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.
Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo
2014-12-01
This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.
A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.
Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale
2016-01-01
Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.